[Downloaded free from http://www.cancerjournal.net on Thursday, March 22, 2018, IP: 177.231.158.

183]

Original Article

Upregulation of CXC chemokine receptor

4-CXC chemokine ligand 12 axis in
invasive breast carcinoma: A potent
biomarker predicting lymph node
metastasis
ABSTRACT Reza Dayer,
Objective: Breast cancer is considered as a heterogeneous disease, characterized by different biological and phenotypic features Sadegh Babashah,
which make its diagnosis and treatment challenging. The CXC chemokine receptor 4 (CXCR4) expression was found to be correlated Shirin Jamshidi,
with poor overall survival in invasive breast carcinoma patients. Here, we sought to investigate the expression levels of the CXCR4‑CXC Majid
chemokine ligand 12 (CXCL12) chemokine axis and their association with clinicopathologic features and lymph node metastasis in Sadeghizadeh
invasive breast carcinoma. Department of
Materials and Methods: The expression of the CXCR4‑CXCL12 chemokine axis and metastasis‑related genes (E‑cadherin and Molecular Genetics,
matrix metalloproteinase 2 [MMP2]) was measured by quantitative real‑time‑polymerase chain reaction. The correlation with various Faculty of Biological
Sciences, Tarbiat
clinicopathologic parameters was analyzed.
Modares University,
Results: We found upregulation of the CXCR4‑CXCL12 chemokine axis in invasive breast carcinoma samples compared with normal Tehran, Iran
adjacent tissues. Moreover, we observed that upregulation of this chemokine axis was correlated with tumor stages and lymph
For correspondence:
node metastasis of breast tumors. Interestingly, this correlation was affected by the expression of human epidermal growth factor
Dr. Sadegh Babashah,
receptor 2/neu. There is also a significant correlation between the expression levels of CXCR4‑CXCL12 axis and metastasis‑related Department of
genes (E‑cadherin and MMP2) in tumor samples with advanced stages of metastasis. Molecular Genetics,
Conclusion: These results suggest a key role for the CXCR4‑CXCL12 chemokine axis in breast cancer progression and highlight Faculty of Biological
Sciences, Tarbiat
the prognostic importance of this chemokine axis for breast cancer survival.
Modares University,
P.O. Box 14115‑154,
Tehran, Iran.
KEY WORDS: CXC chemokine receptor 4‑CXC chemokine ligand 12 chemokine axis, invasive breast carcinoma, lymph node E‑mail: babashah@
metastasis, prognosis modares.ac.ir

INTRODUCTION epidermal growth factor receptor 2 (HER‑2)

Breast cancer is the most frequently diagnosed
cancer in women worldwide and a leading cause of
cancer mortality. According to the National Cancer
Institute, estimated new cases of breast cancer
were about 233,000 women and about 40,000
people died from this neoplasm in the United
States in 2014 (http://www.cancer.gov/).[1] There
are currently several clinical and pathological
factors which have shown prognostic importance
for breast cancer survival. These include patient
age, tumor size, menopausal status, lymph node
involvement, hormone receptor status, human
overexpression, and histological features (such as
tumor grade and peritumoral vascular invasion).[2,3]
Although the determination of these prognostic
algorithms for cancer risk stratification has led
to improve the survival rate, one of the major
challenges is that this approach does not consider
the individual molecular complexity of each
Access this article online
neoplasm. Indeed, accurate prediction of the
Website: www.cancerjournal.net
DOI: 10.4103/0973-1482.177221
This is an open access article distributed under the terms of the Creative Commons
Attribution‑NonCommercial‑ShareAlike 3.0 License, which allows others to remix, PMID: ***
tweak, and build upon the work non‑commercially, as long as the author is credited Quick Response Code:
and the new creations are licensed under the identical terms.
For reprints contact: reprints@medknow.com

Cite this article as: Dayer R, Babashah S, Jamshidi S, Sadeghizadeh M. Upregulation of CXC chemokine receptor 4-CXC
chemokine ligand 12 axis ininvasive breast carcinoma: A potent biomarker predicting lymph node metastasis. J Can Res
Ther 2018;14:345-50.

© 2016 Journal of Cancer Research and Therapeutics | Published by Wolters Kluwer - Medknow 345
[Downloaded free from http://www.cancerjournal.net on Thursday, March 22, 2018, IP: 177.231.158.183]

Dayer, et al.: CXCR4‑CXCL12 axis in invasive breast carcinoma

metastatic potential of a tumor is critical in the management Table 1: The clinical and pathological characteristics at
of breast cancer patients.[4] diagnosis in invasive breast cancer patients
Characteristics Number (n) Percentage
The CXC chemokine receptor 4 (CXCR4) and its ligand Age in years
Median (range): 48.65 (29-77) 36
12 (CXCL12) (stromal cell‑derived factor‑1) have been shown to <50 years 20 56
play a key role in migration, invasion, and adhesion of breast ≥50 years 16 44
cancer cells, which promote tumor growth and metastasis. It is Age at menarche in years (mean±SD) 13.44±1.2
thought that the expression of CXCR4 on malignant epithelium Age at first parturition (mean±SD) 20.7±3.7
Menopausal status
cells in breast cancer results in directing the metastasis Premenopausal 23 63
of CXCR4+ cancer cells to organs expressing high levels of Postmenopausal 13 36
CXCL12 (e.g., the regional lymph nodes, lung, liver, or bones).[5‑7] Age at menopause (mean±SD) 50.6±3.5
Prior hormone use
Yes 19 53
Since CXCR4‑CXCL12 expression level is significantly No 17 47
correlated with breast cancer metastasis, we aimed to Tumor size (cm)
investigate the correlation of CXCR4‑CXCL12 axis with lymph <3 16 44
≥3 20 56
node metastasis. We also sought to study the important Primary tumor (T stage) (cm)
contributing factors such as HER‑2 activation status. It seems T1: ≤2.0 11 31
that the CXCR4‑CXCL12 chemokine axis may serve as a potent T2: >2-≤5 16 44
biomarker predicting lymph node metastasis in breast cancer. T3: >5 9 25
Regional lymph nodes (N stage)
This highlights the prognostic importance of this chemokine NX 3 8
axis for breast cancer survival. N0 10 28
N1 7 19
MATERIALS AND METHODS N2 11 31
N3 5 14
Distant metastasis (M stage)
Patients MX 3 8
Thirty‑six pairs of specimens, tumor tissues and their adjacent M0 14 39
M1 19 53
normal ones, from patients with invasive breast carcinoma, Lymph node metastasis
were obtained from Iran’s National Tumor Bank (Tehran, Negative 14 39
Iran). A record of clinical‑pathological parameters including Positive 22 61
grading and staging (including tumor size, lymph node status, Tumor stage
I + II 19 53
hormonal receptor status, and HER‑2 status) for these tissue III + IV 17 47
samples are summarized in Table 1. The study was approved Estrogen receptor status
by the Ethics Committee and Institutional Review Board, and Negative 11 31
informed consent was obtained from all the patients prior to Positive 22 61
Unknown 3 8
the surgery. The specimens for assay were snap‑frozen in liquid Progesterone receptor status
nitrogen and stored in −80°C until analysis. Negative 12 34
Positive 21 58
Unknown 3 8
RNA extraction and cDNA synthesis
HER‑2 status
Total RNA was extracted from frozen breast tissues using Negative 16 44
Trizol (Invitrogen) and treated with RNase‑free DNase Positive 18 50
(Fermentas, Vilnius, Lithuania). The quality of RNA was Unknown 2 6
verified by gel electrophoresis, and the concentration of RNA SD=Standard deviation, HER‑2=Human epidermal growth factor receptor 2

was assessed by optical density at 260 nm. Complementary

DNA (cDNA) was synthesized by reverse transcription of 3 µg
total RNA using random hexamers and RevertAid™ Reverse
Transcriptase (Fermentas, ON, Canada).
Quantitative real‑time polymerase chain reaction
Quantitative real‑time polymerase chain reaction (Q‑RT‑PCR),
based on SYBR green I chemistry, was performed on the ABI
Step One Sequence Detection System (Applied Biosystems,
Foster City, CA, USA). Thermal cycling was performed using
the following cycling conditions: 95°C for 5 min as first
denaturation step, followed by 40 cycles of denaturation at
95°C for 10 s, and annealing/extension at 60°C for 30 s. Each
individual Q‑RT‑PCR was followed by a dissociation stage; at
95°C for 15 s, 60°C for 30 s, and 95°C for 15 s to ensure the
homogeneity of PCR products. The mean threshold cycle was
obtained from triplicate amplifications and used to calculate
the amount of transcripts. Glyceraldehyde‑3‑phosphate
dehydrogenase gene was used as housekeeping gene to
normalize the amount of transcripts in each sample. The
relative expression of each gene was calculated using the
2−ΔΔCt formula. [8] The amplification efficiencies of target
and housekeeping genes were assessed from the standard
curve drawn by plotting the logarithmic input amount of
cDNA samples versus the corresponding Ct values. The
corresponding real‑time PCR efficiency (E) was calculated
according to the slope of the standard curve and the

346 Journal of Cancer Research and Therapeutics - Volume 14 - Issue 2 - January-March 2018
[Downloaded free from http://www.cancerjournal.net on Thursday, March 22, 2018, IP: 177.231.158.183]
Dayer, et al.: CXCR4‑CXCL12 axis in invasive breast carcinoma
equation: E = (10(−1/Slope)).[8] The primer sequences used in
Q‑RT‑PCR assays are listed in Table 2.
Statistical analysis
Data were presented as mean ± standard deviation of at
least three experiments and analyzed by Student’s t‑test. The
P values < 0.05 were considered statistically significant.
RESULTS
Amplification efficiencies and primer specificity
Standard curves for target and housekeeping genes were
drawn over serially diluted cDNA samples. As shown in
Supplementary Figure 1a, the amplification efficiencies of
investigated transcripts were approximately equal with high
linear correlation, indicating the validity of the assay for
relative quantification.
In addition, specificity of each amplification reaction was
assessed by melting curve analysis. Results showed that
no primer‑dimer or detectable nonspecific products were
generated during the applied Q‑RT‑PCR amplification
cycles [Supplementary Figure 1b].
Expression analysis of CXC chemokine receptor 4‑CXC
chemokine ligand 12 axis in breast carcinoma samples and
their adjacent normal ones
To evaluate the activation status of the CXCR4‑CXCL12 axis, we
used Q‑RT‑PCR to examine the expression levels of CXCR4 and
its chemokine ligand CXCL12 in 20 pairs of resected specimens,
tumor and matched adjacent nontumor tissue samples, from
patients with breast carcinoma. As shown in Figure 1, the mean
normalized ratios for CXCR4 and CXCL12 transcript levels in
breast carcinoma specimens were remarkably higher than
ratios found in corresponding normal tissues.
Expression analysis of CXC chemokine receptor 4‑CXC
chemokine ligand 12 axis in breast carcinoma tissues with
different clinical‑pathological parameters
In order to investigate the correlation between expression
levels of CXCR4‑CXCL12 axis and the clinical‑pathological
Table 2: The oligonucleotide primers used in quantitative
real‑time‑polymerase chain reaction assay
Gene Primer sequence
length (bp)
CXCR4 F: 5’‑AGTGGCCGACCTCCTCTT‑3’
R: 5’‑CTTGGCCTCTGACTGTTGGT‑3’
CXCL12 F: 5’‑CGCACTTTCACTCTCCGTCA‑3’
R: 5’‑ATCGGCATGGGCATCTGTAG‑3’
E‑cadherin F: 5’‑TCATGAGTGTCCCCCGGTAT‑3’
R: 5’‑TCTTGAAGCGATTGCCCCAT‑3’
MMP2 F: 5’‑GGATGCCGCCTTTAACTGGA‑3’
R: 5’‑AGGCACCCTTGAAGAAGTAGC‑3’
GAPDH F: 5’‑TCACCCACTCCTCCACCTTTG‑3’
R: 5’‑TCCACCACCCTGTTGCTGTAG‑3’
CXCR4=CXC chemokine receptor 4, MMP2=Matrix metalloproteinase 2,
GAPDH=Glyceraldehyde‑3‑phosphate dehydrogenase, CXCL12=CXC
chemokine ligand 12
Journal of Cancer Research and Therapeutics - Volume 14 - Issue 2 - January-March 2018
parameters (tumor size, tumor stage, tumor grade, lymphatic
metastases, nodal status, and perineural invasion), the
expression levels of CXCR4‑CXCL12 axis between the different
groups were analyzed. As shown in Figure 2a, high expression
levels of the chemokine receptor CXCR4 were observed in
tumors with metastasis to lymph nodes [Figure 2a]. In this
regard, there was a significant difference between stages I–II
and stages III–IV of breast carcinoma tissues [Figure 2b].
We also sought to investigate whether the correlation between
CXCR4 and lymph node metastasis was affected by positive or
negative estrogen and progesterone receptor status. In this
regard, this correlation was not associated with the hormone
receptor status (data not shown). In addition, we found that
there are no apparent differences of gene expression between
the different groups classified by others parameters (data not
shown).
Expression analysis of CXC chemokine receptor 4 in
human epidermal growth factor receptor 2 positive breast
carcinoma
It was previously showed that upregulation of CXCR4 is
essential for HER‑2‑mediated tumor metastasis.[9] As HER‑2
is a well‑known biomarker associated with increased
metastatic potential in breast cancer,[10‑12] we sought to
investigate whether the correlation between CXCR4 and
lymph node metastasis is affected by the positive or
negative expression of HER‑2/neu. As compared to HER‑2
negative breast carcinoma, all breast tumor tissues in which
HER‑2 expression was positive demonstrated significant
upregulation of CXCR‑4 transcript [Figure 3]. These results
highlight a significantly positive correlation between HER‑2
and CXCR4 expression.
Amplicon
201
190
240
Figure 1: The CXC chemokine receptor 4‑CXC chemokine ligand 12
203 axis is activated in invasive breast carcinoma. Transcript levels for CXC
chemokine receptor 4 and CXC chemokine ligand 12 in invasive breast
112 carcinoma samples and corresponding normal pairs were measured
by quantitative real‑time‑polymerase chain reaction and normalized to
glyceraldehyde‑3‑phosphate dehydrogenase as housekeeping genes.
Column, mean of three different experiments; bars, standard deviation
347
[Downloaded free from http://www.cancerjournal.net on Thursday, March 22, 2018, IP: 177.231.158.183]
Dayer, et al.: CXCR4‑CXCL12 axis in invasive breast carcinoma
a b
Figure 2: Significant difference of transcript levels for CXC chemokine
receptor 4 and CXC chemokine ligand 12 in invasive breast carcinoma
with different clinical and pathological characteristics: (a) Lymph node
metastasis, (b) stages of tumor. Transcription levels were measured
by quantitative real‑time‑polymerase chain reaction and normalized to
glyceraldehyde‑3‑phosphate dehydrogenase as housekeeping genes.
Column, mean of three different experiments; bars, standard deviation
Correlation between the expression levels of CXC
chemokine receptor 4‑CXC chemokine ligand 12 axis and
metastasis‑related genes (matrix metalloproteinase 2 and
E‑cadherin)
As previous reports have revealed that CXCR4 is able to
alter the ability of cancer cells to adhere to the epithelium
and invade through extracellular matrix components, we
analyzed the expression levels of E‑cadherin and matrix
metalloproteinase (MMP2) genes in breast carcinoma samples.
In this regard, a high expression of MMP2 was found in breast
tumor tissues as compared to corresponding normal pairs.
Interestingly, a high expression of MMP2 in breast tumor
tissues was strongly correlated with the expression levels
of CXCR4‑CXCL12 axis. However, no association was found
between the expression levels of MMP2 in tumor tissues
and tumor size (data not shown). As expected, there is also a
significant negative correlation between the expression levels
of CXCR4‑CXCL12 axis and E‑cadherin in tumor samples with
advanced stages of metastasis [Figure 4].
DISCUSSION
Breast cancer is considered as a heterogeneous disease,
characterized by different biological and phenotypic features,
which makes its diagnosis and treatment challenging.[13] The
involvement of chemokines and their respective receptors
in tumor development has been demonstrated in breast
carcinoma, where CXCR4 overexpression is recognized as
a requirement for breast cancer cell proliferation and is
particularly correlating with poor prognosis.[9] In the present
study, we sought to investigate whether the CXCR4‑CXCL12
chemokine axis as a novel biomarker associated with increased
metastatic potential in breast carcinoma could predict the
presence of breast cancer metastases in lymph node‑positive
tumors.
348 Journal of Cancer Research and Therapeutics - Volume 14 - Issue 2 - January-March 2018
Figure 3: A significant positive correlation between the expression of
CXC chemokine receptor 4 and activation status of human epidermal
growth factor receptor 2. Transcription levels were measured by
quantitative real‑time‑polymerase chain reaction and normalized to
glyceraldehyde‑3‑phosphate dehydrogenase as housekeeping genes.
Column, mean of three different experiments; bars, standard deviation
A number of studies have revealed a correlation between
CXCR4 expression and distant metastasis in primary breast
cancer patients.[14‑16] Wu et  al.[17] reported that expression
levels of the CXCR4 and CXCR7 chemokine receptors
in breast cancer tissues were significantly higher than
that in adjacent normal tissues. They suggested that the
CXCL12‑CXCR4‑CXCR7 chemokine axis may serve as a
critical factor in lymph node metastasis. In this regard,
another study proposed that circulating levels of CXCL12
may serve as a prognostic blood marker predictive of distant
metastasis in breast cancer.[18] These data were in consistent
with our observations suggesting that the expression of
CXCR4‑CXCL12 chemokine axis is correlated with the status
of lymph node metastasis.
The overexpression of HER‑2 is observed in ~30% of all breast
cancers and is associated with a relatively poor prognosis.[19]
A positive correlation between HER‑2 and CXCR4 expression
has been previously suggested for breast cancer metastasis.
Li et  al.[9] revealed that HER‑2 enhances the expression and
function of CXCR4 by inhibiting CXCR4 degradation. In this
regard, we sought to explore a possible direct linkage of
CXCR4 and HER‑2. As compared to HER‑2 negative breast
carcinoma, all breast tumor tissues in which HER‑2 expression
was positive demonstrated significant upregulation of CXCR‑4
transcript [Figure 3]. These results lead us to suggest that
HER‑2 signaling in breast cancer may cause increased levels of
CXCR4, which is required for HER‑2 mediated invasion.
Reduced expression of E‑cadherin is often observed in
aggressive cancers and the loss of which is highly associated
with epithelial‑to‑mesenchymal transition (EMT). [20‑22]
Acquisition of the invasive phenotype has many similarities
with EMT, including the loss of cell–cell adhesion and increase
[Downloaded free from http://www.cancerjournal.net on Thursday, March 22, 2018, IP: 177.231.158.183]
Dayer, et al.: CXCR4‑CXCL12 axis in invasive breast carcinoma
Figure  4: Significant correlation between the expression levels
of metastasis‑related genes (matrix metalloproteinase 2 and
E‑cadherin) and CXC chemokine receptor 4‑CXC chemokine
ligand 12 activation status in breast carcinoma tissues with different
stages of metastasis. Transcription levels were measured by
quantitative real‑time‑polymerase chain reaction and normalized to
glyceraldehyde‑3‑phosphate dehydrogenase as housekeeping genes.
Column, mean of three different experiments; bars, standard deviation
in cell mobility. During EMT, there is a switch from E‑cadherin
expression to N‑cadherin expression (a mesenchymal cell
marker), which alters cell‑matrix adhesion.[21] As previous
reports have demonstrated that signaling through CXCR4
alters the ability of cancer cells to adhere to endothelium
and invade through extracellular matrix components,[23,24] we
examined the expression levels of E‑cadherin (as an epithelial
cell marker) and MMP2 (as an important extracellular matrix
component) in breast carcinoma samples. As expected, a
significant positive correlation was observed between the
expression levels of CXCR4‑CXCL12 axis and MMP2 in tumor
samples with advanced stages of metastasis [Figure 4].
However, no association was found between the expression
levels of MMP2 in tumor tissues and tumor size (data not
shown). Importantly, a low expression of E‑cadherin in
breast tumor tissues with advanced stages of metastasis
was associated with high expression levels of CXCR4‑CXCL12
axis [Figure 4].
Furthermore, we found that patients with increased
expression levels of CXCR4 had more extensive metastases
to lymph nodes relative to tumors with reduced CXCR4
expression [Figure 2a]. This data was in consistent with
previous reports suggesting that high levels of CXCR4 were
associated with decreased overall survival of patients.[5,9]
However, the possible functional role of correlation between
CXCR4 and lymph node metastasis in breast carcinoma needs
to be further investigated.
Taken together, our study revealed a new layer of molecular
complexity which should be considered in the management
of patients with invasive breast carcinoma. Further
characterization of the central role of CXCR4 in invasive
breast carcinoma will provide more insight into new signaling
Journal of Cancer Research and Therapeutics - Volume 14 - Issue 2 - January-March 2018
pathways, which are involved in breast cancer progression. In
this regard, it is thought that CXCR4‑CXCL12 chemokine axis
may be a predictor of poor prognosis; however, the clinical
significance of this chemokine axis remains to be further
clarified.
Acknowledgments
The authors appreciate the valuable contribution of the
patients included in this study. This work was supported by a
research grant from Tarbiat Modares University.
Financial support and sponsorship
Research grant from Tarbiat Modares University.
Conflicts of interest
There are no conflicts of interest.
REFERENCES
1. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J
Clin 2014;64:9‑29.
2. Goldhirsch A, Ingle JN, Gelber RD, Coates AS, Thürlimann B, Senn HJ;
Panel Members. Thresholds for therapies: Highlights of the St Gallen
International Expert Consensus on the primary therapy of early
breast cancer 2009. Ann Oncol 2009;20:1319‑29.
3. Galea  MH, Blamey  RW, Elston  CE, Ellis  IO. The Nottingham
prognostic index in primary breast cancer. Breast Cancer Res Treat
1992;22:207‑19.
4. Ferracin M, Querzoli P, Calin GA, Negrini M. MicroRNAs: Toward the
clinic for breast cancer patients. Semin Oncol 2011;38:764‑75.
5. Luker KE, Luker GD. Functions of CXCL12 and CXCR4 in breast cancer.
Cancer Lett 2006;238:30‑41.
6. Meads  MB, Hazlehurst  LA, Dalton  WS. The bone marrow
microenvironment as a tumor sanctuary and contributor to drug
resistance. Clin Cancer Res 2008;14:2519‑26.
7. Teicher BA, Fricker SP. CXCL12 (SDF‑1)/CXCR4 pathway in cancer. Clin
Cancer Res 2010;16:2927‑31.
8. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real‑time quantitative PCR and the 2(‑Delta Delta C(T)) Method.
Methods 2001;25:402‑8.
9. Li YM, Pan Y, Wei Y, Cheng X, Zhou BP, Tan M, et al. Upregulation of
CXCR4 is essential for HER2‑mediated tumor metastasis. Cancer Cell
2004;6:459‑69.
10. Cabioglu N, Yazici MS, Arun B, Broglio KR, Hortobagyi GN, Price JE,
et al. CCR7 and CXCR4 as novel biomarkers predicting axillary lymph
node metastasis in T1 breast cancer. Clin Cancer Res 2005;11:5686‑93.
11. Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network.
Nat Rev Mol Cell Biol 2001;2:127‑37.
12. Yu D, Hung MC. Overexpression of ErbB2 in cancer and ErbB2‑targeting
strategies. Oncogene 2000;19:6115‑21.
13. Visvader JE. Keeping abreast of the mammary epithelial hierarchy
and breast tumorigenesis. Genes Dev 2009;23:2563‑77.
14. Blot  E, Laberge‑Le Couteulx  S, Jamali  H, Cornic  M, Guillemet  C,
Duval C, et al. CXCR4 membrane expression in node‑negative breast
cancer. Breast J 2008;14:268‑74.
15. Holm  NT, Byrnes  K, Li  BD, Turnage  RH, Abreo  F, Mathis  JM, et al.
Elevated levels of chemokine receptor CXCR4 in HER‑2 negative breast
cancer specimens predict recurrence. J Surg Res 2007;141:53‑9.
16. Salvucci O, Bouchard A, Baccarelli A, Deschênes J, Sauter G, Simon R,
et al. The role of CXCR4 receptor expression in breast cancer: A large
tissue microarray study. Breast Cancer Res Treat 2006;97:275‑83.
17. Wu W, Qian L, Chen X, Ding B. Prognostic significance of CXCL12,
349
[Downloaded free from http://www.cancerjournal.net on Thursday, March 22, 2018, IP: 177.231.158.183]

Dayer, et al.: CXCR4‑CXCL12 axis in invasive breast carcinoma

CXCR4, and CXCR7 in patients with breast cancer. Int J Clin Exp Pathol
2015;8:13217‑24.
18. Hassan S, Baccarelli A, Salvucci O, Basik M. Plasma stromal cell‑derived
factor‑1: Host derived marker predictive of distant metastasis in
breast cancer. Clin Cancer Res 2008;14:446‑54.
19. Slamon  DJ, Godolphin  W, Jones  LA, Holt  JA, Wong  SG, Keith  DE,
et al. Studies of the HER‑2/neu proto‑oncogene in human breast and
ovarian cancer. Science 1989;244:707‑12.
20. Friedl P, Wolf K. Tumour‑cell invasion and migration: Diversity and
escape mechanisms. Nat Rev Cancer 2003;3:362‑74.
21. Lee JM, Dedhar S, Kalluri R, Thompson EW. The epithelial‑mesenchymal
transition: New insights in signaling, development, and disease. J Cell
Biol 2006;172:973‑81.
22. Wheelock MJ, Shintani Y, Maeda M, Fukumoto Y, Johnson KR. Cadherin
switching. J Cell Sci 2008;121(Pt 6):727‑35.
23. Fernandis AZ, Prasad A, Band H, Klösel R, Ganju RK. Regulation of
CXCR4‑mediated chemotaxis and chemoinvasion of breast cancer
cells. Oncogene 2004;23:157‑67.
24. Wendel C, Hemping‑Bovenkerk A, Krasnyanska J, Mees ST,
Kochetkova M, Stoeppeler S, et al. CXCR4/CXCL12 participate in
extravasation of metastasizing breast cancer cells within the liver
in a rat model. PLoS One 2012;7:e30046.

350 Journal of Cancer Research and Therapeutics - Volume 14 - Issue 2 - January-March 2018