Journal of Medical Microbiology (2004), 53, 1137–1144 DOI 10.1099/jmm.0.

45719-0

Association of atypical enteropathogenic

Escherichia coli (EPEC) with prolonged diarrhoea
Jan E. Afset,1 Lars Bevanger,1 Pål Romundstad2 and Kåre Bergh1

Correspondence Laboratory of Medical Microbiology, St. Olavs Hospital, University Hospital and Department of
Jan E. Afset Laboratory Medicine, Children’s and Women’s Health1 and Department of Public Health and General
jan.afset@stolav.no Practice, Faculty of Medicine,2 Norwegian University of Science and Technology, Trondheim, Norway

Received 27 April 2004
Accepted 28 June 2004
The aim of the present case control study was to investigate the prevalence of atypical
enteropathogenic Escherichia coli (EPEC) and its possible role in causing diarrhoea among
children , 5 years of age in Norway. Stool specimens received in the laboratory from children with
suspected gastroenteritis (n ¼ 251) were, in addition to routine testing, analysed for the presence of
EPEC by PCR of the eae, bfpA and stx genes. Specimens from healthy children (n ¼ 210) recruited
from Maternal and Child Health Centres were analysed for EPEC only. EPEC isolates (eae þ , stx
)
were classified as typical (bfpAþ ) or atypical (bfpA
), and were tested for O : K serogroup.
Information on duration of diarrhoea was recorded in a questionnaire and from referral forms.
Atypical EPEC was diagnosed in 37 patients (14.7 %) compared to 21 (10.0 %) of the healthy
controls [Odds ratio (OR) ¼ 1.4, P ¼ 0.3]. Only three isolates, all from patients, belonged to EPEC
serogroups. One patient had typical EPEC. Twenty (22.5 %) of 89 patients with diarrhoea lasting
>14 days had atypical EPEC. The association between atypical EPEC and prolonged diarrhoea
(OR ¼ 2.1, P ¼ 0.04) was caused by a high prevalence among female patients (40.6 %). In
conclusion, atypical EPEC was found to be slightly more prevalent in patients than controls, without
any overall significant association with diarrhoea. However, a significant association was observed
with diarrhoea lasting 14 days or more, a finding that may indicate a role for atypical EPEC in
prolonged disease.

INTRODUCTION by intimate adherence of the bacteria to the intestinal

Enteropathogenic Escherichia coli (EPEC) is one of the
leading causes of diarrhoeal morbidity and mortality among
children in developing countries (Clarke et al., 2002).
Decades ago EPEC was also frequently seen among children
in industrialised countries (Levine & Edelman, 1984). The
EPEC diagnosis was at that time based on the identification
of recognized EPEC serogroups. Then, for unknown reasons,
a decline in the incidence of EPEC was observed in the
industrialised world, and most routine laboratories stopped
testing for EPEC. Only after the central mechanism of EPEC
pathogenesis was discovered and new diagnostic methods
were developed, did interest in this pathogen again gradually
increase in the developed world.
The central mechanism of EPEC pathogenesis is a lesion
called ‘attaching and effacing’ (A/E), which is characterized
Abbreviations: A/E, attaching and effacing; EAEC, enteroaggregative E.
coli ; EAF, EPEC adherence factor; EHEC, enterohaemorrhagic E. coli ;
EIEC, enteroinvasive E. coli ; EPEC, enteropathogenic E. coli ; ETEC,
enterotoxigenic E. coli ; OR, odds ratio.
A supplementary table showing risk factors for diarrhoeal disease is
available in JMM Online.
epithelium (Nougayrède et al., 2003). The eae gene located
in the pathogenicity island ‘locus of enterocyte effacement’
(LEE) and the bfpA gene located on a plasmid, called the
EPEC adherence factor (EAF), have been used to classify this
group of bacteria into typical and atypical strains (Kaper,
1996). E. coli strains of the A/E genotype (eae þ ) harbouring
the EAF plasmid (bfpAþ ), are classified as ‘typical EPEC’.
Most such strains belong to certain O : H serotypes (Trabulsi
et al., 2002). Strains of the A/E genotype, which do not posses
the EAF plasmid (bfpA
), are classified as ‘atypical EPEC’.
eae-positive E. coli strains harbouring Shiga toxin genes (stx1
and/or stx2) are classified as enterohaemorrhagic E. coli.
Typical EPEC is well recognized as a cause of gastroenteritis
in infants (Levine & Edelman, 1984; Nataro & Kaper, 1998).
The role of atypical EPEC in childhood diarrhoea is still
controversial. Most case control studies have not been able to
demonstrate any significant association between atypical
EPEC and diarrhoea (Echeverria et al., 1991; Gomes et al.,
1991; Morelli et al., 1994; Forestier et al., 1996; Knutton et al.,
2001; Scaletsky et al., 2002a, b; Nunes et al., 2003; Regua-
Mangia et al., 2004). However, the majority of these studies
demonstrated a tendency for the group of subjects with

45719 & 2004 SGM Printed in Great Britain 1137

J. E. Afset and others
diarrhoea to have a higher prevalence of atypical EPEC than
healthy controls, and it has been argued that atypical EPEC
are probably pathogenic, since such strains are capable of
colonizing the intestinal mucosa and produce A/E lesions
(Knutton et al., 2001). In volunteer studies some of the
subjects who were given EAF plasmid-cured (Levine et al.,
1985) or bfpA-mutated (Bieber et al., 1998) EPEC developed
diarrhoea, although to a lesser extent than those who were
given the original EPEC strains. There have also been reports
where atypical EPEC was significantly associated with
endemic diarrhoea (Scaletsky et al., 1999; Vieira et al.,
2001; Dulguer et al., 2003) or was the cause of outbreaks
(Viljanen et al., 1990; Hedberg et al., 1997; Yatsuyanagi et al.,
2002; Jenkins et al., 2003).
Recently, we described a high prevalence of EPEC among
Norwegian children with diarrhoea (Afset et al., 2003). The
majority of EPEC isolates in that study were classified as
atypical, and most of them (35/43 isolates) did not belong to
EPEC serogroups (as defined by WHO, 1987). To investigate
the prevalence of EPEC and its possible role in causing
diarrhoea among Norwegian children, we conducted a case
control study among children , 5 years old.
METHODS
Patients and controls. The study was conducted during the period
March 2002 to January 2003 in the county of Sør-Trøndelag, Norway,
and was approved by the Regional Committee for Medical Research
Ethics, the Norwegian Data Inspectorate, and Norwegian Social Science
Data Services. Cases were defined as subjects , 5 years of age with
suspected gastroenteritis from whom the laboratory received a stool
specimen. Included were outpatients and patients admitted to the
hospital paediatric observation ward. Patients were not included if there
was no growth in the stool culture, making EPEC analysis impossible.
Consent for participation in the study was requested from the parents of
the patients.
Healthy controls were recruited through Maternal and Child Health
Centres in Trondheim, after informed consent from parents. They were
matched to patients with respect to sex, time of the year of specimen
collection (quarter) and age (<12 months, 13–24 months and 25–60
months). Subjects were not included as controls if they had had
diarrhoea within the last 4 weeks, and were excluded if there was no
growth in the stool culture.
Subjects in whom EPEC was identified were asked for follow-up
specimens. The first of these specimens was taken after 1 month, and
specimens were collected at monthly intervals until negative or until the
subject had been followed for 6 months.
EPEC identification. For EPEC isolation, all stool specimens from
patients and controls were cultured on MacConkey agar (Difco). PCR
(eae, stx) was primarily performed on 2–3 cm streaks from bacterial
growth on the agar plate. If the streak was PCR-positive, ten colonies
were subcultured from the same primary culture plate (stored at 4 8C)
and retested. Isolates with the eae genotype identified as E. coli were then
stored (one isolate per subject) at
70 8C until they were analysed for
the presence of the bfpA gene. Biochemical identification of E. coli was
done by API 10S/20E (bioMérieux).
For PCR testing, streaks from bacterial growth were suspended in 4 ml
physiological saline, and further diluted 1 : 100. From subculture plates
one colony was suspended in 1 ml physiological saline. Lysis of bacterial
1138
cells was done by heating at 94 8C for 15 min. Amplification of the eae
and bfpA genes was performed in a total volume of 50 ìl, containing 50
ìM (each) of dATP, dCTP, dGTP and dTTP, 0.5 ìM of each primer,
103 PCR buffer (Roche), 1.5 mM MgCl2 , 1 U AmpliTaq Gold poly-
merase (Roche), 0.025 % BSA and 2 ìl bacterial lysate as template.
Detection of stx1 and stx2 genes was carried out by multiplex PCR with
conditions as above, except the use of 100 ìM (each) dNTP and no BSA.
The reaction mixture was heated to 94 8C prior to amplification and
held at 72 8C for 7 min before cooling to 4 8C. Primer sequences and
cycling conditions are listed in Table 1. Amplification products were
analysed by 2 % agarose gel electrophoresis and visualized by staining
with ethidium bromide. Clinical isolates of E. coli O157 : H7 (eae, stx1,
stx2) and E. coli B171 (bfpA) were used as positive controls.
Bacterial growth on a primary MacConkey plate was also tested for
EPEC serogroups with polyspecific O-antisera Anti-Coli I (O26, O44,
O114, O125, O142, O158) and Anti-Coli II (O55, O86, O111, O119,
O126, O127, O128) according to the manufacturer’s instructions
(Sifin). If the primary culture was positive, ten colonies were sub-
cultured and retested. Positive strains that were identified as E. coli were
examined using monospecific O : K antisera at the Norwegian Institute
of Public Health, Oslo (Sifin and in-house antisera).
Follow-up specimens were analysed by PCR for the eae gene using a
streak of bacterial growth from the culture plate.
Other pathogens. Whereas stool specimens from control subjects
were tested for EPEC only, patients’ specimens were routinely examined
for a range of pathogens in addition to EPEC. Specimens from patients
were cultured for Salmonella, Shigella, Campylobacter, Yersinia, Aero-
monas and Plesiomonas using lysine sucrose-urea agar (Jühlin &
Ericson, 1961), SSI Enteric Medium (Blom et al., 1999) and selenite
broth (Difco). For the isolation of Campylobacter species, specimens
were cultured on charcoal cefoperazone desoxycholate agar (Mast
Diagnostics). The specimens were examined for adenovirus by enzyme
immunoassay (DakoCytomation), PCR (Krokstad et al., 2003) and viral
cell culture, and for rotavirus with enzyme immunoassay (DakoCyto-
mation).
Stool specimens that contained eae-positive isolates were additionally
tested for the presence of other diarrhoeagenic (enteroinvasive, enter-
otoxigenic, enteroaggregative) E. coli by PCR (Table 1). These speci-
mens were also examined with enzyme immunoassay for astrovirus and
norovirus (DakoCytomation), Giardia lamblia (Remel) and Crypto-
sporidium (Cellabs).
Questionnaire. Information regarding demographic data, possible
risk factors for gastrointestinal infection, medical history and duration
of disease was collected in a questionnaire as well as from the physician’s
referral form (patients). Information about hospital admission and
discharge diagnosis was collected from hospital records.
Statistical analyses. Multiple logistic regression was used to study the
potential association between EPEC and diarrhoea. The analyses were
adjusted for matching factors (sex, age group and time of specimen
collection), and were controlled for potential confounding from other
risk factors. The data were also analysed using conditional logistic
regression, with results similar to that of ordinary logistic regression
analyses. The Mann–Whitney U-test was employed for testing of
difference in number of eae-positive subcultures between patients and
controls, whereas Fisher’s exact test was used in the analysis of duration
of EPEC carriage. P values , 0.05 were considered significant.
Statistical analyses were performed using SPSS version 12.0 (SPSS) except
in conditional logistic regression analyses where Stata version 8.0
(StataCorp 2003) was used.
Journal of Medical Microbiology 53
 Atypical EPEC in Norwegian children

Table 1. PCR for the detection of EPEC, enterohaemorrhagic E. coli (EHEC), enteroinvasive E. coli (EIEC), enterotoxigenic E. coli
(ETEC) and enteroaggregative E. coli (EAEC)
eae, Attaching and effacing-associated gene; stx, Shiga toxin gene; bfpA, bundle-forming pilus gene; ial, invasion associated locus of EIEC.

Category Target Nucleotide sequence (59–39) Amplification No. Size of Reference

conditions cycles amplified
product (bp)

EPEC eae F, GTGGCGAATACTGGCGAGACT 94 8C (1 min), 35 891 Gannon et al. (1993)

R, CCCCATTCTTTTTCACCGTCG 60 8C (1 min),
72 8C (2 min)
EPEC bfpA F, AATGGTGCTTGCGCTTGCTGC 94 8C (1 min), 30 326 Gunzburg et al. (1995)
R, GCCGCTTTATCCAACCTGGTA 60 8C (1 min),
72 8C (2 min)
EHEC stxI F, AAATCGCCATTCGTTGACTACTTCT 94 8C (1 min), 35 370 Brian et al. (1992)
R, CAGTCGTCACTCACTGGTTTCATCA 64 8C (1 min),
72 8C (15 sec)
stxII F, TGCCATTCTGGCAACTCGCGATGCA 94 8C (1 min), 35 283 Brian et al. (1992)
R, GGATCTTCTCCCCACTCTGACACC 64 8C (1 min),
72 8C (15 sec)
EIEC ial F, CTGGATGGTATGGTGAGG 94 8C (1 min), 26 320 Schoolnik (1993)
R, GGAGGCCAACAATTATTTCC 43 8C (2 min),
72 8C (3 min)
ETEC LT-A F, GGCGACAGATTATACCGTGC 94 8C (1 min), 33 696 Schultsz et al. (1994)
R, CCGAATTCTGTTATATATGTC 43 8C (1 min),
72 8C (2 min)
ST-1B F, CCCTCAGGATGCTAAACCAG 94 8C (1 min), 33 166 Schultsz et al. (1994)
R, TTAATAGCACCCGGTACAAGC 43 8C (1 min),
72 8C (2 min)
EAEC AA probe F, CTGGCGAAAGACTGTATCAT 95 8C (1 min), 40 629 Cerna et al. (2003)
R, CAATGTATAGAAATCCGCTGTT 55 8C (1 min),
72 8C (2 min)

RESULTS AND DISCUSSION Table 2. Demographic variables and time of specimen collection
in patients with diarrhoea (n ¼ 251) and healthy controls
During the period March 2002 to January 2003, 251 patients (n ¼ 210)
and 210 healthy controls , 5 years of age were included in
the study. Demographic variables and time of specimen Variable No. patients No. controls
collection are presented in Table 2. The majority in the (%) (%)
patient group (192/251 subjects, 76.5 %) were treated as
outpatients, while 59 (23.5 %) were admitted to hospital. Of Age (months)
those admitted, 44 patients (17.5 % of the total) were <12 68 (27.1) 80 (38.1)
discharged with a diagnosis of infectious gastroenteritis, 13–24 89 (35.5) 58 (27.6)
whereas the remaining 15 patients had conditions other than 25–60 94 (37.5) 72 (34.3)
infectious diarrhoea. Among these, respiratory tract infec- Sex
tion (n ¼ 8) and non-infectious gastrointestinal disease Female 108 (43.0) 87 (41.4)
(n ¼ 3) were most common, while four patients had un- Male 143 (57.0) 123 (58.6)
specified symptoms or disease in other organ systems. It was Time of specimen collection
possible to classify the duration of diarrhoea in 178 (70.9 %) January–March 24 (9.6) 28 (13.3)
of the 251 patients, as either short ( , 14 days) or prolonged April–June 99 (39.4) 71 (33.8)
(>14 days) disease. July–September 43 (17.1) 36 (17.1)
October–December 85 (33.9) 75 (35.7)
Completed questionnaires were returned from 192 (76.5 %)
patients and 204 (97.1 %) controls. Patients and controls
were compared with respect to potential risk factors for ment within the last 3 months (OR ¼ 1.9, P ¼ 0.03) and
diarrhoea other than micro-organisms. A significant associa- diarrhoeal illness among family members within the last 2
tion was found for the factors: drinking water from private weeks (OR ¼ 9.0, P , 0.001). An association was also seen in
well [Odds ratio (OR) ¼ 4.8, P ¼ 0.003]; antibiotic treat- children , 1 year of age between diarrhoea and travel

http://jmm.sgmjournals.org 1139
J. E. Afset and others

abroad within the last 6 months (OR ¼ 3.3, P ¼ 0.02). A Table 4. Classification of EPEC isolates identified among 251
table with risk factors for diarrhoea other than micro- children with diarrhoea and 210 healthy controls , 5 years old
organisms is available as supplementary data in JMM Online.
Classification No. subjects with EPEC among:
Potential enteropathogens in patients
Patients (%) Controls (%)
A potential or established microbial pathogen was detected
in 99 (39.4 %) of the 251 children with diarrhoea. Among bfpA-positive
these, a single pathogen was identified in 88 patients whereas EPEC serogroup* 0 0
more than one organism was found in 11 patients. Among all Non-EPEC serogroup 1 (2.6) 0
potential enteropathogens in children with diarrhoea, rota- bfpA-negative
virus and EPEC were the most commonly identified agents EPEC serogroup* 3 (7.9) 0
(Table 3). Non-EPEC serogroup 34 (89.5) 21 (100.0)
Total 38 (100.0) 21 (100.0)

EPEC
*As defined by WHO (1987).
PCR from growth on the primary culture plate was positive
for the eae gene in 45 (17.9 %) patients and in 27 (12.9 %)
healthy controls. In 13 (7 patients and 6 controls) of these such strains are rarely isolated from children with and
subjects, an eae-positive organism was not recovered after without diarrhoea (Trabulsi et al., 2002). eae-positive E. coli
subculture of ten distinct colonies. Only subjects in whom strains not belonging to EPEC serogroups have been reported
eae-positive E. coli isolates were identified were recorded as to constitute a heterogeneous group (Vieira et al., 2001;
EPEC-positive in the subsequent analyses. Thus, EPEC was Trabulsi et al., 2002). However, most such strains have
identified in 38 (15.1 %) patients compared to 21 (10.0 %) of virulence profiles similar to atypical strains of EPEC ser-
the healthy controls. Among the 38 patients with EPEC, one ogroups (Vieira et al., 2001; Dulguer et al., 2003), and at least
or two additional pathogens were identified in eight patients some of these strains are able to induce A/E lesions in human
(Table 3). intestinal biopsies (Knutton et al., 2001; Vieira et al., 2001).
We therefore chose to include all eae þ , stx
and bfpA
E. coli
Atypical EPEC (58/59 isolates, 98.3 %) constituted the strains in the group of atypical EPEC in this study, irrespec-
majority of eae-positive isolates in this study. Only three of tive of the result of serogroup determination. The finding of
these isolates (all from patients) belonged to EPEC ser- only one isolate of typical EPEC in this study (Table 4)
ogroups (Table 4). This finding is in accordance with that confirms our previous observation that typical EPEC is a rare
recently reported from the UK (Knutton et al., 2001) and cause of diarrhoea in Norwegian patients (Afset et al., 2003).
Brazil (Dulguer et al., 2003), but not with the notion that
Atypical EPEC was highly prevalent both in patients with
diarrhoea (14.7 %) and in controls (10.0 %). Whereas a high
Table 3. EPEC and other intestinal pathogens isolated from 251 prevalence in symptomatic children was as expected (Afset et
Norwegian children with diarrhoea al., 2003), the carrier rate in healthy controls was consider-
ably higher than predicted and almost twice the rates of
Potential pathogen No. patients (%) atypical EPEC in children without diarrhoea recently re-
ported by other authors (Knutton et al., 2001; Gomes et al.,
EPEC total 38 (15.1) 2002; Dulguer et al., 2003).
Alone 30 (12.0)
Combined with other pathogens: Although atypical EPEC was more commonly diagnosed in
Adenovirus 1 (0.4) patients than controls, the association with diarrhoea was not
Astrovirus 1 (0.4) statistically significant when all subjects with and without
EAEC 2 (0.8) diarrhoea were compared (OR ¼ 1.4, P ¼ 0.3, Table 5).
Rotavirus 3 (1.2) Controlling for other risk factors did not change this result.
Rotavirus + adenovirus 1 (0.4) Patients with combinations of atypical EPEC and other
Pathogens other than EPEC 61 (24.3) enteropathogens were included in the statistical analyses.
Adenovirus 13 (5.2) This was done as EPEC is often found together with other
Campylobacter jejuni 4 (1.6) diarrhoeal agents (Afset et al., 2003), and might have a
EHEC (eae-negative) 1 (0.4) propensity to cause symptoms through synergism with other
Rotavirus 40 (15.9) enteropathogenic agents (Fagundes-Neto & Scaletsky, 2000).
Salmonella enterica 1 (0.4)
Combination of organisms Atypical EPEC was uncommon among children less than 1
Adenovirus + rotavirus 1 (0.4) year of age, and was identified in three each of patients and
C. jejuni + rotavirus 1 (0.4) controls (Table 5). This finding is in accordance with that
Total 99 (39.4) found in the same age group in the UK (Knutton et al., 2001),
but very different from that reported from Guinea-Bissau

1140 Journal of Medical Microbiology 53

 Atypical EPEC in Norwegian children

Table 5. Rate of atypical EPEC in selected groups of Norwegian children with diarrhoea compared with healthy controls

Selected group of patients No. subjects with atypical EPEC among:* OR† 95% CI P

Patients Controls

All patients 37/251 (14.7) 21/210 (10.0) 1.4 0.8, 2.5 0.3
Age group (months)
<12 3/68 (4.4) 3/80 (3.8) 1.1 0.2, 5.9 0.9
13–24 14/89 (15.7) 10/58 (17.2) 0.9 0.4, 2.4 0.9
25–60 20/94 (21.3) 8/72 (11.1) 2.2 0.9, 5.3 0.09
Sex
Girls 22/108 (20.4) 8/87 (9.2) 2.4 1.0, 5.8 0.06
Boys 15/143 (10.5) 13/123 (10.6) 1.0 0.4, 2.8 1.00
Duration of diarrhoea (days)
,14 9/88 (10.2) 1.0 0.4, 2.4 0.9
21/210 (10.0)
>14 20/89 (22.5) 2.1 1.0, 4.2 0.04
Duration not recorded 8/74 (10.8) NA


Sex distribution in patients with diarrhoea >14 days
Girls 13/32 (40.6) 8/87 (9.2) 5.6 1.9, 16.3 0.001
Boys 7/57 (12.3) 13/123 (10.6) 0.9 0.3, 2.4 0.8

*No./total no. subjects (%).

†The analysis was adjusted for age, sex and time of specimen collection; NA, not applicable.

where half the infants in a cohort followed from birth were
infected with atypical EPEC before 4 months of age
(Valentiner-Branth et al., 2003). It is possible that Norwegian
infants to some extent are protected from EPEC infection by
maternal immunity, breastfeeding and the fact that most
children start attending kindergarten after 1 year of age. In
this study only two of the children less than 1 year of age
attended kindergarten. However, these factors are unlikely to
completely explain the great difference between infants and
older children, where the prevalence of atypical EPEC was
more than 10 % (Table 5). A considerable proportion of the
infants were not breastfed (32/121 infants), and many were
exposed to potentially infected older siblings (see supple-
mentary table in JMM Online). The reason for this difference
in EPEC rate between infants and older children in Norway
and other industrialised countries therefore remains unclear,
as does the difference compared with developing countries.
The prevalence of atypical EPEC was not markedly different
between the groups of patients and controls less than 2 years
of age. In those aged 25–60 months, however, there was a
tendency that atypical EPEC was more frequently diagnosed
among patients than among controls (OR ¼ 2.2, P ¼ 0.09,
Table 5). Atypical EPEC was more common among girls
(15.9 %) than among boys (10.5 %). This was due to a higher
prevalence among girls with diarrhoea, whereas the preva-
lence among healthy girls was comparable with that of boys
in both groups (Table 5). Although diagnosed throughout all
seasons of the year, atypical EPEC was found most frequently
in the late summer/early autumn period. Almost half (27
isolates, 46.6 %) of the 58 isolates were found during the 3-
month period August to October. Atypical EPEC was
uncommon among hospitalized patients, and was detected
in only three (5.1 %) of the 59 patients who were admitted.
This result, which is in accordance with our previous study of
patients , 2 years old (Afset et al., 2003), supports the
notion that atypical EPEC rarely causes gastroenteritis severe
enough to necessitate hospitalization.
Disease duration
When patients with diarrhoea were compared with respect to
disease duration, the prevalence of atypical EPEC was found
to be higher in those with diarrhoea lasting 14 days or more
(22.5 %) than in patients with disease of shorter duration
(10.2 %, Table 5). Atypical EPEC was significantly associated
with prolonged diarrhoea (OR ¼ 2.1, P ¼ 0.04) when the
subgroup of patients with protracted disease was compared
with healthy controls (Table 5). This difference was caused by
a much higher prevalence in female patients (40.6 %) than
controls (9.2 %, OR ¼ 5.6, P ¼ 0.001), whereas no difference
was observed for males.
It has been argued that the association between EPEC and
prolonged diarrhoea does not necessarily represent a causal
link (Levine & Edelman, 1984; Vallance et al., 2003). Rather
than being cause of the disease, EPEC colonization could be
promoted by the intestinal epithelial changes seen in chronic
diarrhoea. Studies in patients with inflammatory bowel
disease do shed some light on this question (Schultsz et al.,
1997; Darfeuille-Michaud et al., 1998). It was shown that
adult patients with ulcerative colitis and Crohn’s disease did
not have an increased rate of eae þ E. coli compared to healthy
controls. These studies therefore do not support the theory of
EPEC colonization as a result of chronic intestinal disease.

http://jmm.sgmjournals.org 1141
J. E. Afset and others
It is well known that typical EPEC can cause protracted
diarrhoea (Levine & Edelman, 1984; Donnenberg, 1995;
Fagundes-Neto & Scaletsky, 2000), but it has been less clear
whether atypical EPEC has a similar potential. To our
knowledge, an association between atypical EPEC and
prolonged diarrhoea has previously only been reported by
Scaletsky and colleagues in a study of infants where half of the
patients with atypical EPEC had persistent diarrhoea (Sca-
letsky et al., 1999). The present study does indicate a role of
atypical EPEC in prolonged diarrhoea, although lack of data
on disease duration in some patients, as well as other factors
mentioned above preclude any firm conclusion. The finding
of a possible sex-related difference in the association of
atypical EPEC and prolonged diarrhoea is interesting, but
difficult to explain biologically and needs confirmation in
further studies.
Relative quantity of atypical EPEC in stool
specimens
Patients and healthy controls with atypical EPEC were
compared with respect to the relative quantity of eae-positive
organisms in their stools. It was found that a pure culture
(10/10 subcultures) of atypical EPEC was more common in
patients (17/37, 45.9 %) than in controls (5/21, 23.8 %).
However, atypical EPEC was present in a large proportion of
subcultures in both groups. Therefore, the overall difference
in relative quantity between patients and controls was not
statistically significant (P ¼ 0.3, data not shown). This find-
ing is not in accordance with the observation for typical
EPEC which is usually found to be present in a higher
number in patients with diarrhoea than in healthy carriers
(Levine & Edelman, 1984), and is not in favour of the theory
of a causative association between atypical EPEC and diar-
rhoea. However, it is difficult to pick colonies from a culture
plate in a random fashion, and the subjective element
involved might have influenced the results.
Duration of EPEC carriage
A total of 50 of the 57 subjects with atypical EPEC provided at
least one follow-up specimen. Among these, altogether 14
specimens were positive for the eae gene at the first follow-up,
four of 20 (20 %) healthy controls and 10 of 30 (33.3 %)
patients, respectively. However, the difference in interval
from primary to follow-up specimen collection between
patients (median 38 days) and controls (median 59 days)
could explain this difference. Three subjects (5.8 %), one of
whom was a healthy control, still had EPEC in their stool after
3 months.
In patients where it was possible to classify diarrhoea with
respect to duration, colonization with atypical EPEC at 1
month follow-up was compared with disease duration.
Although not significant, the proportion of patients still
colonized after 1 month tended to increase with increasing
length of diarrhoea. Among eight patients with diarrhoea
, 14 days, one subject (12.5 %) was still colonized at 1
1142
month follow-up, compared with five of 16 (31.3 %) and
four of six patients (66.7 %) with diarrhoea lasting 14–28
days and .28 days, respectively (P ¼ 0.12).
Based on the high rate among healthy controls, it is obvious
that a large proportion of atypical EPEC infections must
represent asymptomatic carriage rather than symptomatic
infection. This does not exclude the possibility that some
atypical EPEC strains may have the potential to cause
symptomatic disease in some instances. The association
between atypical EPEC and prolonged diarrhoea in this
study supports this view. Individual atypical EPEC strains
may have additional virulence factors (Scaletsky et al., 2002c;
Dulguer et al., 2003), and host factors might be involved,
either through immunity or other mechanisms. An example
of such a host factor could be polymorphism of the IL8
promoter gene, which has recently been associated with
variable susceptibility to enteroaggregative E. coli diarrhoea
(Jiang et al., 2003). Further studies are necessary to clarify the
role of such factors.
Conclusions
Atypical EPEC was found to be slightly more prevalent in
patients than controls, without any overall significant
association with diarrhoea. However, a significant associa-
tion was observed with diarrhoea duration of 14 days or
more, a finding that may indicate a role of atypical EPEC in
prolonged disease.
ACKNOWLEDGEMENTS
We thank the staff at Maternal and Child Health Centres in Trondheim
for kind co-operation in the recruitment of healthy controls, Jørgen
Lassen, Norwegian Institute of Public Health, for O : K serogrouping of
E. coli isolates, and the technical staff at the laboratory for skilful
technical assistance.
REFERENCES
Afset, J. E., Bergh, K. & Bevanger, L. (2003). High prevalence of atypical
enteropathogenic Escherichia coli (EPEC) in Norwegian children with
diarrhoea. J Med Microbiol 52, 1015–1019.
Bieber, D., Ramer, S. W., Wu, C. Y., Murray, W. J., Tobe, T., Fernandez, R.
& Schoolnik, G. K. (1998). Type IV pili, transient bacterial aggregates,
and virulence of enteropathogenic Escherichia coli. Science 280, 2114–
2118.
Blom, M., Meyer, A., Gerner-Smidt, P., Gaarslev, K. & Espersen, F.
(1999). Evaluation of Statens Serum Institut enteric medium for
detection of enteric pathogens. J Clin Microbiol 37, 2312–2316.
Brian, M. J., Frosolono, M., Murray, B. E., Miranda, A., Lopez, E. L.,
Gomez, H. F. & Cleary, T. G. (1992). Polymerase chain reaction for
diagnosis of enterohemorrhagic Escherichia coli infection and hemoly-
tic-uremic syndrome. J Clin Microbiol 30, 1801–1806.
Cerna, J. F., Nataro, J. P. & Estrada-Garcia, T. (2003). Multiplex PCR for
detection of three plasmid-borne genes of enteroaggregative Escherichia
coli strains. J Clin Microbiol 41, 2138–2140.
Clarke, S. C., Haigh, R. D., Freestone, P. P. & Williams, P. H. (2002).
Enteropathogenic Escherichia coli infection: history and clinical aspects.
Br J Biomed Sci 59, 123–127.
Journal of Medical Microbiology 53

Darfeuille-Michaud, A., Neut, C., Barnich, N. & 7 other authors (1998).
Presence of adherent Escherichia coli strains in ileal mucosa of patients
with Crohn’s disease. Gastroenterology 115, 1405–1413.
Donnenberg, M. S. (1995). Enteropathogenic Escherichia coli. In
Infections of the Gastrointestinal Tract, pp. 709–726. Edited by M.
Blaser, P. Smith, J. Ravdin, H. Greenberg & R. L. Guerrant. New York:
Raven Press.
Dulguer, M. V., Fabbricotti, S. H., Bando, S. Y., Moreira-Filho, C. A.,
Fagundes-Neto, U. & Scaletsky, I. C. (2003). Atypical enteropatho-
genic Escherichia coli strains: phenotypic and genetic profiling reveals a
strong association between enteroaggregative E. coli heat-stable enter-
otoxin and diarrhea. J Infect Dis 188, 1685–1694.
Echeverria, P., Orskov, F., Orskov, I., Knutton, S., Scheutz, F., Brown, J.
E. & Lexomboon, U. (1991). Attaching and effacing enteropathogenic
Escherichia coli as a cause of infantile diarrhea in Bangkok. J Infect Dis
164, 550–554.
Fagundes-Neto, U. & Scaletsky, I. C. A. (2000). The gut at war: the
consequences of enteropathogenic Escherichia coli infection as a factor
of diarrhea and malnutrition. São Paulo Med J 118, 21–29.
Forestier, C., Meyer, M., Favre-Bonte, S., Rich, C., Malpuech, G., Le
Bouguenec, C., Sirot, J., Joly, B. & De Champs, C. (1996). Enteroad-
herent Escherichia coli and diarrhea in children: a prospective case-
control study. J Clin Microbiol 34, 2897–2903.
Gannon, V. P., Rashed, M., King, R. K. & Thomas, E. J. (1993). Detection
and characterization of the eae gene of Shiga-like toxin-producing
Escherichia coli using polymerase chain reaction. J Clin Microbiol 31,
1268–1274.
Gomes, T. A., Rassi, V., MacDonald, K. L. & 7 other authors (1991).
Enteropathogens associated with acute diarrheal disease in urban
infants in São Paulo, Brazil. J Infect Dis 164, 331–337.
Gomes, T. A. T., Irino, K. and other authors (2002). Escherichia coli eae þ
EAF
stx
strains outside the EPEC serogroups. In Abstract Book from
the 3rd International EPEC Symposium, abstract no. S1.5, Puerto
Vallarta, Mexico.
Gunzburg, S. T., Tornieporth, N. G. & Riley, L. W. (1995). Identification
of enteropathogenic Escherichia coli by PCR-based detection of the
bundle-forming pilus gene. J Clin Microbiol 33, 1375–1377.
Hedberg, C. W., Savarino, S. J., Besser, J. M. & 7 other authors (1997).
An outbreak of foodborne illness caused by Escherichia coli O39 : NM,
an agent not fitting into the existing scheme for classifying diarrheo-
genic E. coli. J Infect Dis 176, 1625–1628.
Jenkins, C., Lawson, A. J., Cheasty, T., Willshaw, G. A., Wright, P.,
Dougan, G., Frankel, G. & Smith, H. R. (2003). Subtyping intimin genes
from enteropathogenic Escherichia coli associated with outbreaks and
sporadic cases in the United Kingdom and Eire. Mol Cell Probes 17,
149–156.
Jiang, Z. D., Okhuysen, P. C., Guo, D. C., He, R., King, T. M., DuPont, H. L.
& Milewicz, D. M. (2003). Genetic susceptibility to enteroaggregative
Escherichia coli diarrhea: polymorphism in the interleukin-8 promotor
region. J Infect Dis 188, 506–511.
Jühlin, I. & Ericson, C. (1961). A new medium for the bacteriologic
examination of stools (LSU-agar). Acta Pathol Microbiol Scand 52,
185–200.
Kaper, J. B. (1996). Defining EPEC. Rev Microbiol 27, 130–133.
Knutton, S., Shaw, R., Phillips, A. D., Smith, H. R., Willshaw, G. A.,
Watson, P. & Price, E. (2001). Phenotypic and genetic analysis of
diarrhea-associated Escherichia coli isolated from children in the United
Kingdom. J Pediatr Gastroenterol Nutr 33, 32–40.
Krokstad, S., Haugen, I. & Nordbø, S. A. (2003). Rapid detection and
typing of human adenovirus by real-time PCR. J Clin Virol 27, 51.
http://jmm.sgmjournals.org
Atypical EPEC in Norwegian children
Levine, M. M. & Edelman, R. (1984). Enteropathogenic Escherichia coli
of classic serotypes associated with infant diarrhea: epidemiology and
pathogenesis. Epidemiol Rev 6, 31–51.
Levine, M. M., Nataro, J. P., Karch, H., Baldini, M. M., Kaper, J. B., Black,
R. E., Clements, M. L. & O’Brien, A. D. (1985). The diarrheal response of
humans to some classic serotypes of enteropathogenic Escherichia coli is
dependent on a plasmid encoding an enteroadhesiveness factor. J Infect
Dis 152, 550–559.
Morelli, R., Baldassarri, L., Falbo, V., Donelli, G. & Caprioli, A. (1994).
Detection of enteroadherent Escherichia coli associated with diarrhoea
in Italy. J Med Microbiol 41, 399–404.
Nataro, J. P. & Kaper, J. B. (1998). Diarrheagenic Escherichia coli. Clin
Microbiol Rev 11, 142–201.
Nougayrède, J. P., Fernandes, P. J. & Donnenberg, M. S. (2003).
Adhesion of enteropathogenic Escherichia coli to host cells. Cell
Microbiol 5, 359–372.
Nunes, E. B., Saridakis, H. O., Irino, K. & Pelayo, J. S. (2003). Genotypic
and phenotypic characterization of attaching and effacing Escherichia
coli (AEEC) isolated from children with and without diarrhoea in
Londrina, Brazil. J Med Microbiol 52, 499–504.
Regua-Mangia, A. H., Gomes, T. A., Vieira, M. A., Andrade, J. R., Irino, K.
& Teixeira, L. M. (2004). Frequency and characteristics of diarrhoeagenic
Escherichia coli strains isolated from children with and without diar-
rhoea in Rio de Janeiro, Brazil. J Infect 48, 161–167.
Scaletsky, I. C., Pedroso, M. Z., Oliva, C. A., Carvalho, R. L., Morais, M. B.
& Fagundes-Neto, U. (1999). A localized adherence-like pattern as a
second pattern of adherence of classic enteropathogenic Escherichia coli
to HEp-2 cells that is associated with infantile diarrhea. Infect Immun 67,
3410–3415.
Scaletsky, I. C., Fabbricotti, S. H., Aranda, K. R., Morais, M. B. &
Fagundes-Neto, U. (2002a). Comparison of DNA hybridization and
PCR assays for detection of putative pathogenic enteroadherent
Escherichia coli. J Clin Microbiol 40, 1254–1258.
Scaletsky, I. C., Fabbricotti, S. H., Silva, S. O., Morais, M. B. &
Fagundes-Neto, U. (2002b). HEp-2-adherent Escherichia coli strains
associated with acute infantile diarrhea, São Paulo, Brazil. Emerg Infect
Dis 8, 855–858.
Scaletsky, I. C. A., Michalsky, J. and other authors (2002c). Identifica-
tion of novel adherence genes found in atypical enteropathogenic
Escherichia coli (EPEC) strains. In Abstract book of the 3rd International
EPEC Symposium, abstract no. S2.5, Puerto Vallarta, Mexico.
Schoolnik, G. K. (1993). PCR detection of Shigella species and
enteroinvasive Escherichia coli. In Diagnostic Molecular Microbiology:
Principles and Applications, pp. 277–281. Edited by D. Persing, T. Smith,
F. Tenover & T. White. Washington, DC: American Society for
Microbiology.
Schultsz, C., Pool, G. J., van Ketel, R., de Wever, B., Speelman, P. &
Dankert, J. (1994). Detection of enterotoxigenic Escherichia coli in stool
samples by using nonradioactively labeled oligonucleotide DNA probes
and PCR. J Clin Microbiol 32, 2393–2397.
Schultsz, C., Moussa, M., van Ketel, R., Tytgat, G. N. & Dankert, J.
(1997). Frequency of pathogenic and enteroadherent Escherichia coli in
patients with inflammatory bowel disease and controls. J Clin Pathol 50,
573–579.
Trabulsi, L. R., Keller, R. & Tardelli Gomes, T. A. (2002). Typical and
atypical enteropathogenic Escherichia coli. Emerg Infect Dis 8, 508–513.
Valentiner-Branth, P., Steinsland, H., Fischer, T. K., Perch, M.,
Scheutz, F., Dias, F., Aaby, P., Mølbak, K. & Sommerfelt, H. (2003).
Cohort study of Guinean children: incidence, pathogenicity, conferred
protection, and attributable risk for enteropathogens during the first 2
years of life. J Clin Microbiol 41, 4238–4245.
Vallance, B., Chan, C. and other authors (2003). How noninvasive
1143
J. E. Afset and others
pathogens induce disease: Lessons from enteropathogenic and enter-
ohemorrhagic Escherichia coli. In Microbial Pathogenesis and the
Intestinal Epithelial Cell, pp. 423–437. Edited by G. A. Hecht. Wa-
shington, DC: American Society for Microbiology.
Vieira, M. A., Andrade, J. R., Trabulsi, L. R., Rosa, A. C., Dias, A. M.,
Ramos, S. R., Frankel, G. & Gomes, T. A. (2001). Phenotypic and
genotypic characteristics of Escherichia coli strains of non-enteropatho-
genic E. coli (EPEC) serogroups that carry EAE and lack the EPEC
adherence factor and Shiga toxin DNA probe sequences. J Infect Dis 183,
762–772.
Viljanen, M. K., Peltola, T., Junnila, S. Y., Olkkonen, L., Järvinen, H.,
1144
Kuistila, M. & Huovinen, P. (1990). Outbreak of diarrhoea due to
Escherichia coli O111 : B4 in schoolchildren and adults: association of Vi
antigen-like reactivity. Lancet 336, 831–834.
WHO (1987). Programme for control of diarrheal diseases (CDD/83.3
Rev1). In Manual for Laboratory Investigations of Acute Enteric Infec-
tions, pp. 27. Geneva: World Health Organization.
Yatsuyanagi, J., Saito, S., Sato, H., Miyajima, Y., Amano, K. & Enomoto,
K. (2002). Characterization of enteropathogenic and enteroaggregative
Escherichia coli isolated from diarrheal outbreaks. J Clin Microbiol 40,
294–297.
Journal of Medical Microbiology 53