MOLECULAR COMPARATIVE STUDIES AMONG BLASTOCYSTIS

ISOLATES OBTAINED FROM HUMANS AND ANIMALS

Author(s): Hisao Yoshikawa, Zhiliang Wu, Isao Nagano, and Yuzo Takahashi
Source: Journal of Parasitology, 89(3):585-594.
Published By: American Society of Parasitologists
DOI: http://dx.doi.org/10.1645/0022-3395(2003)089[0585:MCSABI]2.0.CO;2
URL: http://www.bioone.org/doi/full/10.1645/0022-3395%282003%29089%5B0585%3AMCSABI
%5D2.0.CO%3B2

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and
environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published
by nonprofit societies, associations, museums, institutions, and presses.
Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of
BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.
Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries
or rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research
libraries, and research funders in the common goal of maximizing access to critical research.
 J. Parasitol., 89(3), 2003, pp. 585–594
q American Society of Parasitologists 2003

MOLECULAR COMPARATIVE STUDIES AMONG BLASTOCYSTIS ISOLATES OBTAINED

FROM HUMANS AND ANIMALS
Hisao Yoshikawa, Zhiliang Wu*, Isao Nagano*, and Yuzo Takahashi*
Department of Biological Science, Faculty of Science, Nara Women’s University, Kitauoya-Nishimachi, Nara 630-8506, Japan. e-mail:
sb56013@cc.nara-wu.ac.jp

ABSTRACT: This study compared specific polymerase chain reaction (PCR) primers and phylogenetic tree analysis of restriction
fragment length polymorphism using the small subunit ribosomal RNA gene in various Blastocystis populations. A phylogenetic
tree was constructed using 12 restriction enzymes and a sample pool of 22 isolates, including 2 reference strains and Proteromonas
lacertae as an outgroup. The analysis showed that the 22 isolates could be separated into 7 clusters. Four of the 7 clusters were
mixed groups that comprised isolates from both humans and nonhuman hosts. The other 3 clusters contained isolates from
humans or nonhuman hosts only. The phylogenetic analysis also showed that B. hominis isolates from geographical separated
areas did not necessarily cluster in the genetically different groups. The results of genetic homology and phylogenetic tree analysis
among Blastocystis isolates from humans and animals indicated that all isolates from animals appear to be B. hominis. Polymerase
chain reaction amplifications using previously described and newly defined specific primers mirrored the clusters obtained by the
phylogenetic tree analysis. Our results show that primer PCR can be used as a powerful tool for the typing of Blastocystis
populations.

Ever since the first description of Blastocystis hominis as a
harmless yeast in 1912 (Brumpt, 1912), this organism has been
known as a common intestinal parasite in humans. Although
the pathogenesis of B. hominis had been proposed on the basis
of clinical symptoms, the true nature of the parasite infection
of humans is still controversial (Stenzel and Boreham, 1996).
It has been assumed that the route of transmission is fecal–oral,
similar to other common gastrointestinal protozoans (Stenzel
and Boreham, 1996). Whereas this route could be likely, recent
molecular epidemiological investigations showed the possibility
of transmissions among patients and staff members or between
them in small communities (Yoshikawa et al., 2000). Circum-
stantial evidence of several zoonotic strains identified from a
chicken (Yoshikawa et al., 1996, 1998) and a guinea pig (Clark,
1997a) indicated that B. hominis–like organisms isolated from
various animals, including nonhuman primates, rodents, birds,
reptiles, and amphibians are all potential sources of human in-
fections.
Blastocystis organisms from nonhuman hosts are morpholog-
ically similar to B. hominis, and these isolates have been re-
ported as B. hominis, Blastocystis sp., or a new species. Cur-
rently, the proposal of a new species is based on differences in
the host in which the organism was harvested, morphology,
optimal growth temperature, and karyotype (Belova and Kos-
tenko, 1990; Belova, 1991, 1992; Singh et al., 1996; Chen et
al., 1997). However, Blastocystis is known to be morphologi-
cally, genotypically, and karyotypically polymorphic (Upcroft
et al., 1989; Zierdt, 1991; Stenzel and Boreham, 1996; Yoshi-
kawa et al., 1996, 1998, 2000; Carbajal et al., 1997; Clark,
1997a). Similar heterogeneity has been reported among isolates
of Giardia lamblia and Entamoeba histolytica (Hopkins et al.,
1997; Le Blancq and Adam, 1998; Willhoeft and Tannich,
1999; Zaki and Clark, 2001). Therefore, these criteria alone are
insufficient to speciate new specimens of Blastocystis. The re-
sults of our genomic or phylogenetic studies in this report con-
firm that Blastocystis sp. isolated from nonhuman hosts are
identical genotypes of B. hominis isolates and vice versa.
Received 8 February 2002; revised 23 July 2002; accepted 13 Decem-
ber 2002.
* Department of Parasitology, School of Medicine, Gifu University,
Tsukasa, Gifu 500-8705, Japan.
MATERIALS AND METHODS
Sources and culture of Blastocystis
Blastocystis isolates from 11 sources of human origin and from 11
sources of animal origin are described in Table I. Two isolates, CK86-1
and NIH:1295:1, were recently identified as zoonotic strains (Yoshika-
wa et al., 1996, 1998; Clark, 1997a). Xenic isolates were cultured in
diphasic agar-slant medium, and axenic isolates were cultured in dipha-
sic egg-slant medium as described previously (Yoshikawa et al., 1996,
1998). All isolates were cultured at 37 C. Two reference strains isolated
from a human (Nand II) and a guinea pig (NIH:1295:1) were used for
polymerase chain reaction (PCR) and restriction fragment length poly-
morphism (RFLP) analyses to characterize banding patterns of RFLP
on the basis of the entire sequence data of small subunit ribosomal RNA
(SSU rRNA) (Silberman et al., 1996). These 2 strains were purchased
from American Type Culture Collection (ATCC, Manassas, Virginia).
The specificity of the newly developed PCR primer sets (SB336 and
SB337) was tested using 9 isolates (SY99-1 to SY99-9) of Blastocystis
sp. recovered from 6-mo-old domestic pigs located in Hiroshima Pre-
fecture, Japan, in 1999 and the genomic DNAs of WR1, WR2, and S1
isolates from laboratory rats in Singapore (Chen et al., 1997).
Genomic DNA preparation
Genomic DNAs of Blastocystis organisms were extracted using a
DNAzol reagent (GIBCO-BRL, Life Technologies, Inc., Grand Island,
New York) according the manufacturer’s protocol.
RFLP and phylogenetic analyses
The entire SSU rRNA genes (SSU rDNAs) were amplified using a
forward primer SR1F: 59-GCTTATCTGGTTGATCCTGCCAGTAGT-
39 and a reverse primer SR1R: 59-TGATCCTTCCGCAGGTT-
CACCTA-39 (Yoshikawa et al., 2000). The primer pair produced an
approximately 1,800-bp product and did not amplify other common
intestinal protozoans and a yeast as described previously (Yoshikawa et
al., 2000). The PCR amplification consisted of 35 cycles of 94 C for
40 sec, 57 C for 60 sec, and 72 C for 2 min, after an initial denaturation
at 94 C for 3 min using a thermal cycler (Perkin–Elmer model 9600,
Norwalk, Connecticut) (Yoshikawa et al., 2000). The PCR products
were then purified with a Geneclean II Kit (BIO 101, Inc., Vista, Cal-
ifornia). The purified SSU rDNAs were digested with AluI, DdeI,
HaeIII, HinfI, MspI, RsaI, Sau3AI, Sau96I, SinI, SpeI, TaqI, and Tru9I
(Promega, Co., Madison, Wisconsin) in a reaction mixture of 2 ml of
103 buffer, 0.2 ml of bovine serum albumin solution (10 mg/ml), 0.5
ml (5 U) of restriction endonuclease, 8 ml of DNA solution, and 9.3 ml
of distilled water to a final volume of 20 ml, at an optimal temperature
as directed by the manufacturer’s protocol. The fragments were electro-
phoresed with a 100-bp DNA ladder (New England BioLabs, Inc., Bev-
erly, Massachusetts) in 2.0 or 2.5% agarose gels (Agarose 1,000, GIB-
CO-BRL) in Tris–borate buffer. Gels were stained with ethidium bro-
mide, and the approximate size of band profiles was estimated from the

585
586 THE JOURNAL OF PARASITOLOGY, VOL. 89, NO. 3, JUNE 2003

TABLE I. Sources of genomic DNA of Blastocystis isolates.

Isolate* Species Source Condition Country Reference

1. Nand II B. hominis Human Axenic USA ATCC 50177

2. HE87-1 B. hominis Human Xenic Japan Yoshikawa et al., 1996
3. HV93-13† B. hominis Human Xenic Japan Yoshikawa et al., 1998
4. HJ96A-26 B. hominis Human Xenic Japan Yoshikawa et al., 2000
5. HJ96A-29 B. hominis Human Xenic Japan Yoshikawa et al., 2000
6. HJ96AS-1 B. hominis Human Xenic Japan Yoshikawa et al., 2000
7. HJ96-1 B. hominis Human Xenic Japan Present study
8. HJ97-1 B. hominis Human Xenic Japan Present study
9. HJ97-2 B. hominis Human Xenic Japan Present study
10. HT98-1 B. hominis Human Xenic Thailand Present study
11. B B. hominis Human Axenic Singapore Yoshikawa et al., 1996
12. CK86-1‡ B. hominis Chicken Xenic Japan Yoshikawa et al., 1996
13. CK92-2 Blastocystis sp. Chicken Xenic Japan Present study
14. CK92-4 Blastocystis sp. Chicken Xenic Japan Present study
15. QQ93-3 Blastocystis sp. Japanese quail Xenic Japan Yoshikawa et al., 1998
16. QQ98-4 Blastocystis sp. Japanese quail Xenic Japan Present study
17. JM92-2 Blastocystis sp. Japanese monkey Xenic Japan Yoshikawa et al., 1998
18. JM92-3 Blastocystis sp. Japanese monkey Xenic Japan Present study
19. SY94-3 Blastocystis sp. Pig Xenic Japan Yoshikawa et al., 1998
20. SY94-7 Blastocystis sp. Pig Xenic Japan Present study
21. RN94-9 Blastocystis sp. Rat Xenic Japan Yoshikawa et al., 1998
22. NIH:1295:1‡ B. hominis Guinea pig Xenic USA ATCC 50578

* The 2 letters that begin the isolates’ name indicate the genus from which the organism was isolated, and the numbers indicate the year in which the isolate was
found. The number following the hyphen indicates the particular isolate in that series year. The only exceptions are Nand II, B, and NIH:1295:1 strains.
† Because this isolate was recovered from a Vietnamese patient who resided in Japan, it is difficult to ascertain the origin of parasite (Yoshikawa et al., 1998).
‡ These isolates were designated as zoonotic strains (Yoshikawa et al., 1996, 1998; Clark, 1997a).

photographs. Phylogenetic analysis was conducted using a combination
with SeqBoot, Restml, and Consense programs in PHYLIP 3.573 soft-
ware (Felsenstein, 1989) using the score of positive or negative bands
of RFLP. The SSU rDNA–RFLP profile of Proteromonas lacertae was
obtained from the entire sequence data (U37108 in GenBank) and used
as an outgroup in phylogenetic analysis. The phylogenetic tree was
drawn using the Treeview program (Page, 1996), and bootstrap values
were manually input in the phylogenetic tree.
Development of the specific PCR primers
SB83, SB155, SB227, and SB332 had been developed from unique
bands of random amplified polymorphic DNA (RAPD) fragments am-
plified with different B. hominis DNAs using arbitrary 10-base primer
PCR as described previously (Yoshikawa et al., 1998, 2000). The primer
pairs of SB336, SB337, and SB340 were newly developed from RAPD
products with SY94-3, RN94-9, and HJ96-1 isolates, respectively, using
arbitrary primers 50B (59-GCAAGTAGCT-39), 50A (59-TGGTCA
CTGT-39), and 60E (59-CAATCGCCGT-39), respectively. The detailed
procedure used to develop the primers from RAPD fragments was de-
scribed previously (Yoshikawa et al., 1998, 2000).

The PCR primer pairs used in this study are listed in Table II with PCR analysis with the specific primers
GenBank accession numbers. The GenBank entries contain the entire The genomic DNAs from the Blastocystis populations were amplified
DNA sequence used to design the primer pairs. The PCR primer pairs with the PCR primer pairs listed in Table II. The PCR condition was

TABLE II. Subtype classification with specific PCR primer sets among Blastocystis populations.

Product Sequence of forward(F) and Source

Subtype Primer size (bp) reverse(R) primers from 59 to 39 of primer GenBank

1* SB83* 351 F: GAAGGACTCTCTGACGATGA Nand II AF166086

R: GTCCAAATGAAAGGCAGC
2* SB155* 650 F: ATCAGCCTACAATCTCCTC B AF166087
R: ATCGCCACTTCTCCAAT
3* SB227* 526 F: TAGGATTTGGTGTTTGGAGA HV93-13 AF166088
R: TTAGAAGTGAAGGAGATGGAAG
4* SB332* 338 F: GCATCCAGACTACTATCAACATT HJ96AS-1 AF166091
R: CCATTTTCAGACAACCACTTA
5 SB340 704 F: TGTTCTTGTGTCTTCTCAGCTC HJ96-1 AY048752
R: TTCTTTCACACTCCCGTCAT
6 SB336 317 F: GTGGGTAGAGGAAGGAAAACA SY94-3 AY048751
R: AGAACAAGTCGATGAAGTGAGAT
7 SB337 487 F: GTCTTTCCCTGTCTATTCTGCA RN94-9 AY048750
R: AATTCGGTCTGCTTCTTCTG

* Subtype classification with the specific primer sets had been reported previously (Yoshikawa et al., 1998, 2000).

FIGURE 1. A phylogenetic tree of Blastocystis isolates from humans
and animals listed in Table I was constructed by PHYLIP software
inputting the score listed in Appendix I with Proteromonas lacertae
(Pl) as an outgroup. A total 22 Blastocystis isolates fell into 7 clusters.
30 sec at 94 C, 30 sec at 57 C, and 60 sec at 72 C with 30 cycles, after
an initial denaturation at 94 C for 3 min (Yoshikawa et al., 1998, 2000).
The PCR analysis for each primer pair was repeated at least thrice. The
PCR products were electrophoresed with a size marker of a 100-bp
ladder in 1.5% agarose gels and Tris–borate buffer. Gels were stained
with ethidium bromide, and the band profiles were estimated from the
photographs.
RESULTS
The RFLP profiles of all 22 Blastocystis SSU rDNAs, di-
gested with a panel of 12 restriction enzymes, and the approx-
imate band sizes of the resultant digests are summarized in
Appendix I. The phylogenetic analysis undertaken on the RFLP
profiles from all restriction enzymes produced a rooted tree con-
sisting of 7 monophyletic clusters of isolates as shown in Figure
1. Eleven isolates from humans fell into 5 clusters, whereas 11
nonhuman isolates are in 6 clusters. Among 7 clusters, 4 clus-
ters (clusters 1, 3, 6, and 7) contained organisms from both
human and nonhuman hosts. Clusters 2 and 4 comprised or-
ganisms that came from 2 distinct hosts, pigs and rodents. The
remaining cluster 5 came from humans in Japan or Thailand.
Similarly, clusters 3 and 7 contained B. hominis isolates ob-
tained from humans of geographically distinct countries (Fig.
1; Table I).
YOSHIKAWA ET AL.—GENETIC ANALYSIS OF BLASTOCYSTIS 587
TABLE III. Correlation between the phylogenetic clusters by SSU
rDNA–RFLP analysis and subtyping with specific PCR primers ana-
lyzed using the entire Blastocystis population.
Cluster Subtype Strain
1 4 HJ96 AS-1, CK92-4, QQ93-3
2 6 SY94-3, SY94-7
3 2 B, HJ97-2, QQ98-4
4 7 RN94-9, NIH:1295:1
5 3 HV93-13, HJ96A-26, HJ97-1, HT98-1
6 5 HJ96-1, CK92-2, JM92-2, JM92-3
7 1 Nand II, HE87-1, HJ96A-29*, CK86-1
* This strain was classified as a variant of subtype 1 (Yoshikawa et al., 2000).
The PCR analysis showed distinct groupings, which corrob-
orated the phylogenetic relationship (Table III). Specifically, all
7 clusters identified by phylogeny were independently amplified
by different PCR primers developed from the unique RAPD
products (Yoshikawa et al., 1998, 2000; present study; Fig. 2).
Cluster 1 was amplified with SB332 primer set, which had been
developed from the specific sequence of RAPD products of
HJ96AS-1 strain (Yoshikawa et al., 2000; Fig. 2D). Each of the
other groups (clusters 2, 3, 4, 5, 6, or 7) was also amplified
with 1 of the specific primer sets, (SB336, SB155, SB337,
SB227, SB340, or SB83), respectively (Fig. 2). In this study, 3
specific primer pairs were designed from the sequence data of
RAPD products of SY94-3, RN94-9, and HJ96-1 isolates be-
cause these isolates yielded no amplification with any PCR
primer as reported previously (Yoshikawa et al., 1998). Primer
set SB340 was developed from a unique band of RAPD product
of HJ96-1 isolate amplified with 60E primer. SB336 and SB337
primer sets were developed from a unique band of RAPD prod-
ucts of SY94-3 and RN94-9 isolates amplified with 50B and
50A primers, respectively. These primer pairs specifically am-
plified several isolates including same phylogenetic clusters
(Figs. 1, 2E–G) and did not amplify other common intestinal
parasitic protozoans and a yeast (data not shown) as reported
previously (Yoshikawa et al., 1998, 2000). Because SB336 and
SB337 primer sets only amplified 2 distinct hosts, pigs and
rodents, respectively, listed in Table I, the specificity of these
primers was tested by performing PCR reactions on DNAs in-
cluding 9 Blastocystis sp. isolates (SY99-1 to SY99-9) recov-
ered from domestic pigs in Japan and 3 isolates of Blastocystis
ratti (WR1, WR2, and S1) isolated from laboratory rats in Sin-
gapore (Chen et al., 1997). Interestingly, positive amplification
with SB336 primer was only observed in all 9 isolates from
pigs, whereas PCR products with SB337 were seen in all 3
isolates from rats (Fig. 3; Table III).
DISCUSSION
Positive identification of Blastocystis has been traditionally
accomplished by microscopic observation of fresh fecal sam-
ples or cultured organisms. However, gross morphological var-
iations dependent on the samples or the host species have lead
to difficulty in correctly identifying the exact Blastocystis spe-
cies (Stenzel and Boreham, 1996). Because several zoonotic
strains were identified (Yoshikawa et al., 1996, 1998; Clark,
1997a) and molecular epidemiological investigation suggested
possible person-to-person transmission (Yoshikawa et al.,
588 THE JOURNAL OF PARASITOLOGY, VOL. 89, NO. 3, JUNE 2003
FIGURE 2. The specificity of PCR primer sets SB83 (A), SB115 (B), SB227 (C), SB332 (D), SB340 (E), SB336 (F), and SB337 (G) with the
entire Blastocystis population listed in Table I. Each primer set amplified distinct size of PCR product listed in Table II. A 100-bp ladder (M).
The sample of each lane corresponds to the number of isolates listed in Table I. In some cases, primer SB83 yields an additional weak fast band.
2000), B. hominis–like organisms recovered from a variety of
animals are potential sources of human infections through fe-
cal–oral routes of transmission. However, systematic molecular
studies among Blastocystis populations isolated from humans
and nonhuman hosts were not used. In the present study, 2
reliable methodologies, i.e., phylogenetic analysis by SSU
FIGURE 3. The specificity of newly developed primer sets SB336
(A) and SB337 (B) with 9 Blastocystis sp. isolates from domestic pigs
(SY99-1 to SY99-9) and 3 Blastocystis ratti isolates from rats (WR1,
WR2, and S1). A 100-bp ladder (M); SY99-1 (lane 1); SY99-2 (lane
2); SY99-3 (lane 3); SY99-4 (lane 4); SY99-5 (lane 5); SY99-6 (lane
6); SY99-7 (lane 7); SY99-8 (lane 8); SY99-9 (lane 9); WR1 (lane 10);
WR2 (lane 11); S1 (lane 12).
rDNA–RFLP and PCR analyses with known and newly devel-
oped primers, were used to analyze 22 isolates of Blastocystis
from humans and nonhuman hosts. The RFLP analyses using
more than 10 restriction enzymes can analyze the phylogenetic
relationship among the same genus, species, or near isogenic
species (Clark, 1997b). On the other hand, specific primers have
been developed as a tool to study subtype classification of B.
hominis populations on the basis of the genotypic homology
(Yoshikawa et al., 1998, 2000).
So far, 10s to 100s of isolates have been recovered indepen-
dently in different laboratories from humans or other animals
for RFLP analysis (Böhm-Gloning et al., 1997; Clark, 1997a;
Hoevers et al., 2000; Snowden et al., 2000). Because each re-
search group has used a different combination of restriction
enzymes, it is difficult to directly compare RFLP data from
different laboratories. In contrast, PCR analysis only requires
specific primers for amplification, which are available from
published data (Yoshikawa et al., 1998, 2000; present study)
and allows for the easy identification of Blastocystis genotypes
by simple PCR amplimer pattern. Also, if mixed samples are
present in an RFLP analysis, contaminating DNAs from other
intestinal protozoans can cause misreading of the RFLP profile,
leading to inaccurate genotype determination. Therefore, PCR
analysis with specific primers helps in more easily identifying
and typing Blastocystis genotypes. Furthermore, negative PCR
results using the known primer pairs may lead to the identifi-
cation of new genotypes, which will promote further classifi-
cation of genotypically unknown Blastocystis populations.
In the present study, 22 Blastocystis isolates fell into 7 clus-
ters in a phylogenetic tree using SSU rDNA–RFLP analysis

(Fig. 1; Table III). Among these 7 clusters, 4 (1, 3, 6, and 7)
were a mixed population isolated from human and nonhuman
hosts (Fig. 1). Therefore, all isolates from nonhuman hosts of
these 4 groups, including a known zoonotic CK86-1 strain
(Yoshikawa et al., 1996, 1998), appeared to be zoonotic B. hom-
inis strains. The other 3 clusters (2, 4, and 5) comprised isolates
from human or nonhuman hosts (Fig. 1). Strain NIH:1295:1
(cluster 4) isolated from a guinea pig was reported as zoonotic
(Clark, 1997a); RN94-9 isolate (another member of cluster 4)
also appeared to be zoonotic B. hominis. SY94-3 and SY94-7
isolates (cluster 2) from different domestic pigs branched be-
tween other clusters, including B. hominis isolates (Fig. 1). Al-
though the bootstrap value between cluster 2 and cluster 3 was
34, all other groups appeared to be B. hominis in the present
study, cluster 2 might be a zoonotic strain.
Eleven isolates from humans were obtained from patients or
healthy people who resided in geographically different coun-
tries, i.e., Japan, Singapore, Thailand, and United States (Table
I). These isolates were grouped into 5 clusters as described
above; 3 of 5 clusters (3, 5, and 7) contained isolates from
humans residing in geographically different countries. There-
fore, geographical separation of the human isolates is not co-
incident with the genomic differences observed among B. hom-
inis populations. Because the 4 countries from which the iso-
lates were obtained are not adjoining land masses, the infection
route is, as of yet, unexplained.
Recently, a new Blastocystis species from laboratory rats had
been reported as B. ratti on the basis of differences in karyo-
typic pattern when compared with a human B. hominis isolate
and 2 reptilian isolates (Chen et al., 1997). Because extensive
karyotypic and genotypic diversity has been demonstrated
among B. hominis isolates (Upcroft et al., 1989; Yoshikawa et
al., 1996, 1998, 2000; Carbajal et al., 1997; Clark, 1997a), spe-
cies determination based on karyotypic differences alone is in-
sufficient. This assertion is supported by the observation that
our PCR primer set, SB337, developed from the RAPD product
of RN94-9 (named B. hominis, yet isolated from a laboratory
rat), also amplified all 3 B. ratti isolates from Singapore (Fig.
3). Interestingly, the genotypic homology between the latter 3
isolates and several B. hominis isolates were also obtained from
a recent SSU rDNA–RFLP analysis (Ho et al., 2001).
The present study is the first systematic comprehensive effort
to examine the molecular epidemiology of Blastocystis using
isolates that are different in terms of their geographic and host
distribution.
ACKNOWLEDGMENTS
We express our gratitude to Mulkit Singh, National University of
Singapore, for providing B. hominis B strain and genomic DNAs of
WR1, WR2, and S1 isolates from rats in Singapore and to Smarn Tes-
ana, Khon Kaen University in Thailand, for collecting the fecal samples
in Thailand. We thank Michelle Becker-Hapak for critical reading of
the manuscript and helpful discussions. This work was supported by
grant from Japan Society for the Promotion of Science to H.Y. (C-
13670245).
LITERATURE CITED
BELOVA, L. M. 1991. Blastocystis anatis sp. nov. (Rhizopoda, Lobosea)
from Anas platyrhynchos. Zoologicheskii Zhurnal 70: 5–10. [In
Russian.]
YOSHIKAWA ET AL.—GENETIC ANALYSIS OF BLASTOCYSTIS 589
———. 1992. Blastocystis anseri (Protista, Rhizopoda) from domestic
goose. Parazitologiia 26: 80–82. [In Russian.]
———, AND L. A. KOSTENKO. 1990. Blastocystis galli sp. n. (Protista:
Rhizopoda) from the intestine of domestic hens. Parazitologiia 24:
164–168. [In Russian.]
BÖHM-GLONING, B., J. KNOBLOCH, AND B. WALDERICH. 1997. Five sub-
groups of Blastocystis hominis isolates from symptomatic and
asymptomatic patients revealed by restriction site analysis of PCR-
amplified 16S-like rDNA. Tropical Medicine and International
Health 2: 771–778.
BRUMPT, E. 1912. Blastocystis hominis n.sp. et formes voisines. Bulletin
de la Societe de Pathologie Exotique 5: 725–730.
CARBAJAL, J. A., L. DEL CASTILLO, M. D. LANUZA, J. VILLAR, AND R.
BORRAS. 1997. Karyotypic diversity among Blastocystis hominis
isolates. International Journal for Parasitology 27: 941–945.
CHEN, X. Q., M. SINGH, L. C. HO, S. W. TAN, G. C. NG, K. T. MOE,
AND E. H. YAP. 1997. Description of a Blastocystis species from
Rattus norvegicus. Parasitology Research 83: 313–318.
CLARK, C. G. 1997a. Extensive genetic diversity in Blastocystis hominis.
Molecular and Biochemical Parasitology 87: 79–83.
———. 1997b. Riboprinting: A tool for the study of genetic diversity
in microorganisms. Journal of Eukaryotic Microbiology 44: 277–
283.
FELSENSTEIN, J. 1989. PHYLIP: Phylogeny inference package (version
3.2). Cladistics 5: 164–166.
HO, L.-C., K. JEYASEELAN, AND M. SINGH. 2001. Use of the elongation
factor-1a gene in a polymerase chain reaction-based restriction-
fragment-length polymorphism analysis of genetic heterogeneity
among Blastocystis species. Molecular and Biochemical Parasitol-
ogy 112: 287–291.
HOEVERS, J., P. HOLMAN, K. LOGAN, M. HOMMEL, R. ASHFORD, AND K.
SNOWDEN. 2000. Restriction-fragment-length polymorphism analy-
sis of small-subunit rRNA genes of Blastocystic hominis isolates
from geographically diverse human hosts. Parasitology Research
86: 57–61.
HOPKINS, R. M., B. P. MELONI, D. M. GROTH, J. D. WETHERALL, J. A.
REYNOLDSON, AND R. C. A. THOMPSON. 1997. Ribosomal RNA se-
quencing reveals differences between the genotypes of Giardia iso-
lates recovered from humans and dogs living in the same locality.
Journal of Parasitology 83: 44–51.
LE BLANCQ, S. M., AND R. D. ADAM. 1998. Structural basis of karyotype
heterogeneity in Giardia lamblia. Molecular and Biochemical Par-
asitology 97: 199–208.
PAGE, R. D. M. 1996. Treeview: An application to display phylogenetic
trees on personal computers. Computer Applications in the Biosci-
ences 12: 357–358.
SILBERMAN, J. D., M. L. SOGIN, AND D. D. LEIPE. 1996. Human parasite
finds taxonomic home. Nature 380: 398.
SINGH, M., L. C. HO, A. L. L. YAP, G. C. NG, S. W. TAN, K. T. MOE,
AND E. H. YAP. 1996. Axenic culture of reptilian Blastocystis iso-
lates in monophasic medium and speciation by karyotypic typing.
Parasitology Research 82: 165–169.
SNOWDEN, K., K. LOGAN, C. BLOZINSKI, J. HOEVERS, AND P. HOLMAN.
2000. Restriction-fragment-length polymorphism analysis of small-
subunit rRNA genes of Blastocystis isolates from animal hosts.
Parasitology Research 86: 62–66.
STENZEL, D. J., AND P. F. L. BOREHAM. 1996. Blastocystis hominis re-
visited. Clinical Microbiology Review 9: 563–584.
UPCROFT, J. A., L. A. DUNN, L. S. DOMMETT, A. HEALEY, P. UPCROFT,
AND P. F. L. BOREHAM. 1989. Chromosomes of Blastocystis hominis.
International Journal for Parasitology 19: 879–883.
WILLHOEFT, U., AND E. TANNICH. 1999. The electrophoretic karyotype
of Entamoeba histolytica. Molecular and Biochemical Parasitology
99: 41–53.
YOSHIKAWA, H., N. ABE, M. IWASAWA, S. KITANO, I. NAGANO, Z. WU,
AND Y. TAKAHASHI. 2000. Genomic analysis of Blastocystis hominis
strains isolated from two long-term health care facilities. Journal
of Clinical Microbiology 38: 1324–1330.
———, I. NAGANO, Z. WU, E. H. YAP, M. SINGH, AND Y. TAKAHASHI.
1998. Genomic polymorphism among Blastocystis hominis strains
and development of subtype-specific diagnostic primers. Molecular
and Cellular Probes 12: 153–159.
———, ———, E. H. YAP, M. SINGH, AND Y. TAKAHASHI. 1996. DNA
590 THE JOURNAL OF PARASITOLOGY, VOL. 89, NO. 3, JUNE 2003

polymorphism revealed by arbitrary primers polymerase chain re- polymorphic DNA from Entamoeba histolytica. Journal of Clinical
action among Blastocystis strains isolated from humans, a chicken, Microbiology 39: 897–905.
and a reptile. Journal of Eukaryotic Microbiology 43: 127–130. ZIERDT, C. H. 1991. Blastocystis hominis—Past and future. Clinical Mi-
ZAKI, M., AND C. G. CLARK. 2001. Isolation and characterization of crobiology Reviews 4: 61–79.
APPENDIX I. SSU rDNA–RFLP profiles of 12 restriction enzymes among the entire 22 Blastocystis isolates listed in Table I, with the expected size of Proteromonas lacertae (PI) estimated
from the published sequence data (U37108).

Blastocystis isolates listed in Table I

Band
Enzyme size 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Pl*

AluI 650 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 1 1 2
390 1 1 1 1 1 2 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 2 2
370 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
350 1 1 2 2 1 2 2 2 2 2 2 1 2 2 2 2 2 2 1 1 2 2 2
320 1 1 2 2 1 2 1 2 1 2 1 1 1 2 2 1 1 1 1 1 2 1 2
290 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
270 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2
240 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
220 1 1 2 2 1 1 1 2 1 2 1 1 1 1 1 1 1 1 1 1 2 2 2
190 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 1
170 1 1 1 1 1 1 2 1 2 1 2 1 2 1 1 2 2 2 1 1 1 1 1
130 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 1 1 2
110 2 2 2 2 2 2 1 2 2 2 2 2 1 2 2 2 1 1 2 2 2 2 1
100 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 1
90 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 1
DdeI 950 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 1 1 2
630 1 2 2 2 1 2 1 2 1 2 1 2 1 2 2 1 1 1 2 2 2 2 2
600 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 1 1 2 2 1
400 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 1 1 2 2 2
390 1 1 1 1 1 2 1 1 2 1 2 1 1 2 2 2 1 1 2 2 2 2 2
370 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 1
350 1 1 1 1 1 2 1 1 2 1 2 1 1 2 2 2 1 1 1 1 1 1 2
330 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
300 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 1
260 1 1 2 2 1 2 1 2 1 2 1 1 1 2 2 1 1 1 1 1 1 1 2
230 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
130 1 1 2 2 1 1 1 2 2 2 2 1 1 1 1 2 1 1 2 2 2 2 1
100 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 1 1 2
90 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 1 1 1 1 2
70 2 2 1 1 2 2 2 1 1 1 1 2 2 2 2 1 2 2 1 1 1 1 1
HaeIII 1,300 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
1,050 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2
1,000 1 1 2 2 1 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2
540 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
520 1 1 1 1 1 1 1 1 2 1 2 1 1 1 1 2 1 1 1 1 1 1 2
320 1 1 2 2 1 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 1
220 2 2 1 1 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
HinfI 900 1 1 2 2 1 1 2 2 2 2 2 1 1 1 1 2 1 1 2 2 2 2 1
700 2 2 2 2 2 2 1 2 1 2 1 2 2 2 2 1 2 2 1 1 1 1 2
530 1 1 2 2 1 2 1 2 2 2 2 1 1 2 2 2 1 1 2 2 2 2 1
500 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 1 1 1 1 2
480
YOSHIKAWA ET AL.—GENETIC ANALYSIS OF BLASTOCYSTIS

2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
400 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
300 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 1 1 2 1 2
591
APPENDIX I. Continued. 592

Blastocystis isolates listed in Table I

Band
Enzyme size 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Pl*

280 1 1 2 2 2 2 1 2 2 2 2 1 1 2 2 2 1 1 2 2 2 2 2
270 2 2 1 1 2 1 2 1 2 1 2 2 2 1 1 2 2 2 2 2 2 2 2
250 2 2 2 2 2 1 2 2 1 2 1 2 2 1 1 1 2 2 1 1 2 2 2
210 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 1
190 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
180 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
115 2 2 1 1 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2
100 2 2 1 1 1 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 1 2 2
70 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
MspI 1,100 1 1 1 1 1 2 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 2
1,050 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
700 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 1 1 2
580 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
560 1 1 2 2 1 1 1 2 2 2 2 1 1 1 1 2 1 1 1 1 2 2 2
130 1 1 2 2 1 2 1 2 1 2 1 1 1 2 2 1 1 1 1 1 2 2 2
100 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
RsaI 1,150 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 2 2 1
THE JOURNAL OF PARASITOLOGY, VOL. 89, NO. 3, JUNE 2003

550 1 1 2 2 1 1 1 2 2 2 2 1 1 1 1 2 1 1 1 1 1 1 2
510 2 2 1 1 2 1 1 1 2 1 2 2 1 1 1 2 1 1 1 1 2 2 2
380 1 1 2 2 1 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 1 1 2
360 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
320 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
230 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
200 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
170 1 1 1 1 1 2 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 2
150 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 1
140 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
130 1 1 2 2 1 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 1 1 1
70 2 2 2 2 2 2 2 2 1 2 2 2 2 2 2 1 2 2 2 2 2 2 2
60 2 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
Sau3AI 990 2 2 1 1 2 2 1 1 1 1 1 2 1 2 2 1 1 1 1 1 2 2 2
800 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 1 1 2
720 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 1
670 2 1 2 2 2 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2
630 1 2 2 2 1 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 1 1 2
520 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
500 1 1 2 2 1 2 1 2 2 2 2 1 1 2 2 2 1 1 1 1 2 2 2
410 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 1
340 1 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2
320 2 1 2 2 2 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2
280 1 1 2 2 1 2 1 2 2 2 2 1 1 2 2 2 1 1 2 2 2 2 1
240 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 1
160 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
140 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 1 1 2 2 2
120 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
80 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 1
60 1 1 2 2 1 2 1 1 2 2 2 1 1 2 2 2 1 1 1 1 2 2 2
APPENDIX I. Continued.

Blastocystis isolates listed in Table I

Band
Enzyme size 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Pl*

Sau96I 1,200 2 2 1 1 2 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1
900 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
610 2 2 2 2 2 1 2 2 1 2 2 2 2 1 1 1 2 2 1 1 2 2 2
580 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 1 1 2 2 2
500 1 1 1 1 2 2 1 1 2 1 1 1 1 2 2 2 1 1 2 2 2 2 2
470 1 1 1 1 1 2 1 1 2 1 1 1 1 2 2 2 1 1 2 2 1 1 2
420 1 1 2 2 2 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2
330 1 1 2 2 1 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 1
140 1 1 1 1 1 2 1 1 2 1 1 1 1 2 2 2 1 1 2 2 1 1 2
SinI 1,200 2 2 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1
740 1 1 2 2 2 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2
600 2 2 2 2 2 2 2 2 2 2 1 2 1 2 2 1 2 2 2 2 2 2 2
580 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 1 1 2 2 1
470 1 1 2 2 2 2 2 2 2 2 2 1 2 2 2 2 1 1 2 1 1 1 2
450 1 1 1 1 1 2 1 1 1 1 2 1 1 2 2 2 1 1 2 2 2 2 2
140 1 1 1 1 1 2 1 1 1 1 2 1 1 2 2 2 2 2 2 1 1 1 2
SpeI 1,100 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 1 1 2
950 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 1 1 2 2 2
900 1 1 2 2 1 2 1 2 1 2 1 1 1 2 2 1 1 1 1 1 2 2 2
750 2 2 1 1 2 2 2 1 2 1 2 2 2 2 2 2 2 2 2 2 1 1 2
460 1 1 2 2 1 2 1 2 2 2 2 1 1 2 2 2 1 1 2 2 2 2 2
TaqI 850 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
700 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2
520 1 1 1 1 1 2 1 1 2 1 2 1 1 2 2 2 1 1 1 1 1 1 2
480 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2
320 2 1 1 1 2 2 2 2 1 1 1 1 2 2 2 1 2 2 1 1 2 2 2
300 1 1 1 1 1 2 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 1
290 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
250 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
190 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2
160 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2
140 1 2 2 2 1 2 1 2 2 1 2 2 1 2 2 2 1 1 2 2 2 2 2
130 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
Tru9 610 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2
540 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 1 1 2
520 2 2 2 2 2 1 2 2 1 2 1 2 2 1 1 1 2 2 2 2 2 2 2
510 2 2 1 1 2 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
450 2 2 1 1 2 2 1 1 2 1 2 2 1 2 2 2 1 1 2 2 2 2 2
400 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2
390 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2 2 2
370 1 1 2 2 1 2 2 2 1 1 1 1 2 2 2 1 2 2 2 2 2 2 2
320 1 1 2 2 1 2 1 2 2 2 2 1 1 2 2 2 1 1 2 2 2 2 2
YOSHIKAWA ET AL.—GENETIC ANALYSIS OF BLASTOCYSTIS

250 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 1 2
240 1 1 2 2 1 2 1 2 2 2 2 1 1 2 2 2 1 1 2 2 2 2 1
593
 594

APPENDIX I. Continued.

Blastocystis isolates listed in Table I

Band
Enzyme size 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Pl*
THE JOURNAL OF PARASITOLOGY, VOL. 89, NO. 3, JUNE 2003

220 1 1 2 2 1 2 1 2 2 2 2 1 1 2 2 2 1 1 2 2 2 2 1
170 1 1 2 2 1 1 1 2 1 2 1 1 1 1 1 1 1 1 1 1 2 2 2
160 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 1 2 2 2 2 2 2 1
140 2 2 1 1 2 1 2 1 2 1 2 2 2 1 1 2 2 2 2 2 2 2 2
120 2 2 2 2 2 1 2 2 2 2 2 2 2 1 1 2 2 2 1 1 2 2 1
110 2 2 1 1 2 2 2 1 1 1 1 2 2 2 2 1 2 2 1 1 1 1 1
100 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2
80 1 1 2 2 1 1 2 2 2 2 2 1 2 1 1 2 2 2 1 1 2 2 1

* When SSU rDNA fragments were present in P. lacertae only, these bands were excluded from the phylogenetic analysis, and hence do not appear in the table.