European Journal of Pharmacology 861 (2019) 172594

Contents lists available at ScienceDirect

European Journal of Pharmacology

journal homepage: www.elsevier.com/locate/ejphar

Full length article

Liraglutide improves insulin sensitivity in high fat diet induced diabetic T

mice through multiple pathways
Joseph Yi Zhoua, Anil Poudelb, Ryan Welchkob, Naveen Mekalaa,
⁎⁎ ⁎
Prashanth Chandramani-Shivalingappab, Mariana Georgeta Roscaa, , Lixin Lib,
a
College of Medicine, Central Michigan University, MI, 48859, USA
b
Department of Physician Assistant, College of Health Professions, Central Michigan University MI, 48859, USA

A R T I C LE I N FO A B S T R A C T

Keywords: Glucagon like peptide-1 (GLP-1) promotes postprandial insulin secretion. Liraglutide, a full agonist of the GLP-1
Adipocyte receptor, reduces body weight, improve insulin sensitivity, and alleviate Non Alcoholic Fatty Liver Disease
Metabolism (NAFLD). However, the underlying mechanisms remain unclear. This study aims to explore the underlying
Obesity mechanisms and cell signaling pathways involved in the anti-obesity and anti-inflammatory effects of liraglutide.
Insulin resistance
Mice were fed a high fat high sucrose diet to induce diabetes, diabetic mice were divided into two groups and
Liraglutide
injected with liraglutide or vehicle for 14 days. Liraglutide treatment improved insulin sensitivity, accompanied
with reduced expression of the phosphorylated Acetyl-CoA carboxylase-2 (ACC2) and upregulation of long chain
acyl CoA dehydrogenase (LCAD) in insulin sensitive tissues. Furthermore, liraglutide induced adenosine
monophosphate-activated protein kinase-α (AMPK-α) and Sirtuin-1(Sirt-1) protein expression in liver and
perigonadal fat. Liraglutide induced elevation of fatty acid oxidation in these tissues may be mediated through
the AMPK-Sirt-1 cell signaling pathway. In addition, liraglutide induced brown adipocyte differentiation in
skeletal muscle, including induction of uncoupling protein-1 (UCP-1) and PR-domain-containing-16 (PRDM-16)
protein in association with induction of SIRT-1. Importantly, liraglutide displayed anti-inflammation effect.
Specifically, liraglutide led to a significant reduction in circulating interleukin-1 β (IL-1 β) and interleukin-6 (IL-
6) as well as hepatic IL-1 β and IL-6 content. The expression of inducible nitric oxide synthase (iNOS-1) and
cyclooxygenase-2 (COX-2) in insulin sensitive tissues was also reduced following liraglutide treatment. In
conclusion, liraglutide improves insulin sensitivity through multiple pathways resulting in reduction of in-
flammation, elevation of fatty acid oxidation, and induction of adaptive thermogenesis.

1. Introduction
Obesity promotes insulin resistance through alteration of metabolic
and endocrine functions in adipose tissue. For instance, obesity is cor-
related with elevated levels of pro-inflammatory cytokines such as
Interleukin-1β (IL-1β), tissue necrosis factor-α (TNF-α), and
Interleukin-6 (IL-6) which stimulate lipolysis and lead to hyperlipi-
demia (Makki et al., 2013). Furthermore, inflammation and the ensuing
metabolic dysfunction is associated with reduced whole body energy
expenditure in both human and animal studies (Holmes, 2017).
Brown adipose tissue (BAT) generates heat instead of ATP produc-
tion via uncoupling respiration through the uncoupling protein 1 (UCP-
1) (Fuchs et al., 1988). UCP-1 deficient mice gained more body weight
than wild-type controls (Feldmann et al., 2009). Importantly, brown
adipocytes and skeletal muscle originate from the same precursor cells,
and the transcription factor PR-domain-containing 16 (PRDM16) con-
trols the bi-directional cell fate switch between brown fat and skeletal
muscle (Harms and Seale, 2013; Harms et al., 2014). BAT activation has
therefore emerged as an attractive therapeutic target for the treatment
of obesity.
Glucagon like peptide-1 (GLP-1) is released primarily by the L-type
cells of the ileal mucosa in response to nutrient ingestion, and increases
postprandial insulin secretion (Drucker, 2002). Beneficial effects of
GLP-1 in patients with vascular disease, coronary heart disease, and
metabolic syndrome have been reported (Tomas et al., 2011). GLP-1R
agonists induced moderate weight loss and reduced appetite in type 2
diabetic (T2D) patients (Namba et al., 2013; Tang et al., 2013; Zander
et al., 2002). GLP-1 overexpression also promoted insulin induced

⁎
Corresponding author. College of Health Professions, Central Michigan University, Mount Pleasant, MI, 48858, USA.
⁎⁎
Corresponding author. College of Medicine, Central Michigan University, Mount Pleasant, MI, USA.
E-mail addresses: rosca1g@cmich.edu (M.G. Rosca), li6l@cmich.edu (L. Li).

https://doi.org/10.1016/j.ejphar.2019.172594
Received 13 June 2019; Received in revised form 1 August 2019; Accepted 7 August 2019
Available online 11 August 2019
0014-2999/ © 2019 Published by Elsevier B.V.
J.Y. Zhou, et al.
hepatic activation of insulin receptor substrate (IRS-1), reduction of
hepatic glucose production, and fatty acid synthesis in animal studies
(Lee et al., 2007). GLP-1 analogues have also been reported to be ef-
fective in treating patients with nonalcoholic fatty liver disease
(NAFLD) and/or non-alcoholic steatohepatitis (NASH) through redu-
cing hepatic fat content (Armstrong et al., 2016a, 2016b; Mells et al.,
2012). The use of GLP-1R agonists therefore show promise as a therapy
for treating T2D and obesity-related metabolic disorders.
However, GLP-1 has a short half-life (1–2 min) and is degraded by
dipeptidyl peptidase-IV (DPP-IV) once released into the plasma
(Drucker, 2002). Liraglutide, a full GLP-1 receptor agonist with 97%
amino acid sequence similarity with human GLP-1, has long-lasting
effects and can be injected once daily due to its improved resistance to
DPP-IV (Knudsen, 2010). Liraglutide has been shown to promote he-
patic and adipose insulin sensitivity, reduce hepatic steatosis. (Richard
and Lingvay, 2011). Liraglutide also enhanced the ability of insulin to
suppress lipolysis in subcutaneous adipose tissue and decreased de novo
lipogenesis in human primary hepatocytes (Armstrong et al., 2016b).
Therefore, liraglutide may be a potential medication for metabolic
syndrome and disease-modifying intervention in NAFLD (Armstrong
et al., 2016b). However, the underlying mechanisms for these benefits
are not clearly understood and the role of liraglutide in enhancing
thermogenesis has not yet been proven (Heppner et al., 2015). Whether
liraglutide reduces obesity related release of cytokines is also not well
established. This study was therefore designed to explore the under-
lying mechanisms of the anti-obesity effect and potential anti-in-
flammatory effects of liraglutide.
2. Materials and methods
2.1. Reagents
Liraglutide was purchased from BACHEM (Torrance, CA). Anti-PR
domain containing 16 (Prdm16), anti-Inducible Nitric Oxide Synthase
(iNOS), anti-cyclooxygenase-2(COX-2), anti-uncoupling protein-1
(UCP1), anti- Peroxisome proliferator-activated receptor gamma coac-
tivator 1-α (PGC1α), anti-Peroxisome proliferator-activated receptor γ
(PPARγ), anti-Peroxisome proliferator-activated receptor α(PPARα),
and anti-Long Chain Acyl CoA Dehydrogenase (LCAD) antibodies were
purchased from Abcam (Cambridge, MA). Anti-p-acetyl-CoA carbox-
ylase, anti-(p-ACC2), anti-p-5′ AMP-activated protein kinaseα (p-
AMPKα), anti-AMPKα, anti-Sirt-1, anti-mouse IgG, and anti-rabbit Ig
were from Cell Signaling Technology (Danvers, MA). Anti-β actin was
from Sigma Aldrich (St. Louis. MO). Anti-β tubulin and anti-CCAAT-
enhancer-binding proteins-α (C/EBPα) were from Santa Cruz. Mouse
IL1-β and IL-6 Elisa kits were purchased from R & D system, DuoSet
ELISA development system.
2.2. Animals
Male C57BL/6 mice were purchased from Charles River laboratories
Table 1
Primer sequences.
Primers Forward primer
GAPDH ACCCAGAAGACTGTGGATGG
Cidea GCCAGAACTATTCGCTGC TC
PPARϒ ACCACTCGCATT CCT TTG AC
UCP-1 ACTGCCACACCTCCAGTCATT
PGC-1 α GCAGAGACAAATGTGCTTCG
PPAR α CCAATCAGAGATGCCACC TT
LCAD CACCACACAGAATGGGAGAAAG
IL-1β GCCACCTTTTGACAGTGATG
IL-6 AGACAAAGCCAGAGTCCTTCAG
Cox-2 CAGCCAGGCAGCAAATCCTTG
Cebp-α AAGCCAAGAAGTCGGTGGAC
2
European Journal of Pharmacology 861 (2019) 172594
(Colbert, GA) and housed in conventional cages at 22 °C on a 12-h light/
dark cycle. Starting at 9–10 weeks of age mice were fed with either
regular chow diet or high fat high sucrose diet (HFHS; 60% calories
from fat, and 35.7% from carbohydrate; Harlan Teklad, Indianapolis,
IN). Mice fed with HFHS diet developed diabetes after 16 weeks of
feeding. The diet induced obesity (DIO) mice were further divided into
two groups and received daily intraperitoneal injections with either
liraglutide (0.2 mg/kg daily) or saline for 2 weeks. Chow diet mice
received 2 weeks of saline injections. At the end of the two week in-
jection period mice were fasted for 12 h before they were killed.
Harvested tissues were flash frozen in liquid nitrogen and either stored
at −80 °C or fixed in 4% paraformaldehyde (PFA) solution in PBS for
48h before being embedded in paraffin. All experimental procedures
were approved by the Animal Care Committee at Central Michigan
University.
2.3. Western blot analysis
Liver, skeletal muscle, and perigonadal fat were homogenized in
radioimmune precipitation assay (RIPA) lysis buffer containing a pro-
tease inhibitor mixture, EDTA, phenylmethylsulfonyl fluoride, sodium
fluoride, and sodium orthovanadate (Santa Cruz, Dallas, TX). Protein
concentrations were determined using a Bio-Rad protein assay kit.
Western blot analyses were performed using standardized laboratory
protocol. Signals were detected using Luminata Forte Western HRP
substrate (EMD Millipore, MA, USA). Images were taken using LI-COR
Odyssey Fc imaging system (LI-COR Biosciences, NE, USA).
2.4. Quantitation of hepatic, adipose tissues, and skeletal muscle mRNA
RNA was extracted from liver, adipose, and skeletal muscle tissues
using TRIzol (Invitrogen) as described previously (Li et al., 2011a).
RNA was reverse transcribed using the Applied Biosystems High Ca-
pacity RNA-to-cDNA kit (Thermo Fisher Scientific) following the man-
ufacturer's protocol. SYBR Green PCR master mix (Applied Biosystems,
Foster City, CA) was used for quantitative PCR performed using the ABI
PRISM machine 7900HT sequence detection system (SDS software
version 2.3). GAPDH was used as an internal control. The primers were
synthesized by integrated DNA technologies. Primer pairs used to am-
plify these genes are shown in Table 1. The relative mRNA expression
was determined using the comparative Ct method by calculating
2−ΔΔCt.
2.5. Intraperitoneal glucose tolerance test
Mice were fasted overnight then fasting plasma glucose was mea-
sured from tail vein blood using Compact Accu-Check glucometer
(Roche, Diagnostics, Indianapolis, IN). The mice received in-
traperitoneal injections with 10% glucose at 1 g/kg body weight, and
plasma glucose was measured at 15, 30, 60, and 120 min after injection.
Reverse primer
GGATGCAGGGATGATGTTCT
GCCGCGTCTCTTAAATCACT
AACCATTGGGTCAGCTCT TG
CTTTGCCTCACTCAGGATTGG
TCTGGGGTCAGAGGAAGAGA
TCTCCAAGGAGTCTGGCACT
AATGCCGCCATGTTTCTCTG
ATGTGCTGCTGCGAGATTTG
GAGAGCATTGGAAATTGGGGTAGG
CATAGAATCCAGTCCGGGTACAG
TCACTGGTCAACTCCAGCAC
J.Y. Zhou, et al.
2.6. IL-1β and IL-6 measurement
Plasma and tissue IL-1β and IL-6 levels were measured using the
mouse IL-1β and IL6 Duoset Elisa kit following the manufacturer's
protocol. Briefly, 96 well plates were coated with the capture antibody,
incubated with samples and standards for 2 h at RT, then followed by
exposure to the detection antibody. Plates were then treated with
streptavidin-HRP-conjugate and calorimetric changes were measured
by optical density.
2.7. Hematoxylin and eosin (H&E) staining
Mouse tissues were fixed in 4% PFA before being embedded in
paraffin. Sections were stained with Hematoxylin and eosin (H&E)
staining using a standard protocol. An Axiocam 506 color camera
captured images with a Carl Zeiss Axio Imager M2 microscope at the
magnification indicated in the figure legends.
2.8. Statistical analysis
Data was analyzed by non-parametric, two-sided Student's t-test
when comparing two groups. Data was analyzed by one-way ANOVA
followed by Bonfferoroni post-hoc tests when 3 groups were compared.
All data analyses were performed using GraphPad Prism V7.0 software
(GraphPad Software Inc., La Jolla, CA). A P value < 0.05 was con-
sidered to be statistically significant.
3. Results
3.1. Liraglutide induced weight loss, reduced food intake, and improved
glucose tolerance in HFHS diet-fed mice
Mice developed diabetes after 4 months of HFHS diet feeding as well
as impaired glucose tolerance, significant elevation of body weight, and
increased liver and perigondadal fat mass when compared to mice fed a
regular chow diet (Fig. 1A–F). Two weeks of liraglutide treatment sig-
nificantly reduced fasting blood glucose (210.5 ± 19.53 mg/dl vs
87.0 ± 6.66 mg/dl, P < 0.05, Fig. 1A) and improved intraperitoneal
glucose tolerance test (IPGTT) when compared with the HFHS diet
group (Fig. 1B–C). A 10% body weight loss (49.5 ± 1.14 g vs
44.17 ± 1.19 g; P < 0.01, n = 5) was observed in the liraglutide
treated mice at the end of the study (Fig. 1D) which was associated with
a significant reduction of food intake in the first 4 days of injections
(Fig. 1H).
A significant reduction in liver and perigonadal fat mass was also
observed after two weeks of treatment with liraglutide (Fig. 1E–F).
Liver mass was reduced by 19% (P < 0.01, n = 11; Fig. 1E) and was
accompanied by reduced hepatocyte ballooning (Fig. 1G) suggesting a
decrease in liver fat accumulation. While perigonadal fat mass was
reduced by 32% (P < 0.01, n = 11; Fig. 1F), brown fat mass was not
affected after liraglutide treatment (data not shown). Taken together,
our data indicates that liraglutide inhibits food intake in the first four
days of treatment, reduces fasting plasma glucose, and improves glu-
cose tolerance in association with a reduction in liver weight and
perigonadal fat mass.
3.2. Liraglutide displayed an anti-inflammatory effect in insulin sensitive
tissues of HFHS diet-fed mice
To better understand the protective effect of liraglutide against
obesity induced inflammation, IL-6, IL-1β, and other inflammation
marker were examined in our study. HFHS diet resulted in increased
gene expression of IL-1 β and IL-6 in both liver and adipose tissue
(Fig. 2H–I). Liraglutide treatment significantly reduced plasma IL-1β
(Fig. 2A) and IL-6 (Fig. 2D) levels by 27% (456.2 ± 7.689 pg/ml vs.
332.6 ± 13.81 pg/ml, P < 0.005, n = 5) and 61%
3
European Journal of Pharmacology 861 (2019) 172594
(170.24 ± 3.45 pg/ml vs. 65.0 ± 2.34 pg/ml, P < 0.005, n = 5),
respectively. Hepatic IL-1β (Fig. 2B) and IL-6 (Fig. 2E) levels were also
significantly reduced by 26% (135.8 ± 44.02, 60.07 ± 1.401,
P < 0.001, n = 5) and by 78% (201.45 ± 4.56 pg/ml vs
43.04 ± 2.56 pg/ml, P < 0.005, n = 5) respectively by the liraglutide
treatment. These results are in agreement with the IL-1β and IL-6 gene
expression in the liver, which were increased by the HFHS diet and
reduced by the liraglutide treatment (Fig. 2H–I). Both protein and gene
expression of IL-1β were reduced in perigonadal fat tissue by liraglutide
(Fig. 2C and H). However, IL-6 expression was not changed in perigo-
nadal fat after liraglutide treatment (Fig. 2I–F). In contrast to the
findings in the liver, neither IL-1β nor IL-6 levels in skeletal muscle
(data not shown) were altered following liraglutide treatment.
We investigated the iNOS-COX-2 pro-inflammatory signaling path-
ways as well in insulin sensitive tissues. Inducible nitric-oxide synthase
(iNOS) specifically binds to S-nitrosylates cyclooxygenase-2 (COX-2)
leading to enhanced catalytic activity of COX-2 (Kim et al., 2005),
supporting the roles of these two major mediators of inflammation in
promoting obesity-associated pathologies. In addition to elevated cy-
tokine levels, HFHS diet induced obesity was correlated with elevated
gene and protein expression of iNOS and COX-2 in our study
(Fig. 3A–G). Liraglutide treatment significantly reduced HFHS diet in-
duced iNOS protein expression by 37% in liver tissue (P < 0.005,
n = 8), 65% in perigonadal fat (P < 0.05, n = 5), and 73%
(P < 0.005, n = 5) in skeletal muscle when compared to diet induced
obesity (DIO) animals injected with saline (Fig. 3A–C). Similarly, the
expression of COX-2 was reduced by 28% (P < 0.005, n = 8) in liver
tissue, 80% in perigonadal fat (P < 0.005, n = 8), and 41%
(P < 0.05, n = 8) in skeletal muscle after two weeks of treatment with
liraglutide compared to saline treated DIO mice. (Fig. 3D–F). Cox-2
mRNA expression was increased by the HFHS diet, and significantly
reduced after liraglutide treatment in all three insulin sensitive tissues
(Fig. 3G).
3.3. Liraglutide activated the AMPK-SIRT1 energy expenditure signaling
pathway in the liver and adipocytes in HFHS diet mice
5′ AMP-activated protein kinase α (AMPKα) and sirtuin-1 (SIRT-1)
play key roles in regulating cellular energy status (Cantó and Auwerx,
2009; Feige and Auwerx, 2007). HFHS diet led to a significant reduc-
tion of both AMPKα phosphorylation (Fig. 4A–B) and SIRT-1 protein
expression (Fig. 4D–E) in the liver and perigonadal fat when compared
with mice fed a chow diet. We observed a significant elevation in P-
AMPKα in both liver tissue (67%, P < 0.005, n = 8) and perigonadal
fat (by 40%, P < 0.005, n = 5), but not in skeletal muscle, after lir-
aglutide treatment (Fig. 4C). In agreement with our AMPKα findings,
liraglutide induced a significant upregulation of SIRT-1 protein ex-
pression in the liver (by 22%, P < 0.005, n = 8) and perigonadal fat
(108%, P < 0.005, n = 8) when compared with the HFHS fed mice
(Fig. 4D–E). SIRT-1 protein level was increased by 208% (P < 0.005,
n = 5) in skeletal muscle with liraglutide treatment (Fig. 4F). Together,
our results suggest that liraglutide improves the bioenergetics status
through activation of the AMPKα-SIRT-1 energy-sensing network in the
liver and perigonadal fat. However, the protective effect of liraglutide
on skeletal muscle bioenergetics may act through different pathways.
3.4. Liraglutide improved fatty acid oxidation in the liver, perigonadal fat,
and skeletal muscle of HFHS diet-fed mice
Long-chain acylCoA dehydrogenase (LCAD) is a mitochondrial en-
zyme that participates in fatty acid β-oxidation. We examined the
regulation of ACC2 and LCAD by liraglutide in order to further de-
lineate the effects of liraglutide on fatty acid oxidation in DIO mice. As
shown in Fig. 5A–C, a significant increase of LCAD expression was
observed in the liver (14%, P < 0.005, n = 5), perigonadal fat (by
47%, P < 0.005, n = 5) and skeletal muscle (by 49%, P < 0.005,
J.Y. Zhou, et al. European Journal of Pharmacology 861 (2019) 172594

Fig. 1. Liraglutide reduces food intake, body weight and improves glucose homeostasis in HFHS diet mice Food intake was measured during the 2 weeks period of
injection. Fasting blood glucose were measured, and IGTT was performed at the end of the study. Liver and tissue weight were measured before snap frozen in liquid
nitrogen. A. Fasting blood glucose; B. Intra-peritoneal glucose tolerance test (IGTT); C. Area under curve (IGTT); D. Body weight; E. Liver weight; F. Perigonada fat
mass F. Liver tissue stained with H&E. H. Food intake. Data is shown as mean ± S.E.M., n = 5–12 experiments. *P < 0.05, **, P < 0.005.

n = 5) during HFHS diet and was further increased with liraglutide
treatment. These results indicate that in the presence of an excess of
energetic substrates, these insulin sensitive tissues experience an in-
crease in the enzymatic ability to oxidize long-chain fatty acids, and
that liraglutide facilitates this ability.
Additionally, ACC2 phosphorylation decreased significantly in liver
tissue (45% reduction, P < 0.05, n = 5), perigonadal fat (74% reduc-
tion, P < 0.05, n = 5), and skeletal muscle (37% reduction n = 5,
P < 0.005) following liraglutide treatment when compared to mice fed
a HFHS diet (Fig. 5D–F), Hence, liraglutide increased LCAD expression
and decreased ACC phosphorylation in all three peripheral tissues ex-
amined. Taken together, our results clearly indicate that liraglutide

4
J.Y. Zhou, et al. European Journal of Pharmacology 861 (2019) 172594

Fig. 2. Liraglutide reduces systemic and hepatic IL-1 β and IL-6 level in HFHS diet mice. Blood samples were collected from tail vein at the end of the study. Plasma,
liver, fat IL1- β and IL-6 content were measured using mouse douset Elisa kit, and gene expression was measured using real-time PCR. A. Plasma IL-1 β, B. Liver IL-1 β
content, C. Perigonadal fat IL-1 β content. D. Plasma IL-6 content, E. Hepatic IL-6 content, F. Perigonadal fat IL-6 content, H. IL-1 β mRNA expression in liver and
perigonadal fat tissue. I. IL-6 mRNA expression in liver and fat tissue. Data is shown as mean ± S.E.M., n = 5–6. *P < 0.05, **P < 0.005.

improved fatty acid oxidation in all insulin sensitive tissues studied. 3.7. Liraglutide promoted brown fat differentiation in skeletal muscles of
HFHS diet fed mice

3.5. Liraglutide reduced adipogenesis in perigonadal fat and skeletal muscle
tissue in mice fed a HFHS diet
High fat high sucrose diet or obesity suppressed the activity of
AMPK while activating the expression of lipogenetic transcription fac-
tors such as PPARγ and C/EBPα, two major regulators of adipocyte
differentiation during adipogenesis, in our study. Both gene and protein
expression of PPARγ were reduced in all three insulin sensitive per-
ipheral tissues after liraglutide treatment (Fig. 6E–J). As shown in
Fig. 6E–G, there was a 13% decrease in PPARγ protein expression in
liver tissue (P < 0.005, n = 5), a 27% reduction in perigonadal fat
(P < 0.05, n = 5), and a 96% decrease in skeletal muscle (P < 0.005,
n = 5). Liraglutide also significantly decreased C/EBPα protein ex-
pression in liver tissue (41%, P < 0.005, n = 5), perigonadal fat (by
43%, P < 0.005, n = 5) and skeletal muscle (by 44%, P < 0.005,
n = 5) of DIO mice (Fig. 6A–C). Similar findings were observed in C/
EBPα mRNA levels (Fig. 6D). In summary, liraglutide inhibited adipo-
genesis in insulin sensitive tissues in DIO mice.
3.6. Liraglutide induced PPARα in the liver and perigonadal fat of HFHS
diet-fed mice
HFHS diet induced a reduction of PPARα gene expression in the
liver and perigonadal fat (Fig. 7C–D). Liraglutide induced 46% increase
in the level of PPARα in liver and 112% increase (P < 0.05, n = 5) in
perigonadal fat in comparison to saline treated DIO mice (Fig. 7A–B).
To further determine the effect of liraglutide on energy expenditure,
we investigated brown fat differentiation in skeletal muscle and peri-
gonadal fat. We observed that liraglutide induced a 229% increase
(P < 0.005) in UCP-1 expression and a 175% increase (P < 0.005) in
PRDM-16 in the skeletal muscle of DIO mice when compared to control
mice (Fig. 8A–B). Liraglutide therefore failed to induce beige fat in
HFHS diet mice. Furthermore, the expression of PPARα, another brown
fat marker and inducer of mitochondrial biosynthesis, was significantly
enhanced in skeletal muscle of DIO mice treated with liraglutide (109%
increase, P < 0.05, n = 5, Fig. 8C). In concordance with the protein
expression, gene expression markers of BAT were also elevated
(Fig. 8D). In contrast, liraglutide failed to induce expression of UCP-1 or
PRDM-16 in perigonadal fat in DIO mice (data now shown). Overall,
our data suggests that liraglutide induced brown fat differentiation in
skeletal muscle.
4. Discussion
In humans, and experimental animal models, HFHS diet often in-
itiates a series of molecular events that lead to obesity, insulin re-
sistance, or metabolic syndrome. Obesity is associated with an in-
flammatory state that contributes to the development of insulin
resistance in peripheral tissues. In the present study, we demonstrated
that liraglutide improves insulin sensitivity, increases fatty acid oxi-
dation, and reduces systemic and tissue inflammation induced by
obesity in the DIO mouse model. Crucially, we found that liraglutide
induces brown adipocyte differentiation in skeletal muscle in diet

5
J.Y. Zhou, et al. European Journal of Pharmacology 861 (2019) 172594

Fig. 3. Liraglutide reduces iNOS and COX-2 expression in liver, perigonadal fat and skeletal muscle tissue in HFHS diet mice Mice tissues were collected, protein and
RNA were extracted. Protein expression of iNOS and COX-2 were assessed by Western blot, mRNA expression was assessed by real-time PCR. Representaive image of
western blotting and protien expression level of A. iNOS expression in liver tissue; B. Perigonadal fat iNOS expression in perigonadal fat; C. iNOS from skeletal
muscle; D. COX-2 expression in liver; E. COX-2 expression in perigonadoal fat. F. COX-2 expression in skeletal muscle. G. Cox-2 mRNA expression in liver, peri-
gonadal fat and skeletal muscle are shown. Data is shown as mean ± S.E.M., n = 5–12. β-actin and β-tubulin were used as loading control *, P < 0.05, **,
P < 0.005.

Fig. 4. Liraglutide activates AMPKα-SIRT-1 cell signaling in liver and perigonadal fat in HFHS diet mice. Mice tissues were collected, and protein were extraced.
Expression of AMPKα and SIRT-1 were measured by western blotting. A. AMPKα expression in liver tissue; B. AMPKα expression in paragonadal fat; C. AMPKα
expression in skeletal tissue, D. SIRT-1 expression in liver, E. SIRT-1 expresion in perigonadal fat, F. SIRT-1 expression in skeletal muscle. Data is shown as
mean ± S.E.M., n = 5–12. β-actin and β-tubulin were used as loading control *, P < 0.05, **, P < 0.005.

6
J.Y. Zhou, et al. European Journal of Pharmacology 861 (2019) 172594

Fig. 5. Liraglutide increases fatty acid oxdation in liver, perigondal and skeletal muscle in HFHS diet mice Mice tissues were collected, and protein and RNA were
extraced. Expression of LCAD and ACC were measured by western blotting and real-time PCR. A. LCAD expression in liver tissue; B. LCAD expression in perigonadal
fat; C. LCAD expression in skeletal tissue; D. ACC expression in liver, E. ACC expression in perigonadal fat, F. ACC expresison in skeletal muscle. G. LCAD mRNA
expression in liver, perigonadal fat and skeletal muscle tissue. Data is shown as mean ± S.E.M., n = 5–12. β-actin and β-tubulin were used as loading control *,
P < 0.05, **, P < 0.005.

induced obese diabetic mice.
IL-6 and IL-1β are systemic inflammatory cytokines involved in
obesity-linked pathological states including hepatic steatosis and in-
sulin resistance (Bastard et al., 2002; Kern et al., 2001; Parthsarathy
and Hölscher, 2013; Vozarova et al., 2001). In adipose tissue, in-
filtrating macrophages are a major source of pro-inflammatory cyto-
kines and chemokines, and contribute to up to 35% of circulating IL-6
levels (Kim et al., 2009). Activated macrophages further propagate in-
flammation and induce insulin resistance in liver, white adipose tissue,
and skeletal muscle. These insulin sensitive tissues are important sites
of inflammation in obesity (Olefsky and Glass, 2010; Senn et al., 2002;
Sheedfar et al., 2013). Liraglutide has been shown to reduce pro-in-
flammatory cytokines including IL-6 and IL-1β in the brain
(Parthsarathy and Hölscher, 2013) and endothelial cells (Krasner et al.,
2014). However, its anti-inflammatory effect in systemic and insulin-
sensitive tissues has not been well studied. Our results revealed for the
first time that liraglutide significantly reduces the increased circulating
IL-6 and IL-1β levels induced by a HFHS diet. Furthermore, we also
demonstrated that liraglutide reduces IL-6 and IL-1β content in the liver
and fat tissues in HFHS diet induced diabetic mice. To our knowledge,
this is the first report on the anti-inflammatory effects of liraglutide on
both systemic and hepatic IL-1 β and IL-6 content. COX-2 enzyme ac-
tivates inflammation in part through induction of pro-inflammatory
transcription factors, such as NF-kB, and cytokines such as IL-6 and
TNF-α (Leclercq et al., 2004; Yu et al., 2006). Our results showed that
liraglutide significantly reduces iNOS and COX-2 in liver, skeletal
muscle, and adipose tissue. In summary, our observations clearly in-
dicate that liraglutide improves insulin sensitivity through reduction of
both systemic and liver pro-inflammation cytokines and inhibition of
iNOS and Cox-2 expression in insulin sensitive tissues.
Although liraglutide is known to decrease de novo lipogenesis in the
human liver and improve insulin sensitivity, the mechanisms are not
well understood (Armstrong et al., 2016b). Impaired fatty acid oxida-
tion and the ensuing decrease in energy expenditure contribute to the
development of insulin resistance and type 2 diabetes (Montgomery and
Turner, 2015). HFHS diet has been shown to alter β-oxidation in var-
ious tissues and contribute to liver steatosis (Kakimoto and
Kowaltowski, 2016). ACC and LCAD are key enzymes in regulating fatty
acid synthesis and oxidation, respectively (Abu-Elheiga, L et al., 2003).
Two ACC isoforms, ACC1 and ACC2, are expressed in mammals. The
ACC2 isoform regulates mitochondrial malonyl-CoA that controls fatty
acids oxidation. A significant elevation of fatty acid oxidation rates
have been observed in Acc2−/− mutant mice when compared to wild
type mice (Wakil and Abu-Elheiga, 2009). Additionally, LCAD defi-
ciency has been linked to mitochondrial dysfunction, fatty liver, and
hepatic insulin resistance in mice (Zhang et al., 2007). Importantly,
ACC is the downstream effector of AMPK signaling, which is impaired
by high-fat diet as shown in our study. Our study indicates an important
role of liraglutide in the upregulation of mitochondrial fatty acid oxi-
dation. We observed that liraglutide modulated LCAD and ACC2, two
key enzymes in fatty acid metabolism. Specifically, a reduction of ACC2
phosphorylation in association with an upregulation of LCAD after lir-
aglutide treatment was observed in liver, adipose tissue and skeletal
muscle. Hence, an increase of mitochondrial fatty oxidation in insulin
sensitive tissues during the diabetic state after liraglutide treatment
may account for the reduced body weight and improved insulin sensi-
tivity observed.
We further investigated cellular signaling pathways that participate
in liraglutide induced fatty acid β-oxidation. AMPK is an enzyme which
plays an important role in regulating metabolic and energy homeostasis
(Dyck et al., 1996). AMPK phosphorylates ACC2 at Ser 79 and inhibits
its enzymatic activity (Fullerton et al., 2013; Marcinko and Steinberg,

7
J.Y. Zhou, et al. European Journal of Pharmacology 861 (2019) 172594

Fig. 6. Liraglutide elevates C/EBP α and reduces PPAR-γ expresion in liver, perigonadal fat and skeletal muscle in HFHS diet mice Mice tissues were collected, and
protein and RNA were extraced. Expression of C/EBPα and PPARα was measured by both western blotting and real-time PCR. A. C/EBPα expression in liver tissue; B.
C/EBPα in perigonadal fat; C. C/EBPα expression in skeletal tissue, D. PPARα expression in liver, E. PPARα expression in perigonadal fat. F. PPAR-α expression in
skeletal muscle. G. Hepatic PPARγ mRNA expression. H. Perigonadal fat PPAR-γ mRNA expresson. I. Skeletal muscle PPARγ mRNA. Data is shown as
mean ± S.E.M., n = 5–12. β-actin and β-tubulin were used as loading control *, P < 0.05, **, P < 0.005.

2014). Our results indicate that the inhibition of ACC2 phosphorylation
and elevation of LCAD after liraglutide treatment is associated with
activation of AMPK-α in both liver and fat tissues. However, liraglutide
fails to activate AMPK phosphorylation in skeletal muscle, suggesting
the modulatory role of liraglutide on fatty acid oxidation in skeletal
muscle may not occur through the AMPK-α pathway.
SIRT-1 controls hepatic gluconeogenesis by regulating transcription
factors and co-regulators such as PPARγ and PGC-1α (Cantó and
Auwerx, 2009), and has been shown to ameliorate hepatic steatosis in
T2D patients with NAFLD complications (Xu et al., 2014). The AMPK-
SIRT-1 pathway therefore plays a major role in regulating metabolism.
Liraglutide is reported to inhibit cardiac steatosis in diabetic mice
through down regulation of PPARγ induced by activation of the AMPK-
SIRT-1 pathway (Inoue et al., 2015). In agreement with the findings in
cardiac tissue, our study indicates that liraglutide increases SIRT-1 ex-
pression and elevates fatty acid oxidation in insulin sensitive tissues,
including liver, adipose, and skeletal muscle, suggesting that the AMPK-
SIRT-1 cell signaling pathway is a key mediator of liraglutide induced
fatty acid oxidation in liver and fat tissues of DIO mice.
The anti-adipogenic role of liraglutide is also supported by its in-
hibitory effect on lipogenic signaling pathways. A high fat diet or
obesity suppresses AMPK activity while activating the expression of
adipogenic transcription factors such as PPARγ and C/EBPα in the liver
(Armstrong et al., 2016b). Our study confirmed the activation of this

8
J.Y. Zhou, et al.
Fig. 7. Liralutide induces PPARα in liver and perigonadal fat in HFHS diet mice. Mice tissues were collected, and protein and RNA were extraced A. PPARα protein
expression in liver. B. PPARα protein expression in perigonadal fat. C. Liver PPARα mRNA expression. D. Perigonadal fat PPARα mNA expression Data is shown as
mean ± S.E.M., n = 5. β-actin were used as loading control. *, P < 0.05, **, P < 0.005.
signaling pathway in insulin sensitive tissues. Furthermore, we detected
an inhibitory effect; liraglutide downregulated PPAR-γ and C/EBPα in
the liver, adipose tissue, and skeletal muscle, indicating an anti-lipo-
genic effect of liraglutide in these tissues. This can be explained by the
cross-talk between PPARγ and C/EBPα in regulating adipogenesis
(Rosen et al., 2002; Wu et al., 1999), with PPARγ being the proximal
effector of adipogensis (Walton and Maung Tun, 1978), lipogenesis, and
lipid accumulation in steatotic hepatocytes (Schadinger et al., 2005).
The reductions in adiposity as a result of liraglutide treatment, speci-
fically visceral adiposity, suggests a modulatory role of liraglutide in de
novo lipogenic pathways in liver tissue and an anti-lipogenic effect of
liraglutide in fat and skeletal muscle.
Benefits of liraglutide on NAFLD have not been well established.
Forty-eight weeks of liraglutide treatment led to the histological re-
solution of NASH in overweight subjects (Armstrong et al., 2016a).
However, twelve-week liraglutide treatment did not reduce hepatic
steatosis or fibrosis in T2D patients in a randomized, placebo-controlled
trial (Smits et al., 2016). In contrast, eight-weeks of liraglutide treat-
ment improved steatosis scores in DIO-NASH in rodents (Ipsen et al.,
2018; Tølbøl et al., 2018), and this beneficial role may be mediated
through the elevation of adiponectin and the inactivation of JNK-1 (Gao
et al., 2015). Our study provides new evidence that liraglutide reduces
hepatic inflammation and hepatocyte ballooning, which may be
mediated through the AMPK-Sirt-1 cell signaling pathway. However,
long term treatment with liraglutide and extensive study of chronic
HFHS diet induced hepatic steatosis are warranted.
PPARα plays a major role in regulating energy metabolism and is
the most important PPAR in regulating liver fatty acid mitochondrial
and peroxisomal β-oxidation (Bjørndal et al., 2011). Importantly,
9
European Journal of Pharmacology 861 (2019) 172594
recent evidence also suggests it plays a role in modulating acute or
chronic inflammation (Bougarne et al., 2018; Gervois and Mansouri,
2012). We have shown that liraglutide treatment induces PPARα up-
regulation in association with reduced inflammation markers in insulin
sensitive tissues, a finding that supports the anti-inflammatory effect of
liraglutide.
One possible mechanism by which liraglutide promotes energy ex-
penditure is through the activation and/or expansion of brown adipose
tissue and mitochondrial uncoupling of respiration in brown adipo-
cytes, which may be present in skeletal muscles, as reported in our
previous studies (Li et al., 2011b). PRDM-16 is a transcriptional reg-
ulator of a bidirectional switch in cell fate between skeletal muscle and
brown fat (Seale et al., 2008) via regulation of PGC1-α and mi-
tochondrial UCP-1 (Seale et al., 2008). Following treatment with lir-
aglutide we observed substantial increases in the expression of PRDM16
and brown fat markers such as UCP-1 and PPARα in skeletal muscle
tissue. These findings indicate that liraglutide induces brown fat dif-
ferentiation in skeletal muscle in an insulin resistant state. Despite
upregulating brown fat markers, two weeks of liraglutide treatment
failed to induce beige fat in our study, possibly due to the insufficient
duration of the treatment. Twelve-weeks of liraglutide treatment has
been reported to induce beige fat in high fat diet-fed KK/Upj-Ay/J
(KKAy) mice (Zhu et al., 2016). Hence, a prolonged treatment period
with liraglutide may be required to induce beige fat differentiation in
HFHS-fed mice.
In conclusion, our study indicates that liraglutide improves insulin
sensitivity through multiple pathways including reduction of in-
flammation, elevation of fatty acid oxidation, and inducing skeletal
muscle adaptive thermogenesis. Our data that derived from animal
J.Y. Zhou, et al.
Fig. 8. Liralutide induces brown adipocyte diferentiation in skeletal muscle in HFHS diet mice. Mice tissues were collected, and protein and RNA were extraced.
Expression of UCP-1, PRDM-16 and PPARα was measured by both western blotting and real-time PCR. A Expression of UCP-1 in skeletal muscle, B. PRDM-16
expression in skeletal muscle, C. PPARα expression in skeletal muscle. D. mRNA expression of brown fat markers in skeletal muscle. Data is shown as
mean ± S.E.M., n = 5. β-actin and β-tubulin were used as loading control *, P < 0.05, **, P < 0.005.
models provides more evidence that liraglutide may be an effective
treatment for obesity and related metabolic disorders. However, further
human studies regarding the potential therapeutic role of liraglutide on
metabolic disorder and NAFLD are needed.
Conflicts of interest
The authors have no conflict of interests to declare.
Acknowledgement
L.L. is supported by faculty start-up fund from College of Health
Professions, Central Michigan University. Rosca M is supported by
American Heart Association (grant # 18AIREA33990023). The authors
thank Jamsheed Bahaee and Melisa Andrews for technical support and
Darren Story for editing English grammars for the manuscript.
References
Abu-Elheiga, L, Oh, W, Kordari, P, Wakil, S.J, 2003. Acetyl-CoA carboxylase 2 mutant
mice are protected against obesity and diabetes induced by high-fat/high-carbohy-
drate diets. Proc Natl Acad Sci U S A 100, 10207–10212..
Armstrong, M.J., Gaunt, P., Aithal, G.P., Barton, D., Hull, D., Parker, R., Hazlehurst, J.M.,
Guo, K., Abouda, G., Aldersley, M.A., Stocken, D., Gough, S.C., Tomlinson, J.W.,
Brown, R.M., Hübscher, S.G., Newsome, P.N., team, L.t., 2016a. Liraglutide safety
and efficacy in patients with non-alcoholic steatohepatitis (LEAN): a multicentre,
double-blind, randomised, placebo-controlled phase 2 study. Lancet 387, 679–690.
Armstrong, M.J., Hull, D., Guo, K., Barton, D., Hazlehurst, J.M., Gathercole, L.L., Nasiri,
M., Yu, J., Gough, S.C., Newsome, P.N., Tomlinson, J.W., 2016b. Glucagon-like
peptide 1 decreases lipotoxicity in non-alcoholic steatohepatitis. J. Hepatol. 64,
399–408.
Bastard, J.P., Maachi, M., Van Nhieu, J.T., Jardel, C., Bruckert, E., Grimaldi, A., Robert,
J.J., Capeau, J., Hainque, B., 2002. Adipose tissue IL-6 content correlates with re-
sistance to insulin activation of glucose uptake both in vivo and in vitro. J. Clin.
Endocrinol. Metab. 87, 2084–2089.
Bjørndal, B., Burri, L., Staalesen, V., Skorve, J., Berge, R.K., 2011. Different adipose de-
pots: their role in the development of metabolic syndrome and mitochondrial re-
sponse to hypolipidemic agents. J Obes 2011, 490650.
Bougarne, N., Weyers, B., Desmet, S.J., Deckers, J., Ray, D.W., Staels, B., De Bosscher, K.,
10
European Journal of Pharmacology 861 (2019) 172594
2018. Molecular actions of PPARα in lipid metabolism and inflammation. Endocr.
Rev. 39, 760–802.
Cantó, C., Auwerx, J., 2009. PGC-1 alpha, SIRT1 and AMPK, an energy sensing network
that controls energy expenditure. Curr. Opin. Lipidol. 20, 98–105.
Drucker, D.J., 2002. Biological actions and therapeutic potential of the glucagon-like
peptides. Gastroenterology 122, 531–544.
Dyck, J.R., Gao, G., Widmer, J., Stapleton, D., Fernandez, C.S., Kemp, B.E., Witters, L.A.,
1996. Regulation of 5'-AMP-activated protein kinase activity by the noncatalytic beta
and gamma subunits. J. Biol. Chem. 271, 17798–17803.
Feige, J.N., Auwerx, J., 2007. Transcriptional coregulators in the control of energy
homeostasis. Trends Cell Biol. 17, 292–301.
Feldmann, H.M., Golozoubova, V., Cannon, B., Nedergaard, J., 2009. UCP1 ablation in-
duces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal
stress by living at thermoneutrality. Cell Metabol. 9, 203–209.
Fuchs, O., Borová, J., Hradilek, A., Neuwirt, J., 1988. Non-transferrin donors of iron for
heme synthesis in immature erythroid cells. Biochim. Biophys. Acta 969, 158–165.
Fullerton, M.D., Galic, S., Marcinko, K., Sikkema, S., Pulinilkunnil, T., Chen, Z.P., O'Neill,
H.M., Ford, R.J., Palanivel, R., O'Brien, M., Hardie, D.G., Macaulay, S.L., Schertzer,
J.D., Dyck, J.R., van Denderen, B.J., Kemp, B.E., Steinberg, G.R., 2013. Single
phosphorylation sites in Acc1 and Acc2 regulate lipid homeostasis and the insulin-
sensitizing effects of metformin. Nat. Med. 19, 1649–1654.
Gao, H., Zeng, Z., Zhang, H., Zhou, X., Guan, L., Deng, W., Xu, L., 2015. The glucagon-like
peptide-1 analogue liraglutide inhibits oxidative stress and inflammatory response in
the liver of rats with diet-induced non-alcoholic fatty liver disease. Biol. Pharm. Bull.
38, 694–702.
Gervois, P., Mansouri, R.M., 2012. PPARα as a therapeutic target in inflammation-asso-
ciated diseases. Expert Opin. Ther. Targets 16, 1113–1125.
Harms, M., Seale, P., 2013. Brown and beige fat: development, function and therapeutic
potential. Nat. Med. 19, 1252–1263.
Harms, M.J., Ishibashi, J., Wang, W., Lim, H.W., Goyama, S., Sato, T., Kurokawa, M.,
Won, K.J., Seale, P., 2014. Prdm16 is required for the maintenance of brown adi-
pocyte identity and function in adult mice. Cell Metabol. 19, 593–604.
Heppner, K.M., Marks, S., Holland, J., Ottaway, N., Smiley, D., Dimarchi, R., Perez-Tilve,
D., 2015. Contribution of brown adipose tissue activity to the control of energy
balance by GLP-1 receptor signalling in mice. Diabetologia 58, 2124–2132.
Holmes, D., 2017. Pharmacotherapy: a smarter way to treat obesity. Nat. Rev. Endocrinol.
13, 626.
Inoue, T., Inoguchi, T., Sonoda, N., Hendarto, H., Makimura, H., Sasaki, S., Yokomizo, H.,
Fujimura, Y., Miura, D., Takayanagi, R., 2015. GLP-1 analog liraglutide protects
against cardiac steatosis, oxidative stress and apoptosis in streptozotocin-induced
diabetic rats. Atherosclerosis 240, 250–259.
Ipsen, D.H., Rolin, B., Rakipovski, G., Skovsted, G.F., Madsen, A., Kolstrup, S., Schou-
Pedersen, A.M., Skat-Rørdam, J., Lykkesfeldt, J., Tveden-Nyborg, P., 2018.
Liraglutide decreases hepatic inflammation and injury in advanced lean non-alco-
holic steatohepatitis. Basic Clin. Pharmacol. Toxicol. 123 (6), 704–713 2018.
J.Y. Zhou, et al.
Kakimoto, P.A., Kowaltowski, A.J., 2016. Effects of high fat diets on rodent liver bioe-
nergetics and oxidative imbalance. Redox Biol. 216–225.
Kern, P.A., Ranganathan, S., Li, C., Wood, L., Ranganathan, G., 2001. Adipose tissue
tumor necrosis factor and interleukin-6 expression in human obesity and insulin re-
sistance. Am. J. Physiol. Endocrinol. Metab. 280, E745–E751.
Kim, J.H., Bachmann, R.A., Chen, J., 2009. Interleukin-6 and insulin resistance. Vitam.
Horm. 80, 613–633.
Kim, S.F., Huri, D.A., Snyder, S.H., 2005. Inducible nitric oxide synthase binds, S-ni-
trosylates, and activates cyclooxygenase-2. Science 310, 1966–1970.
Knudsen, L.B., 2010. Liraglutide: the therapeutic promise from animal models. Int. J. Clin.
Pract. Suppl, 4–11.
Krasner, N.M., Ido, Y., Ruderman, N.B., Cacicedo, J.M., 2014. Glucagon-like peptide-1
(GLP-1) analog liraglutide inhibits endothelial cell inflammation through a calcium
and AMPK dependent mechanism. PLoS One 9, e97554.
Leclercq, I.A., Farrell, G.C., Sempoux, C., dela Peña, A., Horsmans, Y., 2004. Curcumin
inhibits NF-kappaB activation and reduces the severity of experimental steatohepa-
titis in mice. J. Hepatol. 41, 926–934.
Lee, Y.S., Shin, S., Shigihara, T., Hahm, E., Liu, M.J., Han, J., Yoon, J.W., Jun, H.S., 2007.
Glucagon-like peptide-1 gene therapy in obese diabetic mice results in long-term cure
of diabetes by improving insulin sensitivity and reducing hepatic gluconeogenesis.
Diabetes 56, 1671–1679.
Li, L., Hossain, M.A., Sadat, S., Hager, L., Liu, L., Tam, L., Schroer, S., Huogen, L., Fantus,
I.G., Connelly, P.W., Woo, M., Ng, D.S., 2011a. Lecithin cholesterol acyltransferase
null mice are protected from diet-induced obesity and insulin resistance in a gender-
specific manner through multiple pathways. J. Biol. Chem. 286, 17809–17820.
Li, L., Hossain, M.A., Sadat, S., Hager, L., Liu, L., Tam, L., Schroer, S., Huogen, L., Fantus,
I.G., Connelly, P.W., Woo, M., Ng, D.S., 2011b. Lecithin cholesterol acyltransferase
null mice are protected from diet-induced obesity and insulin resistance in a gender-
specific manner through multiple pathways. J. Biol. Chem. 286, 17809–17820.
Makki, K., Froguel, P., Wolowczuk, I., 2013. Adipose tissue in obesity-related in-
flammation and insulin resistance: cells, cytokines, and chemokines. ISRN Inflamm
2013, 139239.
Marcinko, K., Steinberg, G.R., 2014. The role of AMPK in controlling metabolism and
mitochondrial biogenesis during exercise. Exp. Physiol. 99, 1581–1585.
Mells, J.E., Fu, P.P., Sharma, S., Olson, D., Cheng, L., Handy, J.A., Saxena, N.K., Sorescu,
D., Anania, F.A., 2012. Glp-1 analog, liraglutide, ameliorates hepatic steatosis and
cardiac hypertrophy in C57BL/6J mice fed a Western diet. Am. J. Physiol.
Gastrointest. Liver Physiol. 302, G225–G235.
Montgomery, M.K., Turner, N., 2015. Mitochondrial dysfunction and insulin resistance:
an update. Endocr Connect 4, R1–R15.
Namba, M., Katsuno, T., Kusunoki, Y., Matsuo, T., Miuchi, M., Miyagawa, J., 2013. New
strategy for the treatment of type 2 diabetes mellitus with incretin-based therapy.
Clin. Exp. Nephrol. 17, 10–15.
Olefsky, J.M., Glass, C.K., 2010. Macrophages, inflammation, and insulin resistance.
Annu. Rev. Physiol. 72, 219–246.
Parthsarathy, V., Hölscher, C., 2013. The type 2 diabetes drug liraglutide reduces chronic
inflammation induced by irradiation in the mouse brain. Eur. J. Pharmacol. 700,
42–50.
Richard, J., Lingvay, I., 2011. Hepatic steatosis and Type 2 diabetes: current and future
treatment considerations. Expert Rev. Cardiovasc Ther. 9, 321–328.
Rosen, E.D., Hsu, C.H., Wang, X., Sakai, S., Freeman, M.W., Gonzalez, F.J., Spiegelman,
B.M., 2002. C/EBPalpha induces adipogenesis through PPARgamma: a unified
pathway. Genes Dev. 16, 22–26.
11
European Journal of Pharmacology 861 (2019) 172594
Schadinger, S.E., Bucher, N.L., Schreiber, B.M., Farmer, S.R., 2005. PPARgamma2 reg-
ulates lipogenesis and lipid accumulation in steatotic hepatocytes. Am. J. Physiol.
Endocrinol. Metab. 288, E1195–E1205.
Seale, P., Bjork, B., Yang, W., Kajimura, S., Chin, S., Kuang, S., Scimè, A., Devarakonda,
S., Conroe, H.M., Erdjument-Bromage, H., Tempst, P., Rudnicki, M.A., Beier, D.R.,
Spiegelman, B.M., 2008. PRDM16 controls a brown fat/skeletal muscle switch.
Nature 454, 961–967.
Senn, J.J., Klover, P.J., Nowak, I.A., Mooney, R.A., 2002. Interleukin-6 induces cellular
insulin resistance in hepatocytes. Diabetes 51, 3391–3399.
Sheedfar, F., Di Biase, S., Koonen, D., Vinciguerra, M., 2013. Liver diseases and aging:
friends or foes? Aging Cell 12, 950–954.
Smits, M.M., Tonneijck, L., Muskiet, M.H., Kramer, M.H., Pouwels, P.J., Pieters-van den
Bos, I.C., Hoekstra, T., Diamant, M., van Raalte, D.H., Cahen, D.L., 2016. Twelve
week liraglutide or sitagliptin does not affect hepatic fat in type 2 diabetes: a ran-
domised placebo-controlled trial. Diabetologia 59, 2588–2593.
Tang, S.C., Hendrikx, J.J., Beijnen, J.H., Schinkel, A.H., 2013. Genetically modified
mouse models for oral drug absorption and disposition. Curr. Opin. Pharmacol. 13,
853–858.
Tomas, E., Wood, J.A., Stanojevic, V., Habener, J.F., 2011. Glucagon-like peptide-1(9-36)
amide metabolite inhibits weight gain and attenuates diabetes and hepatic steatosis
in diet-induced obese mice. Diabetes Obes. Metab. 13, 26–33.
Tølbøl, K.S., Kristiansen, M.N., Hansen, H.H., Veidal, S.S., Rigbolt, K.T., Gillum, M.P.,
Jelsing, J., Vrang, N., Feigh, M., 2018. Metabolic and hepatic effects of liraglutide,
obeticholic acid and elafibranor in diet-induced obese mouse models of biopsy-con-
firmed nonalcoholic steatohepatitis. World J. Gastroenterol. 24, 179–194.
Vozarova, B., Weyer, C., Hanson, K., Tataranni, P.A., Bogardus, C., Pratley, R.E., 2001.
Circulating interleukin-6 in relation to adiposity, insulin action, and insulin secretion.
Obes. Res. 9, 414–417.
Wakil, S.J., Abu-Elheiga, L.A., 2009. Fatty acid metabolism: target for metabolic syn-
drome. J. Lipid Res. 50 (Suppl. l), S138–S143.
Walton, D.W., Maung Tun, U.M., 1978. Fleas of small mammals from Rangoon, Burma.
Southeast Asian J. Trop. Med. Public Health 9, 369–377.
Wu, Z., Rosen, E.D., Brun, R., Hauser, S., Adelmant, G., Troy, A.E., McKeon, C.,
Darlington, G.J., Spiegelman, B.M., 1999. Cross-regulation of C/EBP alpha and PPAR
gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity.
Mol. Cell 3, 151–158.
Xu, F., Li, Z., Zheng, X., Liu, H., Liang, H., Xu, H., Chen, Z., Zeng, K., Weng, J., 2014.
SIRT1 mediates the effect of GLP-1 receptor agonist exenatide on ameliorating he-
patic steatosis. Diabetes 63, 3637–3646.
Yu, J., Ip, E., Dela Peña, A., Hou, J.Y., Sesha, J., Pera, N., Hall, P., Kirsch, R., Leclercq, I.,
Farrell, G.C., 2006. COX-2 induction in mice with experimental nutritional steato-
hepatitis: role as pro-inflammatory mediator. Hepatology 43, 826–836.
Zander, M., Madsbad, S., Madsen, J.L., Holst, J.J., 2002. Effect of 6-week course of glu-
cagon-like peptide 1 on glycaemic control, insulin sensitivity, and beta-cell function
in type 2 diabetes: a parallel-group study. Lancet 359, 824–830.
Zhang, D., Liu, Z.X., Choi, C.S., Tian, L., Kibbey, R., Dong, J., Cline, G.W., Wood, P.A.,
Shulman, G., 2007. Mitochondrial dysfunction due to long-chain Acyl-CoA dehy-
drogenase deficiency causes hepatic steatosis and hepatic insulin resistance. Proc Natl
Acad Sci U S A 104, 17075–17080.
Zhu, E., Yang, Y., Zhang, J., Li, Y., Li, C., Chen, L., Sun, B., 2016. Liraglutide suppresses
obesity and induces brown fat-like phenotype via Soluble Guanylyl Cyclase mediated
pathway in vivo and in vitro. Oncotarget 7, 81077–81089.