Diagnostic Microbiology and Infectious Disease

49 (2004) 163–171 www.elsevier.com/locate/diagmicrobio

Identification of Bacillus anthracis by multiprobe microarray

hybridization
Dmitriy Volokhova, Andrei Pomerantsevb, Violetta Kivovichb,
Avraham Rasoolyc, Vladimir Chizhikova,*
a
Center for Biologics Evaluation and Research, Food and Drug Administration, Kensington, MD 20895, USA
b
National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA
c
Center for Food Safety and Applied Nutrition, Food and Drug Administration, College Park, MD 20740-3835, USA

Received 3 November 2003; accepted 22 March 2004

Abstract
We have developed a rapid assay based on microarray analysis of amplified genetic markers for reliable identification of Bacillus
anthracis and its discrimination from other closely related bacterial species of the Bacillus cereus group. By combining polymerase chain
reaction (PCR) amplification of six B. anthracis-specific genes (plasmid-associated genes encoding virulence factors (cyaA, pagA, lef, and
capA, capB, capC) and one chromosomal marker BA-5449) with analysis of amplicons by microarray hybridization, we were able to
unambiguously identify and discriminate B. anthracis among other closely related species. Bacillus identification relied on hybridization
with multiple individual microarray oligonucleotide probes (oligoprobes) specific to each target B. anthracis gene. Evaluation of the assay
was conducted using several B. anthracis strains (with or without pXO1 and pXO2 plasmids) as well as over 50 other species
phylogenetically related to B. anthracis, including B. cereus, B. thuringiensis, B. mycoides, and B. subtilis. The developed microarray
analysis of amplified genetic markers protocol provides an efficient method for (i) unambiguous identification and discrimination of B.
anthracis from other Bacillus species and (ii) distinguishing between plasmid-containing and plasmid-free Bacillus anthracis strains. © 2004
Elsevier Inc. All rights reserved.

Keywords: Multiplex PCR; pXO1; pXO2; Virulence factors; Anthrax toxins

1. Introduction
Bacillus anthracis is a Gram-positive, rod shaped, spore-
forming bacterium that belongs to the Bacillus cereus
group. This phylogenetically distant group from other Ba-
cillus species includes B. cereus, B. thuringiensis, B. my-
coides, and B. weihenstephanensis (Daffonchio et al., 2000;
Mock and Fouet, 2001). The capsule-forming B. anthracis
is the etiological agent of anthrax, the acute and often fatal
mammalian disease (Dixon et al., 1999). Although anthrax
predominantly occurs among animals (particularly herbi-
vores), occasionally it can also affect humans (Dixon et al.,
1999).
Virulent forms of B. anthracis harbor two large patho-
genicity-related plasmids: pXO1 (181.7 kb), which encodes
* Corresponding author. Tel.: ⫹1-301-827-4041; fax: ⫹1-301-827-
4622.
E-mail address: chizhikov@cber.fda.gov (V. Chizhikov).
a group of bacterial toxin genes (pagA, lef, and cyaA) and
pXO2 (93.5 kb), which carries the genes responsible for
capsule synthesis and degradation (capA, capB, capC, and
capD) (Leppla, 2000; Makino et al., 2002; Okinaka et al.,
1999; Pannucci et al., 2002).
Current methods for B. anthracis identification and char-
acterization are based on conventional microbiological ap-
proaches, which include biochemical testing (Logan et al.,
1985; Odendaal et al., 1991), immunological testing (Sastry
et al., 2003), antibiotic susceptibility assays (Mohammed et
al., 2002), phage lysing assays (Logan et al., 1985;
Odendaal et al., 1991; Schuch et al., 2002), and animal
virulence testing (Odendaal et al., 1991). Although shown
to be effective, these approaches are time-consuming and
often yield false-positive results that occur as a consequence
of genetic and phenotypic mimicry of plasmid-free B. an-
thracis and B. cereus isolates. The utility of molecular
methods based on polymerase chain reaction (PCR) ampli-
fication (including real-time PCR) of unique B. anthracis

0732-8893/04/$ – see front matter © 2004 Elsevier Inc. All rights reserved.
doi:10.1016/j.diagmicrobio.2004.03.015
164 D. Volokhov et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 163–171
genetic markers could substantially improve B. anthracis
identification methodology and facilitate anthrax diagnosis
by cutting the time-consuming analysis. The most com-
monly used approach for B. anthracis speciation is based on
detection of virulence factor genes associated with pXO1
and pXO2 plasmids (Bell et al., 2002; Brightwell et al.,
1998; Fasanella et al., 2001; Hutson et al., 1993; Jackson et
al., 1998; Makino et al., 1993; Ramisse et al., 1996;
Timoshin et al., 1994; Turnbull, 1999; Turnbull et al.,
1992). In the case of plasmid loss, however, discriminating
B. anthracis from other genetically related members of the
Bacillus cereus group poses a significant problem (Helga-
son et al., 2000). Thus, the search for genetic markers that
enable unambiguous differentiation of B. anthracis from
other species of the Bacillus cereus group is an important
and challenging task.
Several chromosomal gene markers such as 16S rRNA
(Liu et al., 2001; Sacchi et al., 2002), 16S-23S internal
transcribed spacers (Daffonchio et al., 2000), Ba813 (Patra
et al., 1996; Ramisse et al., 1999), rpoB (Qi et al., 2001),
SG749 (Daffonchio et al., 1999), vrrA (Andersen et al.,
1996; Jackson et al., 1997; Keim et al., 2000), and AC-390
(Cherif et al., 2002) have been reported to be potentially
suitable targets for recognition of B. anthracis plasmid-
cured strains by PCR amplification. However, later studies
revealed that a number of these chromosomal markers have
limited specificity (Ramisse et al., 1999), do not provide
sufficient polymorphism to differentiate B. anthracis (Ash
et al., 1991; Bourque et al., 1995; Harrell et al., 1995), or
require using complicated and time-consuming experimen-
tal protocols (Daffonchio et al., 1999).
In this study we describe a novel approach based on
microarray analysis of amplified genetic markers
(MAAGM), which can be used for unambiguous identifi-
cation and characterization of a variety of genetic variants
of B. anthracis strains. The effectiveness of the new ap-
proach was evaluated by its ability to discriminate between
B. anthracis and other closely related species of the Bacillus
genus.
2. Materials and methods
2.1. Bacterial strains
The Bacillus strains (Table 1) were obtained from the
American Type Culture Collection (ATCC, Manassas, VA),
the collections of Dr. F. Khambaty of the Center for Food
Safety and Applied Nutrition, the Food and Drug Admin-
istration (College Park, MD), and Dr. S. Leppla of the
National Institute of Allergy and Infectious Diseases, Na-
tional Institutes of Health (Bethesda, MD). Some spore-
forming, aerobic, Gram-positive Bacillus spp. were isolated
from the environment (soil samples) and were characterized
based on bacterial cell morphology, colonial morphotype,
and sensitivity to penicillin. Bacilli that belonged to the
Bacillus cereus group were characterized by the presence of
the cerA gene, the identifying genetic marker for represen-
tatives of this bacterial group (Daffonchio et al., 1999;
Schraft and Griffiths, 1995). B. thuringiensis was distin-
guished using the multiplex PCR assay previously described
(Ben-Dov et al., 1997).
2.2. Total DNA preparation
Freshly grown bacteria were resuspended in 0.5 mL
water (approximately 108 cells/mL) and treated with ly-
sozyme (50 mg/mL) for 2 h at 37°C (Chachaty and Saulnier,
2000) to disrupt bacterial walls. Proteins were removed
from solution by two sequential phenol-chloroform (1:1)
extractions, and bacterial DNA was precipitated by 3 vol-
umes of anhydrous ethanol. The DNA pellets were dried in
a vacuum and resuspended in 300 ␮L of water. The pres-
ence and quality of genomic DNA were confirmed by 0.8%
agarose gel electrophoresis followed by gel staining with
ethidium bromide.
2.3. Design of the PCR primers and microarray
oligoprobes
PCR amplification of target genes (cyaA, pagA, and lef)
encoded on the pXO1 was accomplished using three pairs of
primers previously published (Table 2) (Jackson et al.,
1998). Three pairs of primers for amplification of B. an-
thracis capsule genes (capA, capB, and capC) were selected
based on conserved sequences found within each of the
target genes (Table 2).
B. anthracis-specific chromosomal marker BA-5449 was
identified by genomic analysis of several recently se-
quenced B. anthracis strains (GenBank accession numbers
NC_003995, NC_003997, NC_004126, and NC_004352).
Primers for PCR amplification (Table 2) of the BA-5449
ORF were designed using conserved sequences in the re-
gions flanking the BA-5449.
Microarray species-specific oligoprobes for the seven
selected genes were designed using following criteria: oli-
goprobes were selected in the regions highly homologous
among all known genetic alleles of the target gene (Table 3),
and the melting temperature of complex oligoprobe with
template was 50°C and higher (basic algorithm). The se-
quences of the target genes found in the GenBank were
aligned using ClustalX software (Thompson et al., 1994),
and the conserved regions were used to design the gene-
specific oligoprobes summarized in Table 4. The 5⬘-end of
each oligonucleotide was modified during synthesis using
TFA Aminolink CE reagent (PE Applied Biosystems, Fos-
ter City, CA) to enable attachment to the silylated glass
slides (CEL Associates, Inc., Houston, TX).
 D. Volokhov et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 163–171 165

Table 1
Origin and description of laboratory and reference strains used in this study

Species Strain (isolate) Relevant characteristic(s) Microarray result Sourcea

⫺ ⫹ ⫺ ⫹ ⫺ ⫹
B. anthracis Ames 35 and Ames 35 (spo0A ) pXO1 /pXO2 pXO1 /pXO2 /BA-5449 LS
B. anthracis Ames 34 and two Ames 34 (spo0A⫺) variants pXO1⫺/pXO2⫹ pXO1⫺/pXO2⫹/BA-5449⫹ LS
B. anthracis Ames 33 and two Ames 33 (spo0A⫺) variants pXO1⫺/pXO2⫺ pXO1⫺/pXO2⫺/BA-5449⫹ LS
B. anthracis Ames 35 (pepM4C⫺) pXO1⫹/pXO2⫺ pXO1⫹/pXO2⫺/BA-5449⫹ LS
B. anthracis Three Ames 35 (spo0A⫺ pepM4C⫺) variants pXO1⫹/pXO2⫺ pXO1⫹/pXO2⫺/BA-5449⫹ LS
B. anthracis Sterne vaccine strain pXO1⫹/pXO2⫺ pXO1⫹/pXO2⫺/BA-5449⫹ LS
B. cereus 569 cerA⫹b; Hem⫹c Negative LS
B. cereus ATCC 49063 cerA⫹; serotype H.26; Hem⫹ Negative ATCC
B. cereus ATCC 33019 cerA⫹; Hem⫹ Negative ATCC
B. cereus 860 cerA⫹; Hem⫹ Negative KF
B. cereus 1241 cerA⫹; Hem⫹ Negative KF
B. cereus 1242 cerA⫹; Hem⫹ Negative KF
B. cereus 1257 cerA⫹; Hem⫹ Negative KF
B. cereus 1259 cerA⫹; Hem⫹ Negative KF
B. cereus 1261 cerA⫹; Hem⫹ Negative KF
B. cereus 1263 cerA⫹; Hem⫹ Negative KF
B. cereus 1265 cerA⫹; Hem⫹ Negative KF
B. thuringiensis ATCC 13366 cerA⫹ Negative ATCC
B. thuringiensis subsp. israelensis ATCC 35646 cerA⫹; produces delta-endotoxin Negative ATCC
B. thuringiensis 1258 cerA⫹ Negative KF
B. thuringiensis 1260 cerA⫹ Negative KF
B. thuringiensis 1262 cerA⫹ Negative KF
B. thuringiensis 1264 cerA⫹ Negative KF
B. thuringiensis 1266 cerA⫹ Negative KF
B. subtilis ATCC 19659 cerA⫺ Negative ATCC
B. subtilis ATCC 21332 cerA⫺; produces surfactin Negative ATCC
B. subtilis 1267 cerA⫺ Negative KF
B. subtilis 1268 cerA⫺ Negative KF
B. subtilis 1269 cerA⫺ Negative KF
B. subtilis 1270 cerA⫺ Negative KF
B. subtilis 1271 cerA⫺ Negative KF
B. mycoides ATCC 6462 cerA⫹; type strain Negative ATCC
B. mycoides CP9 cerA⫹; PRd Negative SS
B. mycoides CP2 cerA⫹; PR Negative SS
B. mycoides CP3 cerA⫹; PR Negative SS
B. mycoides CP13 cerA⫺; PR Negative SS
B. mycoides PR3 cerA⫹; PR Negative SS
B. mycoides TW2 cerA⫹; PR Negative SS
B. mycoides TW4 cerA⫹; PR Negative SS
B. mycoides TW5 cerA⫺; PR Negative SS
B. mycoides TW7 cerA⫹; PR Negative SS
B. mycoides TW8 cerA⫹; PR Negative SS
B. mycoides WM5 cerA⫺; PR Negative SS
B. mycoides WF1 cerA⫹; PR Negative SS
B. mycoides WF14 cerA⫹; PR Negative SS
B. mycoides WFA1 cerA⫺; PR Negative SS
B. mycoides WFA2 cerA⫹ PR Negative SS
B. mycoides SG1 cerA⫹ PR Negative SS
Bacillus spp.e CP1 cerA⫹ PR Negative SS
Bacillus spp. CP5 cerA⫹ PR Negative SS
Bacillus spp. CP8 cerA⫺; PR Negative SS
Bacillus spp. CP10 cerA⫹ PR Negative SS
Bacillus spp. CP12 cerA⫹ PR Negative SS
Bacillus spp. CP16 cerA⫹ PR Negative SS
Bacillus spp. PR2 cerA⫹ PR Negative SS
Bacillus spp. PR4 cerA⫹ PR Negative SS
Bacillus spp. TW1 cerA⫹ PR Negative SS
Bacillus spp. TW3 cerA⫹ PR Negative SS
Bacillus spp. WM1 cerA⫹ PR Negative SS
Bacillus spp. WM2 cerA⫹ PR Negative SS
Bacillus spp. WF7 cerA⫹ PR Negative SS
Bacillus spp. KS14 cerA⫹ PR Negative SS
a
LS, Leppla S; NIH, National Institute of Allergy and Infectious Diseases; ATTC, American Type Culture Collection; KF, Khambaty F; FDA, Food and
Drug Administration; SS, gram-positive Bacillus spp. isolated from environmental (soil samples).
b
Cereolysin A gene positive (cerA⫹) or negative (cerA⫺).
c
Hemolysin positive (Hem⫹).
d
Penicillin G–resistant isolate (PR).
e
Bacillus isolates belonging to Bacillus cereus group.
166 D. Volokhov et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 163–171

Table 2
Primers used for amplification of Bacillus anthracis genes

Target Primer Nucleotide sequence (5⬘-3⬘) Gene GenBank PCR product Tm (°C)
accession no. size (bp)

pXO1 LEF-1F GGTGCGGATTTAGTTGATTC lef NC_003980 851 50

LEF-1P CGCTTCATTTGTTCTCCC 48
CYA-1F GCGATGAAAACAACGAAGTA cyaA NC_001496 720 48
CYA-1P TCGTCTTTGTCGCCACTATC 52
PA-1F CCAGACCGTGACAATGATG pagA NC_001496 508 51
PA-1R CAAGTTCTTTCCCCTGCTA 49
pXO2 CAPAF TGCGACATGGGTACAACGTACAGAAGC capA NC_003981 525 61
CAPAR TGTTCTTTCGTTGCAATAGCTCCTGCTAC 60
CAPBF CATCGCTTGCTTTAGCGGTAGCAGAG capB NC_003981 432 61
CAPBR GCATACGAGACATAATTTCACTTGTTGACC 59
CAPCF TTGCATTAGTATTAGGAGTTACACTGAGCC capC NC_003981 534 59
CAPCR AGAGGTAATACGATTGCTACATAACGAGG 59
Chromosomal BA-F1 CATGGAATCAAGCTGCAAATTATAAAG BA-5449 NC_003995 1017 54
marker region
BA-R1 CTAAATTGTCATTTGGCAAATTGAAATTC 53

2.4. Microchip design and fabrication sets of primers to ensure the high sensitivity of developed
assay. Thus, the ANX1 primer mixture contained primers
The microchip for identification of B. anthracis, and its for amplification of pXO1-related genes (cyaA, pagA, and
discrimination from closely related Bacillus species, was lef), whereas ANX2 was used for simultaneous amplifica-
designed to contain multiple individual oligonucleotide tion of pXO2 plasmid genes (capA, capB, and capC) and
probes complementary to each target gene (Table 4). The BA-5449 chromosomal intergenic region. The standard
dispensing of oligoprobes onto the microchip surface was PCR mixture (50 ␮L) contained 3 units of HotStarTaq DNA
accomplished using a previously described protocol (Vo- polymerase, 1⫻ reaction buffer supplemented with 2.5 mM
lokhov et al., 2002). MgCl2 (Qiagen, Chatsworth, CA), 300 nM (each) forward
and reverse primers, 300 ␮M deoxynucleoside triphosphate
2.5. Multiplex PCR amplification (dATP, dGTP, dCTP, and dTTP), and 1–2 ␮L DNA tem-
plate (approximately 0.2 ␮g of total bacterial DNA). The
Table 2 summarizes the data on all primers used for B. PCR was carried out using the Gene Amp PCR System
anthracis target gene amplification. Amplification of seven 9700 thermocycler (Applied Biosystems, Foster City, CA)
target B. anthracis genes was performed using two separate with the following cycle conditions: initial activation at
95°C for 15 min, 40 cycles at 94°C for 30 sec, 55°C or 60°C
for 30 sec for pXO1 and pXO2 primer sets respectively,
Table 3 72°C for 1 min, and the final extension at 72°C for 10 min.
Accession numbers of the sequences used for the design of the
microarray oligonucleotide probes and the some cap-specific primers
The synthesis of PCR products was confirmed by electro-
phoresis in 2% agarose gel containing 1⫻ TAE buffer
Gene Organism Accession no. followed by staining with ethidium bromide.
lef Bacillus anthracis NC_003980; AE011190;
AJ413935; AJ413934; 2.6. Synthesis of Cy5-labeled ssDNA
NC_001496; AF065404;
M29081; M30210 Single-stranded DNA (ssDNA) samples for microarray
cyaA Bacillus anthracis AJ413931; AJ413930;
hybridization were synthesized by 40 cycles of the primer
NC_001496; AF065404;
AF003936; A32503; A07289; extension reaction (Volokhov et al., 2002) in the presence of
A02546; M24074; M23179 a mixture of reverse primers (Table 2). The reaction was
pagA Bacillus anthracis AJ413937; AJ413936; conducted in 50 ␮L containing 5 units of Taq DNA poly-
NC_001496; AF306783; merase (Sigma, St. Louis, MO), 1⫻ reaction buffer with 3.0
AF306782; AF306781;
mM MgCl2, 600 nM (each) reverse primer, 200 nM of
AF306780; AF306779;
AF306778; AF065404 dGTP, dATP, and dTTP, 40 nM dCTP, 40 nM Cy5-dCTP
cap (A,B,C) Bacillus anthracis NC_003981; AE011191; and 200 ng of double-stranded DNA template from the first
M24150 round of multiplex PCR and purified using QIAquick PCR
yws (A,B,C) Bacillus subtilis Z92954; AB039950; purification kit (Qiagen, Chatsworth, CA). The protocol
AB046355; Z92953
included the initial activation step at 95°C for 1 min fol-
cap (B,C) Bacillus firmus U60883
lowed by 40 cycles at 94°C for 20 sec, 58°C for 20 sec, and
 D. Volokhov et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 163–171 167

Table 4
Oligonucleotide probes for detection and discrimination of Bacillus anthracis

Type Name Sequence Length (nt) G⫹C (%) Tma (°C)

lef specific Lef1 TTGAAATGGAGAATCCAATTATCAC 25 32 51
Lef2 ATGGAAAGCTTATATTACAAAGAAAC 26 27 50
Lef3 TCAAGAAGCACAGTTAAATATAAATC 26 27 50
Lef4 ATACAAAGCTTATTACATTCAACG 24 29 49
Lef5 ATGCATCCAATATTGTAGAAAGT 23 30 48
Lef6 TAGTTGATGGTAATGGAAGATTTG 24 33 51
cya specific Cya1 TGGAGAAATATAGAAGTGATGG 22 36 49
Cya2 TTGCACTTGCCCCAAGTTTAAC 22 45 53
Cya3 TAACACCCCAAATTCATTAGAAAAG 25 32 51
Cya4 ATTAAATATGGAATTGAGAGGAAAC 25 28 49
Cya5 ACAAATGCTTGATCGTTTGAATG 23 35 50
Cya6 AATAGCTCCTGGTAATAAAGCTTAT 25 32 51
pag specific Pag1 TCACCATGGATTTCTAATATTCATG 25 32 51
Pag2 ATGGAGCACGGCTTCTGATC 20 55 54
Pag3 TTACAGGACGGATTGATAAGAAA 23 35 50
Pag4 ATGTAGATATGGAGAATATTATTCTCT 27 26 51
Pag5 AAGTACATGGAAATGCAGAAGT 22 36 49
Pag6 ATCTGCAGGATTTAGTAATTCG 22 36 49
capA specific CapA1 TCGTGAGAACGAAAAATTGACG 22 41 51
CapA2 ATGGTTGGTGACATTATGATGG 22 41 51
CapA3 AGATTGTTAATCGTTACGGTACA 23 35 50
CapA4 TACGTAAGTGGGAATTTCGAAC 22 41 51
CapA5 AGATAAGAATATTCACTTAAGTGC 24 29 49
CapA6 TGACGGATTATGGTGCTAAGG 21 48 52
capB specific CapB1 TTGCAGCGAATGATCCCTC 19 53 51
CapB2 ACATTACGTATTTGGGAACGT 21 38 49
CapB3 ATGATTTTGGATATAGTAATCTAGC 25 28 49
CapB4 ATTGTAATTATGAATTGCCGCC 22 36 49
CapB5 ACCGCGTTGATCGTACTGAG 20 55 54
CapB6 TGCCATATATTAAAGCGGAAATA 23 30 48
capB specific CapC1 AATCGTTACGTATGGTGTTTCA 22 36 49
CapC2 CGTAGAAAATTTGCGGCAAC 20 45 50
CapC3 TCAGCCCGTATTTATGTTGGT 21 43 50
CapC4 ATGGTGTTTCAAGATTCATGATTTT 25 28 49
CapC5 TATTTGTTTAAAACTTTTATTTGATTATTG 30 13 48
CapC6 ATCAGTATTTTAACATATGTAATCGTT 27 22 49
BA-5449 region BA-1 TTATTAAAGAGCCAGAGGGAT 21 38 49
specific
BA-2 AGCGGTAAAGTAAAGGCACA 20 45 50
BA-3 TGCTTTTAACCGATCGTTTTATAAA 25 28 49
BA-4 TATATAAAACATTAGGATTCGAT 23 22 45
BA-5 AAACAAAGAAGTAGTTGGAGAT 22 32 47
BA-6 ATAATAGATGAATTAAAAAAGAGAA 25 16 45
BA-7 TGAAGAGACGGTAAGAGAAAG 21 43 50
BA-8 TAGTGGATTAACAGAAGAGGA 21 38 49
BA-9 TCAGTTGCAAGTGAATTAAAGA 22 32 47
QC QCprb TGGCAGAAGCTATGAAACGATATGGG 26 46 58
Cy3-QC CCCATATCGTTTCATAGCTTCTGCCA 26 46 58
a
Basic melting temperature (Tm) was calculated with the Oligonucleotide Properties Calculator (http://www.basic.nwu.edu/biotools/oligocalc.html).

72°C for 2 min with the final extension at 72°C for 10 min.
The fluorescently labeled ssDNA products were purified
from nonincorporated reagents with the QIAquick PCR
purification kit according to the manufacturer’s protocol,
dried in vacuum, and solubilized in 10 ␮L of water.
2.7. Hybridization conditions
Hybridization of fluorescently labeled ssDNA samples to
the oligonucleotide microarray was performed in 1⫻ hy-
bridization buffer (5⫻ Denhardt’s solution, 6⫻ SSC, and
0.1% Tween 20) at 53°C for 30 min. Before hybridization,
1 ␮L of the Cy5-labeled ssDNA sample was mixed with an
equal volume of 2⫻ hybridization buffer containing 0.1 ␮M
Cy3-labeled QC probe (Cy3-QCprb) (Table 4), followed by
a denaturing step at 95°C for 1 min and chilling on ice.
Hybridization mixtures were placed onto separate micro-
chip areas containing oligoprobe microarrays and covered
with a 5 ⫻ 5-mm plastic coverslip to prevent evaporation
during incubation. Microchips with 10 identical arrays were
used. After the hybridization, the slides were washed for 1
min with 6⫻ SSC containing 0.2% Tween 20, followed by
168 D. Volokhov et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 163–171

Fig. 1. Microarray analysis of multiple genetic markers of B. anthracis strains using the “Anthrax” microchip. Amplification of seven target B. anthracis genes
was conducted using two separate multiplex PCR mixtures containing primers specific for either (A) cyaA, pagA, and lef or (B) capA, capB, capC and
chromosomal marker BA-5449 genes. Some characteristic hybridization patterns of B. anthracis strains are shown in (C). (A) Lanes: M, MassRuler DNA
Ladder (SM0383, Fermentas); 1, Ames 35; 2, Ames 35(spo0A⫺); 3, Ames 35 (pepM4C⫺); 4, Ames 35 (spo0A⫺pepM4C⫺); 5, Ames 35
(spo0A⫺pepM4C⫺)v2; 6, Ames 35 (spo0A⫺pepM4C⫺)v3; 7, Sterne vaccine strain. (B) Lanes: M, GeneRuler DNA Ladder Mix (SM0333, Fermentas); 1,
Ames 34; 2, Ames 34 (spo0A⫺); 3, Ames 34 (spo0A⫺)v2; 4, Ames 35; 5, Ames 33 (spo0A⫺); 6, Ames 33 (spo0A⫺)v2; 7, Sterne vaccine strain. (C)
Hybridization patterns of B. anthracis strains containing either none of above plasmids or pXO1, or XO2 are shown on panels 1, 2, and 3, respectively.
Microarray rows a and b contain individual oligoprobes for pXO1-specific markers: pagA (columns 1–3), lef (columns 4 – 6), and cyaA (columns 7–9), rows
c and d represent pXO2-specific markers: capA (columns 1–3), capB (columns 4 – 6), and capC (columns 7–9), and row c includes oligoprobes for the
chromosomal marker BA-5449.

three consecutive washes (1 min each) with 6⫻ SSC buffer,
2⫻ SSC buffer, and 1⫻ SSC buffer. Traces of remaining
buffer were removed by air stream.
2.8. Microchip scanning and analysis
Fluorescent images of the microarrays were obtained by
scanning slides using ScanArray 5000 (PerkinElmer, Bos-
ton, MA). The fluorescent signals from each spot were
measured and compared using QuantArray software
(PerkinElmer, Boston, MA).
3. Results
3.1. PCR amplification of target B. anthracis genes
The two primer sets, ANX1 and ANX2, were used for PCR
amplification of the pXO1-associated genes and the pXO2-
associated genes in combination with the chromosomal
marker, respectively. The first set was composed of primers
previously optimized for analysis of B. anthracis pXO1 genes
pagA, lef, and cyaA (Jackson et al., 1998). We found that these
primers efficiently and specifically amplified all target B. an-
thracis genes in both single and multiplex PCR (Fig. 1A, Table
1). Synthesis of detectable amounts of amplicons was observed
with all pXO1-containing B. anthracis isolates, whereas no
PCR product associated with the pXO1 plasmid was detected
when DNA from other Bacillus species has been used as PCR
templates (Table 1).
The results of amplification were more complex for the
ANX2 set of primers. We observed the appearance of non-
specific DNA products having molecular sizes close to
those of pXO2-derived PCR fragments when the DNA from
some non–B. anthracis was used for PCR amplification.
Moreover, although some PCR products obtained by am-
plification of B. thuringiensis showed low cross-hybridiza-
tion with B. anthracis cap-specific microarray oligoprobes,
the pattern of hybridization signals from oligoprobes differed
substantially from that of pXO2-bearing B. anthracis (data not
shown). To improve the specificity of the assay, we designed
a new set of primers for amplification of the capA, capB, and
capC genes. This new set of primers was evaluated using
different Bacillus species, summarized in Table 1. We found
that these primers enabled efficient and highly specific ampli-
fication of target pXO2 genes exclusively from pXO2-contain-
ing B. anthracis strains (Fig. 1B, Table 1).
The new chromosomal marker, BA-5449 (1017 nts), incor-
porated the sequence of the BA813 marker, which has been
 D. Volokhov et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 163–171
previously proposed as a useful discriminatory factor for B.
anthracis identification. New primers, BA-F1 and BA-R1,
designed to amplify BA-5449 marker, demonstrated high se-
lectivity in amplification and were able to generate PCR prod-
ucts of expected size exclusively with the B. anthracis isolates
(Fig. 1B). No amplification was observed with any other spe-
cies of the Bacillus cereus group (data not shown).
3.2. MAAGM-based identification of the B. anthracis
Discrimination of B. anthracis from other bacilli of the
Bacillus cereus group was based on PCR amplification of
target regions of seven B. anthracis–specific genes using
two primer sets, followed by analysis of the amplified DNA
by hybridization with the microchip containing multiple
sequence-specific oligonucleotide probes. The “Anthrax”
microchip included a total of 45 oligoprobes placed into
seven separate panels. Each panel contained oligoprobes
specific to only one target gene (Fig. 1C).
The specificity and discriminatory power of the method
were evaluated using 56 bacterial isolates closely related
genetically to B. anthracis (Table 1). The results of this
analysis are presented on Fig. 1C, and Table 1.
Only isolates of B. anthracis were found to produce PCR
products capable of hybridizing with the oligoprobes specific
to the B. anthracis chromosomal marker and pXO1/pXO2
plasmid-associated genes. The microarray data on the pres-
ence/absence of pXO1 and pXO2 were in concordance with
the phenotypic observation of the B. anthracis isolates. The
microarray analysis unambiguously identified the presence of
pXO1 in the Ames 35 strain, which produces protective anti-
gen. pXO2 was found in the Ames 34 strain, which produces
capsule, whereas none of the plasmids was detected in Ames
33, which produces neither protective antigen nor capsule.
No synthesis of the characteristic PCR products or cross-
hybridization of B. anthracis-specific oligoprobes was ob-
served with any other Bacillus species included in this study.
4. Discussion
In this paper, we describe a development and evaluation
of a new method for a reliable identification of plasmid-
bearing and plasmid-cured strains of B. anthracis and dis-
crimination of anthrax bacilli from other members of the
Bacillus cereus group.
All currently available assays for B. anthracis identifi-
cation suffer, as noted above, from being either labor-con-
suming or having limited specificity (Bell et al., 2002;
Ramisse et al., 1996; Ramisse et al., 1999) and call for a
search of new technical approaches enabling a rapid and
reliable species identification. The application of PCR-
based techniques for characterization of species-specific ge-
netic markers has substantially improved and facilitated
detection and identification of many different bacterial
pathogens (Louie et al., 2000; Mock and Fouet 2001; Tang
169
et al., 1997; Turnbull et al., 1992). Potentially, the sensitiv-
ity of PCR amplification performed at optimal conditions
enables detection of single copies of target DNA molecules
(Tang et al., 1997).
Several PCR-based approaches that rely on identification
of different B. anthracis chromosomal and extrachromo-
somal genetic markers (e.g., 16-23S rRNA intergenic spac-
ers, Ba813, rpoB, GS-749, AC-390 and cyaA, pagA, lef,
capA, capB, capC, respectively) have been developed and
described (Bell et al., 2002; Cherif et al., 2002; Daffonchio
et al., 1999; Daffonchio et al., 2000; Fasanella et al., 2001;
Gryadunov et al., 2001; Jackson et al., 1998; Liu et al.,
2001; Makino et al., 1993; Patra et al., 1996; Qi et al., 2001;
Ramisse et al., 1999; Reif et al., 1994). Although detection
of plasmid-associated genes was demonstrated to be a rel-
atively simple and efficient procedure, the selection of sta-
ble chromosomal markers unique to B. anthracis was ham-
pered by the high genetic similarity among different
Bacillus species (Ash et al., 1991; Bourque et al., 1995;
Daffonchio et al., 2000; Patra et al., 1996; Ramisse et al.,
1996; Ramisse et al., 1999; Sacchi et al., 2002; Yamada et
al., 1999). We conducted comparative analyses of several
recently sequenced B. anthracis and B. cereus genomes
(Ivanova et al., 2003; Read et al., 2003) to identify chro-
mosomal elements unique to B. anthracis. The analysis
allowed us to reveal few genomic regions in the B. anthracis
genome that are suitable for discrimination of B. anthracis
from other Bacillus species. One of such regions, designated
as BA-5449, was selected for further study. This region
incorporated the sequence of genetic marker BA813, previ-
ously proposed for identification of B. anthracis. However,
the utility of the BA813 as a B. anthracis chromosomal
marker was demonstrated to be limited, because of the
presence of sequences homologous to the BA813 in other
Bacillus species, e.g., B. cereus and B. thuringiensis (Ash et
al., 1991; Bourque et al., 1995; Daffonchio et al., 2000;
Patra et al., 1996; Ramisse et al., 1996; Ramisse et al., 1999;
Sacchi et al., 2002; Yamada et al., 1999). Proposed novel
marker BA-5449 of bigger size (1017 bp) contained addi-
tional multiple sequences unique to B. anthracis and appro-
priate for its identification. Using BA-5449 –specific PCR
primers, we observed the synthesis of amplicon of expected
molecular size only when B. anthracis DNA has been used
as a PCR template. In contrast, no PCR products appeared
when DNAs of other Bacillus species have been analyzed. The
simplicity and flexibility of the MAAGM system enable the
extending of the number of microarray oligoprobes and PCR
primers to order to adapt and include in this assay new chro-
mosomal markers that might be found suitable for B. anthracis
identification (Radnedge et al., 2003). Although no cross-spe-
cies amplification was observed with the Bacillus species used
in this study, no one can exclude the possibility that other
bacilli species can contain genetic regions homologous to BA-
5449 and may produce some PCR products with physical
characteristics close to those of B. anthracis amplicons, as was
observed with other markers (Ramisse et al., 1996; Ramisse et
170 D. Volokhov et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 163–171
al., 1999). The main advantage of the MAAGM is that this
method relies on identification of characteristic sequences in
target regions of selected marker genes. The hybridization of
amplicons with multiple short microarray oligoprobes (20-25-
mers) provides accurate analysis of such regions and identifi-
cation of Bacillus anthracis. Because of oligoprobe redun-
dancy, the MAAGM is potentially much more reliable in
comparison with other PCR-based methods, e.g., real-time
PCR. For the same reason, the MAAGM is not affected by the
occasional appearance of sporadic PCR products that can oc-
cur as a result of mispriming during PCR amplification (Elni-
fro et al., 2000; Markoulatos et al., 2002). Such nonspecific
DNA products can often be observed when multiplex PCR is
used for simultaneous amplification of multiple genetic mark-
ers. However, such amplicons are unable to hybridize to the
sequence-specific microarray oligoprobes and therefore cannot
affect microarray-based species identification.
The current cost of microarray analysis is relatively high,
but there are several potential approaches to reduce signifi-
cantly microarray expenses and to make this technology af-
fordable for the majority of clinical and public health labora-
tories. Thus, the implication of simplified variants of scanners
(www.darpa.mil/dso/thrust/biosci/biosensor/argonne.html) and
the development of new protocols for preparation of fluores-
cently-labeled samples for microarray analysis using less ex-
pensive dyes are main ways to reach this goal.
We have successfully used this approach in previous
experiments for the detection and discrimination of different
viral and bacterial pathogens from closely related nonpatho-
genic species (Cherkasova et al., 2003; Chizhikov et al.,
2001; Chizhikov et al., 2002; Laassri et al., 2003; Volokhov
et al., 2002). The simplicity of the proposed microarray
protocol for simultaneous identification of several B. an-
thracis–specific genetic markers and the ability to perform
accurate analysis of multiple samples in a short period (4 –5
hours) present a great improvement over the existing meth-
odology for B. anthracis identification.
Acknowledgments
This work was supported in part by grants from USDA
and funding from FDA office of science awarded to Dr. V.
Chizhikov and Dr. A. Rasooly and from a grant from the
U.S. Defense Advanced Research Project Agency to Dr. K.
Chumakov.
References
Andersen GL, Simchock JM, Wilson KH (1996). Identification of a region
of genetic variability among Bacillus anthracis strains and related
species. J Bacteriol 178, 377–384.
Ash C, Farrow JA, Dorsch M, Stackebrandt E, Collins MD (1991). Com-
parative analysis of Bacillus anthracis, Bacillus cereus, and related
species on the basis of reverse transcriptase sequencing of 16S rRNA.
Int J Syst Bacteriol 41, 343–346.
Bell CA, Uhl JR, Hadfield TL, David JC, Meyer RF, Smith TF, Cockerill
FR 3rd (2002). Detection of Bacillus anthracis DNA by LightCycler
PCR. J Clin Microbiol 40, 2897–2902.
Ben-Dov E, Zaritsky A, Dahan E, Barak Z, Sinai R, Manasherob R,
Khamraev A, Troitskaya E, Dubitsky A, Berezina N, Margalith Y
(1997). Extended screening by PCR for seven cry-group genes from
field-collected strains of Bacillus thuringiensis. Appl Environ Micro-
biol 63, 4883– 4890.
Bourque SN, Valero JR, Lavoie MC, Levesque RC (1995). Comparative
analysis of the 16S to 23S ribosomal intergenic spacer sequences of
Bacillus thuringiensis strains and subspecies and of closely related
species. Appl Environ Microbiol 61, 1623–1626.
Brightwell G, Pearce M, Leslie D (1998). Development of internal controls
for PCR detection of Bacillus anthracis. Mol Cell Probes 12, 367–377.
Chachaty E, Saulnier P (2000). Isolation chromosomal DNA from bacteria.
In The Nucleic Acid Protocols: Handbook. Ed, R Rapley. Totowa, NJ:
Humana Press Inc., pp 29 –32.
Cherif A, Borin S, Rizzi A, Ouzari H, Boudabous A, Daffonchio D (2002).
Characterization of a repetitive element polymorphism-polymerase
chain reaction chromosomal marker that discriminates Bacillus anthra-
cis from related species. J Appl Microbiol 93, 456 – 462.
Cherkasova E, Laassri M, Chizhikov V, Korotkova E, Dragunsky E, Agol
V, Chumakov K (2003). Microarray analysis of evolution of RNA
viruses: New evidence of circulation of virulent highly divergent vac-
cine-derived polioviruses. Proc Natl Acad Sci U S A 100, 9398 –9403.
Chizhikov V, Rasooly A, Chumakov K, Levy DD (2001). Microarray
analysis of microbial virulence factors. Appl Environ Microbiol 67,
3258 –3263.
Chizhikov V, Wagner M, Ivshina A, Hoshino Y, Kapikian AZ, Chumakov
K (2002). Detection and genotyping of human group A rotaviruses by
oligonucleotide microarray hybridization. J Clin Microbiol 40, 2398 –
2407.
Daffonchio D, Borin S, Frova G, Gallo R, Mori E, Fani R, Sorlini C (1999).
A randomly amplified polymorphic DNA marker specific for the Ba-
cillus cereus group is diagnostic for Bacillus anthracis. Appl Environ
Microbiol 65, 1298 –1303.
Daffonchio D, Cherif A, Borin S (2000). Homoduplex and heteroduplex
polymorphisms of the amplified ribosomal 16S-23S internal tran-
scribed spacers describe genetic relationships in the “Bacillus cereus
group.” Appl Environ Microbiol 66, 5460 –5468.
Dixon TC, Meselson M, Guillemin J, Hanna PC (1999). Anthrax. N Engl
J Med 341, 815– 826.
Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE (2000). Multiplex PCR:
Optimization and application in diagnostic virology. Clin Microbiol
Rev 13, 559 –570.
Fasanella A, Losito S, Trotta T, Adone R, Massa S, Ciuchini F, Chiocco D
(2001). Detection of anthrax vaccine virulence factors by polymerase
chain reaction. Vaccine 19, 4214 – 4218.
Gryadunov DA, Mikhailovich VM, Noskov AN, Lapa SA, Sobolev A,
Pankov SV, Rubina A, Zasedatelev AS, Mirzabekov AD (2001). De-
tection of Bacillus anthracis using multiplex PCR on the oligonuclotide
biochip. Dokl Biochem Biophys 381, 384 –386.
Harrell LJ, Andersen GL, Wilson KH (1995). Genetic variability of Ba-
cillus anthracis and related species. J Clin Microbiol 33, 1847–1850.
Helgason E, Okstad OA, Caugant DA, Johansen HA, Fouet A, Mock M,
Hegna I, Kolsto AB (2000). Bacillus anthracis, Bacillus cereus, and
Bacillus thuringiensis— one species on the basis of genetic evidence.
Appl Environ Microbiol 66, 2627–2630.
Hutson RA, Duggleby CJ, Lowe JR, Manchee RJ, Turnbull PC (1993). The
development and assessment of DNA and oligonucleotide probes for the
specific detection of Bacillus anthracis. J Appl Bacteriol 75, 463– 472.
Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V,
Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A, Chu L, Mazur
M, Goltsman E, Larsen N, D’Souza M, Walunas T, Grechkin Y, Pusch
G, Haselkorn R, Fonstein M, Dusko Ehrlich S, Overbeek R, Kyrpides
N (2003). Genome sequence of Bacillus cereus and comparative anal-
ysis with Bacillus anthracis. Nature 423, 87–91.
 D. Volokhov et al. / Diagnostic Microbiology and Infectious Disease 49 (2004) 163–171
Jackson PJ, Hugh-Jones ME, Adair DM, Green G, Hill KK, Kuske CR,
Grinberg LM, Abramova FA, Keim P (1998). PCR analysis of tissue
samples from the 1979 Sverdlovsk anthrax victims: The presence of
multiple Bacillus anthracis strains in different victims. Proc Natl Acad
Sci U S A 95, 1224 –1229.
Jackson PJ, Walthers EA, Kalif AS, Richmond KL, Adair DM, Hill KK,
Kuske CR, Andersen GL, Wilson KH, Hugh-Jones M, Keim P (1997).
Characterization of the variable-number tandem repeats in vrrA from
different Bacillus anthracis isolates. Appl Environ Microbiol 63, 1400 –
1405.
Keim P, Price LB, Klevytska AM, Smith KL, Schupp JM, Okinaka R,
Jackson PJ, Hugh-Jones ME (2000). Multiple-locus variable-number
tandem repeat analysis reveals genetic relationships within Bacillus
anthracis. J Bacteriol 182, 2928 –2936.
Laassri M, Chizhikov V, Mikheev M, Shchelkunov S, Chumakov K
(2003). Detection and discrimination of orthopoxviruses using microar-
rays of immobilized oligonucleotides. J Virol Methods 112, 67–78.
Leppla S (2000). Anthrax toxin. In: Handbook of Experimental Pharma-
cology. Eds, K Aktories and I Just. Berlin, Heidelberg: Springer-
Verlag, pp 445– 472.
Liu WT, Mirzabekov AD, Stahl DA (2001). Optimization of an oligonu-
cleotide microchip for microbial identification studies: A non-equilib-
rium dissociation approach. Environ Microbiol 3, 619 – 629.
Logan NA, Carman JA, Melling J, Berkeley RC (1985). Identification of
Bacillus anthracis by API tests. J Med Microbiol 20, 75– 85.
Louie M, Louie L, Simor AE (2000). The role of DNA amplification tech-
nology in the diagnosis of infectious diseases. CMAJ 163, 301–309.
Makino S, Watarai M, Cheun HI, Shirahata T, Uchida I (2002). Effect of
the lower molecular capsule released from the cell surface of Bacillus
anthracis on the pathogenesis of anthrax. J Infect Dis 186, 227–233.
Makino SI, Iinuma-Okada Y, Maruyama T, Ezaki T, Sasakawa C, Yo-
shikawa M (1993). Direct detection of Bacillus anthracis DNA in
animals by polymerase chain reaction. J Clin Microbiol 31, 547–551.
Markoulatos P, Siafakas N, Moncany M (2002). Multiplex polymerase
chain reaction: A practical approach. J Clin Lab Anal 16, 47–51.
Mock M, Fouet A (2001). Anthrax. Annu Rev Microbiol 55, 647– 671.
Mohammed MJ, Marston CK, Popovic T, Weyant RS, Tenover FC (2002).
Antimicrobial susceptibility testing of Bacillus anthracis: Comparison
of results obtained by using the National Committee for Clinical Lab-
oratory Standards broth microdilution reference and Etest agar gradient
diffusion methods. J Clin Microbiol 40, 1902–1907.
Odendaal MW, Pieterson PM, de Vos V, Botha AD (1991). The biochem-
ical, morphological and virulence profiles of Bacillus anthracis isolated
in the Kruger National Park. Onderstepoort J Vet Res 58, 21–26.
Okinaka RT, Cloud K, Hampton O, Hoffmaster AR, Hill KK, Keim P,
Koehler TM, Lamke G, Kumano S, Mahillon J, Manter D, Martinez Y,
Ricke D, Svensson R, Jackson PJ (1999). Sequence and organization of
pXO1, the large Bacillus anthracis plasmid harboring the anthrax toxin
genes. J Bacteriol 181, 6509 – 6515.
Pannucci J, Okinaka RT, Williams E, Sabin R, Ticknor LO, Kuske CR
(2002). DNA sequence conservation between the Bacillus anthracis
pXO2 plasmid and genomic sequence from closely related bacteria.
BMC Genomics 3, 34.
Patra G, Sylvestre P, Ramisse V, Therasse J, Guesdon JL (1996). Isolation
of a specific chromosomic DNA sequence of Bacillus anthracis and its
possible use in diagnosis. FEMS Immunol Med Microbiol 15, 223–231.
Qi Y, Patra G, Liang X, Williams LE, Rose S, Redkar RJ, DelVecchio VG
(2001). Utilization of the rpoB gene as a specific chromosomal marker
171
for real-time PCR detection of Bacillus anthracis. Appl Environ Mi-
crobiol 67, 3720 –3727.
Radnedge L, Agron PG, Hill KK, Jackson PJ, Ticknor LO, Keim P,
Andersen GL (2003). Genome differences that distinguish Bacillus
anthracis from Bacillus cereus and Bacillus thuringiensis. Appl Envi-
ron Microbiol 69, 2755–2764.
Ramisse V, Patra G, Garrigue H, Guesdon JL, Mock M (1996). Identifi-
cation and characterization of Bacillus anthracis by multiplex PCR
analysis of sequences on plasmids pXO1 and pXO2 and chromosomal
DNA. FEMS Microbiol Lett 145, 9 –16.
Ramisse V, Patra G, Vaissaire J, Mock M (1999). The Ba813 chromosomal
DNA sequence effectively traces the whole Bacillus anthracis com-
munity. J Appl Microbiol 87, 224 –228.
Read TD, Peterson SN, Tourasse N, Baillie LW, Paulsen I.T, Nelson KE,
Tettelin H, Fouts DE, Eisen JA, Gill SR, Holtzapple EK, Oa OK,
Helgason E, Rilstone J, Wu M, Kolonay JF, Beanan MJ, Dodson RJ,
Brinkac LM, Gwinn M, DeBoy RT, Madpu R, Daugherty SC, Durkin
AS, Haft DH, Nelson WC, Peterson JD, Pop M, Khouri HM, Radune
D, Benton JL, Mahamoud Y, Jiang L, Hance IR, Weidman JF, Berry
KJ, Plaut RD, Wolf AM, Watkins KL, Nierman WC, Hazen A, Cline
R, Redmond C, Thwaite JE, White O, Salzberg SL, Thomason B,
Friedlander AM, Koehler TM, Hanna PC, Kolsto AB, Fraser CM
(2003). The genome sequence of Bacillus anthracis Ames and com-
parison to closely related bacteria. Nature 423, 81– 86.
Reif TC, Johns M, Pillai SD, Carl M (1994). Identification of capsule-
forming Bacillus anthracis spores with the PCR and a novel dual-probe
hybridization format. Appl Environ Microbiol 60, 1622–1625.
Sacchi CT, Whitney AM, Mayer LW, Morey R, Steigerwalt A, Boras A,
Weyant RS, Popovic T (2002). Sequencing of 16S rRNA gene: A rapid
tool for identification of Bacillus anthracis. Emerg Infect Dis 8, 1117–1123.
Sastry KS, Tuteja U, Santhosh PK, Lalitha MK, Batra HV (2003). Iden-
tification of Bacillus anthracis by a simple protective antigen-specific
mAb dot-ELISA. J Med Microbiol 52, 47– 49.
Schraft H, Griffiths MW (1995). Specific oligonucleotide primers for
detection of lecithinase-positive Bacillus spp. by PCR. Appl Environ
Microbiol 61, 98 –102.
Schuch R, Nelson D, Fischetti VA (2002). A bacteriolytic agent that
detects and kills Bacillus anthracis. Nature 418, 884 – 889.
Tang YW, Procop GW, Persing DH (1997). Molecular diagnostics of
infectious diseases. Clin Chem 43, 2021–2038.
Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: Improving
the sensitivity of progressive multiple sequence alignment through
sequence weighting, position-specific gap penalties and weight matrix
choice. Nucleic Acids Res 22, 4673– 4680.
Timoshin VB, Zamaraev VS, Antonov VA, Lipnitskii AV (1994). A
species-specific DNA probe for identifying toxic strains of anthrax
pathogens. Mol Gen Mikrobiol Virusol 1, 30 –33.
Turnbull PC (1999). Definitive identification of Bacillus anthracis—a
review. J Appl Microbiol 87, 237–240.
Turnbull PC, Hutson RA, Ward MJ, Jones MN, Quinn CP, Finnie NJ,
Duggleby CJ, Kramer JM, Melling J (1992). Bacillus anthracis but not
always anthrax. J Appl Bacteriol 72, 21–28.
Volokhov D, Rasooly A, Chumakov K, Chizhikov V (2002). Identification
of Listeria species by microarray-based assay. J Clin Microbiol 40,
4720 – 4728.
Yamada S, Ohashi E, Agata N, Venkateswaran K (1999). Cloning and
nucleotide sequence analysis of gyrB of Bacillus cereus, B. thuringien-
sis, B. mycoides, and B. anthracis and their application to the detection
of B. cereus in rice. Appl Environ Microbiol 65, 1483–1490.