http://informahealthcare.

com/mdn
ISSN: 1940-1736 (print), 1940-1744 (electronic)

Mitochondrial DNA, Early Online: 1–5

! 2013 Informa UK Ltd. DOI: 10.3109/19401736.2013.809452

SHORT COMMUNICATION

Phylogenetic analysis of Pomacea canaliculata isolates collected from

rice fields in different origins of China by combined mitochondrial
12S and 16S genes
Xiao-Yan Li*, Qing-Qing Bian*, Guang-Hui Zhao

Northwest A&F University, Yangling, Shaanxi Province 712100, People’s Republic of China
Mitochondrial DNA Downloaded from informahealthcare.com by University of Alabama on 07/30/13

Abstract Keywords
To study the genetic relationships of Pomacea canaliculata collected from rice fields in China, Mitochondrial DNA, phylogenetic analysis,
the mitochondrial (mt) 12S and 16S of 9 P. canaliculata isolates from 5 southern provinces in Pomacea canaliculata, sequence variations
China were sequenced and analyzed. The intra-specific sequence variations of P. canaliculata
were 0–1.1% for 12S and 0–0.6% for 16S, while the inter-specific variations among common History
Pomacea species in mt 12S and 16S were 3.0–11.7% and 2.3–10.1%, respectively. Phylogenetic
analysis based on combined sequences of mt 12S and 16S revealed complex genetic structure Received 3 May 2013
of P. canaliculata in China. Two phylogenetic groups of P. canaliculata were indicated in China Revised 6 May 2013
with one group sistered to P. canaliculata isolates from USA, and two groups were even found Accepted 21 May 2013
in the same province. The phylogenetic relationships of Pomacea spp. also could be effectively Published online 18 July 2013
inferred by combined sequences of mt 12S and 16S. These findings provided basic information
For personal use only.

for further study of population genetics and diffusion pattern of P. canaliculata in China as well
as in the world.

Introduction Pomacea (Rollinson et al., 1986). In last decades, various

DNA-based techniques provided alternative approach to study
Rice, feeding half of the world’s population, has significant
population genetics and genetic diversity of organisms (Carlsgart
implication in the food security in the world and the sustainable
et al., 2009; Huang et al., 2012).
development of society (Tang et al., 2011). The factors, such as
Due to maternal inheritance, rapid evolutionary rate and
breed, climate, plant diseases and insect pests largely affected the
general lack of recombination, as well as the availability of
rice yields (Shi, 1995; Tang et al., 2011). Pomacea canaliculata,
universal primers (Gasser et al., 2008; Le et al., 2002), the
also know as golden apple snail, is an important constraint to rice
mitochondrial DNA (mtDNA) has been widely used as a useful
yields (Halwart, 1994; Teo, 2006), causing massive economic
marker to investigate population genetic structures, systematics
losses to rice production (Cowie, 2002; Jørgensen et al., 2008). It is
and phylogenetics of organisms (Le et al., 2000, 2002; Zhao et al.,
documented that in experimental studies, one snail per m2 can
2009). For example, the mitochondrial cytochrome c oxidase 1
reduce rice crops stand by 20%, and eight snails can reduce it by
(cox1) has been used to differentiate P. canaliculata and P.
over 90% (Cowie, 2002; Schnorbach, 1995). Furthermore,
insularm (Keiichiro et al., 2008). The phylogenetic analyses were
P. canaliculata were defined to be the major intermediate host of
also carried out based on combined mitochondrial 12S–16S and
Angiostrongylus cantonensis and rat lungworm, causing eosino-
philic meningitis of human in China (Lv et al., 2008, 2009). In
cox1, to clarify the identities, origins, and distributions of 13
20
Pomacea species within the continental U.S. (Rawlings et al.,
addition, as an invasive species, P. canaliculata also threats the
2007). The objectives of the present study were to examine
wetland ecosystems and agriculture (Carlsson & Lacoursie‘re,
sequence variability in mt 12S and 16S among P. canaliculata
2005; Rawlings et al., 2007). Given that the high prevalence and
isolates collected from rice fields in different geographical origins
serious damage of P. canaliculata, it is urgently needed to find
in southern China, and to infer phylogenetic structure of these
integrated control strategies to prevent its diffusion.
P. canaliculata isolates in China.
The accurate characterization at different taxonomic levels has
important implications for control of Pomacea. Traditional
Materials and methods
taxonomy of the genus Pomacea, which mainly based on shell,
egg mass, and soft tissue morphology (Cowie et al., 2006; Parasites and isolation of genomic DNA
Thiengo et al., 1993), can not revealed intra-specific variation and
Between April 2010 and December 2012, nine P. canaliculata
inter-specific difference of closely related species (Keiichiro
samples were collected from rice fields in 5 geographic regions of
et al., 2008), enhancing the difficulty of prevention and control of
China. Sample codes, geographical origins and GenBankÔ
accession numbers are listed in Table 1. After identification of
*X.Y. Li and Q.Q. Bian contributed equally to this work. species based on morphological traits (Rawlings et al., 2007) and
Correspondence: X.Y. Li, Northwest A&F University, Yangling, Shaanxi
the sequences of cox1 (Keiichiro et al., 2008; Rawlings et al.,
Province 712100, People’s Republic of China. Tel/Fax: +86 29 2007), the collected samples were washed with physiological
87081762. E-mail: xiaoyanli@nwsuaf.edu.cn saline, fixed in 70% ethanol, and extracted genomic DNA (gDNA)
 2 X.-Y. Li et al. Mitochondrial DNA, Early Online: 1–5

Table 1. Geographical origins of Pomacea samples used in the present study, as well as their GenBankÔ accession numbers for portions of
mitochondrial 12S and 16S genes.

GenBankÔ accession number

Species/Sample code Geographical origin 12S 16S Reference
P. canaliculata/PCG1 Guangdong, China KF002490 KF002499 The present study
P. canaliculata/PCG2 Guangdong, China KF002491 KF002500 The present study
P. canaliculata/PCG3 Guangdong, China KF002492 KF002501 The present study
P. canaliculata/PCT Taiwan, China KF002493 KF002502 The present study
P. canaliculata/PCH1 Hainan, China KF002494 KF002503 The present study
P. canaliculata/PCH2 Hainan, China KF002495 KF002504 The present study
P. canaliculata/PCH3 Hainan, China KF002496 KF002505 The present study
P. canaliculata/PCY Yunnan, China KF002497 KF002506 The present study
P. canaliculata/PCGX Guangxi, China KF002498 KF002507 The present study
P. canaliculata/PC1 California, USA EF519134 EF519134 Rawlings et al., 2007
P. canaliculata/PC2 California, USA EF519132 EF519132 Rawlings et al., 2007
P. insularum/PI1 Bonito, Brazil EF519129 EF519129 Rawlings et al., 2007
P. insularum/PI2 Careiro da Varzea, Brizal EF519118 EF519118 Rawlings et al., 2007
P. paludosa/PP1 Florida, USA EF519159 EF519159 Rawlings et al., 2007
Mitochondrial DNA Downloaded from informahealthcare.com by University of Alabama on 07/30/13

P. paludosa/PP2 Florida, USA EF519157 EF519157 Rawlings et al., 2007

P. diffusa/PD1 Careiro da Varzea, Brizal EF519156 EF519156 Rawlings et al., 2007
P. diffusa/PD2 Florida, USA EF519146 EF519146 Rawlings et al., 2007
P. haustrum/PH1 Florida, USA EF519142 EF519142 Rawlings et al., 2007
P. haustrum/PH1 Florida, USA EF519143 EF519143 Rawlings et al., 2007

Table 2. Sequences of primers used to amplify portions of mitochondrial

12S and 16S genes of Pomacea canaliculata isolates in different origins The genetic variations (D) between P. canaliculata individuals
in China. were determined using the formula D ¼ 1  (M/L), where M is the
number of alignment position at which the two sequences have a
Name Annealing base in common, and L is the total number of alignment positions
For personal use only.

of primer Sequence (50 –30 ) temperature ( C)
For 12S
12SF TTAAAACTYAAAGGRCWTGGCGG 48
12SR TTACTTTYAAGTCCWCCTTC 48
For 16S
16S1 CGCCTGTTTATCAAAAACAT 52
16S2 CTCCGGTTTGAACTCAGATC 52
using spin column purification (WizardÕ SV Genomic DNA
Purification System, Promega, Madison, WI) according to the
manufacturer’s recommendations.
Enzymatic amplification and sequencing
Portions of 12S (p12S) and 16S (p16S) were amplified from each
gDNA sample with primers listed in Table 2, which were reported
previously by Colgan et al. (2007) for p12S and Rawlings et al.
(2007) for p16S. PCR reactions (25 ml) were applied using
reaction system containing 3 mM of MgCl2, 2.5 mM of each
primer, 0.2 mM of each dNTPs, 1.25 U of ExTaq DNA
polymerase (Takara), and 1 ml of each gDNA template. PCR
reactions were validated and performed using the following
protocol: 94  C for 5 min (initial denaturation), followed by 35
cycles of 94  C for 45 s (denaturation), 48  C (for p12S) or 52  C
(for p16S) for 30 s (annealing), 72  C for 1 min(extension), and
then 72  C for 10 min (final extension). Samples without gDNA as
negative control were also included. Each amplicon (4 ml) was
examined on agarose gel (1%). Positive amplicons were sent to
Sangon Company (Shanghai, China) for sequencing.
Sequence analysis and re-construction of phylogenetic
relationships
Portions of 12S and 16S rRNA were separately aligned using the
computer program Clustal X 1.83 (Thompson et al., 1997) and the
ambiguous bases at both ends of these sequences were discarded.
over which the two sequences are compared (Chilton et al., 1995).
The inter-species genetic differences among Pomacea spp. (Table 1)
were evaluated using Megalign procedure in DNASTAR 5.0
(Burland, 2000). In addition, base composition, transition and
transversion were calculated by Mega 4.0 (Tamura et al., 2007).
To determine the phylogenetic relationships of P. canaliculata
in the present study, the phylogenetic trees were re-constructed
based on the combined sequence of mt 12S and 16S, with Marisa
planogyra (EF519165) as the outgroup. Ambiguously aligned
regions were excluded using Gblocks online server (http://
molevol.cmima.csic.es/castresana/Gblocks_server.html). The
remaining sequences were aligned and used for phylogenetic
analyses using the maximum parsimony (MP) and maximum
likelihood (ML) methods. The MP analyses were carried out
using PAUP 4.0 Beta 10 program (Swofford, 2002), in which
bootstrap value was calculated from 1000 bootstrap replicates.
The ML analyses was performed using PhyML 3.0 (Guindon &
Gascuel, 2003), and the GTR model with its parameters for the
concatenated dataset. The bootstrap values for ML trees were
calculated using 1000 bootstrap replicates. Phylograms were
drawn using the Tree View program version 1.65 (Page, 1996).
Results and discussion
Genomic DNA samples were extracted from 9 P. canaliculata
isolates from 5 different provinces in China. Amplicons of 12S
and16S were amplified individually and appeared as single band
in agarose gel electrophoresis, with approximately 300 bp (p12S)
and 500 bp (p16S), respectively. No size variation was observed
on agarose gel for each amplicon examined (not shown).
Sequence variations in the p12S and p16S regions among 9
P. canaliculata isolates were examined after direct sequencing. The
AT contents were 67.29–68.42% and 67.84–68.60% in p12S and
p16S, respectively. The intra-specific variations in p12S and p16S
were 0–1.1% and 0–0.4% for samples from Guangdong and Hainan
province. The differences in p12S and p16S were 0.8–1.9% and 0–
0.4% between isolates from China and USA, respectively (Table 3).
 DOI: 10.3109/19401736.2013.809452 Phylogenetic analysis of Pomacea canaliculata collected from rice fields 3
Among all samples from 5 provinces in China, the genetic members of Pomacea species available in GenBank were 3.0–
variations in p12S and p16S were 0–1.1% and 0–0.6%, respectively. 11.7% in p12S and 2.3–10.1% in p16S (Table 3).
Intra-specific nucleotide variations represented transitions (A $ G, or To further infer the genetic relationships of P. canaliculata
C $ T, n ¼ 3 for p12S, n ¼ 2 for p16S), transversions (T $ G, n ¼ 0 isolates collected from rice fields in China, the combined
for p12S, n ¼ 1 for p16S) and base deletions (n ¼ 0 for p12S and n ¼ 3 sequences of p12S and p16S with total length of 779 bp were
for p16S). And, the inter-species sequence differences among used for the phylogenetic analyses. Topologies of trees, recon-

Table 3. Pairwise comparison of sequence differences (%) in portions of mitochondrial 12S (above the diagonal) and 16S (below the diagonal) among
Pomacea species.

PCG1 PCG2 PCG3 PCT PCH1 PCH2 PCH3 PCY PCGX PC1 PC2 PI1 PI2 PP1 PP2 PD1 PD2 PH1 PH2
PCG1 – 1.1 1.1 0 1.1 1.1 0 0 1.1 0.8 0.8 3.4 3.4 11 10.6 11.3 11.3 11.7 11.7
PCG2 0.4 – 0 1.1 0 0 1.1 1.1 0 1.9 1.9 3.0 3.0 9.8 9.8 11.3 11.3 10.5 10.5
PCG3 0.4 0 – 1.1 0 0 1.1 1.1 0 1.9 1.9 3.0 3.0 9.8 9.8 11.3 11.3 10.5 10.5
PCT 0 0.4 – 1.1 1.1 0 0 1.1 0.8 0.8 3.4 3.4 11 10.6 11.3 11.3 11.7 11.7
PCH1 0.4 0 0 0.4 – 0 1.1 1.1 0 1.9 1.9 3.0 3.0 9.8 9.8 11.3 11.3 10.5 10.5
PCH2 0.4 0 0 0.4 0 – 1.1 1.1 0 1.9 1.9 3.0 3.0 9.8 9.8 11.3 11.3 10.5 10.5
PCH3 0 0.4 0.4 0 0.4 0.4 – 0 1.1 0.8 0.8 3.4 3.4 11 10.6 11.3 11.3 11.7 11.7
Mitochondrial DNA Downloaded from informahealthcare.com by University of Alabama on 07/30/13

PCY 0.2 0.6 0.6 0.2 0.6 0.6 0.2 – 1.1 0.8 0.8 3.4 3.4 11 10.6 11.3 11.3 11.7 11.7
PCGX 0.4 0 0 0.4 0 0 0.4 0.6 – 1.9 1.9 3.0 3.0 9.8 9.8 11.3 11.3 10.5 10.5
PC1 0 0.4 0.4 0 0.4 0.4 0 0.2 0.4 – 0 2.6 2.6 9.8 9.8 10.6 10.6 10.9 10.9
PC2 0 0.4 0.4 0 0.4 0.4 0 0.2 0.4 0 – 2.6 2.6 9.5 9.5 9.8 9.8 10.5 10.5
PI1 2.7 2.3 2.3 2.7 2.3 2.3 2.7 2.9 2.3 2.7 2.7 – 1.5 10.2 10.2 12.5 12.5 12.0 12.0
PI2 2.9 2.5 2.5 2.9 2.5 2.5 2.9 3.1 2.5 2.9 2.9 1.4 – 10.2 10.2 10.9 10.9 11.3 11.3
PP1 5.7 5.1 5.1 5.7 5.1 5.1 5.7 5.9 5.1 5.7 5.7 6.1 6.2 – 0 14.8 14.8 12.9 12.9
PP2 5.7 5.1 5.1 5.7 5.1 5.1 5.7 5.9 5.1 5.7 5.7 6.1 6.3 0 – 14.8 14.8 12.9 12.9
PD1 9.2 9.7 9.7 9.3 9.7 9.7 9.2 9.4 9.7 9.3 9.2 9.6 9.4 9.8 9.6 – 0 9.1 9.1
PD2 9.4 9.5 9.5 9.5 9.5 9.5 9.4 9.6 9.5 9.5 9.4 9.7 9.6 10.4 10.2 0.2 – 9.1 9.1
PH1 9.6 9.3 9.3 10.1 9.3 9.3 9.6 9.7 9.3 10.1 9.6 9.9 9.9 10.0 10.2 8.2 8.5 – 0
PH2 9.6 9.3 9.3 10.1 9.3 9.3 9.6 9.7 9.3 10.1 9.6 9.9 9.9 10.0 10.2 8.2 8.5 0 –
For personal use only.

Figure 1. Phylogenetic relationships of Pomacea canaliculata samples from different province in China, with other Pomacea spp. inferred by
maximum parsimony (MP), using the combined dataset (12S þ 16S), with Marisa planogyra as the outgroup. Bootstrap values (in percentage) above
50% are shown for maximum parsimony (the first value) and maximum likelihood analyses (the second value). Weak refers to nodes recovered in the
optimal parsimony or likelihood tree, but not found (550%) in the bootstrap majority-rule consensus tree.
 4 X.-Y. Li et al.
structed using different methods or strategies, were identical or
similar, with only small differences of bootstrap values (Figure 1).
There are two main clades in the phylogenetic trees: P. diffusa and
P. haustrum grouped in one clade (clade I), and other Pomacea
species located in another clade (clade II). Within clade II, all
P. canaliculata samples clustered together sistered to clade of
P. insularm. In addition, the complex genetic structure was found
for P. canaliculata isolates in China. Two phylogenetic groups of
P. canaliculata were indicated in China with one group sistered to
P. canaliculata isolates from USA, and two groups were found
even in same province.
P. canaliculata can nibble up various agricultural crops,
especially young rice shoots, and cause large amount loss of
crops (Cowie, 2002; Strong et al., 2008). Since introduced for
commercial production in 1981 (Mochida, 1991; Teo, 2006),
P. canaliculata rapidly invaded a large number of provinces,
such as Guangdong, Guangxi, Fujian and Hainan province (Song
et al., 2010), making these regions as epidemic focuses for
Mitochondrial DNA Downloaded from informahealthcare.com by University of Alabama on 07/30/13
A. cantonensis. It is reported that the angiostrongyliosis of
human was mainly resulted from eating half-cooked P.
canaliculata infected with the third stage of A. cantonensis. P.
canaliculata, as the major intermediate hosts of A. cantonensis,
directly affect the epidemic range and propagation speed of A.
cantonensis (Lv et al., 2009; Wang et al., 2008). Over the past
40 years, attributed to the geographic isolation and diffusion to
new environment, P. canaliculata from different regions have
formed a certain population structure and genetic diversity
(Martin et al., 2005; Toe, 2006). Therefore, it has great
significance for the prevention and control of A. cantonensis
to study the population structure and diffusion pattern of P.
For personal use only.
canaliculata, and especially to reveal the biodiversity, population
structure and genetic evolution by molecular methods. In the
present study, the genetic variability of P. canaliculata samples
collected from rice fields in China was revealed by mt 12S and
16S sequences. The genetic variation was higher in p12S than
that in p16S. The combined sequences of p12S and p16S were
useful for reconstruction of phylogenetic relationships of
Pomacea spp. These findings provided basic information for
further study of population genetics and diffusion pattern of
P. canaliculata in China as well as in the world.
Declaration of interest
This work was supported in part by grants from the Funds of Basic
Research Program (QN2012003). The authors report no conflicts of
interests. The authors alone are responsible for doing the research and
writing the paper.
References
Burland TG. (2000). DNASTAR’s Lasergene sequence analysis software.
Methods Mol Biol 132:71–91.
Carlsgart J, Roepstorff A, Nejsum P. (2009). Multiplex PCR on single
unembryonated Ascaris (roundworm) eggs. Parasitol Res 104:939–43.
Carlsson NOL, Lacoursie‘re JO. (2005). Herbivory on aquatic vascular
plants by the introduced golden apple snail (Pomacea canaliculata) in
Lao PDR. Biol Invasions 7:233–41.
Chilton NB, Gasser RB, Beveridge I. (1995). Differences in a ribosomal
DNA sequence of morphologically indistinguishable species within
the Hypodontus macropi complex (Nematoda: Strongyloidea). Int J
Parasitol 25:647–51.
Colgan DJ, Ponder WF, Beacham E, Macaranas J. (2007). Molecular
phylogenetics of Caenogastropoda (Gastropoda: Mollusca). Mol
Phylogenet Evol 42:717–37.
Cowie RH. (2002). Apple snails as agricultural pests: Their biology,
impacts and management. In: Barker GM, editor. Molluscs as crop
pests. Wallingford: CAB International. p 145–92.
Cowie RH, Hays KA, Thiengo SC. (2006). What are apple snails?
Confused taxonomy and some preliminary resolution. In: Joshi RC,
Mitochondrial DNA, Early Online: 1–5
Sebastian LS, editors. Global advances in ecology and management of
golden apple snail. Nueva: Philippine Rice Research Institute. p 3–23.
Gasser RB, Bott NJ, Chilton NB, Hunt P, Beveridge I. (2008). Toward
practical, DNA-based diagnostic methods for parasitic nematodes of
livestock – Bionomic and biotechnological implications. Biotechnol
Adv 26:325–34.
Guindon S, Gascuel O. (2003). A simple, fast, and accurate algorithm to
estimate large phylogenies by maximum likelihood. Syst Biol 52:
696–704.
Halwart M. (1994). The golden apple snail (Pomecea canaliculata) in
Asian rice farming systems: Present impact and future threat. Int J Pest
Manage 40:199–206.
Huang SY, Zhao GH, Fu BQ, Xu MJ, Wang CR, Wu SM, Zou FC, Zhu
XQ. (2012). Genomics and molecular genetics of Clonorchis sinensis:
Current status and perspectives. Parasitol Int 61:71–6.
Jørgensen A, Kristensen TK, Madsen H. (2008). A molecular phylogeny
of apple snails (Gastropoda, Caeno-gastropoda, Ampullariidae) with an
emphasis on African species. Zoologica Scripta 37:245–52.
Keiichiro K, Mitsuru O, Kenji K, Takashi W. (2008). Genetic
divergence of the genus Pomacea (Gastropoda: Ampullariidae)
distributed in Japan, and a simple molecular method to distinguish
P. canaliculata and P. insularum. Japanese Society Appl Entomol
Zool 43:535–40.
Le TH, Blair D, McManus DP. (2000). Mitochondrial DNA sequences of
human schistosomes: The current status. Int J Parasitol 30:283–90.
Le TH, Blair D, McManus DP. (2002). Mitochondrial genomes of
parasitic flatworms. Trends Parasitol 18:206–13.
Lv S, Zhang Y, Steinmann P, Zhou XN. (2008). Emerging angiostrongy-
liasis in mainland China. Emerg Infect Dis 14:161–4.
Lv S, Zhang Y, Liu HX, Hu L, Yang K, Steinmann P, Chen Z, et al.
(2009). Invasive snails and an emerging infectious disease: Results
from the first national survey on Angiostrongylus cantonensis in China.
PLoS Negl Trop Dis 3:e368.
Martin PR, Estebenet AL, Burela S. (2005). Factors affecting the
distribution and abundance of the commensal Temnocephala iheringi
(Platyhelminthes: Temnocephalidae) among the southernmost popula-
tions of the apple snail Pomacea canaliculata (Mollusca:
Ampullariidae). Primary Res Paper 545:45–53.
Mochida O. (1991). Spread of freshwater Pomacea snails Pilidae
Mollusca from Argentina to Asia. Micronesica Suppl 3:51–62.
Page RD. (1996). TreeView: An application to display phylogenetic trees
on personal computers. Comput Appl Biosci 12:357–8.
Rawlings TA, Hayes KA, Cowie RH, Collins TM. (2007). The identity,
distribution, and impacts of non-native apple snails in the continental
United States. BMC Evol Biol 7:97.
Rollinson D, Walker TK, Simpson AJ. (1986). The application of
recombinant DNA technology to problems of helminth identification.
Parasitology 92:53–71.
Shi PJ. (1995). The natural disasters, constructions works for disesater
reduction and sustainable development of China. J Nat Res 10:267–78
(in Chinese).
Schnorbach HJ. (1995). The golden apple snail (Pomacea canaliculata
Lamarck), an increasingly important pest in rice, and methods of
control with Bayluscid. Pflanzenschutz-Nachrichten Bayer 48:
313–46.
Song HM, Hu YC, Wang PX, Mou XD, Li XH, Wang XJ, Luo JR. (2010).
Sequencing cytochrome oxidase subunit of mitochondrial DNA and the
taxonomic status of apple snails. Chin J Zool 45:1–7 (in Chinese).
Strong EE, Gargominy O, Ponder WF, Bouchet P. (2008). Global
diversity of gastropods (Gastropoda: Mollusca) in freshwater.
Hydrobiologia 595:149–66.
Swofford DL. (2002). PAUP*: Phylogenetic analysis using parsimony
(and other methods). Sunderland, MA: Sinauer Associates.
Tamura K, Dudley J, Nei M, Kumar S. (2007). MEGA4: Molecular
evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol
Evol 24:1596–9.
Tang L, Cai DH, Pang YF, Xie XJ. (2011). Principal component analysis
of factors in influencing rice yields in Neijiang. J Neijiang Normal
Univ 26:62–6 (in Chinese).
Teo SS. (2006). Evaluation of different species of fish for biological
control of golden apple snail Pomacea canaliculata (Lamarck) in rice.
Crop Prot 25:1104–12.
Thiengo SC, Borda CE, Barros Araujo JL. (1993). On Pomacea
canaliculata (Lamarck, 1882) (Mollusca; Pilidae: Ampullariidae).
Mem Inst Oswaldo Cruz Rio de Janeiro 88:67–71.
 DOI: 10.3109/19401736.2013.809452 Phylogenetic analysis of Pomacea canaliculata collected from rice fields 5
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. cantonsis in Beijing. Zhonghua Liu Xing Bing Xue Za Zhi 29:27–9 (in
(1997). The Clustal X windows interface: Flexible strategies for Chinese).
multiple sequence alignment aided by quality analysis tools. Nucleic Zhao GH, Mo XH, Zou FC, Li J, Weng YB, Lin RQ, Xia CM, Zhu XQ.
Acids Res 25:4876–82. (2009). Genetic variability among Schistosoma japonicum isolates
Wang J, Zheng XY, Yin CH, Guo ZZ, Qi HY, Li XL, Diao ZL, et al. from different endemic regions in China revealed by sequences of three
(2008). Epidemiological analysis on 141 cases of angiostrongyliasis mitochondrial DNA genes. Vet Parasitol 162:67–74.
Mitochondrial DNA Downloaded from informahealthcare.com by University of Alabama on 07/30/13
For personal use only.