Chapter 8 In Vitro Amplification of DNA by the Polymerase Chain Reaction INTRODUCTION PROTOCOLS 1 The Basic Polymerase Chain Reaction 818 2 Purification of PCR Products in Preparation for Cloning 825 3 Removal of Oligonucleotides and Excess JNTPs from Amplifed DNA by Ulraftration 8.27 Introduction to Cloning PCR Products (Protocols 4 8.30 4 Bluntiend Cloning of PCR Products 8.32 5 Cloning PCR Products into T Vectors 835 6 Cloning PCR Products by Addition of Restriction Sites o the Termini of Amplified DNA 8.37 7 Genetic Engineering with PCR 3.42 {Amplification of CONA Generated by Reverse Transcription of mRNA (RT-PCR) 8.46 9 Rapid Amplification of 5° cDNA Ends (5 -RACE) 854 10 Rapid Amplification of 3° cDNA Ends (3 -RACE) 861 11 Mixed Oligonucletide-primed Amplification of CDNA (MOPAC) 8.66 12 Rapid Characterzatian of ONAS Cloned in Prokaryotic Vectors an + Additional Protocol: Screening Yeast Colonies by PCR 875 « Additional Protocol: Screening Bacteriophage 2 Libraries 876 13. Long PCR 877 14 Inverse PCR ast 15 Quantitative PCR 8.86 16 Differential Display-PCR (OD-PCR) 8.96 INFORMATION PANELS Multiplex PCR 8.107 Taq DNA Polymerase 8.108, Hot Start PCR 8.10 Ribonuclease H am Terminal Transferase aim ‘Touchdown PCR an Use of Inosine in Degenerate Pools of Oligonucleotides Used for PCR ans Universal Primers ans ar82 ‘Chapter 8: In Vitro Amplification of DNA by PCR The principles for extensive synthesis ofthe duplexed tRNA genes which emerge front the present work are the following, The DNA duplex would be denatured to form single strands, This denaturation step would be carried out in the presence of a sufficiently large excess of the two “appropriate primers. Upon cooling, one would hope to obtain two structures, each containing the ful length of the template strand appropriately complexed with the primer. DNA polymerase will bbe added t0 complete the process of repair replication. Two molecules of the original duplex should result. The whole cycle could be repeated, there being added every time a fresh dose of the enzyme. It is, however, possible that upon cooling after denaturation of the DNA duplex, renaturation to form the original duplex would predominate over the template-primer complex formation. If this tendency could not be circumvented by adjusting the concentrations of the primers, clearly one ‘wold have to resort t0 the separation of the strands and then carry out repair replication. Ajter every cycle of repair replication, the process of strand separation would have to be repeated. Experiments based on these lines of thought are in progres. K. Kleppe, E. Ohtsuka., R. Kleppe, I. Molineux, and H.G. Khorana, Studies on polynucleotides. XCVI. Repair replications of short synthetic DNAs as catalyzed by DNA polymerases (J. Mol, Biol. 56: 341 [1971]).Introduction Sometimes a good idea comes to you when you are not looking for it. Through an improbable combination of coincidences, naivéte and lucky mistakes, such a revelation canie to me one Friday night in April, 1983, as 1 gripped the steering wheel of my car and snaked along a moonlit mountain road into northern California’s redwood country. That was how I stumbled across a process that could make unlimited numbers of copies of genes, a process now known as the polynterase chain reaction (PCR): One Friday evening late in the spring I was driving 10 Mendocino County with a chemist friend, She was asleep. U.S. 101 was undemanding. I liked night driving; every weekend I went north to my cabin and sat still for three hours in the car, my hands occupied, my mind free. On ‘that particular night I was thinking about my proposed DNA-sequencing experiment. Around Cloverdale, where California 128 branches northwest from US. 101 and winds ‘upward through the coastal rang, I decided the determination would be more definitive if, instead of just one oligonucleotide, I used two... By directing one oligonucleotide to each strand of the sample DNA target, I could get complementary sequencing information about both strands, The experiment would thereby contain an internal control at no extra inconvenience Although I did not realize it at that moment, with the wo oligonucleotides poised in my mind, their hree-prime ends pointing at each other on opposite strands of the gene target, I was on the edge of discovering the polymerase chain reaction. Yet what I most felt on the edge of was the mountain road. That night the air was saturated with moisture and the scent of lowering buckeye. The reckless white stalks poked from the roadside into the glare of my headlights... Excited, I started running powers of two in my head: two, four, eight, 16, 32... remembered vaguely that two to the tenth power was about 1000 and that therefore two to the twentieth was around a million. 1 stopped the car at a turnout overlooking Anderson Valley. From the glove compartment I pulled a pencil and paper —I needed to check my calculations. Jennifer, my sleepy passenger, objected grogeily to the delay and the light, but I exclaimed that I had discovered something fantastic. Nonplussed, she went back to sleep. I confirmed that two to the twentieth power really was over a million and drove About a mile farther down the road I realized something else about the products of the reaction, Afier a few rounds of extending the primers, ds-sociating the extension products, rehybridizing new primers and extending them, the length of the exponentially accumulating DNA strands would be fixed because their ends would be sharply defined by the five-prime ends of the oligonucleotide primers. I could replicate larger fragments of the original DNA sample by designing primers that hybridized farther apart on it. The fragments would always be discrete eniies of a specified length, 1 stopped the car again and started drawing lines of DNA molecules hybridizing and extending, the products of one cycle becoming the templates for the next in a chain reaction... Jennifer protested again fiom the edge of slep. “You're not going to believe this, crowed. It's incredible?” She refused to wake up. { proceeded 10 the cabin without further stops. The deep end of ‘Anderson Valley is where the redwoods start and where the “ne’er-do-well” have always lived. My Aliscovery made me fee as though I was about 10 break out of that old valley tradition. It was dificult for me to slep that night with deaxyritonuclear bombs exploding in my brain K.B. Mull ‘The unusual origin of the polymerase chain reaction (Sei. Am, 262: 56 [1990]). 83a4 Chapter 8 In Vitro Amplification of DNA by PC! tion — underlies almost all of modern molecular biology. Of these three, the PCR is the oldest in theory and the most versatile in practice. The method was frst proposed in the early 1970s by H. Ghobind Khorana and his colleagues as a strategy to lessen the labor involved in chemical syn thesis of genes (Kleppe etal. 1971). Their ideas, however, did not seem practicable ata time when genes had not yet been sequenced, thermostable DNA polymerases had not been described, and synthesis of oligonucleotide primers was more of an art than a science, Not surprisingly, Khorana’s ideas were quickly forgotten. The technique was independently conceived 15 years later, given its present name, and put into practice by Kary Mullis and coworkers at Cetus Corporation, who described in vitro amplification of single-copy mammalian genes using the Klenow fragment of Escherichia coli DNA polymerase I (Saiki etal. 1985; Mullis etal. 1986; Mullis and Faloona 1987). Even so, PCR would probably have remained a clumsy laboratory curiosity ‘were it not for the discovery of thermostable DNA polymerases (Chien et al. 1976: Kaledin et al. 1980). The use of a thermostable polymerase from Thermus aguaticus (Saiki et al. 1988) greatly increased the efficiency of PCR and opened the door to automation of the method. By the end of the 1980s, cloning was no longer the only way to isolate genes: DNA sequencing had been revo- lutionized and PCR had become a fundamental cornerstone of genetic and molecular analyses. In addition to its simplicity, PCR is robust, speedy, and most of all, flexible. An enormous number of variations on the method have been described and entire journals and books have been devoted to the technique. In this chapter, we first discuss the parameters that affect PCR and then furnish core protocols that can be used to amplify DNA fragments and characterize them, The first description of PCR — precise, laconic, and impersonal — was published by Kleppe et al. in 19715 second — incarnadine, sel-indulgent, and visionary — was published by Kary Mulls in 1990, PARAMETERS THAT AFFECT POLYMERASE CHAIN REACTIONS Essential Components of Polymerase Chain Reactions PCRs contain seven essential components: ‘© A thermostable DNA polymerase to catalyze template-dependent synthesis of DNA. A wide choice of enzymes is now available that vary in their fidelity, efficiency, and ability to synthe- size large DNA products (for discussion, please see Thermostable DNA Polymerases on p. 8.6). For routine PCRs, Tag polymerase (0.5-2.5 units per standard 25-50-11 reaction) remains the enzyme of choice. The specific activity of most commercial preparations of Taq is ~80,000 units/mg of protein, Standard PCRs therefore contain 2 x 10!? to 10 x 10! molecules of enzyme. Since the efficiency of primer extension with Tag polymerase is generally ~0.7 (e-, please see Gelfand and White 1990; Lubin etal. 1991), the enzyme becomes limiting when 14 x 10!?t0 7x 10! molecules of amplified product have accumulated in the reaction. © A pair of synthetic oligonucleotides to prime DNA synthesis. Of the many factors that influ- ence the efficiency and specificity of the amplification reaction, none are more crucial than the design of oligonucleotide primers, Careful design of primers is required to obtain the desired products in high yield, to suppress amplification of unwanted sequences, and to facilitate sub sequent manipulation of the amplified product. Given that primers so heavily influence theIntroduction 85 successor failure of PCR protocols, itis ironic that the guidelines for their design are largely qualitative and are based more on common sense than on well-understood thermodynamic or structural principles. Compliance with these empirical rules does not guarantee success. Disregarding them, however, is likely to lead to failure. For more information, please see Design of Oligonucleotide Primers for Basic PCR on p. 8.13. In certain situations, it may be desirable to amplify several segments of target DNA simul- taneously. In these cases, an amplification reaction termed “multiplex PCR is used that includes more than one pair of primers inthe reaction mix. For further details on this varia tion, please see the information panel on MULTIPLEX PCR at the end of this chapter. Standard reactions contain nonlimiting amounts of primers, typically 0.1-0.5 ut of each primer (6 x 10" to 3x 10! molecules). This quantity is enough for at least 30 cycles of amplification of a |-b segment of DNA. Higher concentrations of primers favor mispriming, which may lead to nonspecific amplification. Oligonucleotide primers synthesized on an automated DNA synthesizer can generally be tased in standard PCRs without further purification. However, amplification of single-copy sequences from mammalian genomic templates is often more efficent ifthe oligonucleotide primers are purified by chromatography on commercially available resins (eg., NENSORB, NEN Life Science Products) or by denaturing polyacrylamide gel electrophoresis, as described in Chapter 10, Protocol 1. Deoxynucleoside triphosphates (NTPs). Standard PCRs contain equimolar amounts of dATP, TTP, ACTP, and dGTP. Concentrations of 200-250 yMt of each dNTP are recommended for Taq polymerase in reactions containing 1.5 mM MgCl,. In a 50«ul reaction, these amounts should allow synthesis of ~6-6.5 ng of DNA, which should be sufficient even for multiplex reac tions in which eight or more primer pairs are used at the same time. High concentrations of NTPs (>4 mM) are inhibitory, perhaps because of sequestering of Mg”. However, a satisfac tory amount of amplified product can be produced with dNTP concentrations as low as 20 ust —0.5-1.0 pmole of an amplified fragment ~1 kb in length. Several manufacturers (¢.g., Boehringer Mannheim) sell stocks of dNTPs that are made specifically for POR, These stocks are free of pyrophosphates that may inhibit PCR and are adjusted with NaOH to a pH of ~8.1, which protects the dNTPs to some extent from damage luring freezing and thawing, To avoid problems, stocks of NTPs (100-200 mt) — whether homemade or purchased — should be stored at ~20°C in small aliquots that should be dis- carded after the second cycle of freezing/thawing. During long-term storage at ~20°C, small amounts of water evaporate and then freeze on the walls of the vial. minimize changes in concentration, vials containing dNTP solutions should be centrifuged, afer thawing, for a few seconds in a microfuge. Divalent cations, All thermostable DNA polymerases require free divalent cations — usually Mg?* — for activity, Some polymerases will also work, albeit less efficiently with buffers con- taining Mn? (please see Thermostable DNA Polymerases below). Calcium ions are quite inef- fective (Chien et al. 1976). Because dNTPs and oligonucleotides bind Mg’*, the molar con- centration of the cation must exceed the molar concentration of phosphate groups con tributed by UNTPs plus primers. Itis therefore impossible to recommend a concentration of| ‘Mg"* that is optimal in all circumstances. Although a concentration of 1.5 mM Mg’* is rou- tinely used, increasing the concentration of Mg’ to 4.5 mM or 6 mM has been reported to decrease nonspecific priming in some cases (eg. please see Krawetz etal, 1989; Riedel et al 1992) and to increase it in others (eg, please see Harris and Jones 1997). The optimal con- centration of Mg?* must therefore be determined empirically for each combination of primers86 Chapter 8: in Vitro Amplification of DNA by and template. Many companies (e.g., Invitrogen, Perkin-Elmer, and Stratagene) sell optimizer kits containing various bulfer formulations that enable investigators to determine optimal reaction conditions for particular primer-template combinations. Once these conditions have bbeen identified, the best buffer can then be purchased in volume or assembled in the labora- tory. Alternatively, optimization can be achieved by comparing the yield obtained from a series of ten PCRs containing concentrations of Mg?* ranging from 0.5 mM to 5.0 mM, in 0.5 mM increments. Sometimes a second round of optimization is necessary using a narrower range of Mg", in0.2 mM increments. If possible, preparations of template DNA should not contain sig- nificant amounts of chelating agents such as EDTA (ethylenediaminetetraacctic acid) or atively charged ions, such as PO }-, which can sequester Mg. ‘© Buffer to maintain pH. Tris-Cl, adjusted to a pH between 8.3 and 8.8 at room temperature is included in standard PCRs at a concentration of 10 mM. When incubated at 72°C (the tem: perature commonly used for the extension phase of PCR), the pH of the reaction mixture €rops by more than @ full unit, producing 2 buffer whose pH is ~7.2. ‘© Monovalent cations. Standard PCR buffer contains 50 mM KCI and works well for amplifica tion of segments of DNA >500 bp in length. Raising the KCI concentration to ~70-100 mM ‘often improves the yield of shorter DNA segments ‘» Template DNA. ‘femplate DNA containing target sequences can be added to PCR in single- or double-stranded form. Closed circular DNA templates are amplified slightly less efficiently than linear DNAs. Although the size of the template DNA is not critical, amplification of sequences embedded in high-molecular-weight DNA (>10 kb) can be improved by digesting the template with a restriction enzyme that does not cleave within the target sequence. ‘When working at its best, PCR requires only a single copy of a target sequence as template (Liet al. 1990), More typically, however, several thousand copies of the target DNA are seeded into the reaction. In the case of mammalian genomic DNA, up to 1.0 ug of DNA is utilized per reaction, an amount that contains ~3 x 10° copies of a single-copy autosomal gene. The typi cal amounts of yeast, bacterial, and plasmid DNAs used per reaction are 10 ng, I ng, and 1 pg, respectively. Thermostable DNA Polymerases ‘Thermostable DNA polymerases are isolated from two classes of organisms: the thermophilic and hyperthermophilic eubacteria Archaebacteria, whose most abundant DNA polymerases are rem- iniscent of DNA polymerase I of mesophilic bacteria; and thermophilic Archaea, whose chief DNA polymerases belong to the polymerase o family. T aquaticus, an organism from the ther: mophilic Archaea family (please see Figure 8-1 and Brock 1995a,b, 1997). Taq (T: aquaticus) DNA polymerase, the first isolated and best understood of the thermostable DNA polymerases, remains the workhorse of PCR in most laboratories. Unfortunately, preparations of Taq polymerase sold by different manufacturers are not ‘identical: Variations have been reported in the yield, length, and fidelity of the amplified product generated by different commercial preparations of Tag in standardized PCRs (e.g, please see Linz et al. 1990). It is therefore important to optimize PCRs every time for each new batch of Tag. Despite these annoyances, aq polymerase remains the enzyme of choice for routine amplifica- tion of small segments of DNA. However, when greater fidelity is required, when the length of the target amplicon exceeds a few thousand bases, or when cloning mRNA by reverse transerip- tase-PCR (RT-PCR), other thermostable enzymes may have significant advantages. The choice among enzymes should be determined by the purpose of the experiment. For example if the goalIntroduction 8.7 FIGURE 8-1 The Brack Exped Thomas D. frock (a microbial ecologist atthe University of Wisconsin, Madison) is standing next to ‘Mushroom Spring in Yellowstone National Park, June 23, 1967. aquaticus strain YT-1 was isolated from a sample taken in the previous year from the outflow channel visible on the lft side of the photo) by Tom Brock and his undergradvate student, Hudson Freeze. Their work is elegantly and proudly described in autobiographical memoirs by Tom Brock (Brock 1995a,b, 1997). The subsequent impact of ‘extremophiic” microorganisms on the biotechnology industry is described by Madigan and Marrs (1997), (Reprinted, with permission, fom Brock 19956.) is to make faithful copies of a gene, an enzyme with proofreading function is required, whereas if the goal is to clone an amplified product, an enzyme that generates blunt ends may be of advan- tage. Until recently, these choices often involved compromise on the part of the investigator. However, mixtures of two or more DNA polymerases can significantly increase yield and enhance amplification, particularly of longer target DNAs (Barnes 1994; Cheng etal. 1994; Cohen 1994) This improvement is presumed to be due to the capacity of one enzyme to complement the inability of another to extend a primer through potential obstructions on the template strand, ‘These obstructions include regions of high secondary structure (Eckert and Kunkel 1993), abasic gaps that cannot be bridged by polymerases lacking terminal transferase activity (Hu 1993), and Iispaired bases that cause nonproofreading polymerases to stall and dissociate from the primer:template (Barnes 1994), Several manufacturers now sell cocktails of thermostable poly- _merases that allow desirable features to be assembled in one reaction mixture. For example, cock- tails of Tor and Tag sold under the trade name DyNAzyme (MJ Research Inc.) exhibit high fideli- ty because of the proofreading function of Tbr and the high efficiency thats characteristic of Tag. Similarly, a mixture of Taq and Pfis polymerases sold by Stratagene (TaqPlus Long PCR System) and Boehringer Mannheim (Expand Long Template PCR System) generates high yields of long targets (up to 35 kb).88° Chapter 8: In Vitro Amplification of DNA by PCR The enzymatic properties and applications of the best known of the commercially produced thermostable DNA polymerases are summarized in Table 8-1, Details of the isolation and physi- cal properties of the purified enzymes may be found in the many reviews (Erlich 1989; Gelfand and White 1990; Cha and Thilly 1993; Bej and Mahbubani 1994; Cohen 1994; Perle etal. 1996) and books on this topic (Innis et al. 1990; Griffin and Griffin 1994; Dieffenbach and Dveksler 1995), In addition, a summary of the error rates for thermostable-resistant DNA polymerases may be found at http:/lsteria.nwfse.noaa.gov/protocolsitaq-errors.html. However, in. some «cases, the only source of information isthe indefatigably optimistic material supplied by the man- ufacturer Programming Polymerase Chain Reactions PCR is an iterative process, consisting of three elements: denaturation of the template by heat, annealing of the oligonucleotide primers to the single-stranded target sequence(s), and extension of the annealed primers by a thermostable DNA polymerase. # Denaturation. Double-stranded DNA templates denature at a temperature that is determined in part by their G+C content. The higher the proportion of G+C, the higher the temperature required to separate the strands of template DNA. The longer the DNA molecules, the greater the time requited at the chosen denaturation temperature to separate the two strands com pletely. If the temperature for denaturation is too low or ifthe time is too short, only AT-rich regions of the template DNA will be denatured. When the temperature is reduced later in the PCR cycle, the template DNA will reanneal into a fully native condition. In PCRs catalyzed by Tay DNA polymerase, denaturation is carried out at 94-95%C, which is the highest temperature that the en7} ing excessive damage. In the first cycle of PCR, denaturation is sometimes carried out for 5 minutes to increase the probability that long molecules of template DNA are fully denatured However, in our experience, this extended period of denaturation is unnecessary for linear DNA molecules and may sometimes be deleterious (Gustafson et al. 1993), We recommend denaturation for 45 seconds at 94-95°C for routine amplification of linear DNA templates whose contents of G#C is 55% or less. Higher temperatures may be required to denature template and/or target DNAs that are rich in G+C (>35%). DNA polymerases isolated from Archaea are more heat-tolerant than Tag and are therefore preferred for amplification of GC-rich DNAs. ¢ can endure for 30 or more cycles without sustain. ‘© Annealing of primers to template DNA, The temperature used for the annealing step (T,) is critical, Ifthe annealing temperature is too high, the oligonucleotide primers anneal poorly, if at all, to the template and the yield of amplified DNA is very low. Ifthe annealing temper- ature is too low, nonspecific annealing of primers may occur, resulting in the amplification of ‘unwanted segments of DNA. Annealing is usually carried out 3-5°C lower than the calculat- ced melting temperature at which the oligonucleotide primers dissociate from their templates. Many formulas exist to determine the theoretical melting temperature, but none of them are accurate for oligonucleotide primers of all lengths and sequences (please see Calculating Melting Temperatures of Hybrids between Oligonucleotide Primers and Their ‘Target Sequences on p. 8.15). It is best to optimize the annealing conditions by performing a series of trial PCRs at temperatures ranging from 2°C to 10°C below the lower of the melting tem- peratures calculated for the two oligonucleotide primers. Alternatively the thermal eycler can be programmed to use progressively lower annealing temperatures in consecutive pairs of cycles (“touchdown” PCR; Don et al. 1991). Instead of surveying a variety of annealing con.Introduction 8.9 ditions in separate PCRs, optimization is achieved by exposing a single PCR to a sequential seties of annealing temperatures in successive cycles of the reaction, For many investigators, touchdown PCR bypasses the need to determine the optimum annealing temperature for every pait of primers and is used to obtain acceptable yields of amplified products in routine PCR (Peterson and Tjian 1993; Roux 1995; Hecker and Roux 1996; Roux and Hecker 1997; please see the information pane! on TOUCHDOWN PCR). «Extension of oligonucleotide primers is cartied out at or near the optimal temperature for DNA synthesis catalyzed by the thermostable polymerase, which in the case of Tq DNA poly merase is 72-780C. In the first two cycles, extension from one primer proceeds beyond the sequence complementary to the binding site of the other primer. In the next cycle, the first molecules are produced whose length is equal to the segment of DNA delimited by the bind ing sites of the primers. From the thitd cycle onward, this segment of DNA is amplified geo- ‘metrically, whereas longer amplification products accumulate arithmetically (Mullis and Faloona 1987). The polymerization rate of Taq polymerase is ~2000 nucleotides! minute at the optimal temperature (72-78°C) and as a rule of thumb, extension is carried out for | minute for every 1000 bp of product. For the last cycle of PCR, many investigators use an extension time that is three times longer than in the previous cycles, ostensibly to allow completion of all amplified products. However, in our experience, the result of the PCR is not significantly altered by tinkering with the extension time in this way. © Number of eycles. As discussed in the panel on PCR IN THEORY (p. 8.12), the number of eycles required for amplification depends on the number of copies of template DNA present at the boginning of the reaction and the efficiency of primer extension and amplification. Once established in the geometric phase, the reaction proceeds until one of the components becomes limiting. At this point, the yield of specific amplification products should be maxi smal, whereas nonspecific amplification products should be barely detectable, if at all. This is generally the case after ~30 cycles in PCRs containing ~10° copies of the target sequence and Tag DNA polymerase (efficiency ~0.7). Atleast 25 cycles are required to achieve acceptable ev els of amplification of single-copy target sequences in mammalian DNA templates. Optional Components of Polymerase Chain Reactions ‘A number of cosolvents and additives have been reported to reduce unacceptably high levels of rispriming and to increase the efficiency of amplification of G+C-rich templates (Pomp and Medrano 1991; Newton and Graham 1994; Varadaraj and Skinner 1994). Cosolvents include for- ‘mamide (1.25-10% v/v} (Sarkar et al. 1990), dimethylsulfoxide (up to 15% viv) (Bookstein etal 1990), and glycerol (1-10% v/v) (Lu and Négre 1993). Additives include tetramethylammonium chloride (Hung et al, 1990; Chevet et al. 1995), potassium glutamate (10-200 mM), ammonium sulfate (Schoetilin et al. 1993), nonionic and cationic detergents (Bachmann et al. 1990; Pontius and Berg 1991), and certain as yet unidentified “Specificity Enhancers” such as Perfect Match Polymerase Enhancer (Stratagene) and GC-Melt (CLONTECH). Many of these additives and cosolvents inhibit PCR when used at high concentrations, and the optimum concentration must be determined empirically for each combination of primers and template DNA. Rather than reaching for thest regular components of the reaction, particularly the concentrations of M; (Krawetz etal. 1989; Riedel et al. 1992), The one exception to this general rule concerns the use of GC-Melt, which in our hands often overcomes problems of low-efficiency amplification with uncooperative G+C-rich templates enhancers atthe first sign of trouble, itis far better in our view to optimize the and K" ions[Chapter 8: In Vitro Amplification of DNA by PCR 80 a ° ‘486 18 me OS 296 18 UAW OS aoe 38 we 21 ag 18 cH 0 os'46 1 uM 12 es 46 1 Un 6 Gamay way vq (eo as se ws es aamarg sosesnuikjog WNG mIgeisowsu1 Jo suone>yddy pue somiodor Auauay ASvDNNOXY soo so09 oese owse 0 omse ose ows “(0 ana wawinao aa ae spout mui) aumgamy aap swy seh og us smydomioue yatta Le Ld eats vou WSIWOIO AAALDWANNYWY —aIWAZNG bon neva811 Introduction lwoisusns>-i9uitad 30} 24h “aan ha poe 218 pur poiesaust uaoq any Ata 2se2pnu0xD poonpos ti suey sesso VN 2k Ai ep “tye Bauynbor og pur vrsuses “snurad 19 jgpine st noyd0cy ‘suomeat Bupsuanbos 94 ws ssspyea se posm au souihau ae9ut “aN = es 1 un ove DS 9001 18 ui OB 001 Ve un pT 901 1824 2 vy iy vy snsouinf oe Bete snmar0ug SIN Mandan se oso ond a se so-08 Wa ong812 Chapter 8: In Vitro Amplification of DNA by PCR PCR IN THEORY ‘When amplifying a small segment of a larger double-stranded DNA template, the desired bluntended frag- tenet purine We Qc REL Te apd pads es acura openly Seid natn # ean 185 vena ® er hcp ie aie einfach tl py nore te cape OMe de ecg ali per ce Ticcnaionawy soto apoetl pice anpicaonwicnconnas fore hecm- porns ne ton eres iina toxlad PER conan ef ermal ONG ay "merase, the enzyme becomes limiting when the copy number of the target sequence approaches 10, At this pant teeny orator Sap preopinc te it ogres he geomet Eon kanye nye fap pes se he pr paseo et, cyev tee earn cae sad on Egon? vfs where Ys the efficiency of amplticaton por cycle, and N,N, the numberof amplified molecules produced in. cyces of exponential amplification ncnving the ial copy number and the efciency of the reaction, the numberof cycles required to gen- ‘tate the desred numberof copies (eg, 10") of the target DNA. can be calculated by substitution in Equation 1. For example, when the inital numberof template molecules = 3 x 10° and the efcency ofthe exponential hase ofthe reaction is 70", Equation 1 becomes 10! = 3108 1+ 0.7 Solving for nyilds 28.6. Twenty. rine cycles of exponential aplication wll therefore be needed fo generate 10% molecules of product. ‘The efciency of PCR is determined chiefly by the quality of the thermostable DNA polymerase. Because ‘ofthe geometric nature of CR, the penalty for using an inefiient enzyme is severe. For example, Linz etal (1990) found that after 20 cycles of exponential amplification, the ammount of product varied over a 200-old ‘ange depending onthe polymerase used. This age diference in yield was atibuted to a2-old diference in the efcieny of the enzymes during the exponential phase ofthe reaction Table 8-2 shows the theoretical numberof cycles required to generate 10 ng ofa 200-bp product in PCRS running a various efcencies and containing diferent numbers ont template DNAS. TABLE 8-2 Theoretical Number of Cycles Required for PCR Tarcers y 1 10 100 1,000 10,000 100,000 1.00 0 a 2 20 7 95, 3 28 25 2 18 090) 33 29 26 2 18 ons a 0 ” 3 19 0.50 36 2 2 Fy 20 075 6 33 2 23 n 70 0 35 3 z 2 065. 2 a 8 3 000 45 40 30 3 035 “6 B 2 a 050. 2 46 3 » 50 30 3 3 e 35 2 % 70 2 a » 39 7 53 “ 3 8 0 52 us 2 %6 6 M9 132 9 8 28 194 M3 om om Rameckers eal (19 [Springer-Verlag Dumber of PCR cytes (rounded) requted 1 reach 1 ng of DNA ‘hed on 3 200-Np PCR product) a sarows of ‘enh (Y and ars target numer ages),Inhibitors DESIGN OF OLIGONUCLEOTIDE PRIMERS FOR BASIC PCR Introduction 8.13 Almost anytiing will inhibit PCRs if present in excess. The common culprits include proteinase K (which, if given the opportunity, can degrade thermostable DNA polymerase), phenol, and DTA. Other substances that can cause problems are ionic detergents (Weyant et al. 1990), heparin (Beutler et al. 1990), polyanions such as spermidine (Ahokas and Erkkila 1993), hemo- slobin, and gel-loading dyes such as bromophenol blue and xylene cyanol (Hoppe et al, 1992). In ‘many cases, the chief cause of low or erratic yields are contaminants in the template DNA, which is often the only component of the reaction supplied by the investigator. Many problems with PCR can be cued simply by cleaning up the template by dialysis, ethanol precipitation, extrac tion with chloroform, and/or chromatography through a suitable resin. ‘The chief goal of primer design is specificity, which is achieved only when each member of a primer pait anneals in a stable fashion to its target sequence in the template DNA. As a rule of thumb, the longer an oligonucleotide, the higher its specificity fora particular target. The follow ing equations can be used to calculate the probability that a sequence exactly complementary to a string of nucleotides will occur by chance within a DNA sequence space that consists of ran- dom sequence of nucleotides (Nei and Li 1979), k= (ga) x(a ga) where K is the expected frequency of occurrence within the sequence space, is the relative G+C content of the sequence space, and G, C, A, and T are the number of specific nucleotides in the oligonucleotide. For a double-stranded genome of size N (in nucleotides), the expected number (n) of sites complementary to the oligonucleotide is m = 2NK. ‘These equations predict that an oligonucleotide of 15 nucleotides would be represented only once in @ mammalian genome where N is ~3.0 x 10°, In the case of a 16-mer, there is only ‘one chance in ten thata typical mammalian cDNA library (complexity ~107 nucleotides) will for tuitously contain a sequence that exactly matches that f the oligonucleotide. However, these cal mammalian culations are based on the assumption that the distribution of nucleotides genomes is random. This is not the case because of bias in codon usage (Lathe 1985) and because a significant fraction of the genome is composed of repetitive DNA sequences and gene families (Bains 1994), To minimize problems of nonspecific annealing, it is advisable to use oligonu- cleotide primers longer than the statistically indicated minimum. Because of the presence of repetitive elements, no more than 85% of the mammalian genome can be targeted precisely, even by primers that are 20 or more nucleotides in length (Bains 1994). Before synthesizing an oligonucleotide primer, itis prudent to scan DNA databases to check that the proposed sequence ‘occurs only in the desired gene and not in vectors, undesired genes, or repetitive elements (e.g. please see Mitsuhashi etal. 1994), ‘Table 8-3 presents information on the design of oligonucleotide primers for basic PCR. Failures will be rae if the advice provided in the table is followed carefully. Selecting PCR Primers Listed below are several steps involved in the selection of oligonucleotide primers: ‘© Analysis of the target gene for potential priming sites that are free of homopolymeric tract, have no obvious tendency to form secondary structures, are not sef-complementary, and have no significant homology with other sequences on either strand of the target genome,814 Chapter 8: In Vitro Amplification of DNA by PCR TABLE 8-3 Primer Design: Properties of Proreeiy © Creation of lists of possible forward and reverse primers based on the criteria listed in the ‘Table 8-3. Calculate the melting temperatures of the oligonucleotides from the formulae given inthe following section on Calculating Melting Temperatures of Hybrids between Oligonucleotide Primers and Their Target Sequences. ‘© Selection of well-matched pairs of forward and reverse primers that are similar in their con- tent of G+C and will generate an amplified product of the appropriate size and base compo- sition. The GC content of both primers and the amplified product should be similar and lie between 40% and 60%, ‘Orrimat Disicn Base composition Length Repeated and sel: complementary sequences Complementarit Jherween members of primer pair Melting temper: atures Adding restriction sites, hacteriophage Promoters and cther sequences tothe 3 termini oof primers Placement of priming sites Primers for degenerate PCR ‘G-+C content should be between 40% and 60%, with an even distribution of al four bases along the length of the primer {e.g..n0 polypurine tracts or polypyrimidin tracts and no dinucleotide repeats. ‘The region of the primer complementary to the template should be 18-25 nucleotides long. Members of primer pair should not difler in length by >3 bp, [No inverted repeat sequences or self-complementary sequences >8 bp in length should be present. Sequences of thistype tend to form haispin structures, which if stable under PCR conditions, can effectively prevent the oligonucleotide from annealing to its target DNA. The 3 terminal sequences of one primer should not be abe ta bind to any site onthe other primer. Because primers are present at high concentration in PCR, even weak complementarity between them leads to hybrid formation and the consequent synthesis and amplification of primer dimers. If primer diners form eatly in PCR. they can compete for DNA polymerase, primers and nucleotides and so can suppress amplification of the get DNA. Formation of primer dimers can be educed by careful primer design, by the we of hot start. oF touchdown PCR, andfor by the use of specially formulated! DNA polymerase (e4., AmpliGold, Perkin-Elmer) When more than one primer pur is used ina single PCR, check that none of the 3” ends have detectable com= plementarity to any other primers in the reaction, Caleulated 7, values of members of a primer par should not fer by >5%C. The T,, of the amplitie product should not dlfer from the ,, values ofthe primer pairs by >10*C. This property ensures that the amplified product wil be eliiently denatured during each cycle of PCR, The nature of the 3 end of primers is crucial. Ifpossble, the 3° ase ofeach primer should be G or C. However, primers witha ..NNNCG or ..NNGC sequence a theit 3 termini age not recommended because the unusually high AG of the terminal GC bases promotes the formation of hairpin structures and may generate primer dimers Useful sequences not complementary tothe target DNA ae commonly added to the 5’ end ofthe primer, In general the presence of such sequences does not significantly affect annealing ofthe oligonucleotide tits target DNA. These additional sequences include bacteriophage promotes (Kain etal. 1991) and GC clamps (Sheffield al. 1989), Restriction sites area special case. Because the efficiency of cleavage of restriction sites located atthe 5 termini of DNA molecules is poor the primer should be extended by a least three additional nucleotides beyond the recognition sequence of the restriction enzyme. New England Biolabs’ catalog contains information 1m the efficiency with which different restriction enzymes cleave sites near the termini of DNA molecules. Depending on the purpose ofthe experiment, the placement of priming sites may be constrained by the loca tion of mutations, restriction sites, coding sequerices, microsatellites or cis-acting elements. When designing primers for use on cDNA templates it is best to use forward and reverse primers that bind to sequences in if {erent exons, This allows amplification products derived from cDNA and contaminating genomic DNA to be easily distinguished, When a short sequence of amino acids has been obtained by sequencing a purified protein, pols of degenerate ‘oligonucleotides containing al posible coding combinations can be used to amplily the corresponding genomic lor . Buffers and Solutions Please see Appendix 1 for components of stock solutions, buffers, and reagents, Dilute stock solutions to the appropriate concentrations. 10x Amplification butter Chloroform NTP solution (20 mx) containing all four dNTPS (pH 8.0) Enzymes and Buffers Thermostable DNA polymerase Gels Polyacrylamide <> or agarose gel lease see Step 4 Nucleic Acids and Oligonucleotides Bystander DNA lease see the panel to Step 1 Forward primer (20 uh) in H,O and Reverse primer (20 yw) in H,O Pease se the discussion on Primers inthe protocol introduction. [tie eg eds cla i cs wife cipro | (M, = (Cx 289) + (Ax 313) + (Tx 304) + (Gx 329) were Cis heuer of Crees he hgh Ait mabe of is, ste urbe | of Tress, and Gis the numberof G resides The molecular mass ofa 20-ner wl be 6000 delons | lactic ul apace Template DNA Dissolve template DNA in 10 mM Tris-Cl (pH 7.6) containing alow concentration of EDTA (<0.1 mst) at the following concentrations: mammalian genomic DNA, 100 pg/ml yeast genomic DNA. 1 ion bacterial genomic DNA, 0.1 ygimland plasmid DNA, 1-5 ng Special Equipment Barrier tips for automatic micropipetting device Microfuge tubes (0.5 ml, thin-walled for amplification reactions) or Microtiter plates Positive-displacement pipetteProtocol 1: The Basic Polymerase Chain Reaction 821 Thermal cycler programmed with desired amplification protocol Ie thermal cyeler is not equipped with heated id, use either mineral ol or paraffin wax to prevent evaporation of guid fom the reaction mitute during PCR, Paafin wax not only prevents evapora ‘ion, but ao maintains separation between components. primet and template until the ration ‘mixtures heated This separation prevents nonspecific binding of primers ding the initial phase ofthe reaction (please se the information panel on HOT START PCR). Additional Reagents METHOD Step 4 of this protocol may require the reagents listed in Chapter 6, Protocol 10, andior Chapter 12, Protocol 6. 1. Ina sterile 0.5-ml microfuge tube, amplification tube, or the well ofa sterile microtiter plate, imix in the following order: 10x amplification buffer Sul 20 mit solution of four NTPs (pH 80) ny 20 ut forward primer 254 20 uM reverse primer 254 1-5 units thermostable DNA polymerase 1-2 units #0 28-33 ul template DNA 5-104 ‘oral volume 50 yl ‘The table below provides standard reaction conditions for PCR, Mgt KCL___ANTPs _ Primers _DNA polymerase Template DNA. 13mm SOmM 200M. Lun I-Sunits IL pgto tug The pH of the reaction buffer should he 8.3 when measured at 25°C, Because of the high tempens- ture dependence of the pXa of Tris, the pH ofthe reaction will drop to ~7.2at72%C (Good etal. 1956: Ferguson etal, 1980). The amount of template DNA requited vates according to the complexity of its sequence. Inthe ase of mammalian DNA, up 10 1.0 gis used per reaction, Typical amounts of yeast, bacterial, and plasmid DNAs used per reaction ae 10 ng, 1g and LO pg, respectively, Each set of PCRs must aways include postive and negative controls. Postve control are required to imonitor the efcency ofthe PCR, whereas negative controls are required to detect contamination with DNAs that contain the target sequence. Bysunder NAY Template DNAY Target DNAS Speci Primers! Positive Controls 2 2 : t : Negative Controls a - - + 4 ; : 5 i “Bystander DNA doesnot contain target sequences. t should esenblethe template DNA inal the respects: complenty, size, an concenaton. "remplte DNA isthe DNA under tes, “Target DNA contains the target sequence. can be a recombinant ONA clone, a puri! DNA fragment, oF ‘sample of genomic DNA I should be ade to the positive contol at concentatons ema to those expt fin the template DNA. I's often necessary to set pa eres of postive controls conning diferent amounts «fag ONA spacing amount predtedin he tole DNA. An apropratiston of the ange sequent shld be prepared ahead of ime ian area ofthe aboatory ferent fom tha used or the preparation of oes PCRreagents. This precaution reduces the risk of contaminating eroipment and plasticware nthe area ofthe > ‘ratory set aside for PCRS. "Specic Primers are lganuleide primers soci for the segment of target DNA.8.22 Chapter 8: In Vitro Amplification of DNA by PCR 2, If the thermal eyeler is not fitted with a heated lid, overlay the reaction mixtures with | drop (~50 ul) of light mineral oil to prevent evaporation of the samples during repeated cycles of heating and cooling. Alternatively, place a bead of wax into the tube if using a hot start pro- tocol, Place the tubes or the microtiter plate inthe thermal cycler. ig the denaturation, annealing, and polymerization times and Annealing Polymerization Seyeles | 30sec at 94°C 30seeat 55°C min at 72°C. Last gycle | 1 min at 949°C 30sec at 55°C min at 72% These times are suitable for 50-1 reactions assembled in thin-walled 0.5-m tubes and incubated in thermal eycers suchas the Perkin-Elmer 9600 or 9700, Master Cycler (Eppendorf) and PTC 100 (Research). Times and temperatures may need tobe adapted to suit other types of equipment and reaction volumes, Polymerization shouldbe carried out for 1 minute for every 100 bp of length of the target DNA ‘Mos thermal eylershavean end routine in which the amplified samples are incubated at 4*C until they are removed from the machine. Samples an be left overnight at this temperature, but should be stored thereafter at 20°C. 4, Withdraw a sample (5-10 pl) from the test reaction mixture and the four control reactions and analyze them by electrophoresis through an agarose or polyacrylamide gel. Be sure to include DNA markers of an appropriate size. Stain the gel with ethidium bromide or SYBR Gold to visualize the DNA. A successful amplification reaction should yield a readily visible DNA fragment of the expected size, The identity of the band can be confirmed by DNA sequencing (pease see Chapter 12 Protocol 6), Southern hybridization (please see Chapter 6, Protocol 10), andor restition map” ping. IFall has gone well anes ofthe gel containing samples ofthe two postive controls (Tubes! and 2), and the femplate DNA under test should contain 2 prominent band of DNA of the appropriate molecular weight. This band should be absent fom the lanes containing samples of the negative «controls (Tubes 3 and 4. Ion the other hand, lis not well, please sce Tables 8-4 and 85. 5. If mineral oil was used to overlay the reaction (Step 2), remove the oil from the sample by extraction with 150 pl of chloroform, The aqueous phase, which contains the amplified DNA, will form a micelle near the meniscus. The micelle can be transferred toa fresh tube with an automatic micropipette, For many purposes, eg. purification ofthe amplified DNA using a Centticon microconcentrtor ‘or cloning amplification products, i is desirable to remove the oll from the sample before pro- coeding. ‘A IMPORTANT Do not attempt chioroform extractions in miceaiter plates, The plastic used in these plates is not resistant to organic solvents,OPTIMIZATION OF PCRs Protocol 1: The Basic Polymerase Chain Reaction 8.23 When setting up PCRs for first time with new template DNA, new primers, or a new prepara- tion of thermostable DNA polymerase enzyme, amplification will generally be less than opti- ‘mal. Fine tuning ofthe reaction is usually required to suppress nonspecific amplification and/or to enhance the yield of the desired DNA product. Table 8-4 lists some commonly observed problems and suggests ways in which the reaction can be optimized. TABLE 8-4 Troubleshooting Ampl Paosiem ations EXPLANATION ‘SuccesreD REMEDY ands ofthe desired product are sharp but ‘et faint in both postive controls ana est PCR. Bands of the desired product smear into the portion of the gel containing ower-molecular weight DNAs. Bands of the desired product are very faint inthe test simple and in positive conteo 2 The band in positive control | is much stronger Bands in the negative controls Distinct bandis} of the wrong molecular woight eralized smear of amplified DNA that ‘muy obscure the desired product. Inofficient priming or ineicien extension, Dirty template DNA. Contamination of solutions or plasticware with template DNA. Nonspecific priming by one or both primers Amplification of primer dimers. Too much template DNA. Set up a series of PCRS containing diferent concentrations ofthe two primers Find the ‘optimal concentration and then set up a series of touchdown PCRs containing dif ferent concentrations of Mg” to find the optimal concentration, Include GC-Melt (CLONTECH) in the reaction mixture Use the minimum possible temperature during the annealing step. Consider adding adjuvants such as BSA {02-0.6 mg/ml), DMSO (5%), oF glycerol {59 tothe reaction mixture Repurify the template DNA by extraction (vice) with phenok:chloroform and ethanol precipitation, Dissolve the purified DNA in H,0 (no EDTA) Please sce the panel on CONTAMINA- TION IN PCR {introduction} and then make up new reagents. Decrease the annealing time andor increase the annealing temperature, Check that nether primer has homology with highly repetitive sequences inthe tem plate DNA. Optimize the concentrations of ‘ach primer independently. ‘Use touchdown PCR and/or hot start PCR {please sce the information panels Reduce the amount of template DNA by factors of 2.5 and 10.8.24 Chapter 8: In Vitro Amplification of DNA by PCR TROUBLESHOOTING MAJOR PROBLEMS THAT OCCUR IN PCRs ‘Table 8-5 describes problems that may be encountered in amplification reactions and provides guidance for how to address major difficulties. TABLE 8-5 Troubleshooting PCRs Syurrom Possuste Causes Amplifiation weak or nondetectable,Defetive reagents); defective thermal cyder; programming error. Suboptimal annealing conditions. Suboptimal extension of annealed primers Ineffective denaturation, Distance between primers to large iple amplification products, Fecessive amounts of primer-dimers. PossiBte ReMeDies ‘Compare the yields obtained from fresh and old ‘reagents in PCRS incubated in to diferent theemal cyclers, Recalculate 7, of primers. Use touchdown PCR, preferably in combination with hot sart PCR. Verify the concentration of primers and, if necessary, optimize their concentration. Ifthe primers appear to be the cause of the problem, design and synthesize new primers, Optimize the concentration of MgCl, and dNTP, Testa range of pH values in the PCR. Consider replac: ing Tris with tricin,bicine, or EPPs which have a lower temperature coeficient than Tris (Cheng etal. (994). Use a fresh preparation of thermostable DNA poly Repurify the template DNA to remove inbibitors Increase the number of cycles at constant annealing temperature (55°C). If problems persist, add an enhancer (¢g., 10% DMSO, 5% PEG 6000, or 10% glycerol) Ipeoblems stil persis, iter amplify 1:100 dilution ofthe PCR in fresh PCR buffer and primers for 30 cycles ata constant annealing temperature or cary out nested PCR Use GC-Melt (CLONTECH inthe reaction misture. nplate DNA, Increase the time or temperatute of denaturation Use preparations of thermostable polymerases capable ‘of amplifying long segments of DNA. Use touchdown PCR, preferably in combination with hot start or booster PCR ‘Optimize the concentration of MgCl template DNA, thermostable DNA polymerase, and dNTP. “Testa sange of pH values Either reamplify 4 1:100 dilution of the PCR in fresh PCR buffer and primers for 30 cycles at a constant annealing temperature (359) or carry out nested PCR or recover the desired band of DNA from a gel and reamplify Verify the concentration of primers and, if necessary, ‘optimize their concentration. If the problem persists, design and synthesize new primers. Use touchdown PCR, preferably in combination with hot start or booster PCR. If the problem persists, design and synthesize new primers, paying paticular attention to the sequences ofthe 3’ ends,Protocol 2 Purification of PCR Products in Preparation for Cloning MATERIALS with phenol:chloroform. ethanol precipitation, and other regimens commonly used to purify the products of PCRs (Crowe et al. 1991; Barnes 1992). The continuing presence of the DNA poly- ‘merase together with residual ANTPs often thwarts methods to tailor the ends of the amplified DNA for cloning, For example, the surviving DNA polymerase will fll recessed 3° termini creat- ed by digestion with restriction enzymes. Undoubtedly, the durability of Taq explains in large part the difficulties encountered by many laboratories in cloning PCR products after digestion with restriction enzymes (Bennett and Molenaar 1994), The following method of purification of amplified DNA is based on procedures described by Crowe etal (1991) and Wybranietz and Lauer (1998). CAUTION: Please see Appendix 12 for appropriate handling of materials marked with . Buffers and Solutions 1 for components of stock solutions, buffers, and reagents. Please see Appendi 5 to the appropriate concentrations. Dilute stock sol Ammonium acetate (10 M) Chloroform Ethanol Phenolschloroform (1:1, viv) TE (pH 8.0) Enzymes and Buffers Gels Proteinase K (20 mg/ml) Please see Appendix 4 Agarose gel containing 0.5 ygiml ethidium bromide Please see Step 8, Be sure to include DNA markers of an appropriate size (please see Protocol 1 8.258.26 Chapter 8: In Vitro Amplification of DNA by PCR Nucleic Acids and Oligonucleotides Speci METHOD Amplified DNA from polymerase chain reactions Equipment DNA purification resin Optional, please see note to Step 6 Water bath preset to 75°C 1. Pool up to eight PCRs (400 ul) containing I yg of the desired amplification product. Ie nonspecific amplification products are present at significant levels (ey, are detectable by gel slectrophoress), purify the desited product by electrophoresis through low-melting temperature agarose before proceeding (please see Chapter 5, Protocol ). If ninera oil was used to prevent evaporation during PCR, centrifuge the pooled samples briefly and transfer the lower (aqueous) phase toa fresh microfuge tube. 2. Add 0.2 volume of 5x proteinase K buffer and proteinase K to a final concentration of 50 ig/ml. Incubate the mixture for 60 minutes at 37°C. 3. Inactivate the proteinase K by heating the reaction mixture to 75°C for 20 minutes. 4. Extract the reaction mixture once with phenol:chloroform and once with chloroform. Add 0.2 volume of 10 M ammonium acetate and 2.5 volumes of ethanol. Mix the solution well and store it for 30 minutes at 4°C. 100,000, are routinely used. These devices allow oligonucleotide primers up to 48 bases in length to pass through the filter, and they retain dou- 8.278.28 Chapter 8: In Vitro Amplification of DNA by PCR MATERIALS ble-stranded PCR products as small as 125 bp (Krowezynska and Henderson 1992). Longer oligonucleotides are best removed by purifying the amplified DNA by gel electrophoresis. ‘This protocol is a modified version of a method supplied by M.B. Henderson that was orig- inally described by Krowezynska and Henderson (1992) CAUTION: Please see Appendix 12 for appropriate handling of materials marked with . Buffers and Solutions Please see Appendix 1 for components of stock solutions, buffers, and reagents. Dilute stock solutions to the appropriate concentrations. Chloroform <1> Ethanol Sodium acetate (3 a0) TE (pH 8.0) Nucleic Acids and Oligonucleotides Amplification reaction products (20-200 wl) Centrifuges and Rotors Preparative centifuge or microfuge Special Equipment METHOD Centricon-100 units will fit in any ixed-angle rotor with adaptors capable of supporting 17x 150-mm tubes. The centrifuge must be capable of generating a steady force of 1000. Microcon-100 nits require a variable-speed microfuge Concentrators (Centricon-100 or Microcon-100, Amicon) Place 2 ml of TE (pH 8.0) in the reservoir chamber of a Centricon-100 unit. Carefully sepa- rate the amplification reaction products from the upper mineral oil layer by pipetting or by extraction with chloroform. ‘ransfer the amplification reaction products to the reservoir chamber of the Centricon-100 unit. Place the entire unit into an appropriate rotor of a preparative centrifuge (eg. afixed-angle rotor). Insert the microconcentrator into the centrifuge with the filtrate cup (translucent portion) toward the bottom of the rotor. Usea concentrator filed with an equivalent amount of fluid or a standard balance tube as a counterbalance. ‘A IMPORTANT Do not touch the membrane with pipette or pipette tips when loading the micro concentrator. }- Centrifuge the loaded concentrator at 1000g for 30 minutes at a temperature between 40C and 25°C. Remove the concentrator from the centrifuge, and discard the filtrate cup. Invert the unit, and replace it in the centrifuge (ie. the retentate tube should now be placed tovrard the bot- tom of the rotor). Centrifuge at 300-1000g for 2 minutes.Protocol 3: Removal of Oligonucleotides and Excess dNTPs from Amplified DNA by Ultrafiltration 8.29 5. Remove the concentrator from the centrifuges remove the retentate cup and discard the rest of the device. Transfer the fluid in the retentate cup to a fresh microfuge tube. 6. IF necessary, precipitate the sample by adding one-tenth volume of 3 M sodium acetate and 2-3 volumes of ethanol. The amplified sample is now ready for subsequent manipulation (DNA sequencing and ligation). A single centrifugation step through a Centicon-100 membrane removes ~95% of the primers and deoxynucleoties from the PCR. This process also inactivates the thermostable DNA poly- merase (presumably by absorption to the membrane). single purification step is usualy sufi- ‘ent for most subsequent manipulation steps. f necessary, trace oligonucleotide primers ean be further removed by performing second 30-minute centrifugation te. At Step 4above, empty the translucent flteate cup, reassemble the device, andl add another 2-ml aliquot of TE (pH 8.0 10 the reservoir chamber. Repeat Steps 2 through 4 ‘Smaller-sale and faster purification can be cartie out using Microcon- 100 units. The overall pro cedure is the same as that outlined above except that 400 pl of TE is added tothe reservoir char ber in Step 1, followed by 20-100 pl of PCR. Centrifugation is carried out in a variable-speed microfuge at 000g for 5-7 minutes. After inversion, the sample is transferred to the retentat cup by L-mimute spin at 300-1000. This procedure removes ~90% of the oligonucleotide primers, and deoxynucleotides and can be repested as deseribed above to obtain further purification of the amplified DNA.830 Introduction to Protocols 4-7 Cloning PCR Products Come AMPUFIED SEGMENTS OF DNA GENERATED BY PCRS into plasmid or phagemid vectors turns out to be easier said than done. Many products of PCR are recalcitrant to cloning by the usual methods because: ‘© Several of the commonly used thermostable DNA polymerases possess a template-indepen: dent terminal transferase activity (extendase activity) that results in the addition of a single, unpaired nucleotide at the 3” ends of amplified DNA fragments (Clark 1988; Mole etal. 19895, Hu 1993), The nucleotide added to the 3° end depends both on the adjacent base and on the particular DNA polymerase used during PCR (Hu 1993). For example, when the 3'-terminal base of the template DNA is cytidine, Taq polymerase will efficiently transfer an adenine residue to the end of the completed chain (Clark 1988; Hu 1993). «© Tag polymerase and presumably other thermostable DNA polymerases survive extraction with phenok:chloroform, ethanol precipitation, and other regimens commonly used to purify the products of PCRs (Crowe etal, 1991; Barnes 1992). The continuing presence of the DNA poly- ‘merase together with residual dNTPs often thwarts methods to tailor the ends of the amplified DNA for cloning. For example, the surviving DNA polymerase will fill recessed 3° termini cre ated by digestion with restriction enzymes. Undoubtedly, this carry-over explains in large part the difficulties encountered by many laboratories in cloning PCR products after digestion with restriction enzymes. Over the years, many methods — some good and some bad — have been devised to cir- cument these difficulties (for review, please see Levis 1995). These include: © Using the 3°05" exonuclease activity of bacteriophage T4 DNA polymerase ot Pfu DNA polymerase to polish the termini of PCR products that contain extended bases (Hemsley eta 1989). The polished DNAs can then be phosphorylated by T4 polynucleotide kinase and cloned into a blunt-ended dephosphorylated vector. © Cloning blunt-ended DNA fragments generated by thermostable DNA polymerases such as Pwo and Pfu, which do not exhibit terminal transferase activity and generate blunt-ended products (Hinnisdaels et al. 1996). Blunt-end cloning is notoriously inefficient. Even in the presence of large amounts of bacteriophage T4 DNA ligase, the cloning efficiency of blunt- ended DNA is 10-100-fold lower than the efficiencies attained with DNAs equipped with cohesive termini. In addition, blunt-end ligation provides no opportunity to direc the orien-Introduction t0 Protocols 4-7 831 tation of the amplified fragment of DNA within the vector. For these reasons, blunt-ended cloning of PCR products has fallen from favor in the last few years and has been largely replaced by methods that rly on ligation of cohesive ends. Using a linearized plasmid vector fitted with a protruding 3° thymidylate residue at each of its 3° termini, These T vectors are used to clone DNA fragments that carry a nontemplated, unpaired deoxyadenosy! residue at their 3” termini (Holton and Graham 1991; Hengen 1995a) A single unpaired 3° thymidine residue may not seem like much of a cohesive end, but itis enough to provide a strong toehold for the unpaired adenine residue on DNAs amplified in PCRs catalyzed by Tag or any other thermostable DNA polymerase that adds 3° adenosyl over- hangs. Cloning into T vectors is reportedly 50 times more efficient than blunt-end cloning of amplified DNA fragments (Holton and Graham 1991; Marchuk et al, 1991). This is almost equal to the efficiency of cloning that can be achieved with DNAs whose 3° protrusions are a ‘more respectable length. ‘# Adding restriction sites to the 5” termini of the oligonucleotides used to prime PCR. These primer-specific restriction sites are transferred to the termini of the target DNA during ampli fication (Scharf et al. 1986) and can then be cleaved with appropriate restriction enzymes to generate amplified segments of DNA with cohesive termini, Because the restriction sites may be identical or different in the two primers, this modification allows the investigator to tailor the termini of the amplified DNA fragment to the vectors best suited to the task at hand. For years, this method of cloning PCR products was plagued with traps that, if not avoid ed, would ensnare entire experiments and visit sharp misery upon the investigator. These included the inability of some restriction enzymes to cleave sites efficiently near the termini of DNA molecules and the possible presence of internal restriction sites within amplified DNAs whose internal sequences were unknown (Crouse and Amorese 1986; Jung et al. 1990: Kaufman and Evans 1990). The problems have largely been solved by improving the design of oligonucleotide primers; by understanding the strengths and limitations of restriction enzymes; by converting terminal restriction sites to internal sites by concatemerization of amplified DNAs; and by devising better methods to eliminate primers, dNTPs, and ther- mostable DNA polymerase from the amplified product before digestion with restriction enzyme(s). For a more detailed discussion, please see the introduction to Protocol 6. In addition to the basic methods discussed so far, large variety of more esoteric techniques to clone amplified fragments of DNA have been described in hundreds of papers published over the years, These techniques include ligation-independent cloning (Aslanidlis and de Jong 1990; Shuldiner et al, 1991; Haun et al. 1992; Kaluz and Flint 1994; Temesgen and Eschrich 1996; Shuldiner and Tanner 1997), UDG cloning (Nisson et al. 1991; Rashtchian etal. 1992; Smith etal 1993; for review, please see Levis 1995), directional cloning using exonuclease III (Kaluz etal 1992), in vivo cloning (Jones and Howard 1991; Oliner et al, 1993), and turbo cloning (Boyd 1993), Many of these methods require special strains of E.coli, particular vectors, oligonucleotide primers that contain modified bases, and/or the use of several different enzymes. Although these ‘methods under special circumstances may have some advantage, it is difficult to think of cloning predicaments where the use of occult techniques would be obligatory. The following four protocols describe how to clone amplified fragments of DNA by blunt- ‘end ligation (Protocol 4), annealing to T vectors (Protocol 5), and addition of terminal restriction sites (Protocol 6) and by use of the principles of genetic engineering (Protocol 7).Protocol 4 Blunt-end Cloning of PCR Products Te FOLLOWING ELEGANT AND SIMPLE PROTOCOL FOR POUSHING the termini of amplified DNA, adapted from Weiner (1993) and Chuang et a. (1995), builds on the earlier work of Liu and Schwartz (1992), who showed that incubation of a ligation reaction in the presence of an excess amount of restriction enzyme can dramatically increase the yield of recombinant plasmids, The role of the restriction enzyme isto cleave circular and linear concatemers at restriction sites that are regenerated when plasmid molecules ligate to themselves. The method requires that ligation of the plasmid to a target DNA molecule destroy the restriction site. This prevents the restriction enzyme from destroying recombinants generated during the ligetion reaction. The net effect of constant reclamation of unit-length linear vector molecules isto drive the equilibrium of the lig- ation reaction strongly in favor of recombinants between vector and insert. The method is efficient because regeneration of vector DNA, ligation, and polishing the ter ini of PCR-generated fragments of DNA all occur sinmultaneously in the same reaction mixture MATERIALS, CAUTION: Please see Appendix 12 for appropriate handling of materials marked with . Buffers and Solutions Please see Appendix 1 for components of stock solutions, buffers, and reagents. Dilute stock solutions to the appropriate concentrations. ATP (30 mw NTP solution (2 mut) containing all four dNTPs 10x Universal KGB buster 1 potassium acetate 150 mM Tris-acetate (pH 7.6) 100 mst magnesium acetate tetrabydrate 5 mM Bemercaptoethanol 100 ugiml bovine serum albumin Enzymes and Buffers Bacteriophage T4 DNA ligase Bacteriophage T4 DNA polymerase Do not use the Klenow fragment of E.coli DNA polymerase as a polishing enayme because it carries an ‘endogenous terminal transerase activity 832Protocol 4: Blunt-end Cloning of PCR Products 833, Restriction endonuclease for cloning “The restriction enzyme should generate blunt end, cleave the vector once, and na leave the amplified DNA (please ee Step 1) Restriction endonucleases ease ce Step 4 Gels Agarose gel Please sce Step 5 Nucleic Acids and Oligonucleotides Closed circular plasmid DNA (50 ygim!) Choose plasmid vector containing a single sit fora restvcton enzyme that generates blunt ends (eg Smal Sl and EcoRV). The restriction site should not be present inthe amplified DNA. and gation of te target fragment othe vector should not regenerate the restiction site. Among the plasmid vectors thatare commonly used for cloning of blun-ended PCR products are the Bluesrpttype plasmids and plasmids containing abbreviated multiple coning ses (eg, pCR-Srit Diet, Stratagene). The pls- mn vector and its bacterial host should carry a bluelwhite seeing system, Target DNA (25 ygim, amplified by PCR ‘When the PCR mixture contains more than one or two bands of amplified DNA, pith target Frage ment by electrophoresis through low meling/elling temperature agarose (please see Chapter 5, Protocol 6) not purified by ge electrophoresis, PCR-amplified DNA shouldbe prepared foe ligation by extraction with phenokchloroform and ultraftration through a Centicon-100 fier (please see Protocol 3}. Special Equipment Water bath preset 10 22°C Additional Reagents Step 3 af this protocol requires the reagents listed in Chapter 1, Protocol 25 or 26 and Protocol 27. Step 4 of this protocol may require the reagents listed in Protocol 12 of tis chapter. Step 6 ofthis protocol requires the reagents listed in Chapter 12, Protocol 6, or Chapter 6, Protocol 10. METHOD a 1 icrofuge tube, mix the following in the order shown: 50 gil closed circular plasmid vector Lal 25 ug/ml amplified target DNA 8ul 1c universal KGB butfer 24 H.0 [please see note below) Sul omc ATP. nl 2 mst dNTPs al restriction enzyme 2units TADNA polymerase Tunic TA DNA ligase 3 units ‘Adjust the amount of HO added so that the final reaction volume is 20 yl Set up a control reaction that contains all of the reagents listed above except the amplified target DNA.8.34 Chapter 8: In Vitro Amplification of DNA by 2. Incubate the ligation mixture for 4 hours at 22°C Te restriction enzyme cleaves the plasmid DNA; the 3'-exonuclease activity of T4 DNA poly: ‘merase polishes the ends ofthe amplified DNA inthe presence of NTP. 3. Dilute 5 ul of each of the two ligation mixtures with 10 yl of H,O and transform a suitable strain of competent E. coli to antibiotic resistance as described in Chapter 1, Protocol 25 or 26, Plate the transformed cultures on media containing IPTG and X-gal (please see Chapter 1, Protocol 27) and the appropriate antibiotic. 4, Calculate the number of colonies obtained from each of the ligation mixtures. Pick a num- ber of white colonies obtained by transformation with the ligation reaction containing the target DNA. Confirm the presence of the amplified fragment by (i) isolating the plasmid [DNAs and digesting them with restriction enzymes whose sites flank the insert in the multi- ple cloning site or (ii) colony PCR (Protocol 12). 5, Practionate the restricted DNA by electrophoresis through an agarose gel using appropriate DNA size markers. Measure the size of the cloned fragments 6. Confirm the identity of the cloned fragments by DNA sequencing, restriction mapping, or Southern hybridization,Protocol 5 Cloning PCR Products into T Vectors MATERIALS cient method to clone PCR products into a vector (TT vector) containing a complementary unpaired 3’ thymidyl residue (Holton and Graham 1991; Marchuk et al. 1991). T vectors may be created by the following three methods (Mezei and Storts 1994): 4 Digest a vector with restriction enzymes such as Xonl, Hpkl, and MiolT that generate 3’ter minal unpaired deoxythymidine residues (Kovalic et al. 1991; Mead et al. 1991; Chuang etal 1995; Borovkov and Rivkin 1997). ‘© Use terminal transferase and dideoxy TTP to add a single protruding T residue to the 3° termi ni ofa linearized vector (Holton and Graham 1991). «Use the template-independent terminal transferase activity of Taq DNA polymerase to catalyze the addition of a T residue to the terminal 3’-hydroxyl groups of a linearized vector (Marchuk etal, 1991), Alternatively, T vectors can be purchased ready-made from many commercial suppliers as components of cloning kits (eg., pCR-Script [SK+] from Stratagene; pCRII in the TA Cloning kit from Invitrogen; pGEM-T from Promega) (Hengen 1995a). Enzymes and Buffers Gels Bacteriophage T4 DNA ligase Agarose gel Pease see Sep 5 Nucleic Acids and Oligonucleotides Target DNA (25 ugim), amplified by PCR ‘When the PCR mixture contains more than one or two bands of amplified DNA, purify the target rag ment by electrophoresis through low meltinglgeling temperature agarose (please see Chapter 5, Uy8.36 Chapter 8: In Vitro Amplification of DNA by PCR Vectors Protocol 6). 1 not purified by gel electrophoresis, PCR-amplified DNA should be prepared for ligation by extraction with phenokchloroform and ultrafiltration through 2 Centricon-100 filter (please see Protocol 3) T vector For an outline of the generation of T vectors, please see the introduction to this protocol. T vectors and Target DNAs tend to lose the unpaired 3" residues when frozen and thawed many times, Special Equipment Water bath preset t0 14°C Additional Reagents METHOD _ Step 3 of this protocol requires the reagents listed in Chapter 1, Protocol 25 or 26 and Protocol 27. Step 6 of this protacol requires the reagents listed in Chapter 12, Protocol 6, or Chapter 6, Protocol 10. - Ina microfuge tube, set up the following ligation mixture: 25 ng/ml amplified target DNA, tal Tiled plasmid 20g 10 ligation buter al bacteriophage T' DNA ligase Suits HO 010 If necessary add ATP toa final concentration of | mM. A 1:5 molar ratio of vectoramplified DNA, Jragment is recommended. Set up a control reaction that contains all the reagents listed above except the amplified tar get DNA. . Incubate the ligation mixture for 4 hours at 149 - Dilute 5 ul of each of the two ligation mixtures with 10 jl of H,O and transform a suitable strain of competent E, coi to antibiotic resistance as described in Chapter 1, Protocol 25 or 26, Plate the transformed cultures on media containing IPTG and X-gal (please see Chapter 1, Protocol 27) and the appropriate antibiotic. Calculate the number of colonies obtained from each of the ligation mixtures. Pick a num ber of white colonies obtained by transformation with the ligation reaction containing the target DNA. Confirm the presence of the amplified fragment by (i) isolating the plasmid DNAs and digesting them with restriction enzymes whose sites flank the insert in the multi ple cloning site or (i) colony PCR (Protocol 12). The ratio of blue:white colonies varie between 1 and 2:1 -Fractionate the restricted DNA by electrophoresis through an agarose gel using appropriate DNA size markers. Measure the size ofthe cloned fragments Confirm the identity of the cloned fragments by DNA sequencing, restriction mapping, or Southern hybridizationProtocol 6 Cloning PCR Products by Addition of Restriction Sites to the Termini of Amplified DNA P... OF OLIGONUCLEOTIDE PRIMERS USED IN PCR are often designed with restriction sites in their 5° regions. In many cases, the sites are different in the two primers. In this case, amplifica- tion generates a target fragment whose termini now carry new restriction sites that can be used for directional cloning into plasmid vectors (Scharf et al. 1986; Kaufman and Evans 1990). The purified fragment and the vector are digested with the appropriate restriction enzymes, ligated together, and transformed into E. col (please see Figure 8-3) For years, this method of cloning PCR products was beset with technical difficulties, Fortunately, most of these problems have been solved, bringing great improvements in both the efficiency and reproducibility of the technique. However, beware of the following pitfalls. ‘© Many restriction enzymes fail to cleave recognition sequences located close to the ends of DNA fragments, particularly those generated by PCR (eg, please see Kaufmann and Evans 1990; Larrick 19925 Jung etal. 1993; Rychlik 1995; Zimmermann et al. 1998). ‘© The presence of residual polymerase activity and dNTPs after cleavage of the PCR product by restriction enzymes can regenerate a blunt-ended DNA. ‘# The presence in the reaction mixture of residual single-stranded primers or double-stranded primer-dimers may reduce the efficient cleavage of terminal restriction sites in amplified DNA molecules, Solutions to these problems lie in the design of the oligonucleotide primers, the choice of restriction enzymes, and, as described above, in the elimination of primers, dNTPs, and ther- mostable DNA polymerase from the amplified product before digestion with restriction enzyme(s). Listed below are some helpful hints for designing primers. ‘© Wherever possible, design primers that create a different restriction site on each end of the amplified DNA. Directional cloning can then be used to attach the fragment to an appropri ately prepared plasmid ‘© Many restriction enzymes fail to cleave recognition sequences located close to the ends of DNA fragments, particularly those generated by PCR (e.., please see Crouse and Amorese 1986; Ho et al. 1990; Jung et al. 1990, 1993; Kaufman and Evans 1990; Larrick 1992; Rychlik 1995; ‘Zimmermann et al. 1998). Wherever possible, avoid using restriction enzymes such as Hindill, 8378.38 (Chapter 8: In Vitra Amplification of DNA by PCR y, ae a GGTACCNNN 8 —CCATEGNNN Cigect wih Hina anes Koo! Soot cr ° Sacer crac! ar FIGURE 8-3 Cloning PCR Products by Addition of Restriction Sites Specific PCR primers (represented by arrows) are designed to ampliy region of interest with the desired recognition sequence for the restriction endonuclease included at the 5” end of the primer. The sense- strand primer contains the sense strand of a restriction site, and the antisense primer contains the com plementary sequence of 2 second restriction site. (A) To achieve high efficiency digestion, additional ‘nucleotides must be included on both sides of the restriction endonuclease sequence. In this example, proper recognition and culting requires atleast three additional bases on either side of the Hindll site, and atleast two additional nucleotides on either side ofthe Kpal site. (:) Amplification by PCR produces a specitic product with an Hind site atthe 5’ end and a Kpnl site atthe 3° end. (C) Digestion with Hindi and Kpnl produces a PCR product that can be cloned directionally. Sall, Xbal, Xhot, and Nott, which are known to cleave terminal and subterminal recognition sites inefficiently, The catalogs of many commercial suppliers of enzymes (e.g., New England Biolabs) contain information about the efficiency of cleavage of these sites by restriction enzymes (see Appendix 4). Wherever possible, avoid using restriction enzymes that display “star” activity ‘© Wherever possible, avoid using restriction sites that are known to occur naturally within the amplified segment of DNA. If the location and type of restriction sites are unknown, use restriction enzymes that are known to cleave the particular species of DNA very rarely. ‘© Design a “clamp” sequence at the extreme 5° ends of the oligonucleotide primers to hold together the ends of the amplified DNA and to provide an adequate toehold for the restriction ‘enzymes, Unfortunately, there is no agreement about the minimal number of additional bases required to stabilize the termini of the amplified DNA. Early estimates ranged from 4 (Jung et al. 1990) to 20 (Ho et al. 1990) additional bases. More recent data (Zimmermann et al. 1998) suggest that in most cases, only 3 additional bases are required for efficient digestion by a vari- ety of restriction enzymes. Perhaps the best advice is to add as many bases as reason and bud- get will allow to the 5° ends of the oligonucleotide primers.cloning PCR Products by Addition of Restriction Sites to the Termini of Amplified DNA 8.39 Prowoco! 6: MATERIALS. CAUTION: Please see Appendix 12 for appropriate handling of materials marked with . Buffers and Solutions Please see Appendix 1 for components of stock solutions, buffers, and reagents. Dilute stock solutions to the appropriate concentrations. Chloroform <1> EDTA (0.5 M, pH 8.0) Ethanol Phenol:chloroform (1:1, viv) Sodium acetate (3 M, pH 5.2) TE (pit 7.5) Enzymes and Buffers Bacteriophage T4 DNA ligase Restriction endonucleases, Gels Agarose gel Please see Step 12 Nucleic Acids and Oligonucleotides Forward primer (20 uM) in H,0 and Reverse primer (20 yt) in HO Design forward and reverse primers carrying the appropriate restriction sites, The 3” end ofeach primer should be an exact complement of ~15 consecutive bases ata selected sit in the target DNA. The 3’ ter: ‘minus of each primer serves asa clamp to hold together the termini ofthe amplified DNA and to pro Vide a landing site for the restrition enzyme. The camp should be 3-10 nucleotides in length. The mid Portion of the primer contains the recognition site for the restriction enzyme. Each primer should there fore be 24-31 mucleotides in length and contain approximately equl numbers ofthe four bases, with a balanced distribution of G and C residues and a low propensity to form stable secondary structues. For further details, please se the introduction to this protocol andthe introduction to this chapter (Design ‘of Oligonucleotide Primers for Basic PCR). (Oigonucleotige primers synthesized on an automated DNA synthesizer can generally be used in stan dlard PCR without further purification, Target DNA Vectors Plasmid DNA cleaved with the appropriate restriction enzyme(s) and purified by gel electrophoresis, Ifthe linearized plasmid DNA carries compatible termini that can be ligated to each other use alkane phos- phatase to remove the 3 phosphate groups and suppress el-ligaton {please see Chapter 1, Protocol 20) Special Equipment Water bath preset to 16°C Water bath preset to optimum temperature for the restriction endonuclease digestions Pease see Step 3. Additional Reagents Step 1 of this protocol requires the reagents listed in Protocol 1 of this chapter. Step 10 of this protocol requires the reagents listed in Chapter 1, Protocol 25 or 26 and Protocol 27. Step 11 of this protocol may require the reagents listed in Protocol 12 of this chapter. Step 13 of this protocol requires the reagents listed in Chapter 12, Protocol 6, or Chapter 6, Protocol 10.840° Chapter 8 In Vitro Amplification of DNA by PCR METHOD 1. Use forward and reverse primers designed as outlined in the Materials section of this proto- col to set up and carry out four identical amplification reactions (50-4 volume) to amplify the target fragment (please see Protocol 1). Combine the four PCRs, which, in aggregate, should contain 200-500 ng of the desired amplification product. 2, If the PCR mixture contains more than one or two bands of amplified DNA, purify the tar get fragment by electrophoresis through low melting/geling temperature agarose (please see Chapter 5, Protocol 6) Ifnot purified by gel electrophoresis, prepare PCR-amplified DNA for ligation by extraction with phenok:chloroform and ultrafiltration through a Centricon-100 filter (please see Protocol 3), Dissolve the purified product in TE (pH 7.5) at a concentration of 25 g/ml. 3. Ina reaction volume of 20 ul, digest ~100 ng of purified PCR product with 1.02.0 units of the relevant restriction enzyme(s). Incubate the reactions for | hour at the optimum tem- perature for digestion, 4, At the end of the digestion, adjust the volume of the reaction mixture to 100 pl with HO, and add 0.5 M EDTA to final concentration of 5 mit, Extract the reaction mixture once with phenok:chtoroform and once with chloroform, 5 Transfer the aqueous phase to a fresh tube and add 3 M sodium acetate (pH 5.2) to achieve a final concentration of 0.3 M, Add 2 volumes of ethanol. Store the mixture for 30 minutes at we, 6. Recover the precipitated DNA by centrifugation at maximum speed for § minutes at 4°C in microfuge. Discard the supernatant, and then wash the pellet with 70% ethanol. Centrifuge the solution again, remove the supernatant, and allow the pellet of DNA to dry in the air for a few minutes. 7. Dissolve the DNA in 10 pl of H,O. 8. In a microfuge tube, set up the following ligation mixture: 25 ugim amplified target DNA Lou plasmid DNA. 20g 10x tigation butfer 10ul 4 DNA ligase Vunit HO wo 104 UFnecessay,add ATP toa final concentration of 1 mv ‘When directional cloning s used the gation mseure should contain an ~121 malar aio ofp fed target DNA to cleaved plasmid vector. Set up a control reaction that contains all the reagents listed above except the amplified tar- get DNA 9. Incubate the ligation mistures for 4 hours at 16°C. 10. Dilute 5 pl of each of the two ligation mixtures with 10 yl of H,O and transform a suitable strain of competent E. coli to antibiotic resistance as described in Chapter 1, Protocol 25 or 26, Plate the transformed cultures on media containing IPTG and X-gal (please see Chapter 1, Protocol 27) and the appropriate antibiotic.Protocol 6: Cloning PCR Products by Addition of Restriction Sites to the Termini of Amplified DNA 841 11. Calculate the number of colonies obtained from each of the ligation mixtures. Pick a num: ber of white colonies obtained by transformation with the ligation reaction containing the target DNA. Confirm the presence of the amplified fragment by (i) isolating the plasmid [DNAs and digesting them with restriction enzymes whose sites flank the insert in the multi- ple cloning site or (i) colony PCR (Protocol 12). In diferent experiments the ratio of blue-white colonies can vary between [:5 and 21 12, Fractionate the restricted DNA by electrophoresis through an agarose gel using appropriate DNA size markers. Measure the sizeof the cloned fragments. 13. Confirm the identity of the cloned fragments by DNA sequencing, restriction mapping, oF Southern hybridization, TROUBLESHOOTING The absence of transformed, white colores containing the PCR product of interest may be due 1 low | efficiencies of transformation or inetcient ligation. For each experiment, include a positive control to | monitor the efciency of transformation of the preparation of competent E col. Contr tha the con | centrations of vector and tanget DNAS are correct by analyzing Samples of the igaton matures and con- trols using gel electrophoresis | | high background of nonecombinant colores is most likely du to incomplete cleavage ofthe vee: [ by etcon eneProtocol 7 Genetic Engineering with PCR Ti PROTOCOL (PROVIDED BY STEFAN ANDERSSON, UNIVERSITY OF TEXAS Southwestern Medical Center, Dallas) describes a method to introduce simultaneously restriction endonuclease sites at the 5’ and 3° ends of a cloned mammalian cDNA and to change several codons at the 5° end of the cDNA to those preferentially utilized in E, coli. These types of end modifications are fre quently used in engineering cDNAs, or genes, before cloning in various eukaryotic and prokary otic expression vectors (please see Chapters 15 and 16). Additional methods for modifying the ends of DNA molecules are described in the panel belove | MORE STRATEGIES FOR MUTAGENESIS The variations on end modification of DNA are numerous Several lever strategies use tis type of aplifica fon reaction in sitediected mutagenesis, For example, Hersey et al (1989) describe a meat form of inverse PCR in which the starting plasmid vector and the insert to be mated are ampli atthe sae tne The oligonucleotide primers conan the mtatons or modcations fe incorporated int the cDNA or gene and proced outward from two adjacent maceoties in the target DNA. Te ampifiaon reaction proces linear predicts om the crclr plasmid DNA. nraoleculrligition of the pdics gies rise Yo crue roles, which can be used to transform Eco, proportion of which contain the desed changes. This method works wel for repeated mutagenesis of a previously constructed expression vector. The procedure patently sues rom two drawbacks: the overall size iit ofthe PCR (~# Kb) athe tendency of some | thermostable DNA polymerases toad unpaired nocleatide resides tothe 3° ends of apiied DNA. long | | PCR protocol can overcome the size mit problem (pease see Protocol 13) (Barnes 1994) Several remedies | to the later problem are discussed inthe intradction to Protocol 1 End meciicaton canbe combined with standard bacterophage M3 site-specific mutagenesis please | sce Chapter 13, Protocol) o enact domain swaps between diferent proteins (lackson and Winter 1989) | and to create CDNA or gene chimeras via overlap extension (Horton etl. 1950. Faly a deletion can aso beinzoiced int a clned ragment of DNA by tse ofverse PCR ane two olgoneode primers tha abut | eis deletion endpoints aie al. 199). | 842Protocol 7: Genetic Engineering with PCR 843 MATERIALS A IMPORTANT To reduce the chance of contamination with exogenous DNAS, prepare and use a special set of reagents and solutions for PCR only. Bake all glassware for 6 hours at 150°C and autoclave all plasticware, For more information, please see the panel on CONTAMINATION IN PCR in the chapter introduction, CAUTION: Please see Appendix 12 for appropriate handling of materials marked with . Buffers and Solutions Please see Appendix 1 for components of stock solutions, buffers, and reagents. Dilute stock solutions to the appropriate concentrations. 10x Amplification buffer NTP solution (20 mM) containing all four dNTPs (pH 8.0) Enzymes and Buffers Appropriate restriction endonucleases Thermostable DNA polymerase Gels Agarose or Polyacrylamide gel <1> Please see Step 5 Nucleic Acids and Oligonucleotides Oligonucleotide primer 1 (10 jw) in TE (pH 8.0) and Oligonucleotide primer 2 (10 ua) in TE (pH 8.0) Positive control DNA Template DNA The template DNA could be, for example, a cloned gene or cDNA in a vector of genomic DNA. Vectors Vector DNA cleaved with the appropriate restriction enzyme(s) and purified by gel electrophoresis Ifthe restricted vector DNA carries compatible termini that can be ligated to each other, use alkaline Phosphatase to remove the S-phosphate groups and suppress selfligation (please see Chapter 1, Protocol 20), Special Equipment Barrier tips for automatic micropipetting device Microfuge tubes (0.5 ml, thin-walled for amplification) or Microtter plates Positive-displacement pipette Thermal cycler programmed with desired amplification protocol Ifthe thermal cycler is not equipped with a heated ld, use either mineral oil or paraffin wa to prevent ‘evaporation of liquid from the reaction misture during PCR, Additional Reagents ‘Step 5 of tis protocol requires the reagents listed in Chapter 5, Protocol 2, Chapter 12, Protocol 6, or Chapter 6, Protocol 10. ‘Step 6 of this protocol requires the reagents listed in Protocol 3 of this chapter. ‘Step 7 of this protocol requires the reagents listed in Protocol 6 of this chapter.844 Chapter 8: In Vitro Amplification of DNA by PCR _METHOD 1. Design and synthesize the appropriate oligonucleotide primers for the end modifications desired. Jn this example, two primers derived from the 5° sequence (5° dATCATATGGCICTGGATGA ACTGTGCCTGCTGGACATGCT 3° and the 3” sequence (5 dATAAGCETITATTAAGACAGAC TCAGCTCATGGGAGGCAA 3") of the starting cDNA template are used to introduce an Niel (CATATG) site atthe end af the cDNA and to change several codons to those preferentially used inf. co. The underlined nackeoties indicate differences between the oligonucleotide primers and the CDNA template. The numberof perfectly matched nucleotides equired at the 3 end of the ‘oligonucleotide primers for a sucessful amplification has not been rigorously determined: Howey cf, cight to ten generally work well 2. Ina sterile 0.5-ml microfuge tube, amplification tube, or the well ofa sterile microtiter plate, ‘mix inthe following order: 100 ng template DNA ton 0xamplification ber Sul 20 mt solution of four UNTPS Sul unt primer 1 (50 pms) Sul Out primer 2 (50 poles) Sul 1-2 units of thermostable DNA polymerase Int Ho to 5040 Set up two control reactions. In one reaction, include all of the above additions, except the template DNA. In the other reaction, include a DNA template that has previously yielded a positive result in the PCR. Carry the controls through all subsequent steps of the protocol. 3, Ifthe thermal cycler is not fitted with a heated lid, overlay the reaction mixtures with 1 drop (50 1!) of light mineral oi. This prevents evaporation of the samples during repeated cycles of heating and cooling, Alternatively, place a bead of wax into the tube if using hot start PCR. Place the tubes or the microtiter plate in the thermal cycler. 4. Amplify the nucleic acids using the denaturation, annealing, and polymerization times and temperatures listed in the table. Gye Number Denaturation Annealing/Polymerization 1 min at 94°C, 3 min at 68°C 1 min at 94°C 15 min at 68°C ‘These times are suitable for 50-u reactions assembled in thin-walled 0,5-ml tubes and incubated in thermal cyclers such asthe Perkin-Elmer 9600 or 9700, Master Cycler (Eppendorf), and PTC. 100 (MI Research). Times and temperatures may need to be adapted to suit other types of equip ‘ment and reaction volumes. 20 cycles Last cycle A small numberof cycles are performed to decrease the chance of introducing spurious mutations 5. Analyze 5-10% of the amplification on an agarose or polyacrylamide gel and estimate the concentration of the amplified target DNA. Be sure to include DNA markers of an appropri ate size. Stain the gel with ethidium bromide or SYBR Gold to visualize the DNA. A successful amplification reaction should yield a readily visible DNA fragment of the expected size, The identity of the band can be confirmed by DNA sequencing (please see Chapter 12), Southern hybridization (please see Chapter 6), and/or restriction mapping,Protocol 7: Genetic Engineering with PCR 8.45, 6. If mineral oil was used to overlay the reaction (Step 3), remove the oil from the sample by extraction with 150 ul of chloroform, The aqueous phase, which contains the amplified DNA, will form a micelle near the meniscus. The micelle can be transferred toa fresh tube with an automatic micropipette For many purposes, for example, purification ofthe amplified DNA using a Centricon microcon- centrator o cloning amplification products, itis desirable to remove the oll rom the sample before proceeding. A IMPORTANT Do not attempt chloroform extractions in microtiter plates. The plastic used in these plates isnot resistant to organic solvents 7. For subsequent cloning, cleave the DNA fragment at the restriction sites placed (or located) at the 5” ends of the primers (with Ndel and Hindlll in the above example). Purify the digest- ed fragment using gel electrophoresis or ultrafiltration (please see Protocol 3). 8. Set up the appropriate ligation reaction with the desired vector DNA. Use @ molar ratio of insert to vector of 3:1 in the ligation reactions. Because ofthe eror rate of thermostable DNA polymerases, itis very important verily the sequence ofthe amplified DNA afer cloning into the expression vector. TROUBLESHOOTING ‘The most common result in a failed reaction i the appearance of @ smear of bands on the thir bro- ride-staned gl. This usually due to the use of tex much input template DNA. this situation, cary | Cut several plot PCRS in which the amount of input DNA is varied over at east a 1OOold range ic 1100 ng.Protocol 8 Amplification of cDNA Generated by Reverse Transcription of mRNA 8.46 R EVERSE TRANSCRIFTASE-PCR (RT-PCR) 15 A METHOD used to amplify cDNA copies of RNA. Sensitive and versatile, RT-PCR is used to retrieve and clone the 5” and 3 termini of mRNAs and to generate large eDNA libraries from very small amounts of mRNA. In addition, RT-PCR can be easily adapted to identify mutations and polymorphisms in transcribed sequences and to measure the strength of gene expression when the amounts of available mRNA are limited and/or when the RNA of interest is expressed at very low levels. ‘The literature is abundantly adorned with descriptions of variants of RT-PCR, many of which have their own acronym. The technical details may vary from one paper to the next, but the underlying concepts are constant and relatively simple: In every case, the first step is the enzy- matic conversion of RNA to a single-stranded cDNA template. An oligodeoxynucleotide primer is hybridized to the mRNA and is then extended by an RNA-dependent DNA polymerase to cre- ate a cDNA copy that can be amplified by PCR. Depending on the purpose of the experiment, the primer for fist-strand cDNA synthesis can be specifically designed to hybridize to a particular target gene or it can bind generally to all mRNAs (please see Figure 8-4). ‘© Oligo(dtT), which binds to the endogenous poly(A)’ tails of mammalian mRNAs, can be used a8 4 universal primer for conventional first-strand cDNA synthesis, Subsequent amplification by PCR generally utilizes one or more internal, gene-specific primers and oligo(dT) to generate copies ofthe 3-terminal sequences of a particular mRNA (3'-RACE; please see Protocol 10) ‘© cDNA synthesis can be primed by a synthetic antisense oligonucleotide that hybridizes specif: ically to a chosen region in a particular target RNA oF family of mRNAs. Amplification of the desired portion of cDNA can be achieved in PCRs primed, for example, by sense and antisense oligonucleotide primers corresponding to specific sequences in particular cDNAs. For maxi- mum specificity the antisense primer should be located upstream of the oligonucleotide used to prime cDNA synthesis. ‘Wherever possible oligonucleotides that bind to sequences located in different exons of the target RNA should be used as sense and antisense primers for amplification of the DNA prod- uct. In this way, amplification products derived from cDNA and contaminating genomic DNA. can be easly distinguished. However, transcripts of intronless genes cannot be differentiated ‘unambiguously from contaminating genomic sequences. In these circumstances, treating the RNA preparation with RNase-free DNase may be helpful (Grillo and Margolis 1990; please see Chapter 9, Protocol 8).Protocol 8: Amplification of cDNA Generated by Reverse Transcription of MRNA 8.47 RNA isolation in, ns, tnt CONA synthesis, random hexamer priming gene-specific priming aigotar) peiming rere SHAH, rere HARA emer AHA oe ai wae ; ; ata ftom horas REI IN, a Moon, TATE an ‘ + ' POR amplification PCR ampitication PCR amplification cycle cycle 1 cycle 1 y 4 iid a “En ee seine ei 1 1 cycle 2 cycle coyole2 contnuad hemacjtng FIGURE 8-4 Schematic Representation of Various Methods for the Amplification of RNA by PCR _ ‘The first-strand synthesis of cDNA may be primed using either a gene-specific primer (GSP), oligotdT), or a random hexamer sequence. Second-strand synthesis (amplification cycle 1) is primed withthe sense primer. Amplification of cDNA continues in the presence of both sense and antisense primers. (Modified, with permission, from Dieffenbach and Dveksler 1995.) ‘¢ Random hexanucleotides, which are capable of priming cDNA synthesis at many points along RNA templates, generate fragmentary copies ofthe entire population of RNA molecules. They are useful when the target RNA is extremely long or contains so much secondary structure that cDNA synthesis cannot be efficiently primed by oligo(dT) or synthetic oligonucleotide(s) (Lee and Caskey 1990). Because all mRNAS in the population can serve as templates, gene-specific848° Chapter 8: In Vitro Amplification of DNA by PCR amplification is achieved by using sense and antisense primers targeted to sequences in the «DNA. In most cases, investigators aim to generate a first strand of cDNA that is as long as posi ble and contains a high proportion of molecules complementary to the target RNA. Synthetic gene-specific oligonucleotides that bind to the 3“-untranslated regions of the target MRNA are therefore the primers of choice. Oligo(¢'l) is the next best option, and random hexamers, which have no specificity and generate both long and short molecules of CDNA, are used when the other ‘methods of priming fail A second primer and a thermostable DNA polymerase are then added for the subsequent, PCR-driven amplification step. Positive and negative controls should always be included when setting up RI-PCRS, Negative controls are generated by omitting essential components of the RT stage of the RT-PCR, Positive controls, however, are much trickier because they require standards that can be transcribed into cDNA and amplified in parallel with the authentic target sequence. Ideally, these standards should consist of known amounts of a synthetic RNA transcribed in vitro REVERSE TRANSCRIPTASES USED IN RT-PCR ] The dscovery of DNA-dependent RNA pohmerasas in 1970 solved the long landing puzl of how the RNA genomes of etn tumor vases could be copied into DNA in infect andr tanskrmed cel Baltimore 1970; Teminand Mutant 1970), The name reverse tanspase as coed as ajoke by J Toe who fs used tin an anonymous Nes nd Views atin Nature: Much othe annoyance of pur andthe delight bere, he name stckand qu became on Tre forms of RNA-depondent ONA polymerases ae row use nv t aay the sys of DNA completa tan RNA temple: ‘+ Mesophilic enzymes encoded by avian myeloblastoss virus (AMV) and the Moloney strain of murine leukemia virus (Mo-MLN). Both enzymes require an RNA or DNA template with an RNA or DNA primer bear Inga 3 hydroxy! group. Lacking an editing 35° exonuclease activity, both enzymes are prone to eror. The ‘values for their ANTP substrates are very high, in the millimolar range. To ensure complete transcription "Template RNAS, it is essential to include a high concentration of NTPs in the reaction. ‘The enzyme encoded by AMV has a poweriul RNase H activity that can digest the RNA moiety of RNA- [DNA hybrids and can cleave the template near the 3" terminus ofthe growing DNA strand if reverse tran Scripta pauses during synthesis (Kotewicz etal. 1988). Thus, the high level of RNase H activity associat ced with the avian reverse transcriptase ends to suppress the yield of cDNA and restrict its length (fr fur ther details, please see the inormation panel on RIBONUCLEASE H). The murine enzyme is far better suited for RTPCR because is RNase H activity is comparatively weak (Gerard etal. 1997), However, the Mo-MLV enzyme reaches maximum activity a a lower temperature (37°O) than the avian enzyme (42°C), which may bea sight disadvantage i the RNA template has a high degree of secondary structure. «+ Variants of Mo-MILV reverse transcriptase that lack RNase H activity. Several such enzymes are sold com: ‘mercially (e.g, Superscript from Lie Technologies and SialScrip rom Stratagene). The modified reverse ‘ranscripases transcribe a greater proportion of the template molecules and synthesize longer cDNA mol «ecules than the wildtype enzyme (Gerard etal. 1988, 1997; Kotewicz et al. 1980; Telesnitsky and Goff 1993). In alton, they ae capable of CDNA synthesis at high temperatures (up to 50°C in some cases} \hich is an advantage when the template RNA is rucked into secondary structures, ‘+ Thermostable Tth DNA polymerase, which is encoded by the thermophilic eubacterium Thermus ther _mophits and exhibits reverse transcriptase activity in the presence of Mn (Myers and Gelfand 1991). The Chief advantage of using Tth polymerase in RT-PCR is that hoth phases ofthe reaction (reverse transcription and amplification) are carried out inthe same reaction tube (Myers tal, 1994). In our view, this increase in convenience is no sufcient to compensate forthe disadvantages of Th polymerase, which are thatthe average sizeof the CDNA synthesized by th is only ~1-2 kb, far less than can be achieved with Mo-MLV reverse transcriptase (~10 kb); in adltion, the use of Mn?" is a worry because ofthe lowered fidelity of DNA synthesis inthe presence of this cation. Finally th cannot be used with oligo(dT) or random hexam- rs as primers, since the hybrids will be unstable at temperatures at which the thermostable DNA poly erases active,MATERIALS Protocol 8: Amplification of cDNA Generated by Reverse Transcription of mRNA 8.49 from a cloned, mutated segment of the target DNA. The perfect standard would differ in sequence from the target RNA by only one or two bases required to create one or more novel restriction site(s) in the amplified cDNA products. Both the target RNA and the standard should be able to be amplified with the same pair of primers (Becker-André and Hahlbrock 1989; Wang etal. 1989; Gilliland etal, 1990; Siebert and Larrick 1992). After amplification, the two PCR produets are dis tinguished by digestion with restriction enzyme(s) and agarose gel electrophoresis (for review, please see Becker-André 1993), Generating a perfect standard requires detailed planning and considerable labor. Most, investigators therefore settle for internal standards that fall short of perfection, for example, a cloned segment of cDNA that can be added in varying quantities to the RNA template, or, less desirably, a completely unrelated, endogenous RNA species that can be amplified only with sep. arate primers, Such imperfect controls may be malodorous to purists, but they are certainly preferable to no controls at all. At least they provide a means to measure the overall efficiency of reverse transcription and amplification and provide some indication of the quality of the RNA preparation, ‘A. IMPORTANT To reduce the chance of contamination with exogenous DNAS, prepare and use a special set of reagents and solutions for PCR only Bake all glassware for 6 hours at 150°C and autoclave all plasticware. For more information, please see the panel on CONTAMINATION IN PCR in the chapter introduction CAUTION: Please see Appendix 12 for appropriate handling of materials marked with , Buffers and Solutions ions, buffers, and reagents Please see Appendix 1 for components of stock solut Dilute stock solutions to the appropriate concentrs 10x Amplification butter Chloroform NTP (20 mu) solution containing all four dNTPs (pH 8.0), Ethanol MgCl, (50 man) Phenol:chloroform (1:1, viv) Placental RNase inhibitor (20 units/ul) Please see the information panel on INHIBITORS OF RNASts in Chapter 7, Enzymes and Buffers Gels Reverse transcriptase (RNA-dependent DNA polymerase) Please see the pane! on REVERSE TRANSCRIPTASES USED IN RT-PCR inthe introduction to ths protocol Thermostable DNA-dependent DNA polymerase Tag DNA polymerase i the standard and appropriate enayme forthe amplification stage of most forms of RT-PCR. However, where elongation from 3-mismatched primes is suspected, a thermostable DNA Polymerase with 3-45" proofreading activity may be preferred (Chiang etal. 1993) Agarose or polyacrylamide gel Please see Step 8.8.50 Chapter 8: In Vitro Amplification of DNA by PCR Nucleic Acids and Oligonucleotides Exogenous reference RNA Please se Step 2 Oligonucleotide primers for synthesis of CDNA: OligorA. yg (100 pgm) in TE (pH 8.0) Random hexanucleotides (1 mglmi) in TE (pH 8.0) Gene-specific oligonucleotide (20 ww) in HO (20 pmolesisl) The gene-specific oligonucleotide shouldbe complementary to a known sequence inthe target miRNA. Depending on the experiment, oligo(dT}, yy. random hexanucleotides, or gene-specific antisense liganucleotides can be used as primers for symthesis of ist-srand cDNA (please see the introduction to this protocoh. Sense and antisense oligonucleotide primers for amplification of cDNA by PCR ‘The primer used to generate cDNA may also be used as the antisense primer inthe amplification tage of standard RT-PCR. However, the specificity of amplification can be improved by using an antisense primer tht binds to an upstream sequence inthe target transcript. Bath sense and antisense primers are gene-specific synthetic oligonucleotide, which should be 20-30 nucleotides in length and contin spprorimately equal numbers ofthe four bases, with a balanced distribution of G and C residues, and « low propensity to form stable secondary structures, Wherever possible, use specific oligonucleotides that bind to sequences located in different exons f the target RNA as sense and antisense primers for ampli fication of the cDNA product. In this way, amplification products derived from cDNA and contamina ing genomnic DNA can be easly distinguished. For further details, please see Design of Olgonucletide imers for Basic PCR in the introduction to this chapter Bases encoding restriction sits canbe added to the termini ofthe sense and antisense primers used in PCR (please see Protocol 6) Ths ation greatly faitates cloning ofthe amplified product. Oligonucleotide primers synthesized on an automated DNA synthesizer can genealy be wed in stan dard RT-PCR without further purification, However, amplification of low-abundance mRNAs is often ‘more efficient ithe oligonucleotide primes are purted by chromatography on commercially salable resins (¢, NENSORB, NEN Life Science Products) or by denaturing polyacrylamide gel electrophore- sis, as described in Chapter 10, Protocol 1. Use the following formula to calculate the molecular weight ofthe olgonucleoties M,= (C280) 4 313) + (F304) + (Gx329) Where C= number of C residues inthe oligonucleotide ‘A= number ofA residues number of T residues G = number of G residues Te gram molecular weight ofa 20-mer will be ~6000; 100 pmoles ofthe oligonucleotide will be equivalent to ~0.6 ng. Total RNA (100 ugim)) in H,0 or Poly(A)* RNA (10 ugiml) in HO Total RNA extracted from cells with chaotropic agents is generally the template of choice for RT-PCR for mRNAs that are expressed at moderate to high abundance (Tiedtke etal. 1994). Poly(A)" is preferred 8a template for ll forms of RT-PCR when the target mRNA js expressed at low abundance. RNA st able for use a8 a template in RT-PCR may be prepared from stall numbers of cultured clissfllows is Pellet the cells (10-100 cells} by centrifugation for S seconds at °C in a microfuge. ii, Remove the supernatant by aspiration Add 10-20 fan ice-cold Isis soltion of 0.9 Nonidet -40 (NP-40), 10 m Tris-Cl (pH 80), 10 mt NaCl, 3 mbt MCL, Vortex the tbe very gently to disperse the cells throughout the isis solution, ° Ii, Store the tube for 5 minutes on ice and then centrifuge at maxinnum speed for 2 minutes a 4C in a microfuge, Use the supernatant directly as the template in acDNAvdriven PCR as described below. Note that i may be necessary to carry out preliminary experiments to determine the optimum concen. tration of NP-A0 in the lysis buf. The concentration of 0.5% recommended in the protocol works well for lymphocytes. Higher concentrations may be required for other types of mammalian cellProtocol 8: Amplification of CDNA Generated by Reverse Transcription of mRNA 8.51 Special Equipment Barter tips for automatic micropipettes Microtuge tubes (0.5 mi, thio-walled for amplitication) or Microtiter plates Positive-displacement pipetie Thermal cycler programmed with desired amplification protocol IF the thermal eycer snot equipped wit a heated lid, use either mineral ol or paraffin wax to prevent evaporation of guid fom the reaction mixcure during PCR. Water baths preset to 75°C and 95°C Additional Reagents Step 6 ofthis protocol requires the reagents listed in Chapter 5, Protocol 2, Chapter 12, Protocol 6, or Chapter 6, Protacol 10. Step 10 of this protocol requires the reagents listed in Protocols 3 and 4, 5, or 6 of this chapter. METHOD 1. Transfer 1 pg to 100 ng of poly(A)* mRNA or 10 pg to 1 pg of total RNA toa fresh microfuge tube. Adjust the volume to 10 ul with H,. Denature the RNA by heating at 75°C for 5 min- utes, followed by rapid chilling on ice. 2, To the denatured RNA add: ox amplification buffer 2ul 20 mat solution of four ANTPS (pH 80) Tal primers (optimize, pease see below) Tal 20 units placental RNase inhibitor Tul 50 mst MgCl, Lut 100-200 unitslyl reverse transcriptase Ll 40 0204 Incubate the reaction for 60 minutes at 37°C, ‘MgCl, is added to meet the need ofthe reverse transcriptase. ‘The optimum rato of primer to template should be ascertained empirically foreach preparation (of RNA. Asa starting point for optimization, we recommend adding varying amounts of primers to 20. reactions synthetic oligonucleotide com plementary tothe target RNA: 5-20 poles aligot4) 0.1-05ug : 15g the proportion of radioactivity incorporated in reactions that hve been supplemented with 10-20 wi of (=P}ACTP (sp. at. 3000 Cifmmale). The sive of the firststrand cDNA molecules can be estimated by electrophoresis through alkaline agarose gels (pease see Chapter 5, Protocol 8) Set up three negative control reactions. In one reaction, include al of the components of the first-strand reaction, except the RNA template, In another reaction, include all of the com- ponents, except the reverse transcriptase, Omit primers from the third reaction. Carry the controls through al subsequent steps of the protocol. These controls provide reassurance that the cDNA product is not due to contamination or self-priming by RNA. Whenever possible, setup positive control containing varying amounts of an exogenous reference RNA equipped with a set of primer annealing sites identical to those used in the authentic target8.52 Chapter 8: In Vitro Amplification of DNA by PCR 5. RNA (Wang etal. 1989). With some foresight, itis often possible to generate an appropriate refer ence by cloning synthetic copies of the sense and antisense primer binding sites on either side of an exogenous DNA sequence. The recombinant clone may then be transcribed in vito into an FRNA template that can serve as a positive contra in RT-PCR, . Inactivate the reverse transcriptase and denature the template-cDNA complexes by heating the reaction to 95°C for 5 minutes. ‘The reverse transcriptase must be inactivated to ensure efficient synthesis during the amplification phase of RI-PCR (Sellne et al. 1992; Chumakov 1994). Sometimes, inactivation of reverse tran- Scriptase by heat isnot sulicient. Is then necessary to purify the frst-strand cDNA by extraction with phenol:chloroform and precipitation with ethanol before setting up the PCRs, Presumably, ‘contaminants in the reverse transcriptase enzyme lead to a decreased efficiency of the ampliica Adjust the reaction mixture so that it contains 20 pmoles ofthe sense and antisense primers ‘The 20 pmoles of antisense oligonucleotide primer in the amplification reaction includes any gene specific oligonucleotide used to prime the synthesis ofthe first-strand «DNA. The presence of, excess oligonucleotide primers can lead to amplification of undesirable (nontarget) sequences, whereas dearth of primers reduces the efficiency of amplification, It may be necessary to remove exces oligonucleotide and random hexamer primes ftom the cDNA preparation and then to opti- ‘mize the concentrations of the sense and antisense primers in the amplification reaction (please se Step 3 of Protocol 9) ‘Add to the reaction mixture: required to bring reaction mixture to 994l) 7? ul 1-2 units thermostable DNA polymerase Tal If the thermal cycler is not fitted with a heated lid, overlay the reaction mixtures with 1 drop (~50 ul) of light mineral oil. Alternatively, place a bead of paraffin wax into the tube if using ‘hot start protocol. Place the tubes or the microtiter plate in the thermal cycler. Amplify the nucleic acids using the denaturation, annealing, and polymerization times and temperatures listed inthe table, Cyd Denaturation Annealing Polymerization 3Seyeles | 4S sec at °C AS sccat 55°C Imin 15sec ar72°C Lasteycle | 1 min at 94°C A5secats5°C 1 min 15 secat 729C ‘These times ae suitable for 100-u reactions assembled in thin-walled 0.5-ml tubes and incubated §n thermal cyclers such asthe Perkin-Elmer 9600 or 9700, Master Cycler (Eppendorf) and PTC 100 (M) Research). Times and temperatures may need tobe adapted to suit other types of equipment and reaction volumes, Polymerization should be carried out for | minute for every 1000 bp of length of the target DNA, Mos thermal cyclers have an end routine in which the amplified samples ae incubated at 4°C until they are removed from the machine. Samples can be left overnight at tis temperature, but should be stored thereafter at -200C. Withdraw a sample (5~10 yl) from the test reaction mixture and the four control reactions and analyze them by electrophoresis through an agarose or polyacrylamide gel. Be sure to include DNA markers of an appropriate size. Stain the gel with ethidium bromide or SYBR Gold to visualize the DNA. A successful amplification reaction should yield readily visi ent ofthe expected size Then of he and ante cone by DNA enn pease Che base Souther hybridization (pease see Chapter 6, Protocol 1D} andlor eestiction mapping. If no producti visible ater 30 cycles of amplification, add fresh Tag polymerase and continue the amplification reaction for a further 15-20 cyclesProtocol &: Amplification of cDNA Generated by Reverse Transcription of mRNA 8.53 9. IF mineral oil was used to overlay the reaction (in Step 6), remove the oil from the sample before cloning by extraction with 150 ul of chloroform, The aqueous phase, which contains the amplified DNA, il form a micelle nea the meniscus. The «an then be transfered to fresh tube with an automatic micropipette A. IMPORTANT Do not attempt chloroform extractions in microtiter plates. The plastic used in these plates is not resistant to organic solvents 10. Clone the amplified products into an appropriately prepared vector by any of the methods described in Protocol 4, 5, or 6. Before cloning, separate the amplified DNA from the resid- ual thermostable DNA polymerase and dNTPs (please see Protocol 3). The DNA can then be ligated to a blunt-ended vector ot @ T vector, ot it can digested with restriction enzymes and ligated to a vector with compatible termini. Poor yes of produc in RT-PCR may be due to inefcent CDNA synthess ox, more frequently to inet | | fective ampiication of CDNA. Investigate the ater possiblity by eting up a series of reactions in which ‘arable amounts of CDNA template are added to the PCR. Suboptimal amounts of cDNA template may generate @ numberof discrete amplification products, which may be larger or smaller than the authen- | tic target sequence. A more common problem is a ronspeciic smear ot amped products, a visu ized on a stained gel. This outcome is caused by spurious priming, which occurs when excess CDNA, template is present inthe PCR. For ths reason, mary experimenters use = 10% ofthe cDNA generated | in the reverse transcriplase reaction as template in the subsequent PCR. In this case, addtional ANTPs must be added to the PCR ‘Once the best concentration of template as been established, the other parameters of PCR can be ‘optimized ina systematic fashion by varying the concentration of Mge*,atenng annealing concitions, and so on. problems sil persist: } «Check the integrity of the RNA preparation by electrophoresis through an agarose gel containing | formaldehyde. «Set up test reactions containing a control mRNA, an oligo(dT) primer, and a radiolabeled tracer to | measure the eficiency of CDNA synthesis. The total amounts of frststvand cDNA synthesis can be measured by determining the proportion of radioactivity incorporated in reactions that have been | supplemented with 10-20 Ci of (=PIACTP (sp. act. 3000 Cimmole). The size of the fisttrand . Buffers and Solutions Please see Appendix 1 for components of stock solutions, buffers, and reagents. Dilute stock solutions to the appropriate concentrations. 10x Amplification butter Chloroform <1> ATP (1 mxy (disodium salt) NTP (20 mv) solution containing all four dNTPs (pH 8.0) Placental RNase inhibitor (20 units/ul) Please se the information panel on INHIBITORS OF RNASts in Chapter TE (pH 7.6) Enzymes and Buffers 5x Reverse transcriptase butler Reverse transcriptase (RNA-dependent DNA polymerase) Please se the panel on REVERSE TRANSCRIPTASES USED IN RT-PCR in Provo! 8 Terminal deoxynucleotidy! transferase (terminal transferase) Pleas ee the information panel on TERMINAL TRANSFERASE. 5x Terminal transferase burfer Thermostable DNA polymerase Tag DNA polymerases the sandard and appropriate enzyme fr the amplification stage of mest forms of RT-PCR. However where elongation fom 3 "mismatched primers is suspected, a thermostable DNA polymerase with 35 proofreaing activity may be prefered (Chiang et al. 193) Gels Agarose or polyacrylamide gel <1> Please se Step 9. Nucleic Acids and Oligonucleotides Adaptor-primer (10 uw) (5° GACTCGAGTCGACATCG 3°) in HO (10 pmolesful) The adaptor-prime is used in conjunction with a gene-specific sense primer to amplify a particular tar- fe cDNA. After amplification, the desired product can comprises litle ss 196 and as much a 10% of the total yield of DNA. Hf necesary, the yield of desired product can be improved by setting up a second round of amplification using the adaptor primer and a nested gene-specific antisense primer that binds toa sequence within the amplified segment of target DNA. After this second round of nested ampifica tion, alms al ofthe product detected by ethidium bromide staining contains sequences corespond ing to the 5 region of the desired mRNA. Oligonucleotide primers synthesized on an automated DNA synthesizer can generally be used in stan dard RT-PCR without further purification, However, amplification of low abundance mRNAS is often more efficient if the oligonucleotide primes are purified by chromatography on commercially available resins (eg, NENSORB, NEN Life Science Products) or by denaturing polyacrylamide gl eectrophore: sis, as dscibed in Chapter 10, Protocol 1 (7) ,»-Adaptor-primer (10 uw) (5° GACTCGAGTCGACATCGAT,,, 3°) in H,O (10 pmoles/ul) ‘The (dT), -adaptor-primer binds to the poly(A)* tract added to the 5" terminus of CDNAS by terminal transferase. In the example given in this protocol one of the termini ofthe amplified DNAs becomes ‘equipped with recognition sites for Xho, Sal, Act, inc, and Cat restriction enzymes.Protocol 9: Rapid Amplification of 5° cDNA Ends 8.57 Gene-specific antisense oligonucleotide primers (10 uid) in HO (10 pmolesiul “The gene-specific antisense primers should be complementary tothe known sequence of the target mRNA, should he 20-30 ncictides in length, and shoud contain approximately qual numbers ofthe four bases, ‘with balanced distribution of G and C residues and a low propensity to form sable secondary struct For further deals pease ee Design of Oligonucleotide Primers for Basic PCR in the introduction to «chapter Gene-specfc primer 1 used inthe reverse transcriptase reaction (Step 2) to prime synthesis of ‘gene-specific frst-strand cDNA, Gene-specfic primer 2 is complementary to a sequence inthe target mRNA that is 510 primer 1 and is used the amplification stage ofthe eeaton, As discussed below, restriction sts ar always designed into adapor primers. Hovever, they can also be incorporated int the gene-specific oligonucleotides. The presence of restriction sites simplifies cloning ofthe amplified cDNAs, Random hexanucleotides (1 mg/m) in TE (pH 8.0) (optional) In an emergeney, random hexanucleotides canbe used in place of the gene-specific antisense oigonu- cleotide to prime synthesis of

You might also like

• The Subtle Art of Not Giving a F*ck: A Counterintuitive Approach to Living a Good Life

  

  From Everand

  The Subtle Art of Not Giving a F*ck: A Counterintuitive Approach to Living a Good Life

  Mark Manson

  Rating: 4 out of 5 stars

  4/5 (5819)
• The Gifts of Imperfection: Let Go of Who You Think You're Supposed to Be and Embrace Who You Are

  

  From Everand

  The Gifts of Imperfection: Let Go of Who You Think You're Supposed to Be and Embrace Who You Are

  Brené Brown

  Rating: 4 out of 5 stars

  4/5 (1092)
• Never Split the Difference: Negotiating As If Your Life Depended On It

  

  From Everand

  Never Split the Difference: Negotiating As If Your Life Depended On It

  Chris Voss

  Rating: 4.5 out of 5 stars

  4.5/5 (845)
• • Magazines
  • Podcasts
  • Sheet music
• Principles: Life and Work

  

  From Everand

  Principles: Life and Work

  Ray Dalio

  Rating: 4 out of 5 stars

  4/5 (609)
• The Glass Castle: A Memoir

  

  From Everand

  The Glass Castle: A Memoir

  Jeannette Walls

  Rating: 4.5 out of 5 stars

  4.5/5 (1717)
• Grit: The Power of Passion and Perseverance

  

  From Everand

  Grit: The Power of Passion and Perseverance

  Angela Duckworth

  Rating: 4 out of 5 stars

  4/5 (590)
• Sing, Unburied, Sing: A Novel

  

  From Everand

  Sing, Unburied, Sing: A Novel

  Jesmyn Ward

  Rating: 4 out of 5 stars

  4/5 (1104)
• Hidden Figures: The American Dream and the Untold Story of the Black Women Mathematicians Who Helped Win the Space Race

  

  From Everand

  Hidden Figures: The American Dream and the Untold Story of the Black Women Mathematicians Who Helped Win the Space Race

  Margot Lee Shetterly

  Rating: 4 out of 5 stars

  4/5 (897)
• Shoe Dog: A Memoir by the Creator of Nike

  

  From Everand

  Shoe Dog: A Memoir by the Creator of Nike

  Phil Knight

  Rating: 4.5 out of 5 stars

  4.5/5 (540)
• The Perks of Being a Wallflower

  

  From Everand

  The Perks of Being a Wallflower

  Stephen Chbosky

  Rating: 4.5 out of 5 stars

  4.5/5 (2104)
• The Hard Thing About Hard Things: Building a Business When There Are No Easy Answers

  

  From Everand

  The Hard Thing About Hard Things: Building a Business When There Are No Easy Answers

  Ben Horowitz

  Rating: 4.5 out of 5 stars

  4.5/5 (348)
• Bad Feminist: Essays

  

  From Everand

  Bad Feminist: Essays

  Roxane Gay

  Rating: 4 out of 5 stars

  4/5 (1018)
• Elon Musk: Tesla, SpaceX, and the Quest for a Fantastic Future

  

  From Everand

  Elon Musk: Tesla, SpaceX, and the Quest for a Fantastic Future

  Ashlee Vance

  Rating: 4.5 out of 5 stars

  4.5/5 (474)
• Her Body and Other Parties: Stories

  

  From Everand

  Her Body and Other Parties: Stories

  Carmen Maria Machado

  Rating: 4 out of 5 stars

  4/5 (822)
• The Outsider: A Novel

  

  From Everand

  The Outsider: A Novel

  Stephen King

  Rating: 4 out of 5 stars

  4/5 (1866)
• The Emperor of All Maladies: A Biography of Cancer

  

  From Everand

  The Emperor of All Maladies: A Biography of Cancer

  Siddhartha Mukherjee

  Rating: 4.5 out of 5 stars

  4.5/5 (271)
• The Sympathizer: A Novel (Pulitzer Prize for Fiction)

  

  From Everand

  The Sympathizer: A Novel (Pulitzer Prize for Fiction)

  Viet Thanh Nguyen

  Rating: 4.5 out of 5 stars

  4.5/5 (122)
• Angela's Ashes: A Memoir

  

  From Everand

  Angela's Ashes: A Memoir

  Frank McCourt

  Rating: 4.5 out of 5 stars

  4.5/5 (441)
• Brooklyn: A Novel

  

  From Everand

  Brooklyn: A Novel

  Colm Toibin

  Rating: 3.5 out of 5 stars

  3.5/5 (1947)
• The Little Book of Hygge: Danish Secrets to Happy Living

  

  From Everand

  The Little Book of Hygge: Danish Secrets to Happy Living

  Meik Wiking

  Rating: 3.5 out of 5 stars

  3.5/5 (401)
• A Man Called Ove: A Novel

  

  From Everand

  A Man Called Ove: A Novel

  Fredrik Backman

  Rating: 4.5 out of 5 stars

  4.5/5 (4770)
• Steve Jobs

  

  From Everand

  Steve Jobs

  Walter Isaacson

  Rating: 4.5 out of 5 stars

  4.5/5 (808)
• The World Is Flat 3.0: A Brief History of the Twenty-first Century

  

  From Everand

  The World Is Flat 3.0: A Brief History of the Twenty-first Century

  Thomas L. Friedman

  Rating: 3.5 out of 5 stars

  3.5/5 (2259)
• The Yellow House: A Memoir (2019 National Book Award Winner)

  

  From Everand

  The Yellow House: A Memoir (2019 National Book Award Winner)

  Sarah M. Broom

  Rating: 4 out of 5 stars

  4/5 (98)
• Devil in the Grove: Thurgood Marshall, the Groveland Boys, and the Dawn of a New America

  

  From Everand

  Devil in the Grove: Thurgood Marshall, the Groveland Boys, and the Dawn of a New America

  Gilbert King

  Rating: 4.5 out of 5 stars

  4.5/5 (266)
• The Art of Racing in the Rain: A Novel

  

  From Everand

  The Art of Racing in the Rain: A Novel

  Garth Stein

  Rating: 4 out of 5 stars

  4/5 (4208)
• A Tree Grows in Brooklyn

  

  From Everand

  A Tree Grows in Brooklyn

  Betty Smith

  Rating: 4.5 out of 5 stars

  4.5/5 (1929)
• Team of Rivals: The Political Genius of Abraham Lincoln

  

  From Everand

  Team of Rivals: The Political Genius of Abraham Lincoln

  Doris Kearns Goodwin

  Rating: 4.5 out of 5 stars

  4.5/5 (234)
• Yes Please

  

  From Everand

  Yes Please

  Amy Poehler

  Rating: 4 out of 5 stars

  4/5 (1902)
• A Heartbreaking Work Of Staggering Genius: A Memoir Based on a True Story

  

  From Everand

  A Heartbreaking Work Of Staggering Genius: A Memoir Based on a True Story

  Dave Eggers

  Rating: 3.5 out of 5 stars

  3.5/5 (231)
• The Woman in Cabin 10

  

  From Everand

  The Woman in Cabin 10

  Ruth Ware

  Rating: 3.5 out of 5 stars

  3.5/5 (2522)
• Fear: Trump in the White House

  

  From Everand

  Fear: Trump in the White House

  Bob Woodward

  Rating: 3.5 out of 5 stars

  3.5/5 (738)
• Wolf Hall: A Novel

  

  From Everand

  Wolf Hall: A Novel

  Hilary Mantel

  Rating: 4 out of 5 stars

  4/5 (3811)
• John Adams

  

  From Everand

  John Adams

  David McCullough

  Rating: 4.5 out of 5 stars

  4.5/5 (2409)
• On Fire: The (Burning) Case for a Green New Deal

  

  From Everand

  On Fire: The (Burning) Case for a Green New Deal

  Naomi Klein

  Rating: 4 out of 5 stars

  4/5 (74)
• The Light Between Oceans: A Novel

  

  From Everand

  The Light Between Oceans: A Novel

  M.L. Stedman

  Rating: 4.5 out of 5 stars

  4.5/5 (789)
• Manhattan Beach: A Novel

  

  From Everand

  Manhattan Beach: A Novel

  Jennifer Egan

  Rating: 3.5 out of 5 stars

  3.5/5 (792)
• The Constant Gardener: A Novel

  

  From Everand

  The Constant Gardener: A Novel

  John le Carré

  Rating: 3.5 out of 5 stars

  3.5/5 (104)
• The Unwinding: An Inner History of the New America

  

  From Everand

  The Unwinding: An Inner History of the New America

  George Packer

  Rating: 4 out of 5 stars

  4/5 (45)
• Rise of ISIS: A Threat We Can't Ignore

  

  From Everand

  Rise of ISIS: A Threat We Can't Ignore

  Jay Sekulow

  Rating: 3.5 out of 5 stars

  3.5/5 (137)
• Little Women

  

  From Everand

  Little Women

  Louisa May Alcott

  Rating: 4 out of 5 stars

  4/5 (104)
• The Cartoon Guide To Statistics-3

  

  Document8 pages

  The Cartoon Guide To Statistics-3

  Swetha Ramesh

  100% (1)
• Advanced Hindi Grammar

  

  Document156 pages

  Advanced Hindi Grammar

  Swetha Ramesh

  No ratings yet
• His Tag Purification PDF

  

  Document5 pages

  His Tag Purification PDF

  Swetha Ramesh

  No ratings yet
• Enzyme Notes - Sathyanarayana

  

  Document32 pages

  Enzyme Notes - Sathyanarayana

  Swetha Ramesh

  No ratings yet
• Cells of Immune System

  

  Document14 pages

  Cells of Immune System

  Swetha Ramesh

  No ratings yet
• B198T45ApplicationForm PDF

  

  Document1 page

  B198T45ApplicationForm PDF

  Swetha Ramesh

  No ratings yet
• Varalakshmi Vratham Pooja Ebook in Tamil PDF

  

  Document25 pages

  Varalakshmi Vratham Pooja Ebook in Tamil PDF

  Swetha Ramesh

  No ratings yet
• Competant Cells and Transformation

  

  Document3 pages

  Competant Cells and Transformation

  Swetha Ramesh

  No ratings yet
• Lymphoid Organ

  

  Document23 pages

  Lymphoid Organ

  Swetha Ramesh

  No ratings yet
• Development of Neem Based Bioplastic For Food Packaging Application

  

  Document8 pages

  Development of Neem Based Bioplastic For Food Packaging Application

  Swetha Ramesh

  No ratings yet
• International Webinar

  

  Document1 page

  International Webinar

  Swetha Ramesh

  No ratings yet
• Processing and Storage Effects On Orange Juice Aroma: A Review

  

  Document13 pages

  Processing and Storage Effects On Orange Juice Aroma: A Review

  Swetha Ramesh

  No ratings yet
• Bioscouring in Textile Industry

  

  Document2 pages

  Bioscouring in Textile Industry

  Swetha Ramesh

  No ratings yet
• Notes of Lesson - Microbiology Code: BT1204 Unit - I: Introduction History of Microbiology

  

  Document18 pages

  Notes of Lesson - Microbiology Code: BT1204 Unit - I: Introduction History of Microbiology

  Swetha Ramesh

  No ratings yet
• Diatom Book-1 PDF

  

  Document23 pages

  Diatom Book-1 PDF

  Swetha Ramesh

  No ratings yet
• Unit II Microbes Structure and Multiplication

  

  Document22 pages

  Unit II Microbes Structure and Multiplication

  Swetha Ramesh

  No ratings yet
• Restriction Mapping - Key

  

  Document6 pages

  Restriction Mapping - Key

  Swetha Ramesh

  100% (1)
• Genome Sequencing: BY:-Anitha.Y 14KUST4002

  

  Document20 pages

  Genome Sequencing: BY:-Anitha.Y 14KUST4002

  Swetha Ramesh

  No ratings yet
• Notes of Lesson - Microbiology Code: BT1204 Unit - I: Introduction History of Microbiology

  

  Document18 pages

  Notes of Lesson - Microbiology Code: BT1204 Unit - I: Introduction History of Microbiology

  Swetha Ramesh

  No ratings yet
• Organic Farming:: Organic Inputs and Techniques: S. No. Groups Examples

  

  Document23 pages

  Organic Farming:: Organic Inputs and Techniques: S. No. Groups Examples

  Swetha Ramesh

  No ratings yet
• P-3116 - Immunocytochemistry Lecture Notes PDF

  

  Document26 pages

  P-3116 - Immunocytochemistry Lecture Notes PDF

  Swetha Ramesh

  No ratings yet
• GE6251-Basic Civil and Mechanical Engineering-1 - 258 PDF

  

  Document21 pages

  GE6251-Basic Civil and Mechanical Engineering-1 - 258 PDF

  Swetha Ramesh

  No ratings yet