Accepted Manuscript

Research paper

Zinc(II) and cadmium(II) halide complexes with caffeine: synthesis, X-ray

crystal structure, cytotoxicity and genotoxicity studies

Nataliya S. Rukk, Lyudmila G. Kuzmina, Ravshan S. Shamsiev, Galina A.

Davydova, Elena A. Mironova, Artem M. Ermakov, Grigory A. Buzanov, Alena
Yu. Skryabina, Andrej N. Streletskii, Galina A. Vorob'eva, Vasilii M. Retivov,
Pavel A. Volkov, Svetlana K. Belus, Evgeniya I. Kozhukhova, Valeriya N.
Krasnoperova

PII: S0020-1693(18)30667-4
DOI: https://doi.org/10.1016/j.ica.2018.11.036
Reference: ICA 18651

To appear in: Inorganica Chimica Acta

Received Date: 3 May 2018

Revised Date: 17 October 2018
Accepted Date: 24 November 2018

Please cite this article as: N.S. Rukk, L.G. Kuzmina, R.S. Shamsiev, G.A. Davydova, E.A. Mironova, A.M.
Ermakov, G.A. Buzanov, A. Yu. Skryabina, A.N. Streletskii, G.A. Vorob'eva, V.M. Retivov, P.A. Volkov, S.K.
Belus, E.I. Kozhukhova, V.N. Krasnoperova, Zinc(II) and cadmium(II) halide complexes with caffeine: synthesis,
X-ray crystal structure, cytotoxicity and genotoxicity studies, Inorganica Chimica Acta (2018), doi: https://doi.org/
10.1016/j.ica.2018.11.036

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Zinc(II) and cadmium(II) halide complexes with caffeine: synthesis, X-ray crystal
structure, cytotoxicity and genotoxicity studies

Nataliya S. Rukka*, Lyudmila G. Kuzminab, Ravshan S. Shamsieva, Galina A.

Davydovac, Elena A. Mironovaс, Artem M. Ermakovс, Grigory A. Buzanovb, Alena Yu.
Skryabinaa, Andrej N. Streletskiid, Galina A. Vorob'evad, Vasilii M. Retivove, Pavel A.
Volkove, Svetlana K. Beluse, Evgeniya I. Kozhukhovae, Valeriya N. Krasnoperovaa
a
MIREA - Russian Technological University, M.V. Lomonosov Institute of Fine Chemical Technologies,
Vernadsky av. 86, 119571 Moscow, Russian Federation
b
Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Leninskii
pr. 31, 119991 Moscow, Russian Federation
c
Institute of Theoretical and Experimental Biophysics of the Russian Academy of Sciences, Pushchino,
142290 Moscow region, Institutskaya str., 3, Russian Federation
d
Semenov Institute of Chemical Physics of the Russian Academy of Sciences, Kosygin str., 4, 119991
Moscow, Russian Federation
e
The Federal State Unitary Enterprise "Institute of Chemical Reagents and High Purity Chemical
Substances of National Research Center "Kurchatov Institute"" (NRC–"Kurchatov Institute"–IREA),
Bogorodskii val, 3, 107076 Moscow, Russian Federation
* Corresponding author:
E-mail address: roukkn@inbox.ru (N. S. Rukk).

ABSTRACT

Molecular complexes [Zn(caf)(H2O)I2] (I), [Zn(caf)(H2O)Cl2] (IV), and the polymeric

ones {[Cd(H2O)2I2](caf).2H2O}n (II) and {[Cd(H2O)2Br2](caf).2H2O}n (III) consisting of
infinite Cd-containing chains with bridging halide ions and water molecules in trans-
position and connected with each other due to hydrogen bonding with participation of
caffeine (сaf) and water molecules, were prepared and characterized by the powder and
single crystal X-ray diffraction, IR vibrational spectroscopy, 1H NMR, ESI-MS
spectroscopy, thermal analysis and DFT calculations. It was found that the complexes (I)
and (IV) are characterized by tetrahedral geometry, the caffeine molecule being
coordinated by the central atom via its N9 atom. The preferability of complex formation
was evaluated by quantum-chemical calculations. Cyto- and genotoxicity of the
compounds have been investigated and discussed in comparison with that of [Zn(AP)2I2]
(1) and [Cd(AP)6][Cd(AP)I3]2 (2). It was demonstrated that the prepared complexes,
primarily that of cadmium iodide with caffeine (II), are the promising ones for further
studies both in vitro and in vivo.

Keywords: Zinc and cadmium complexes; Сaffeine; Crystal structure; DFT calculations;
Cyto- and genotoxicity.

1. Introduction

It is known that zinc belonging to the Group III of the essential trace elements [1]
plays an important role in cell proliferation, differentiation and metabolic activity of the

1
cell [1, 2]. Zinc(II) complexes with participation of antipyrine (AP, 2,3-dimethyl-1-
phenyl-3-pyrazolin-5-one, phenazone) and its 4-acyl derivatives demonstrate cytotoxic
activity on viability of the NCTC L929 cell line [3] and on that of the DU145, LNCaP
and PC-3 human prostate cancer cells, respectively [4]. It has been concluded that zinc(II)
is a promising alternative to platinum(II) ion in the design of novel more effective
antitumor agents [4] and that the simultaneous presence of flat chelating ligands around
the zinc(II) ion is a winning choice for endowing new non-platinum complexes with good
antitumor activity [4].
It was found [5] that [M(ANA)2Cl2] complexes (M = Zn, Cd, Hg, ANA - 2-
aminonicotinaldehyde) demonstrate the synergistic effect on the cell growth suppressive
action for breast cancer cell line (MCF-7), cervical carcinoma cell line (HeLa), alveolar
carcinoma (A-549) and human embryonic kidney 293 cell line (HEK-293) in comparison
with free ligand and non-active metal chlorides, zinc-containing complex exhibiting
significant activity against three cancer cell lines with HeLa, MCF-7 and A549 IC50
values of 19.02 ± 0.29, 21.72 ± 0.24 and 17.25 ± 0.37 μM, when compared with the cis-
platin standard drug (IC50 values: 2.24±0.19; 1.82±0.1; 2.307±0.32 μM, respectively).
Enhancing of antitumor activity upon coordination of a number of metal cations with
(E)-2-Hydroxy-N'-((Z)-3-(hydroxyimino)-4-oxopentan-2-ylidene)benzohydrazide against
human liver HepG2 cancer cells (HepG2 cell line) was demonstrated in [6]
Glycine bridged zinc(II) Schiff base coordination polymer synthesized by the
condensation of 2,6-diformyl-4-methylphenol, glycine, and zinc(II) chloride [7]. was
found to be remarkably active against Jurkat human T cell leukemia, Raji Burkitt’s
lymphoma and A-549 cell lines (IC50 = 7.3; 9.3; 93.6 μg/mL, respectively, in comparison
with the cis-platin with IC50 = 26, 30, 79.4 μg/mL for the same order of cancer cells.
Cadmium is a nonessential transition metal and it has been classified as a human
carcinogen by the International Agency for Research on Cancer (IARC) and the
International Programme on Chemical Safety (IPCS) [8]. It has been demonstrated that
the known toxicity of cadmium can be modulated by complexation [3, 9] and that the
cytotoxic effect of the cadmium ion is attenuated by its coordination, for example with
supramolecular p-tetrasulfonated thiacalix[4]arene (TC4ATS) [8]. The prepared
TC4ATS-Cd complex showed anti-proliferative activity elicited by induction of apoptosis

2
in T-cell leukemia cell lines, indicating that this supramolecular ligand is a promising one
in the development of metal-coordinated anticancer drugs [8]. Cadmium complexes
appear to be interesting as well from a structural point of view because of the ability of
the cation to form both tetrahedral and octahedral complexes [3, 5, 6]
Caffeine (1,3,7-trimethylpurine-2,6-dione) and its derivatives are the perspective
source for receiving therapeutic agents to be used in a combined therapy for primary and
metastatic brain tumors due to their possibility to penetrate through the Blood-Brain-
Barrier (BBB) [10]. It has been proposed that antitumorigenic effect of caffeine may be
related to its ability to inhibit the bonding of active metabolites of carcinogens to cellular
DNA and that caffeine may be considered in designing strategies to modulate the activity
of the intercalating drugs in vivo, e.g. in lowering drug toxicity when inadvertently
applied at too bright doses [11]. Caffeine enhancement of the tumoricidal effect of
anticancer drugs and its synergistic action on human sarcoma cells in the course of
caffeine combination with cis-platin, cyclophosphamide, mitomycin C and adriamycin
has been demonstrated [12]. Antiproliferative activity of novel caffeine derivatives is
discussed in [13].
To the best of our knowledge, the structural and cyto- and genotoxic properties of
the zinc- and cadmium halide complexes with caffeine are unknown. So, the aim of the
present work consists in the synthesis, investigations, including cyto- and genotoxicity
studies, of the zinc(II)- and cadmium(II) halide complexes with caffeine -
[Zn(caf)(H2O)I2] (I), [Zn(caf)(H2O)Cl2] (IV), {[Cd(H2O)2I2](caf).2H2O}n (II) and
{[Cd(H2O)2Br2](caf).2H2O}n (III) - and in the subsequent bioactivity comparison
between the respective complexes with caffeine and antipyrine. The aim of the present
work consists also in the theoretical calculations (DFT, Density Functional Level of
Theory) in order to determine the probability of complex formation and to elucidate the
regularities in the properties of compounds in the course of metal-, ligand- or halide ion
variation.

3
2. Experimental
2.1. Materials and physical techniques
All manipulations were performed under aerobic conditions using materials
(reagent grade) as received. Zinc oxide or carbonate was used for preliminary preparation
of zinc(II) iodide (or chloride) polyhydrate. Cadmium(II) bromide was prepared from
cadmium carbonate and hydrobromic acid. Cadmium(II) iodide was used as received
GOST 8421-79 [3]. Antipyrine and caffeine were recrystallized from water.
The complexes were obtained by interaction of aqueous solution of MX2 with a
saturated aqueous solution of antipyrine taken in a molar ratio MX2 : AP = 1:2 (M = Zn,
X = I) or 1:(2.6-2.7) (M = Cd, X = I) [3].
Complexes with caffeine were obtained by a reaction of MX2 with caffeine in the
molar ratio MX2 : caf = (1-3):1 (Schemes 1, 2, X = Cl, Br, I).

b
Scheme 1. Preparation of [Zn(caf)(H2O)X2]: a) X = I (I); b) X = Cl (IV).

4
a

b
Scheme 2. Preparation of {[Cd(H2O)2X2](caf).2H2O}n : a) X = I (II); b) X = Br (III).

Contents of chemical elements were determined using the CHNS EuroVector

EuroEA 3000 (EuroVector s.p.a., Italy) elemental analyzer and the inductively coupled
plasma atomic emission spectroscopy (ICP-AES) iCAP 6300 DUO (Thermo Scientific,
USA) [3, 14].
The zinc and cadmium content was determined as well by the complexonometric
method (titration by EDTA in the presence of xylenol orange (or Eriochrome Black T) as
an indicator). The antipyrine content was determined by back titration of excess iodine by
sodium thiosulfate solution. Halide-ion content was determined gravimetrically in the
form of AgX (X = Cl, Br, I). The relative error of determination equals to ca. 0.2-0.3 %.
Details are given in [3, 15].
IR-spectra were recorded on an IR–Fourier spectrometer EQUINOX 55
(«BRUKER», Germany) in the range 4000 – 400 cm-1 (KBr pellets) and 680 – 30 cm-1
(Nujol mulls), respectively.

5
 The phase composition of both starting materials and resulting products were
studied by the powder X-ray diffraction (pXRD) analysis. Powder X-ray diffraction
patterns were performed on a Bruker D8 Advance diffractometer (CuKα radiation, Ni-
filter, LYNXEYE detector, reflection geometry) over the 2θ range from 5о to 80о and the
step of 0.01125о in the Shared Equipment Centre of the Kurnakov Institute of General
and Inorganic Chemistry of the Russian Academy of Sciences. The measurements were
performed with the samples deposited in cuvettes made from oriented single-crystalline
silicon. Samples were thoroughly powdered in an agate mortar before diffraction pattern
registration.
The single crystal XRD data and crystallographic parameters for (I)–(IV) were
measured at 150 K under a stream of cooled nitrogen on a CCD SMART APEX-II
diffractometer (graphite monochromatized Mo-Kα radiation, ω scan mode). The primary
processing of the experimental data was performed by the SAINT program [16]. The
absorption correction was applied by use of SADABS program.
The crystal structures of the compounds under investigation were solved by direct
methods and refined on F2 by full-matrix least-squares in anisotropic approximation for
non-hydrogen atoms. Positions of hydrogen atoms were calculated geometrically. Their
least squares refinement was performed using the “riding” model. All calculations for
(I)–(IV) were performed using Olex-2 [17] and SHELXTL-Plus [18] program software.
Visualization of the compounds structure was performed using the MERCURY
program [19].
Thermal Analysis (TG/DSC/MS) was carried out on STA-449 (Jupiter)
synchronous thermal analyzer with QMS 403 CF Aeolos mass-spectrometer (NETZSCH-
Geratebau GmbH, Germany) under He atmosphere. The temperature was ramped from 20
up to 400 °C at a rate of 10 °/min.
The 1H NMR spectra were recorded on a Bruker Avance III NanoBay
spectrometer at 300.28 MHz and 25º C using D2O and CD3CN as the solvents and
tetramethylsilane (TMS) as the internal standard. Chemical shifts are reported as ppm
values downfield from TMS. (Appendix C. Supplementary Figs. S1-S6, Scheme S1).

6
 Electrospray ionization mass spectrometry (ESI-MS) spectra were recorded on an
electrospray mass spectrometer AmaZon Bruker Daltonik GmbH in the UltraScan
positive and negative ionization mode (m/z range: 70–2200). Aqueous acetonitrile (1:1)
solutions of caffeine or complex compound (I) or acetonitrile solutions of (II), (III), (IV)
were introduced directly into the ESI source through a syringe with a rate of 240 μL/h.
Experimental conditions were as follows: needle source voltage 3.5 kV, carrier gas flow
rate 6 L/min, capillary temperature 100° C, signal accumulation 300000 ions in the ion
trap, signal averaging of 13 scans (Appendix C. Supplementary Figs. S7-S10).

2.2. Compound preparation

The complexes were obtained by interaction of the preliminary prepared
MX2∙nH2O (by a reaction of MCO3 or MO with aqueous solution of HX; (M = Zn, X =
Cl, I; M = Cd, X = Br; CdI2) with a saturated aqueous solution of antipyrine or caffeine in
a molar ratio MI2 : AP = 1:2 (M = Zn, X = I) or 1:(2.6-2.7) (M = Cd) [3] and MX2 : caf =
(1-3):1 (Schemes 1, 2).
The precipitated compounds were filtered off and kept in a desiccator over NaOH.
The yield of compounds was in the range of 50 – 80%.

Anal. Calc. for 1, C22H24I2N4O2Zn (695.62): Zn, 9.40; AP (C11H12N2O), 54.12; I, 36.48.
Found: Zn, 9.35; AP, 53.99; I, 36.48 wt.%.
IR (cm-1): 92, 127, 151 (lattice vibrations); 178, 199 (ν(Zn-I)); 203 (out-of-plane
vibrations of rings+ ν(Zn-I)); 262, 278, 305, 323 (out-of-plane vibrations of rings +
ν(Zn-O)); 430, 459, 501 (out-of-plane vibrations of rings); 586, 616, 640 (ν(Zn-O)); 1612
(ν(CO) + ν(CC)). M.p. 164º C; ΔHm = 51.76 J/g (36.00 kJ/mol).
Calc. for 2, C88H96Cd3I6N16O8 (2604.40): Cd, 15.14; AP (C11H12N2O), 50.68; I, 34.17.
Found: Cd, 15.38; AP, 50.06; I, 34.56 wt.%.
IR (cm-1): 92, 100, 122, 140, 157 (lattice vibrations); 174 (ν(Cd-I)); 303 (out-of-plane
vibrations of rings + ν(Cd-O)); 406, 440, 500 (ν(Cd-O)+out-of-plane vibrations of rings);
590, 608, 620, 645 ν(Cd-O)); 1600-1604 cm-1 (ν(CO) + ν(CC)); M.p. 125.3º C;
ΔHm = 47.60 J/g (123.97 kJ/mol).

7
Calc. for (I) C8H12I2N4O3Zn (531.39): Zn, 12.31; I, 47.76; Found: Zn, 12.08; I, 47.41
wt.%. IR (cm-1): 80-100 ν(Zn-O)+ δ(OZnN)+ν(Zn-I)+δ(IZnI); 150-400 ν(Zn-O)+ν(Zn-
N)+ν(Zn-I)+ρr(H2O)+δring; 480-490 ν(Zn-N); 570 ν(Zn-O)+ring+ρw(H2O); 610 γring+ν(Zn-
N); 1547 ν(C=C)+δ(NCN)+ν(Zn-N); 1627 νas(C=O)+ν(C=N)+δring+δ(H2O); 1652
νas(C=O)+ δring; 1692 νs(C=O)+ δring; 3200-3500 ν(O-H). 1H NMR (CD3CN, ppm, 300.28
MHz): δ 7.74 (s, CH A), 3.90 (s, CH3 B), 3.50 (s, CH3 C), 3.26 (s, CH3 D) (Appendix C,
Supplementary Fig. S3, Scheme S1). Powder XRD data: Fig. 3b.
Calc. for (II), C8H18CdI2N4O6 (632.46): C, 15.19; Cd, 17.75; H, 2.87; I, 40.13; N, 8.86;.
Found: C, 15.08; Cd, 18.14; H, 2.93; I, 40.53; N, 8.71 wt.%. IR (cm-1): 50-190 (I-Cd-I)
+(O-Cd-I) + ring (lattice vibrations) + ν(Cd-O) + ν(Cd-Iμ); 535 ν(Cd-O); 1652
νas(C=O)+ δring;+ δ(H2O); 1702 νs(C=O)+ δring; 3200-3500 ν(O-H). M.p. 200-210º C. 1H
NMR (CD3CN, ppm, 300.28 MHz): δ 7.69 (s, CH A), 3.90 (s, CH3 B), 3.49 (s, CH3 C),
3.27 (s, CH3 D) (Appendix C, Supplementary Fig. S4, Scheme S1). Powder XRD data:
Figs. 1, 2b.
Calc. for (III) C8H18CdBr2N4O6 (538.46): Cd, 20.88; Br, 29.69; Found: Cd, 20.81; Br,
29.50 wt.%. IR (cm-1): 50-230 (Br-Cd-Br) + (O-Cd-Br) + ring (lattice vibrations) +
ν(Cd-O) + ν(Cd-Brμ); 552 ν(Cd-O); 1658 νas(C=O)+ δring;+ δ(H2O); 1704 νs(C=O)+ δring;
3200-3500 ν(O-H). 1H NMR (D2O, ppm, 300.28 MHz): δ 7.79 (s, CH A), 3.90 (s, CH3
B), 3.35 (s, CH3 C), 3.18 (s, CH3 D) (Appendix C, Supplementary Fig. S5, Scheme
S1). Powder XRD data: Fig. 2a.
Calc. for (IV), C8H12Cl2N4O3Zn (348.49): N, 16.08; C, 27.57; H, 3.47; Found: N, 15.35;
C, 26.55; H, 3.57; IR (cm-1): 80-120 ν(Zn-O)+δ(OZnN)+ν(Zn-Cl)+δ(ClZnCl); 150-400
ν(Zn-O)+ν(Zn-N)+ν(Zn-Cl)+ρr(H2O)+δring; 499 ν(Zn-N); 550 ν(Zn-O) + ring+ ρw(H2O);
614 γring+δ(ZnNC); 1563 ν(C=C)+δ(NCN)+ν(Zn-N);
1636 νas(C=O)+ν(C=N)+δring+δ(H2O); 1664 νas(C=O)+ δring; 1707 νs(C=O)+ δring; 3200-
3500 ν(O-H); M.p. 160-165º C. . 1H NMR (CD3CN, ppm, 300.28 MHz): δ 7.77 (s, CH
A), 3.78 (s, CH3 B), 3.31 (s, CH3 C), 3.14 (s, CH3 D) (Appendix C, Supplementary Fig.
S6, Scheme S1). Powder XRD data: Fig. 3a.

8
2.3. Cytotoxicity assay
Cytotoxicity was determined by methylthiazole tetrazolium (MTT) assay. The
MTT-test is based on the reduction of a colorless salt of tetrazolium (3-[4,5-
dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, MTT) by mitochondrial and
cytoplasmic dehydrogenases of living metabolically active cells with formation of blue
intracellular formazan crystals soluble in dimethyl sulfoxide (DMSO) [20].
Cytotoxicity was analyzed using the postnatal dental pulp stem cells (DPSC) and
MCF-7 breast cancer cell line obtained from the Russian Collection of Cell Cultures
(Institute of Cytology of the Russian Academy of Sciences).
The DPSC culture was obtained from freshly extracted third molar teeth (donor
age 16 years) with a root at least two thirds formed, which were extracted for
orthodontics reasons at the Central Research Institute of Dentistry and Maxillofacial
Surgery, Ministry of Health of the Russian Federation (Moscow), under the approval of
the Ethical Committee and after the patient’s parents had signed consent forms. The pulp
tissue was gently separated from the crown and root and washed three times with Hank’s
Balanced Salt Solution containing 200 U/mL penicillin and 200 μg/mL streptomycin to
minimize the risk of contamination. The pulp cell cultures were established via enzymatic
digestion of the pulp tissue after treatment with a solution of 0.25% trypsin/0.02% EDTA
for 30 min at 37◦C. Afterwards, the cell suspension was centrifuged for 3 min at 200g
and transferred into culture medium consisting of DMEM/F12 (1:1, PanEko), 10% fetal
calm serum (FBS, HyClone), 2mM L-glutamine (PanEko), 200 U/mL penicillin, and 200
μg/mL streptomycin, and solution of vitamins (PanEko), kept in the cell incubator and
cultured under 5% CO2 atmosphere at 37 ◦C. It was treated with trypsin/EDTA (0.25%)
in the course of growth and the subconfluent state reaching and passaged into new vessels
in the 1:2 ratio [21]. The studied DPSC cells are identified as the mesenchymal stem cells
[21]. The 4-5-passaged cells were used for studies.
The cells were plated for 24 h onto 96-well culture plates for cell viability assay at
a density of 25000-30000 cell/cm3 in DMEM/F12 (1:1) medium containing 5% (v/v) of
fetal bovine serum.
The genotoxic activity of the complexes was studied by the DNA-comet assay.
The method is based on the registration of different mobility DNA fragments in constant

9
electric field using agarose gel. The fragments of damaged DNA migrate towards the
anode forming comet tail-like trace with the parameters depending on the DNA damage
degree. The analysis of the DNA damage in cells was carried out using the alkaline
version of the comet assay [22]. The microscopic slides were made of two layers of 1%
agarose gel (Sigma, type II, USA). The cell suspension (cell concentration was
determined in the Goryaev chamber and equals to 1.106 cell/cm3) was introduced into
low-melting agarose gel (Sigma, type VIIa) prepared in the phosphate-buffered saline
(PBS) solution at 37 C. After hardening the lysis procedure was performed for 60 min at
4 C in lysis buffer (10 mM Tris-HCl (pH 10), 2.5 M NaCl, 100 mM EDTA-Na, 1%
Triton-X-100). Then the samples were subjected to alkaline denaturation (20 min, 4 C;
0.3 М NaOH, 1мМ EDTA-Na, рН 13) which had a result of the DNA alkali labile sites
transformation into single-strand breaks. The horizontal electrophoresis was performed
for 20 min under thin layer (2-3 mm) of the same buffer at an electric field density of 1
V/cm. The prepared slides were washed twice with distilled water, stained with ethidium
bromide for 1 h in the darkness at 4 C and finally washed in distilled water (2-3 times).
The samples were studied using Axiovert-200 fluorescent microscope, DNA-comet
parameters being analyzed on the saved digital images by the Open Comet software [23].
The mRNA levels of 18 gene markers for apoptosis and necrosis (Table 1) were
measured in cell culture using real-time PCR [24]. The analyzed genes taken from the
database [25] were used for PCR profiling of various biological processes.
Gene transcription levels were normalized to the mean level of transcription of the
house-keeping genes (beta-actin, ribosomal protein, large, P0 (rplp0) and glyceraldehyde-
3-phosphate dehydrogenase (GAPGH)).
Gene-specific primers were designed using the program Primer Express 3
(Applied Biosystems, USA) (the primers list and their sequence is shown in the Table 1).
“Isolation of full-length poly (A) mRNA on magnetic particles” (Silecs, Moscow)
kit was used for mRNA isolation. This mRNA was subsequently used for the cDNA
synthesis with the kit “First-strand cDNA synthesis oligo(dT)15”, Eurogen, Russia. The
cDNA was used as a template for the real-time PCR; cDNA was amplified using the kit
(Eurogen) with SyberGreen and the real-time PCR was performed on the PCR machine
BioRad CFX96.

10
 Cycling conditions: initial 950C, 5 min; 40 cycles 950C -30 s - 600C-40 s; final
step (dissociation) 950C-15s, 600C-1 min, 950C- 15s. The specificity of the PCR was
analyzed by agarose gel electrophoresis (on 2% agarose), as well as by analysis of the
amplicon melting curves.

2.4. Computational studies

Quantum-chemical calculations were performed with the Priroda package [26] in
the framework of the Density Functional Theory (DFT) (PBE exchange-correlation
functional) [27]. The orbital basis sets (TZ) used have the following contraction schemes:
(5s1p)/[3s1p] for H, (11s6p2d)/[6s3p2d] for C, N and O, (15s11p2d)/[10s6p2d] for Cl,
(17s13p8d)/[12s9p4d] for Zn, (18s14p9d)/[13s10p5d] for Br, (20s16p11d)/[14s11p7d] for
Cd, and (21s17p12d)/[15s12p8d] for I. Geometry optimization was started from the
single crystal X-ray experimental atomic positions and was performed without
restrictions on the molecular symmetry. Vibrational harmonic frequency analysis of the
optimized geometries was utilized to ensure that it is true local minimum having no
imaginary frequencies.

11
Table 1. A list of genes which expressions have been studied in the present work and the primers' sequences.
Entry Gene function Abbreviation Gene title NCBI Reference Sequence F Primer R Primer

1. Anti-Apoptotic BCL2 B-cell CLL/lymphoma 2 NM_000633.2 CTGGGATGCCTTTGTGGAACT AGACAGCCAGGAGAAATCAAACAG

2. Anti-Apoptotic BIRC3 aculoviral IAP repeat containing 3 NM_001165.4 GGACAGGAGTTCATCCGTCAAG TCTCCTGGGCTGTCTGATGTG

3. Anti-Apoptotic MCL1 myeloid cell leukemia 1 NM_021960.4 CACGAGACGGCCTTCCAA CACTCGAGACAACGATTTCACATC

4. Anti-Apoptotic TRAF2 TNF receptor-associated factor 2 NM_021138.3 GGCCGTCTGTCCCAGTGAT TTCGTGGCAGCTCTCGTATTC

5 .Autophagy ATG3 autophagy related 3 NM_022488.4 CCATTGAAAATCACCCTCATCTG CACCTCAGCATGCCTGCAT

6. Autophagy ATG12 autophagy related 12 NM_004707.3 CCCGGGAACAGAGGAACCT GGAGTGTCTCCCACAGCCTTT

7. Autophagy NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 NM_003998.3 GGCTACACCGAAGCAATTGAAG CAGCGAGTGGGCCTGAGA

8. Autophagy RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 NM_003161.3 TGGCATAGAGCAGATGGATGTG AGAGTTCGGCTGTCGTATTGGA

9. Necrosis: CCDC103 coiled-coil domain containing 103 NM_213607.2 GCTGCAAGGGCTTGTTTCAG GCCCCTCCTTCACGGATCT

10. Necrosis: FOXI1 forkhead box I1 NM_012188.4 CGCCTCACTCTCAGCCAGAT CCGGCCTTGCTCTTGTTGTA

11. Necrosis: JPH3 junctophilin 3 NM_020655.3 CCAGGATCACTGCCAAAGAGTT CGCTTCGGCCTCTGGTACT

12. Necrosis: RAB25 RAB25, member RAS oncogene family NM_020387.2 TGTCTTCAAGGTGGTGCTGATC CGCGTGAATCGGGAGAGTAG

13. Pro-Apoptotic BAX BCL2-associated X protein NM_004324.3 GTGGCAGCTGACATGTTTTCTG GCAAAGTAGAAAAGGGCGACAA

14. Pro-Apoptotic CD40 CD40 molecule, TNF receptor superfamily member 5 NM_001250.4 ACACTGCCACCAGCACAAATACT CTGTTTCTGAGGTGCCCTTCTG

15. Pro-Apoptotic CFLAR CASP8 and FADD-like apoptosis regulator NM_003879.5 GTGTGTATGGTGTGGATCAGACTCA GGCATGAATCTCCCATGAACA

16. Pro-Apoptotic FAS Fas cell surface death receptor NM_000043.4 GAATCATCAAGGAATGCACACTCA AAAGCCACCCCAAGTTAGATCTG

17. Pro-Apoptotic TNFRSF1 umor necrosis factor receptor superfamily, member 10a NM_003844.3 CTGGCGCTTGGGTCTCCTA TGCGTTGCTCAGAATCTCGTT

18. House-keeping GAPDH glyceraldehyde-3-phosphate dehydrogenase NM_002046.5 GTGGAAGGACTCATGACCACAGT GCCATCACGCCACAGTTTC

19. House-keeping RPLP0 ribosomal protein, large, P0 NM_001002.3 ATGCAGCAGATCCGCATGT TTGCGCATCATGGTGTTCTT

20. House-keeping Actin beta-actin XM_006715764.1 TCGTGCGTGACATTAAGGAGAA AGCAGCCGTGGCCATCT

12
3. Results and discussion
3.1. Synthesis and single crystal preparation
Complexes (1,2, I-IV) were prepared in aqueous solutions from antipyrine or
caffeine and the respective metal(II) halide taken in the 2:1 (compound 1), 2.6-2.7:1
(compound 2) molar ratio [3]. These ratios equal to (1-3):1 for I-IV, respectively. The
single crystals were obtained after slow evaporation of water from saturated aqueous
solutions at room temperature. Results of chemical analyses are in good agreement with
those of the calculated ones (see Experimental).
3.2. Compounds identification
The compounds are found to be pure ones without presence of reagents and other
impurities (Figs. 1-3). The compounds phase purity was confirmed as follows: the
patterns calculated from the single-crystal structures are in good agreement with the
observed ones (Figs. 2, 3a) confirming that the pXRD data are compatible with the single
crystal XRD ones and the single-crystal structures are really representative of the bulk of
the corresponding samples. The additional peak at 2 = ca. 8-10º (Fig. 2b, curve 1) is
possibly related with the partial water loss during the sample keeping under air and
subsequent non-significant change in the diffraction pattern. This suggestion is confirmed
by the absence of the mentioned peak in the diffraction pattern of the sample wetted by a
mother liquor. This phenomenon is reversible. Further changes with time in the
diffraction diagram for the "dry" sample were not observed.
The respective caffeine complex of zinc chloride [Zn(H2O)(caf)Cl2] (IV) was
prepared as described in [28] with the aim of comparison (Figs. 3a, 4b), but it turned out
that its composition and structure ([Zn(caf)(H2O)Cl2] vs. [Zn(H2O)6][Zn(caf)Cl3]2∙2H2O
[28]) were different from those given in [28].

13
Fig. 1. pXRD diagrams for cadmium iodide (1), caffeine (2), wet
{[Cd(H2O)2I2]∙(caf)∙2H2O}n (3).

14
a)

b)
Fig. 2. a) comparison of experimental (1) and theoretical (2) diagrams for
{[Cd(H2O)2Br2]∙(caf)∙2H2O}n (III):b) pXRD diagrams for {[Cd(H2O)2I2]∙(caf)∙2H2O}n
(II):dry (1), wet (2), theoretical (3).

15
a)

b)
Fig. 3. a) [Zn(caf)(H2O)Cl2)] (IV): theoretical (1) and powder XRD (2) diagrams; b)
comparison of powder XRD diagrams for ZnI2 (1), [Zn(caf)(H2O)I2)] (I) (2), and caffeine
(3).

16
a)

b)
Fig. 4. a) Structure of compound (I); (b) structure of compound (IV).

17
 3.3. Results of crystal structure determination
The diiodo(aqua)(caffeine)zinc(II) (I) is a molecular compound and is
characterized by a monoclinic unit cell, sp. gr. P21/n (Z = 4) (Tables 2 and 3, Fig. 4a).
Coordination polyhedron is slightly distorted tetrahedron, the Zn–O and Zn–N bond
lengths are 2.03(1) and 2.05(1) Å, and the Zn–I ones equal to 2.5579(3) and 2.5539(3) Å,
respectively. These values are in accordance with the calculated ones 2.219 (Zn-O), 2.101
(Zn-N), 2.552 and 2.592 Å (Zn–I) (Table 4, entry 6) and literature data (the Zn–O and
Zn–I bond distances equal to 2.07(1)-2.11(1) (Zn–O) [28, 29] and 2.592(6)-2.635(4) Å
[29], 2.5560(8)-2.5662(9) (Zn–I) [3]. The packing structure consists of nearly parallel
(deviation from the ideal case is near 16) and slightly displaced planes of coordinated
caffeine molecules linked to coordinated water molecules of neighboring complex
species due to H-bonding.
The dichloro(aqua)(caffeine)zinc(II) (IV), similar to the
diiodo(aqua)(caffeine)zinc(II) (I), is a molecular compound (monoclinic unit cell, sp. gr.
P21/n (Z = 4), (Tables 2 and 5, Fig. 4b). Coordination polyhedron is slightly distorted
tetrahedron, the Zn–O and Zn–N bond lengths are 2.0243(9) and 2.07(1) Å, and the Zn–
Cl ones equal to 2.2320(4) and 2.2059(4) Å respectively. The Zn–O and Zn–Cl bond
lengths are slightly shorter (2.07(1) to 2.11(1) Å and 2.2435(6), 2.2497(7) and 2.2707(7)
Å, respectively) than reported in [28] and are in accordance with the calculated ones
(Table 4, entries 1, 3).
Compounds (II) and (III) (Tables 6-8, Figs. 5, 6) are formed of infinite Cd-
containing chains built from octahedral units with bridging halide ions and water
molecules in trans-position and connected with each other due to hydrogen bonding with
participation of caffeine and water molecules (Figs. 5, 6). Parallel caffeine molecules are
additionally linked by - interaction (the shortest distances between the 5- and 6-
membered ring centers equal to 3.602 and 3.569 Å for II and III, respectively). Selected
bond lengths and angles are listed in Tables 7 and 8. Different nature of water molecules
in (II) is confirmed by the results of thermal analysis ("double" melting at 200-210º C
with the subsequent caffeine sublimation at 265 and 280 C for the "wet" and "dry"
samples and cadmium iodide melting at 390 C, Fig. 7) and pXRD data (Fig. 2b, curves
1 and 2). As to [Zn(caf)(H2O)Cl2] (IV) (Fig. 8), its thermal behavior is characterized by

18
melting at 160-165 C with simultaneous water removal (weight decrease is ca. 5.5%)
and is consistent with the compound molecular structure (Fig. 4b).The water molecules
removal is confirmed by mass-spectra studies.
The signals at 7.74, 7.69, 7.79, and 7.77 ppm in the 1H NMR spectra of
compounds I-IV, respectively, (in comparison with 7.59 ppm for pure caffeine) are
assigned to proton of CH (A) group due to coordination of a ligand via nitrogen atom in
(I), (IV) or due to hydrogen bonding formation with participation of coordinated and
non-coordinated water molecules in (II) and (III) ((Appendix C, Supplementary Fig.
S1-S6, Scheme S1).
ESI-MS spectrometry data additionally confirm the stoichiometry of compounds
(Appendix C. Supplementary. Figs. S7-S10). The spectrum of complex
[Zn(C8H10N4O2)(H2O)I2] (I) (Fig. S7) shows the presence of low intensity molecular
peak at m/z = 531 ([Zn(C8H11N4O2)(H2O)I2]) and the peak at m/z = 446.55 due to
formation of significantly more complex species {[Zn(C8H10N4O2)(H2O)I2]3–2I––2H+}.
The peak at m/z = 579.00 is assigned to {[Zn(C8H10N4O2)(H2O)I2]Na2H2}+. Other peaks,
including cafH+ (m/z = 195.05), are also present at lower m/z values.
For compound {[Cd(H2O)2I2](caf).2H2O}n (II) (Fig. S8) the peaks at m/z 504.95,
384.95, 368.95 are assigned to {{[Cd(H2O)2(μ-I)2](C8H10N4O2).2H2O}–I}+,
{{[Cd(H2O)2(μ-I)2](C8H10N4O2).2H2O}–2I–H2O+Na}+ and {{[Cd(H2O)2(μ-
I)2](C8H10N4O2).2H2O}–2I–H2O+Na–OH}+, respectively. Other peaks with lower m/z
values including cafH+ (m/z = 195.07), are also present.
We have also studied by the sectioning method (unpublished data) the CdI2-
C8H10N4O2–H2O ternary system at 25º C. It was found that the crystallization field of the
ternary phase occupies significant area of the diagram (Е1: CdI2 (48.0 wt%); caf (4.5
wt%); H2O (47.5 wt%); E2: CdI2 (2.5 wt%); caf (15.0 wt%); H2O (82.5 wt%)).and
corresponds to formation of the {[Cd(H2O)2(μ-I)2](C8H10N4O2).2H2O}n. (II) single
congruent compound. 1H NMR spectrum (CD3CN) of the saturated aqueous solution
containing CdI2 (43.1 wt.%) and C8H10N2 (0.9 wt.%) demonstrates the signal at 7.97
ppm (s, CH A) and confirms the complex formation.

19
 For compound {[Cd(H2O)2Br2](caf).2H2O}n (III) (Fig. S9) the peaks at m/z
195.10, 306.60, 386.97, 422.47, 581.00 are assigned to cafH+, [Cd(C8H10N4O2)]+,
[Cd(C8H10N4O2)Br]+, {{[Cd(H2O)2(μ-Br)2](C8H10N4O2).2H2O}–Br–H2O}+,
{[Cd(H2O)2(μ-Br)2](C8H10N4O2).2H2O}(H2O)2NaH}+, respectively. The peak at 352.83 is
assigned to CdBr3–.
For compound [Zn(C8H10N4O2)(H2O)Cl2] (IV) (Fig. S10) the peaks m/z 195.16,
298.18, 323.22, 343.7, 365.15, 420,24, 451.20, 487.18 are assigned to cafH+ ,
{[Zn(C8H10N4O2)(H2O)Cl2]-H2O-Cl+3H}+, [Zn(C8H10N4O2)(H2O)Cl2]–Cl–
H2O+2Na+3H]+, {{[Zn(C8H10N4O2)(H2O)Cl2]3–2Cl–3H}/3}+, [Zn(C8H10N4O2)Cl3]+,
{[Zn(C8H10N4O2)(H2O)Cl2]+3Na+3H}+, {[Zn(C8H10N4O2)(H2O)Cl2]+3Na+Cl–H}+,
{[Zn(C8H10N4O2)(H2O)Cl2]+3Na+2Cl–H}+, respectively. In the negative mode the peaks
at 170.95, 306.85, 364.78, and 442.63 are assigned to ZnCl3–,
{{[Zn(C8H10N4O2)(H2O)Cl2]3–3H2O–2Cl–H}/3}–, [Zn(C8H10N4O2)Cl3–H]–,
{{[Zn(C8H10N4O2)(H2O)Cl2]+3Na+Cl-H}2–H2O}/2}–, respectively.
In all the cases the ESI-MS spectra confirm the stoichiometry of the studied
compounds and the complex species presence in the liquid phase.

20
Table 2. Crystal data and structure refinement for compounds (I) and (IV).

[Zn(C8H10N4O2)(H2O)Cl2]
Compound [Zn(C8H10N4O2)(H2O)I2] (I)
(IV)
Empirical Formula C8H12I2N4O3Zn C8H12Cl2N4O3Zn
Formula weight 531.39 348.49
Radiation, Т, К Mo Kα (λ = 0.71073), 150 K
Crystal system, Sp. gr., Z Monoclinic, P21/n, 4 Monoclinic, P21/n, 4
9.1725(6), 13.7050(8), 7.4087(2), 11.3558(3),
а, b, c, Å
12.1383(7) 15.1700(4)
90.00, 110.9580(10), 90.00; 90.00, 91.80, 90.00,
α, β, γ, °; V, Å3
1424.95(15) 1275.65(6)
0.34 x 0.26 x 0.12 0.38 x 0.20 x 0.17
Crystal size, mm3
Colourless plates Colourless plates
2Θ range for data collection,  4.66 – 61.3 2.24 –20
-13 ≤ h ≤ 13; -19 ≤ k ≤ 19; - -10 ≤ h ≤ 10; -15 ≤ k ≤ 15;
Index ranges
17 ≤ l ≤ 17 -21 ≤ l ≤ 21
Reflections collected
17096/4395 3717/3323
/Independent reflections
Data/restraints/parameters 4395/0/174 14747/0/167
μ, mm-1; ρ, g∙cm-3 6.062; 2.477 2.349, 1.815
GOOF 1.063 1.051
0.0208/0.0506;
R1/wR2 [I≥2σ(I)]; R1/wR2 0.0217/0.0553; 0.0256/0.0567
0.0236/0.0517
Largest diff. peak/hole/ e Å-3 1.35/-0.62 0.47/-0.27
Flack parameter - -

21
Table 3. Selected bond distances (Å) and angles () for (I).
Bond lengths

Zn(1) –I(1) 2.5579(3) N(1)–C(5) 1.370(3) N(3)–C(7) 1.478(3)

Zn(1) –I(2) 2.5539(3) N(2)–C(1) 1.331(3) N(4)–C(4) 1.377(3)

Zn(1)–O(3) 2.03(1) N(2)–C(2) 1.384(3) N(4)–C(5) 1.376(2)

Zn(1)–N(1) 2.05(1) N(2)–C(6) 1.465(3) N(4)–C(8) 1.461(3)

O(1)–C(3) 1.227(3) N(3)–C(3) 1.402(3) C(2)–C(3) 1.428(3)

O(2)–C(4) 1.225(3) N(3)–C(4) 1.398(3) C(2)–C(5) 1.373(3)

N(1)–C(1) 1.351(3)
Bond angles

I(2)–Zn(1)–I(1) 113.36(1) C(5)–N(4)–C(4) 118.9(1)

O(3)–Zn(1)–I(1) 113.44(5) C(5)–N(4)–C(8) 122.9(1)

O(3)–Zn(1)–I(2) 104.76(5) N(2)–C(1)–N(1) 112.6(1)

O(3)–Zn(1)–N(1) 98.38(7) N(2)–C(2)–C(3) 130.9(1)

N(1)–Zn(1)–I(1) 114.45(5) C(5)–C(2)–N(2) 106.0(1)

N(1)–Zn(1)–I(2) 111.12(5) C(5)–C(2)–C(3) 123.1(1)

C(1)–N(1)–Zn(1) 117.2(1) O(1)–C(3)–N(3) 121.2(2)

C(1)–N(1)–C(5) 104.3(1) O(1)–C(3)–C(2) 127.3(2)

C(5)–N(1)–Zn(1) 138.5(1) N(3)–C(3)–C(2) 111.5(1)

C(1)–N(2)–C(2) 106.8(1) O(2)–C(4)–N(3) 120.6(2)

C(1)–N(2)–C(6) 125.7(1) O(2)–C(4)–N(4) 121.7(1)

C(2)–N(2)–C(6) 127.5(1) N(4)–C(4)–N(3) 117.7(1)

C(3)–N(3)–C(7) 118.3(1) N(1)–C(5)–N(4) 127.8(1)

C(4)–N(3)–C(3) 126.6(1) N(1)–C(5)–C(2) 110.3(1)

C(4)–N(3)–C(7) 115.0(1) C(2)–C(5)–N(4) 121.9(1)

C(4)–N(4)–C(8) 117.8(1)

22
Table 4. Experimental and calculated М-O и M-Hal bond lengths
for a number of complexes.

Bond length (Å)

compound
Entry Single crystal XRD DFT/PBE/TZ
M-O M-Hal M-N M-O M-Hal M-N
1 2 3 4 5 6 7
2.206
2.204
1 [Zn(caf)(H2O)Cl2] (IV) 2.024 2.232 2.068 2.212 2.089
2.240

1.982 2.215 2.077 2.232,

2 [Zn(AP)2Cl2] [3] – –
1.997 2.228 2.082 2.237
2.089 2.180
2.117 2.193
[Zn(H2O)6][Zn(caf)Cl3]2∙2H2O 2.068 2.244
2.050 2.118 2.237
3 [28] 2.083 2.250 2.274
2.167 2.334
2.110 2.271
2.180 2.376
2.289 2.467
2.346
4 [Zn(caf)(H2O)Br2] – – – 2.216 2.094
2.382
1.973 – 2.068 2.362,
5 [Zn(AP)2Br2] [3, 30] 2.361 –
1.974 2.101 2.392
2.554 2.552
6 [Zn(caf)(H2O)I2] (I) 2.028 2.053 2.219 2.101
2.558 2.592
n=1 n=1
7 {[Cd(H2O)2(μ-Cl)2](C8H10N4O2)∙2H2O}n – – – 2.328 2.387 –
2.524 2.457
2.694
2.705
2.333
2.727
{[Cd(H2O)2(μ-Br)2](C8H10N4O2)∙2H2O}n 2.361 n=1 n=1
2.736
8 2.362 – 2.332 2.521 –
(III) 2.737
2.367 2.528 2.585
2.742
2.770
2.781
n=1 n=1
2.977 2.322 2.762
{[Cd(H2O)2(μ-I)2](C8H10N4O2)∙2H2O}n 2.332 2.929 2.573 2.725
9 2.343 2.918 – –
(II)
2.988 n=2 n=2
2.287 2.843 b
2.296 2.974 b
23
 2.811 t
2.825 t
2.773 t
2.348,
2.338
2.266 2.846,
2.7567 2.345,
2.266 2.868,
10 [Cd(AP)6][Cd(AP)I3]2 [3] 2.7473 – 2.335, –
2.253 2.831
2.7538 2.333,
2.361
2.358,
2.367
2.333,
2.256 2.336,
2.262 2.576 2.338, 2.644,
11 [Cd(AP)6][Cd(AP)Br3]2 [3] 2.268 2.566 – 2.343 2.638, –
2.381 2.561 2.359, 2.649
2.367,
2.370,

24
Table 5. Selected bond distances (Å) and angles () for (IV).
Bond lengths

Zn(1)– Cl(1) 2.2320(4) N(1)–C(5) 1.37(1) N(3)–C(7) 1.47(1)

Zn(1) – Cl(2) 2.2059(4) N(2)–C(1) 1.33(1) N(4)–C(4) 1.38(1)

Zn(1) – O(3) 2.0243(9) N(2)–C(2) 1.38(1) N(4)–C(5) 1.37(1)

Zn(1) – N(1) 2.07(1) N(2)–C(6) 1.47(1) N(4)–C(8) 1.47(1)

O(1) – C(3) 1.23(1) N(3)–C(3) 1.40(1) C(2)–C(3) 1.43(1)

O(2) – C(4) 1.23(1) N(3)–C(4) 1.39(1) C(2)–C(5) 1.37(1)

N(1)–C(1) 1.35(1)
Bond angles

Cl(2)–Zn(1)–Cl(1) 117.54(1) C(1)–N(1)–Zn(1) 113.48(8)

O(3)–Zn(1)–Cl(1) 107.28(3) O(1)–C(3)–N(3) 120.9(1)

O(3)–Zn(1)–Cl(2) 106.09(3) O(1)–C(3)–C(2) 127.2(1)

O(3)–Zn(1)–N(1) 98.17(4) O(2)–C(4)–N(3) 120.8(1)

N(1)–Zn(1)–Cl(1) 102.66(3) O(2)–C(4)–N(4) 121.1(1)

N(1)–Zn(1)–Cl(2) 122.68(3)

25
Table 6. Crystal data and structure refinement for compounds (II) and (III).
{[Cd(H2O)2(μ-I)2](C8H10N4O2).2H2O}n {[Cd(H2O)2(μ-Br)2](C8H10N4O2).2H2O}n
Compound
(II) (III)
Empirical Formula C8H18CdI2N4O6 C8H16Br2CdN4O5
Formula weight 632.46 520.47
Radiation, Т, К Mo Kα (λ = 0.71073), 150 K
Crystal system, Sp. gr., Z Monoclinic, P21, 2 Monoclinic, P21, 4
7.7865(6), 24.3428(18), 8.7423(7)
а, b, c, Å 4,2598(4), 26,780(3), 7.7944(7)

90.00, 104.1510(10), 90.00; 90.00,108.7870(10), 90.00,

α, β, γ, °; V, Å3
862.17(14) 1568.8(2)
0.42 x 0.08 x 0.06 0.38 x 0.12 x 0.1
Crystal size, mm3
Colorless needle Colorless block
2Θ range for data collection,  2.69 - 29.00 2.46 - 28.99
-5 ≤ h ≤ 5; -34 ≤ k ≤ 36; -10 ≤ h ≤ 10; -33 ≤ k ≤ 33 ;
Index ranges
-10 ≤ l ≤ 10 - 11 ≤ l ≤ 11
Reflections collected
8614/4301 17118/8168
/Independent reflections
Data/restraints/parameters 4301/5/199 8168/1/374
μ, mm-1; ρ, g∙cm-3 4.875; 2.436 6.508; 2.204
GOOF 1.101 1.048
R1/wR2 [I≥2σ(I)]; R1/wR2 0.0281/0.0657; 0.0294/0.0663 0.0409/0.1112; 0.0497/0.1154
Largest diff. peak/hole/ e Å-3 1.32/-0.78 1.131/-0.757
Flack parameter 0.0(17) 0.0(10)

26
Table 7. Selected bond distances (Å) and angles () for (II).
Bond lengths

Cd(1) –I(1) 2.99(1) N(1)–C(2) 1.355(5) N(4)–C(3) 1.381(9)

Cd(1) –I(1) 2.93(1) N(1)–C(6) 1.427(7) N(4)–C(4) 1.42(1)

Cd(1)–I(2) 2.92(1) N(2)–C(1) 1.524(8) N(4)–C(7) 1.45(1).

Cd(1)–I(2) 2.98(1) N(2)–C(5) 1.26(1) C(2)–C(3) 1.35(1)

Cd(1)–O(3) 2.343(7) N(3)–C(4) 1.37(1) C(2)–C(5) 1.43(1)

Cd(1)–O(4) 2.332(6) N(3)–C(5) 1.38(1) C(3)–O(1) 1.33(1)

N(1)–C(1) 1.483(8) N(3)–C(8) 1.48(1) C(4)–O(2) 1.218(6)

Bond angles

I(1)–Cd(1)–I(1) 92.08(3) O(3)–Cd(1)–I(2) 93.5(1)

I(1)–Cd(1)–I(2) 87.70(2) O(4)–Cd(1)–I(1) 93.7(1)

I(2)–Cd(1)–I(1) 179.77(4) O(4)–Cd(1)–I(1) 90.5(1)

I(2)–Cd(1)–I(1) 179.78(4) O(4)–Cd(1)–I(2) 89.6(1)

I(2)–Cd(1)–I(1) 87.69(2) O(4)–Cd(1)–I(2) 86.3(1)

I(2)–Cd(1)–I(2) 92.53(3) O(4)–Cd(1)–O(3) 179.0(3)

O(3)–Cd(1)–I(1) 88.6(1) Cd(1)–I(1)–Cd(1) 92.08(3)

O(3)–Cd(1)–I(1) 86.5(1) Cd(1)–I(2)–Cd(1) 92.53(3)

O(3)–Cd(1)–I(2) 91.4(1)

27
Table 8. Selected bond distances (Å) and angles () for (III).
Bond lengths

Cd(1) –Br(1) 2.77(1) Cd(2)–Br(3) 2.73(1)

Cd(1) –Br(2) 2.70(1) Cd(2)–Br(4) 2.74(1)

Cd(1)–Br(3) 2.69(1) Cd(2)–O(3W) 2.333(5)

Cd(1)–Br(4) 2.78(1) Cd(2)–O(4W) 2.367(5)

Cd(1)–O(1W) 2.361(5) O(1)–C(3) 1.28(1)

Cd(1)–O(2W) 2.362(5) O(2)–C(4) 1.236(6)

Cd(2)–Br(1) 2.74(1) O(2A)–C(4A) 1.240(7)

Cd(2)–Br(2) 2.74(1) O(1A)–C(3A) 1.24(1)

Bond angles

Br(1)–Cd(1)–Br(4) 179.58(5) Br(3)–Cd(2)–Br(1) 91.90(4)

Br(2)–Cd(1)–Br(1) 88.07(4) Br(3)–Cd(2)–Br(2) 179.38(5)

Br(2)–Cd(1)–Br(4) 91.53(4) Br(3)–Cd(2)–Br(4) 88.31(3)

Br(3)–Cd(1)–Br(1) 92.33(4) Br(4)–Cd(2)–Br(2) 91.76(4)

Br(3)–Cd(1)–Br(2) 179.44(4) Cd(1)–Br(2)–Cd(2) 91.48(5)

Br(3)–Cd(1)–Br(4) 88.07(4) Cd(1)–Br(3)–Cd(2) 91.59(4)

O(1W)–Cd(1)–Br(1) 85.6(1) Cd(2)–Br(4)–Cd(1) 89.53(4)

O(1W)–Cd(1)–Br(2) 86.6(1) O(3W)–Cd(2)–Br(1) 86.4(1)

O(1W)–Cd(1)–Br(3) 93.0(1) O(3W)–Cd(2)–Br(2) 85.1(1)

O(1W)–Cd(1)–Br(4) 94.2(1) O(3W)–Cd(2)–Br(3) 94.3(1)

O(1W)–Cd(1)–O(2W) 178.7(3) O(3W)–Cd(2)–Br(4) 93.3(1)

O(2W)–Cd(1)–Br(1) 95.2(1) O(3W)–Cd(2)–O(4W) 177.7(3)

O(2W)–Cd(1)–Br(2) 92.3(1) O(4W)–Cd(2)–Br(1) 95.8(1)

O(2W)–Cd(1)–Br(3) 88.1(1) O(4W)–Cd(2)–Br(2) 94.4(1)

O(2W)–Cd(1)–Br(4) 85.0(1) O(4W)–Cd(2)–Br(3) 86.2(1)

28
Br(1)–Cd(2)–Br(2) 88.02(3) O(4W)–Cd(2)–Br(4) 84.5(1)

Br(1)–Cd(2)–Br(4) 179.62(4) Cd(2)–Br(1)–Cd(1) 90.22(4)

29
a)

b)
Fig. 5. a). Structure of compound (II); b) Packing structure for (II).

30
a)

b)
Fig. 6. a) Structure of compound (III); b) Packing structure for (III).

31
Fig. 7. Thermograms for {[Cd(H2O)2(µ-I)2](caf)∙2H2O}n.(II)
blue – as-prepared; green - after keeping in air and partial water removal; red – pure
caffeine.

Fig. 8. Thermal analysis data for [Zn(caf)(H2O)Cl2] (IV).

32
 3.4. Results of quantum-chemical calculations
As can be seen from Table 4, the calculated bond lengths (columns 5–7, entries 1,
3, 6, 8, 9) for complexes with caffeine, similar to antipyrine compounds (Table 4, entries
2, 5, 10, 11) [3] are comparable with the experimental ones, the former as a rule being
slightly above than the latter. Taking into account that the molecular geometry in the
vapour phase may be different from that in the solid state there is a reasonable agreement
between the calculated and experimental bond lengths.
For {[Cd(H2O)2(μ-I)2](C8H10N4O2).2H2O}n (n = 1 and n = 2, Table 4, entry 9)
the former is characterized by the longer bond lengths than the latter as a result of more
compact structure formation at higher n due to cooperative effects, mainly hydrogen
bonding and van der Waals interactions.
With the aim of determination of the complex compound formation preferability
we have calculated, from the thermodynamic point of view, the Gibbs free energy change
ΔG298 values for a number of model reactions (Fig. 9).

33
Fig. 9. Calculated Gibbs Free Energy change ΔG298 values for the reactions:
1. 3[Zn(H2O)2Cl2] + 2caf + 2H2O  [Zn(H2O)6][Zn(caf)Cl3]2∙2H2O,
2. ZnCl2 + caf + 2H2O  [Zn(caf)(H2O)Cl2]∙H2O,
3. [Zn(H2O)2Cl2] + caf  [Zn(caf)(H2O)Cl2]∙H2O,
4. ZnCl2 + caf + H2O  [Zn(caf)(H2O)Cl2],
5. ZnBr2 + caf + 2H2O  [Zn(caf)(H2O)Br2]∙H2O,
6. [Zn(H2O)2Br2] + caf  [Zn(caf)(H2O)Br2]∙H2O,
7. ZnBr2 + caf + H2O  [Zn(caf)(H2O)Br2],
8. ZnI2 + caf + 2H2O  [Zn(H2O)(caf)I2]∙H2O,
9. [Zn(H2O)2I2] + caf  [Zn(caf)(H2O)I2]∙H2O,
10. ZnI2 + caf + H2O  [Zn(caf)(H2O)I2],
11. CdCl2 + caf + 4H2O = {[Cd(H2O)2Cl2]∙caf ∙2H2O}
12. CdBr2 + caf + 4H2O = {[Cd(H2O)2Br2]∙caf ∙2H2O}
13. CdI2 + caf + 4H2O = {[Cd(H2O)2I2]∙caf ∙2H2O}
14. 2CdI2 + 2caf + 8H2O = {[Cd(H2O)2I2]∙caf ∙2H2O}2
(DFT/PBE/TZ; E0(caf) = –679.67 a.u., G298(caf) = 89.20 kcal/mol); (p) is for the reaction product.

34
 The Gibbs Free Energy change (ΔG298) values for reactions of complex formation
demonstrate (Fig. 9) the preferential formation of [Zn(caf)(H2O)X2].(H2O) molecular
complexes (Fig. 9, entries 2-10) in comparison with the [Zn(H2O)6][Zn(caf)Cl3]2∙2H2O
one (Fig. 9, entry 1) and are in good agreement with the experimental single crystal XRD
data (Table 2). Attempts to consider water molecules for the reaction
[Zn(H2O)2X2] + caf = [Zn(caf)(H2O)X2] ∙ (H2O) (X = Cl, Br, I)
gave the following ΔG298 values: –4.72, –3.76, –2.72 kcal/mol (Fig. 9, entries 3, 6, 9 for
X = Cl, Br, and I), demonstrating the same tendency in the ΔG298 change as for the
reactions
ZnX2 + caf + H2O = [Zn(caf)(H2O)X2]
(–9.53, –9.35, –3.82 kcal/mol, Fig. 9, entries 4, 7, 10), and
ZnX2 + caf + 2H2O = [Zn(caf)(H2O)X2] ∙ H2O
(–10.05, –9.70, –3.96 kcal/mol, Fig. 9, entries 2, 5, 8 respectively). The same tendency
has been found for [Zn(AP)2X2] [3].
As to cadmium complexes (Fig. 9, entries 11-14) the probability of their
formation decreases in the raw bromo–chloro––iodo compounds as it takes place for
cadmium complexes with antipyrine [3]. Formation of polymeric chains leads to higher
stability (Fig. 9, entry 14 vs. entry 13).

35
 3.5. Results of bioactivity studies
It has been found that caffeine and antipyrine at c < 1∙10–4 mol/L demonstrate no
plausible inhibitory action on culture of both stem cells and linear cells of cancer origin,
antipyrine showing cytotoxic effect on stem cells at higher concentrations
(5∙10–4 -1∙10–3 mol/L) (Supplementary B, Tables S1, S2). All the studied compounds
suppress cellular survivability of both cell types at 1∙10–4 - 1∙10–3 mol/L. Complex (II) of
cadmium iodide with caffeine has suppressive effect on cells up to 1∙10–3 mol/L (Tables
S1, S2, Figs. 10a, 10b). Complexes of zinc iodide with caffeine and cadmium iodide with
antipyrine ((3) and (2), respectively) demonstrate the lowest effect on cellular
survivability at c = 1∙10–7 - 1∙10–5 mol/L. At the same time compounds (II) and (IV) show
the highest suppressive effect (Tables S1, S2, Figs. 10a, 10 b). All the studied compounds
exhibit dose-dependent action on both cell lines. The results obtained are in accordance
with those described in [3] for antipyrine complexes of zinc(II)- and cadmium(II) iodides
with respect to the NCTC clone L929 cell viability. It has been demonstrated [3] that
cadmium-containing compounds are more toxic than the Zn-containing ones at 1∙10–5 and
1∙10–4 mol/L and at approximately the same degree of the complexed ligand deviation
from planarity (torsion angle ~ 18 in comparison with ~ 30 for pure antipyrine [31]).
The latter is important in the process of DNA metabolism disrupting and species binding
to DNA through a non-covalent interaction that requires at least partial planarity [32].

36
a)

b)
Fig. 10. a) Effect of different compounds on survivabilityof the DPSC line;
b) effect of different compounds on survivability of the MCF-7 cells.

37
a)

b)
Fig. 11. Results of DNA cometa assay for zinc- and cadmium iodide complexes with
antipyrine with respect to the DPSC line (a) and MCF-7 cell line (b).

38
a)

b)

39
c)

d)
Fig. 12. Results of DNA cometa assay for zinc- and cadmium complexes with caffeine
with respect to the DPSC line (a, b) and MCF-7 cell line (c, d).

40
Fig. 13. Results of cometa-test for CdI2 (left), control (middle) and
{[Cd(H2O)2I2] ∙caf∙2H2O}n (II) (right) at c = 1∙10-5 mol/L (MCF-7 cells).
Scale bar: 100 m.

41
 Cadmium complexes with antipyrine and caffeine at c = 1.10-4 mol/L demonstrate
the same DNA-damaging activity (DNA content in the comet tail is near 100%, Figs.
11-12, Supplementary B, Tables S3-S6). Similar behavior was found for
[Zn(caf)(H2O)Cl2] (Fig. 12 a), c)), while [Zn(AP)2I2] demonstrates higher level of DNA
damage with respect to MCF-7 cancer cells (69.55±14.69%) in comparison with the
DPSC ones (48.97±17.96%) at 1∙10-4 mol/L (Supplementary B, Tables S3, S4).
Cadmium compounds are more cyto- and genotoxic in comparison with the zinc ones at c
= 1∙10-5 mol/L (Figs. 10-13), cadmium iodide complex with antipyrine demonstrating
lower DNA damaging for DPSC cells (DNA content in the comet tail is 74.45±18.19%
and 52.58±20.81% for the cancer cells and DPSC ones) than cadmium iodide complex
with caffeine (DNA content in the comet tail is 90% and 66.47±13.62 for DPSC and
MCF-7 cells, respectively, Figs. 11-13, Supplementary B, Tables S3-S6). Zinc
complexes with antipyrine and caffeine have genotoxic effect on DPSC cell line
(25.15±13.45% ([Zn(AP)2I2]), 15.78±9.16% ([Zn(caf)(H2O)Cl2]), respectively), while
DNA damaging level was below 5% for cancer cells at c = 1∙10-5 mol/L (Supplementary
B, Tables S3-S6). Genotoxicity values of pure antipyrine and caffeine as well as
[Zn(caf)(H2O)I2] are near the control.
Increasing the transcription of the FOXI1, JPH3 и RAB25 necrosis markers has
been observed as a result of the MCF-7 cell line incubation with solutions of CdI2,
{[Cd(H2O)2(μ-I)2](caf).2H2O}n (II), [Cd(AP)6][Cd(AP)I3]2 (2), ZnI2, and [Zn(caf)(H2O)I2]
(I), it being the most pronounced for (II) (Table 9, Entries 11-13). At the same time
transcription activation for antiapoptopic (NOS2, BCL2, BIRC3, MCL1 and TRAF2) and
some proapoptopic (BAX, CD40, and TNFRSF10A) genes took place in cells incubated
with CdI2, complexes (II), (2) and (I) (Table 9, entries 1-5, and 14, 15, 18, respectively)
Changes in transcriptional activity of genes under study were not observed at all
in the case of zinc iodide complex with antipyrine – compound (1), while ZnCl2, complex
of zinc chloride with caffeine (IV), caffeine, and antipyrine caused expression change
only for a few genes (Fig. 14, Table 9).
Stem cells, similar to the MCF-7 ones, responded on the action of CdI2,
compounds (II), (2), ZnI2 and (I) by increasing the transcriptional activity of the necrotic-

42
and antiapoptopic genetic markers (Table 10) , but in contrast with the MCF-7 ones the
growth of transcriptional activity for the autophagy genetic markers (ATG3 и ATG12)
has been observed as well (Table 10, entries 6,7). Expression of the necrotic genes
increased to a greatest extent as a result of compound (II) action (Table 10, entries 11-
13). Action of antipyrine and compound (I) resulted to expression activation of nearly all
the studied genes. It should be underlined that caffeine also resulted to transcriptional
growth of the CCDC103, FOXI1, JPH3 and RAB25 necrotic- and FAS и TNFRSF10A
apoptopic genetic markers (Table 10, entries 10-13 and 17-18, respectively). Complexes
(1), (IV) and ZnCl2,caused transcription growth for a few genes (Fig. 14, Table 10).

MCF-7 DPSC
Fig. 14. Expression dynamics of the studied cell dying genetic markers for MCF-7 and
DPSC cells after incubation with free ligands, zinc- and cadmium containing compounds.
Data are given in colored binary logarithm scale. Green scale gradation reflects the gene
expression inhibition degree, while red scale gradation - the stimulation level with respect
to control.

43
Table 9. Dynamics of genes' expression level in MCF-7 cells (in comparison with control) after incubation with different compounds.
Gene
Entry Gene function CdI2 (II) (2) ZnI2 (I) (1) ZnCl2 (IV) Caffeine AP
Symbol
1 NOS2 Anti Apoptotic 10,9283 125,3658 9,5798 1,3287 170,0718 1,9588 3,5064 4,3169 5,2054 5,0281
2 BCL2 Anti Apoptotic 1,4743 4,4691 1,5911 0,6285 4 1,2058 1,0718 1,815 1,2058 1,2746
3 BIRC3 Anti Apoptotic 2,5669 2,1735 2,3784 1,3472 1,8025 1,2226 1,1251 0,79 1,7901 0,7526
4 MCL1 Anti Apoptotic 2,5847 2,1735 1,057 0,8011 0,933 0,8066 0,895 0,6878 1,0425 0,6736
5 TRAF2 Anti Apoptotic 2,8481 4,9246 2,4116 0,79 2,1435 1,4241 1,8277 2,7321 1,5583 2,2501
6 ATG3 Autophagy 0,6878 0,8409 1,2226 0,669 1,4044 1,1251 0,6071 0,5586 0,7684 0,5548
7 ATG12 Autophagy 0,9862 1,007 1,3755 0,712 1,1096 1,1487 0,712 0,5824 0,933 0,5905
8 NFKB1 Autophagy 1,0497 1,0943 1,3851 0,8467 1,4142 0,895 0,9526 0,8827 0,9931 0,7684
9 RPS6KB1 Autophagy 0,8179 0,9013 1,014 0,5987 1,5911 1,057 0,5864 0,6598 0,8467 0,507
10 CCDC103 Necrosis: 2,042 1,6245 1,7654 0,9794 1,7777 1,2142 1,1408 1,5263 1,0497 1,1567
11 FOXI1 Necrosis: 8,515 439,5855 19,0273 2,7511 634,7303 1,3755 2,4623 8,0556 13,737 15,0324
12 JPH3 Necrosis: 8,515 439,5855 3,7064 0,4383 5,8971 0,727 0,7846 1,3287 1,1329 1,021
13 RAB25 Necrosis: 2,8481 112,2055 4,7568 0,3078 67,1819 0,8586 1,057 2,6574 2,2346 3,7842
14 BAX Pro apoptotic 1,8025 3,2266 2,4284 1,0867 2,114 1,7291 1,7053 2,0279 1,4439 1,7901
15 CD40 Pro apoptotic 1,5369 1,7171 2,395 0,8526 1,4044 1,2311 1,5911 1,7901 1,2397 1,7171
16 CFLAR Pro apoptotic 1,0792 1,1975 1,2924 0,6598 2,0562 0,8293 0,7684 0,9794 1,1647 0,8236
17 FAS Pro apoptotic 0,717 0,8011 0,7631 0,6736 0,7022 0,8236 0,6199 0,4897 0,7423 0,4414
18 TNFRSF10A Pro apoptotic 3,1821 2,1735 1,6702 0,7579 1,7053 0,8236 0,9202 1,3379 0,8236 1,1173
*
(red numbers: expression stimulation, p < 0.05; blue numbers: expression inhibition, - p < 0.05, black - no significant difference)

44
Table 10. Dynamics of genes' expression level in DPSC cells (in comparison with control) after incubation with different compounds.
Gene
Entry Gene function CdI2 (II) (2) ZnI2 (I) (1) ZnCl2 (IV) Caffeine AP
Symbol
1 NOS2 Anti Apoptotic 42,4751 277,9716 78,4788 12,3343 43,2988 5,3627 3,4845 2,6393 6,1151 16,1353
2 BCL2 Anti Apoptotic 1,5353 5,3472 1,5738 0,9491 0,8329 1,1042 1,3296 0,9396 1,4564 1,3123
3 BIRC3 Anti Apoptotic 0,65 0,8344 0,576 2,1061 15,9585 4,1496 1,2754 1,2925 1,3588 4,2344
4 MCL1 Anti Apoptotic 2,2169 2,5825 2,504 0,9425 8,8535 1,8442 0,8356 1,133 1,3217 1,696
5 TRAF2 Anti Apoptotic 1,4226 5,9331 3,4683 0,7094 4,7775 2,5367 1,8416 1,0141 1,3874 1,6727
6 ATG3 Autophagy 1,4728 2,0122 3,0193 2,958 4,0174 1,4469 1,4549 1,1893 2,6251 3,8964
7 ATG12 Autophagy 1,7393 1,8645 3,7953 1,8083 2,7062 0,9814 1,2492 0,8012 2,5357 2,5353
8 NFKB1 Autophagy 0,7212 0,403 1,1362 2,1355 4,0174 2,1931 1,0504 0,8951 1,5077 2,2379
9 RPS6KB1 Autophagy 1,188 0,5429 2,504 1,4089 2,8804 1,295 1,1415 0,9527 2,0884 2,1919
10 CCDC103 Necrosis: 0,4318 1,3555 0,3023 1,4385 0,6719 0,9546 1,0146 0,7527 2,2228 1,233
11 FOXI1 Necrosis: 7,6664 137,0723 38,6992 6,5188 21,3513 1,7207 1,0504 1,5159 6,287 4,0338
12 JPH3 Necrosis: 16,3197 291,7914 82,3805 3,5667 45,4514 1,769 2,0719 0,8123 3,5366 6,1567
13 RAB25 Necrosis: 12,1978 96,9248 27,3645 4,5146 15,0977 1,9903 1,7912 1,7293 3,3458 5,9883
14 BAX Pro apoptotic 1,0487 1,2735 1,2178 1,5962 2,5959 1,016 0,8711 0,669 1,5288 2,0593
15 CD40 Pro apoptotic 0,6065 0,8519 0,4551 1,1604 0,9701 1,7207 0,9733 1,0869 1,2246 1,119
16 CFLAR Pro apoptotic 0,444 1,0202 0,9423 1,2097 3,0871 1,427 1,1574 1,1649 1,9621 2,382
17 FAS Pro apoptotic 0,3318 0,3033 0,5192 1,3799 2,094 2,148 1,386 1,1097 2,2074 2,003
18 TNFRSF10A Pro apoptotic 3,6516 10,6206 3,8483 1,771 5,8412 2,3668 1,4054 1,6247 2,3989 6,0719
*
(red numbers: expression stimulation, p < 0.05; blue numbers: expression inhibition, - p < 0.05, black - no significant difference)

45
 As a whole, cadmium complexes with caffeine and antipyrine cause cell death for
both cancer and stem cells. But on the basis of MTT test analysis it should be concluded
that complex (II) demonstrate more severe effect on cancer cells in terms of metabolism
at c = 1.10-5, 5.10-5, 1.10-4 mol/L (Fig. 10) . The same tendency can be found as well at
the level of gene expression: expression of FOXI and JPH3 necrotic gene markers is 3.2
and 1.5 times higher (p <0.01 and p < 0.05, respectively) for cancer cells treated with
complex (II) in comparison with the stem ones (Tables 9, 10, entries 11, 12).
It should be underlined that cadmium iodide complexes with antipyrine- (2) and
caffeine (II) have approximately the same effect on cell death for both stem and cancer
cells (Tables 9, 10), but the zinc iodide complex with caffeine (I) demonstrates stronger
action on cancer cells and higher level of death due to necrotic genes activation (Table 9),
while stem cells show lower level of necrotic genes activation at simultaneous activation
of other studied genes (pro- and antiapoptotic, autophagous ones), the latter being
characteristic for more homeostatic reactions (Table 10). At the same time the stem cells
in contrast to the cancer ones are under the influence of pure caffeine and antipyrine, but
synergistic effect is more pronounced for zinc- and cadmium complexes (1, 2, I and II)
(Table 10, entries 1, 11, 12, 13). On the other hand, activation of transcription of
necrotic gene markers by complex (II) is many times higher than by complex (2), and it
is greatly pronounced with respect to cancer cells in comparison with the stem ones
(Tables 9, 10, Entries 11-13). The same tendency is observed for the activation of
expression of the antiapoptotic gene marker NOS2 (Tables 9, 10, Entry 1), the
difference being more significant for cancer cells.
On the basis of results obtained it can be proposed that complex (II) at
concentrations lower than 1.10-5 mol/L possesses an ability to kill cancer cells to a greater
extent in comparison with stem cells but it is not observed in the course of cometa-test
because the reason of cancer cell death is necrosis while that of stem cells - apoptosis
[33].. The higher anticancer effect of polymeric compound (II) is possibly related to the
size of complex species: as it has been demonstrated [34, 35], HCPT-AuNPs conjugates
of 10-hydroxycamptothecin (HCPT) and gold nanoparticles (AuNPs) showed greater
cytotoxic effects on the MDA-MB-231 human breast cancer cell line compared with an
equal dose of free HCPT, and that HCPT-AuNPs of an average diameter of 50 nm

46
(HCPT-AuNPs-50) had the greatest effect versus different-sized HCPT-loaded AuNPs,
ranging from 10 to 50 nm. Possibly the supramolecular character [36, 37] of complex (II)
is the prevailing one compared with the compound (ligand) planarity or nonplanarity
degree (for example, {[Cd(H2O)2(μ-I)2](caf).2H2O}n (II) and [Cd(AP)6][Cd(AP)I3]2 (2))
and represents the main reason of its high activity. The latter is in accordance with the
results of cytotoxicity studies for [Nd(phen)3(OH)(H2O)(CH3OH)]2(I–)4I2 with respect
to NCTN L929 cells [38].
In conclusion, the studied compounds, primarily the cadmium iodide complex
with caffeine, are the promising ones for further additional investigations of their
anticancer activity and possible applicability as new chemotherapeutics. For example,
cytotoxicity of II (Supplementary B, Tables S1, S2) is more pronounced for cancer cells
and is higher than that of cadmium iodide and caffeine at c = 1.10-5–1.10-4 mol/L thus
demonstrating the synergistic effect. It should be underlined that the structure of the
compound and specific features of its stereochemistry should be taken into account in the
course of these studies [39].

47
4. Conclusions
The studied zinc- and cadmium-containing complexes with antipyrine and
caffeine demonstrate cyto-and genotoxocity and are the promising ones for further
investigations both in vitro and in vivo. Probably, the combination of ligands, metals and
anions will be useful in the process of optimal drug design, cadmium complexes with
caffeine being candidates for subsequent complementary studies. It should be stressed
that cytotoxicity is the result of a number of factors such as cell accumulation and
proceeding through DNA modification, cellular responses to the DNA damage etc. and it
is not a simple task to reveal all aspects of the mechanism underlying antitumor effects of
the studied complexes, so it is apparently incorrect to attribute cytotoxicity to their single
property. Further studies are therefore warranted to reveal a relative contribution of all
potential factors influencing the complex activity on various types of cancer cells.
Quantum-chemical calculations allow to predict the compound formation probability and
preferability and the respective structural specific features.

Aknowledgement

We thank the Federal State Unitary Enterprise “The State Scientific-Research

Institute of Chemical Reagents and High Purity Chemical Substances” National Research
Center “Kurchatov Institute” (IREA Shared Knowledge Center) for CHN and elemental
analysis and far-IR spectra recording.
We thank also the Shared Equipment Centre of the Kurnakov Institute of General
and Inorganic Chemistry of the Russian Academy of Sciences for the pXRD studies.

This research did not receive any specific grant from funding agencies in the
public, commercial, or not-for-profit sectors.

Appendix A. Supplementary data

CCDC 1530409, 1530408, 1530410, and 1530411 contain the supplementary
crystallographic data for I-IV, respectively. These data can be obtained free of charge via

48
http://www.ccdc.cam.ac.uk/conts/retrieving.html, or from the Cambridge
Crystallographic Data Centre, 12 Union Road, Cambridge CB2 1EZ, UK; fax: (+44)
1223-336-033; or e-mail: deposit@ccdc.cam.ac.uk. Supplementary data associated with
this article can be found, in the on-line version, at doi: _________________.

Appendix B. Supplementary Tables S1-S6.

Appendix C. Supplementary Figs. S1-S10, Scheme S1.

References

[1] L. Prashanth, K.K. Kattapagari, R.T. Chitturi, V.R.R. Baddam, L.K. Prasad, J. Dr.
NTR University of Health Sciences, 4 (2015) 75-85, https://doi.org/10.4103/2277-
8632.158577.
[2] L. Findoráková, K. Györyová, D. Hudecová, D. Mudroňová, J. Kovářová, K.
Homzová, F.A. Nour El-Dien, J. Therm. Anal. Calorim. 111 (2013) 1771-1781,
https://doi.org/10.1007/s10973-012-2275-9.
[3] N.S. Rukk, L.G. Kuzmina, D.V. Albov, R.S. Shamsiev, S.N. Mudretsova, G.A.
Davydova, V.M. Retivov, P.A. Volkov, V.V. Kravchenko, G.N. Apryshko, A.N.
Streletskii, A.Yu. Skryabina, E.A. Mironova, V.V. Zamalyutin, Polyhedron. 102 (2015)
152-162.
[4] P.F. Liguori, A. Valentini, M. Palma, A. Bellusci, S. Bernardini, M. Ghedini, M.L.
Panno, C. Pettinari, F. Marchetti, A. Crispini, D. Pucci, J. Chem. Soc., Dalton Trans. 39
(2010) 4205-4212.
[5] R. Mallela, R. Konakanchi, R. Guda, N. Munirathinam, D. Gandamalla, N. R. Yellu,
L.R. Kotha, Inorg. Chim. Acta. 469 (2018) 66-75.
[6] A.S. El-Tabl, M.M. Abd El-Waheed, M.A. Wahba, N.A. El-Halim A. El-Fadl,
Bioinorg. Chem. Appl. 2015, Article ID 126023, 14 pages,
https://doi.org/10.1155/2015/126023.
[7] Z. Asadi, M. Golchin, V. Eigner, M. Dusek, Z. Amirghofran, Inorg. Chim. Acta 465
(2017) 50-60.

49
[8] X. Zhou, Y. Koizumi, M. Zhang, M. Natsui, S. Koyota, M. Yamada, Y. Kondo, F.
Hamada, T. Sugiyama, Cancer Sci. (2015) 1-7, https://doi.org/10.1111/cas.12651.
[9] L.L. López Tévez, J.J. Martínez Medina, M.S. Islas, O.E. Piro, E.E. Castellano, L.
Bruzzone, E.G. Ferrer, P.A.M. Williams, J. Coord. Chem. 64 (2011) 3560-3574.
[10] L.P. Vartanyan, M.B. Kolesova, G.F. Gornaeva, Yu.I. Pustovalov, Psychopharmacol.
Biol. Narcology. 5 (2005) 1093-1095 (Russ.).
[11] M. Melnik, O. Sprusansky, P. Musil, Adv. Biol. Chem. 4 (2014) 274-280.
[12] K. Tomita, H. Tsuchiya, Jpn. J. Cancer Res. 80 (1989) 83-88.
[13] M. Andrs, D. Muthna, M. Rezacova, M. Seifrtova, P. Siman, J. Korabecny, O.
Benek, R. Dolezal, O. Soukup, D. Jun, K. Kuca, RSC Adv. 6 (2016) 32534-32539,
https://doi.org/10.1039/C5RA22889A
[14] A.S. Kubasov, E.Y. Matveev, V.M. Retivov, S.S. Akimov, G.A. Razgonyaeva, I.N.
Polyakova, N.A Votinova, K.Y. Zhizhin, N.T. Kuznetsov, Russ. Chem. Bull. Int. Ed. 63
(2014) 187-193.
[15] N.S. Rukk, D.V. Albov, R.S. Shamsiev, S.N. Mudretsova, G.A. Davydova, G.G.
Sadikov, A.S. Antsyshkina, V.V. Kravchenko, A.Yu. Skryabina, G.N. Apryshko, V.V.
Zamalyutin, E.A. Mironova, Polyhedron 44 (2012) 124-132.
[16] Bruker (2001). SAINT (Version 6.02a). Bruker AXS Inc., Madison, Wisconsin, USA.
[17] O.V. Dolomanov, L.J. Bourhis, R.J. Gildea, J.A.K. Hovard, H. Puschmann, J. Appl.
Crystallogr. 42 (2009) 339-341.
[18] SHELXTL-Plus, Version 5.10, Bruker AXS Inc., Madison, Wisconsin (USA), 1997.
[19] C.F. Macrae, I.J. Bruno, J.A. Chisholm, P.R. Edgington, P. McCabe, E. Pidcock, L.
Rodriguez-Monge, R. Taylor, J. van de Streek, P.A. Wood, J. Appl. Crystallogr. 41
(2008) 466-470. http://dx.doi.org/10.1107/S0021889807067908.
[20] T. Mossman, J. Immunol. Methods. 65 (1-2) (1983) 55-63.
[21] R.A. Poltavtseva, Yu.A. Nikonova, I.I. Selezneva, A.K. Yaroslavtseva ,
V.N. Stepanenko, R.S. Esipov, S.V. Pavlovich, I.V. Klimantsev , N.V. Tyutyunnik,
T.K. Grebennik, A.V. Nikolaeva, G.T. Sukhikh, B. Exp. Biol. Med. 158 (2014) 164-169,
https://doi.org/10.1007/s10517-014-2714-7.

50
[22] A.A. Angeluts, A.B. Gapeyev, M.N. Esaulkov, O.G. Kosareva, S.N. Matyunin, M.M.
Nazarov, T.N. Pashovkin, P.M. Solyankin, O.P. Cherkasova, A.P. Shkurinov, Quantum
Electron. 44 (3) (2014) 247-251.
[23] B.M. Gyori, G. Venkatachalam, P.S. Thiagarajan, D. Hsu, M.-V. Clement, Redox
Biol. 2 (2014) 457-465.
[24] S.A. Bustin, J. Mol. Endocrinol. 29(1) (2002) 23-39,
https://doi.org/10.1677/jme.0.0290023.
[25] QIAGEN Resources. http://www.sabiosciences.com/ru/shop/pcr/primer-sets/rt2-
profiler-pcr-arrays/#orderinginformation, 2018 (accessed 14 April 2018).
[26] D.N. Laikov, Chem. Phys. Lett. 281 (1997) 151-156.
[27] J.P. Perdew, K. Burke, M. Ernzerhof, Phys. Rev. Lett. 77 (1996) 3865-3868.
[28] Z.-M. Jin, L. Li, M.-L.Hu, H. Su,C.-X.Tong, Acta Crystallogr. E61 (2005) m1849-
m1851.
[29] H. Wakita, G. Johansson, M. Sanstöm, P.L. Goggin, H. Ohtaki, J. Solut. Chem. 20
(1991) 643-668.
[30] V. Zelenák, K. Györyová, S. Vargová, Main Group Met. Chem. 22(3) (1999) 179-
184.
[31] M. Romanos, M. Kertesz, J. Phys. Chem. 115A (2011) 4832-4839.
[32] D.R. Boer, A. Canals, M. Call, J. Chem. Soc., Dalton Trans. (2009) 399-414,
https://doi.org/10.1039/b809873p.
[33] V. Gunasekarana, G.V. Raj, P. Chand, J Clin Diagn Res. 9(3) (2015) GE01-GE05.
DOI: 10.7860/JCDR/2015/12062.5622.
[34] H. Bao, Q. Zhang, H. Xu, Z. Yan, Int. J. Nanomed. 11 (2016) 929–940.
[35] Y. Ikuta, Y. Koseki, T. Onodera, H. Oikawa and H. Kasai, Chem. Commun. 51
(2015) 12835-12838, https://doi.org/10.1039/C5CC04164C.
[36] K. Ariga, T. Kunitake, Supramolecular Chemistry – Fundamentals and Applications,
Springer-Verlag Berlin Heidelberg 2006, https://doi.org/10.1007/b84082.
[37] J.-M. Lehn, Supramolecular Chemistry: concepts and perspectives, Weinheim-New
York-Basel-Cambridge-Tokyo, VCH. 1995.
[38]. N.S. Rukk, L.G. Kuzmina, G.A. Davydova, A.Yu. Skryabina, V.M. Retivov,

51
V.V. Kravchenko, G.N. Apryshko, E.A. Mironova, S.N. Mudretsova, A.N. Streletskii, in:
Monograph Series of the International Conferences on Coordination and Bioinorganic
Chemistry. Slovak Chemical Society. Bratislava. 2015. pp. 163-177.
[39] C.M. Manna, G. Armony, E.Y. Tshuva, Inorg. Chem. 50 (2011) 10284-10291,
https://dx.doi.org/10.1021/ic201340m.

52
Graphical abstract

53
Highlights
 Zinc and cadmium complexes with bioactive ligands

 Single-crystal XRD studies and DFT calculations

 Cytotoxicity and genotoxicity studies

54