Professional Documents
Culture Documents
3066-3071,1983
01989 by The American Society for Biochemistry and Molecular Biology, Inc Printed in U.S.A.
Ci inhibitor plays an important role in the regulation plexes with them. The reactive site of a serpin contains an
of vascular permeability through its ability to inacti- amino acid sequence which is an ideal substrate for its target
vate enzymes which release polypeptide kinins. Dys- protease(s). The reactive site is located on a loop protruding
functional Ci inhibitor molecules are present in the from the surface of the inhibitor molecule (21,22). In contrast
plasma of affected members of the Da and Ri heredi- to events associated with proteolysis of true substrates, serpin-
tary angioneurotic edema kindreds. We constructed protease complexes dissociate extremely slowly, and the pro-
genomic libraries from Da and Ripatient DNAs which tease remains inactive while engaged in the complex (6, 23-
had been cleaved with BclI to generate a fragment 26). The amino acid preceding the peptide bond of the serpin
containing 21 kilobases of the C1 inhibitor locus. Ci that is cleaved during complex formation iscalled the P1
inhibitor gene-containing recombinants originating residue and is an importantdeterminant of serpin target
from mutant Da and Ri alleles weredifferentiated from
those derived from normal alleles by linkage analysis protease specificity. In protease-inhibitor complexes, the P1
using the intragenic HgiAI restriction fragment length residue is probably ester-bonded to the active siteserine
polymorphism. Nucleotide sequencing of the complete residue of the target protease (27).
protein-coding regions of the mutant alleles identified Humans have a single gene for C i inhibitor which maps
two different mutations in a CpG dinucleotide corre- near the centromere on chromosome 11 (8, 9). C i inhibitor
sponding to the first two bases of arginine codon 444. deficiency is inherited as the autosomal dominant disorder
These single base mutations changed the identity of the hereditary angioneurotic edema (HANE)’ (28). HANE pa-
functionally critical P1 reactive site residue from ar- tients suffer from self-limited episodes of localized, enhanced
ginine to cysteine (Da) or histidine (Ri). The additional vascular permeability, particularly of subcutaneous tissue,
cysteine residue in C i inhibitor Da suggests how it is airways, and gastrointestinaltract (29). In addition to reduced
covalently bound to albumin in plasma. The presence levels of serum C i inhibitor, their Cz and Cx levels are also
of CpG dinucleotides in the codons specifying the P1 decreased due to consumption by uninhibited, activated C i
arginines of C i inhibitor and antithrombinI11 explains (30, 31). Individuals with HANE are heterozygous at the C i
the high incidence of histidine and cysteine substitu- inhibitor locus and have one normal and one abnormal C i
tions observed among dysfunctional mutants of these inhibitor gene. Although all persons with HANE are deficient
serine protease inhibitors. in C i inhibitor function, the molecular defects are different
in different families (32-34). Most kindreds exhibit parallel
reduction of Ciinhibitor functional activity and antigenlevels
(type I). However, in 15-25% of HANE pedigrees, decreased
The human plasma proteinase inhibitor C i inhibitor plays functional activity is found in thepresence of a dysfunctional
an important role in the regulation of vascular permeability inhibitor synthesized from the mutant allele (type 11). Dy?
through its ability to inactivate enzymes which release poly- functional gene products often represent the predominant C1
peptide kinins. It is the most important physiological inhibitor inhibitor species in type I1 patient plasma due to consumption
of plasma kallikrein and factor XIIa (1-5) and theonly known (complex formation and clearance) of the normal gene product
inhibitor of C i , the first component of complement (6).
(35-37). C i inhibitor genes encoding three type I1 dysfunc-
C i inhibitor is a member of the serpin (serine protease tional proteins did not exhibit major rearrangements com-
inhibitor) gene family (7-11) which also includes the genes pared to the normal C i inhibitor gene (8);however, electro-
for other plasma protease inhibitors such as al-antitrypsin, phoretic abnormalities and variability in the patterns of re-
antithrombin I11 (12, 13), heparin cofactor I1 (14), az-anti- sidual protease inhibitory activity of Ciinhibitor preparations
plasmin (15), protein C inhibitor (16), and the placental (17) from eight different type I1 families have been noted (38,39).
and endothelial (18-20) type plasminogen activator inhibi- Identification of the mutations responsible for type I1 hered-
tors. Serpins are suicidal proteins which inhibit their target itary angioneurotic edema will improve understanding of C i
proteases by forming stoichiometric protease-inhibitor cam- inhibitor structure/function relationships.
* This work was supported in part by United States Public Health Dysfunctional C i inhibitors Da and Ri have been studied
Service Grants HL-30712 (to S. C . B.) and HL-15690 (to V. H. D.). previously. Ci inhibitor Da binds to albumin (32) and con-
The costs of publication of this article were defrayed in part by the tains a free sulfhydryl group (40). C i inhibitor preparations
payment of page charges. This article must therefore be hereby from Da patient plasma had residual proteaseinhibitory
marked “aduertisement” in accordance with 18 U.S.C. Section 1734 activities against Cis, kallikrein, activated Hageman factor,
solely to indicate this fact. Hageman factor fragments, and plasmin which were 75, 50,
$ Supported by NationalInstitutes of Health-Fogarty Interna-
tional Fellowship TW-04025 and by the Danish Natural Science
Research Council and the Danish Research Academy. The abbreviations used are: HANE, hereditary angioneurotic
n Supported by American Heart Association Established Investi- edema; RFLP, restriction fragment length polymorphism; kh, kilo-
gatorship 880261. base(s); serpin,serine protease inhibitor.
3066
CpG Mutations
Reactive
thein Site of Human
Ci‘lnhibitor 3067
70,194, and 20%, respectively,of the inhibitory activities RESULTS
displayed by an equivalent amount of normal C i inhibitor.
Identification of Alleles Coding for Dysfunctional Ci Inhibi-
Preparations of C i inhibitor from Ri patient plasma had tor Da and Ri Proteins-Ci inhibitor deficiency is inherited
negligible inhibitory activity against any of these proteases
i n an autosomal dominant manner,and hereditary angioneu-
(38). rotic edema patientsare heterozygotes for a mutant (or null)
An HgiAI restriction fragment
lengthpolymorphism
(RFLP) in the C i inhibitor gene produces 0.7- and 0.4-kb
C i inhibitorgene.TheHgiAI RFLP was used to follow
inheritance of individual C i inhibitor alleles i n the Da and
bands o n Southern blots (8). This polymorphic marker was
R i HANE kindreds and to identify those carrying abnormal
used to identify mutant C i inhibitor alleles inthe Da and R i
pedigrees and to distinguish them from the normal C i inhib- genes. The studies shown inFig. 1 indicate that the dysfunc-
itor alleles also present in recombinant librariesof heterozy- tional Da gene resides on a chromosome carrying the 0.7-kb
gous patient DNA. Sequencing of the mutant C i inhibitor allele of the HgiAIRFLP, whereas the dysfunctional Ri gene
genes identified single base changes relative to the normal is associated witha chromosome carrying the 0.4-kb allele.
gene in both. These mutations, which have occurred i n a Cloning and Sequencing-Genomiclibrarieswere con-
single CpG dinucleotide encoding the first two positions of structed from BclI digests of Da-11-2 or Ri-1-1 DNAs and
arginine 444 codon, convert the reactive site P1 residue of C i BamHI-digested XDash vector DNA. These two individuals
inhibitor to a cysteine in affected members of the Da family were chosen as the source of DNA for cloning experiments
a n d to a histidine in affectedmembers of the R i family. because they have hereditary angioneurotic edema and are
heterozygotes for the HgiAI RFLP linkage marker (Fig. 1).
MATERIALS AND METHODS~ Three Da and six Ri recombinant phage carrying C i inhib-
Determ&ztion of C i Inhibitor Functional Activity and Antigen itor gene inserts were isolated, and their HgiAI polymorphism
Leuels-C1 inhibitor functional activity levels in serum samples were types were determined. Twoof the Da clones carriedthe 0.7-
determined by the method of Levy and Lepow (41) using the estero- kb HgiAI RFLP allele (which is associated with HANE i n the
lytic substrate N-acetyl-L-tyrosine ethyl ester. Antigen levels were Da kindred), and three of the R i clones carried the 0.4-kb
measured by rocket immunoelectrophoresis (42) or radial immuno-
diffusion (43). HgiAI RFLP allele (which is associated with HANE i n the R i
Preparation of Genomic DNA-Peripheral blood wasobtained from kindred). Side-by-side Southern blot analysis of cloned phage
several members of each family, and genomic DNA was isolated as DNA and patient and normal genomic DNAs reassured t h a t
described previously (44). gross rearrangement ofthe Ciinhibitor genehad not occurred
Southern Blot Analysis-Three-pg samples of restriction endonu-
clease-treated genomic DNA were separated by agarose gel electro-
phoresis and transferred to nylon membranes (Gelman), which were
then hybridized to 32P-ni~ktranslated C i inhibitor cDNA probe
fragments (8).In order to avoid electrophoresis and blotting artifacts, A
I I m-p1 2
aliquots 0-f chicken genomic DNA (which does not hybridize to the 11
human C1 inhibitor cDNA probe) were added to samples of recom- 1 2
binant phage DNA used for side-by-side Southern blot analysis with
normal and patientgenomic DNAs.
Genomic Cloning-Family studies using the HgiAI restriction frag-
ment length polymorphism (8) were employed to identify and mark
mutant C1 inhibitor alleles in the Da and Ri families. Recombinant B
phage carrying the mutant alleles were obtained as follows. Genomic
DNA samples (-45 pg) from HANE patients Da-11-2 and Ri-1-1, who
are heterozygous for the HgiAI RFLP, were digested to completion
with BclI. 18-23-kb fragments were isolated by centrifugation through
10-40% sucrose gradients, and one-fifth of the material from the
appropriate fractions was inserted into the BamHI site ofXDash DA RI
(Stratagene). In this manner, libraries of approximately 200,000
plaque-forming units were generated from size-fractionated material
obtained from an initial 9 pgof patient DNA. C i inhibitor gene- C 10.9 0 9.1 0 8.41.6 0
containing recombinants were identified by hybridization to the 32P-
labeled C i inhibitor cDNA probe. HgiAI RFLP analysis of the posi- D 26 51 22 4 26.9
16.8 21.8
tives indicated whether they originated from a normal or mutant FIG. 1. Inheritance of hereditary angioneurotic edema and
allele, as defined by linkage analysis. HgiAI RFLP in Da and Ri kindreds. A, pedigrees of the Da and
Sequencing-The protein-coding portion of the human C i inhibi- Ri families. Solidsymbols represent HANE patients, and striped
tor gene consists of seven exons interrupted by six introns (45). symbols represent unaffected familymembers. B, Southern blots
Fragments of the mutant Da allele were subcloned into pUC vectors prepared with HgiAI-digested genomicDNAhybridized to a 3zP-
(46). Fragments of the mutant Ri allele were subcloned into Genes- labeled 500-base pair EcoRI fragment from the 3’-end of human C i
cribe-Z vectors (United States Biochemicals Corp.). Linearized dou- inhibitor cDNA. The region of the blot containing the 0.7- and 0.4-
ble-stranded DNA was sequenced by the dideoxy chain termination kb HgiAI polymorphic fragments is shown. In these linkage studies,
method (47) using Sequenase” (United States Biochemicals Corp.). the abnormal C i inhibitor gene segregates with the 0.7-kb HgiAI
“Universal” primers (corresponding to vector sequences near poly- marker in the Da family-and with the 0.4-kb HgiAI marker in the Ri
linker insertion sites) and C i inhibitor-specific primers were used to family. Dysfunctional C1 inhibitor genes were isolated from Da-11-2
sequence the seven protein-encoding Exons in both directions. Se- and Ri-1-1,who are heterozygous for-the HgiAI marker polymor-
quences of 15-and 16-nucleotide-long_Clinhibitor primerswere based phism. C, functional activity levels of C1 inhibitor in seradetermined
on intron sequences of the normal C1 inhibitor gene (see Miniprint). by esterolytic assay with N-acetyl-L-tyrosine ethyl ester. Normal
range for pooled sera in this assay is 6-10 units/ml. D , C1 inhibitor
* Portions of this paper (including part of “Materials and Methods,” antigen levels in serum (mg/dl). Antigen levels weredetermined using
part of “Results,” part of “Discusison,” and Figs. 4 and5) are the method of Laurel1 (42) for the Da family and by the method of
presented in miniprint at the end of this paper. Miniprint is easily Mancini et al. (43) for the Ri family. Normal range for pooled sera in
read with the aid of a standard magnifying glass. Full size photocopies these assays is 11-22 mg/dl. Patient sera used for functional and
are included in the microfilm edition of the Journal thatis available immunological assays were obtained prior to treatment with andro-
from Waverly Press. gens.
3068 of Human Ci Inhibitor
CpG Mutations in the Reactive Site
E
u IV
P3 P2 P I " P1' PZ' P3' acid, GAG), whereas a C (glutamine,CAG) had been reported
in that position of the cDNA. Que and Petra (11) and Carter
Normal: GTG GCC ACC CTG
CTG
et al. (45) also report a glutamic acid (encoded by GAA and
Val - Ala - Arq - Thr ~ Leu - Leu GAG triplets, respectively) in this position.
DISCUSSION
111-R-10 20 30 40 50 60
TAATGGTCAG AGATTACAGA GTCCCTGACTATCCCTCATC TTCTGCAGAG ACATTCCTGT
80 70 90 100 110 120
GCACCCCCAC CCTCACCCTGTATTGCCCCT TCTCTGAGGA ATIAGTGGTG GTGGTTCTRA
130 150140 160 170 180
GACAGATTGC TCATCTGCTG CRCTGTCAGA AATTACTCTC TTGTACAGGA CATTTTCCAC
190 200 210 220 230 24C
IIICCACACCTTCTCTTCCIG CTTTGAGIAT TTTIGMGACTGTGCCICGI AGTMG-
""-C2b""".)
250 iII-R-260 268 lIII-L-10
R A A T G M C T CAGTTTCTTG AACCACAG, exon I 1 1 1499 b p ) lGTA4GACCCI
IIII-L-20
GCTTGMTTC . ................ .-1.2 k b ....................
,111-R-10 20 30 40 50 60
I'TIGGGAGGC AAGGCAGGAG TTCAAGACCA GCCTGGCCAA CATGTTGAAA CCCCATCTCT
'0 80 90 100 110 120
A C I W T G C W T T A G CCAGGCATAG TGATGCATGC TTATTGICCC AGCTACTTGG
130 140 150 160 170 Inn
GAGGCAGAGG TGGGAGGRTT GCTTGAACCT GGAGATTCAA GTGRGCTGAG AITGCACCAC
190 200 210 220 230 240
TGCATTCCAG CCTGGGCAAC AAAGCMGAC TCTGTCTCM RARAAARlIAA