Life Sciences 267 (2021) 118988

Contents lists available at ScienceDirect

Life Sciences
journal homepage: www.elsevier.com/locate/lifescie

TXNIP positively regulates the autophagy and apoptosis in the rat müller
cell of diabetic retinopathy
Haocheng Ao , Haichun Li , Xiujuan Zhao , Bingqian Liu , Lin Lu *
State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou 510060, China

A R T I C L E I N F O A B S T R A C T

Keywords: Aims: Diabetic retinopathy (DR) can cause vision loss in patients with diabetes. The present study evaluated the
Diabetic retinopathy expression of thioredoxin interacting protein (TXNIP) and investigated the role of TXNIP in autophagy and
TXNIP apoptosis of DR.
Autophagy
Main methods: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting
Apoptosis
CRISPR/cas9
were used to measure the expression level of the targets. Clustered regularly interspaced short palindromic
repeats/CRISPR-associated 9 (CRISPR/cas9) method was applied for knockout of TXNIP. TdT-mediated dUTP
Nick-End Labeling (TUNEL) assay and flow cytometry were utilized to detect the apoptosis. Cell Counting Kit-8
(CCK-8) assay was used to evaluate the cell viability. EdU assay was carried out to measure the cell proliferation
ability. Retinal immunohistochemistry, retinal frozen section immunofluorescence as well as the electroretino­
gram (ERG) recording were implemented to detect the function of the retina.
Key findings: TXNIP was up-regulated under hyperglycemic condition both in vivo and in vitro. Overexpression of
TXNIP activated the autophagy and apoptosis in the rat müller cell. Knockout of TXNIP reduced the autophagy
and apoptosis in the rat müller cell under high glucose condition. TXNIP positively regulates autophagy via
inhibition of the PI3K/AKT/mTOR signaling pathway. Knockdown of TXNIP improved the visual response to
light stimulus of DR.
Significance: Our study unraveled for the first time that TXNIP positively regulates the autophagy in rat müller
cell under high glucose condition by inhibiting the PI3K/AKT/mTOR signaling pathway, providing a novel
understanding in the pathogenesis of DR and suggesting a potential new therapeutic target of DR.

1. Introduction upregulated protein 1 (VDUP1) [4]. Subsequently, it was identified as a

Diabetic retinopathy (DR) is a microvascular complication of dia­
betes, threatening the vision of working-age and aged population
worldwide, which is preventable [1]. Though various studies have been
reported in exploring the mechanism and treatments of DR, there are
still many unknowns surrounding the disease which calls for further
investigation. DR is a neurovascular disease which damages both the
retinal vessels and neural cells [2]. As the primary neuroglia crossing
from the outer to the inner layer of neuroretina, müller glia provides
nutrition and structural stability, which is vital for the homeostasis of
retina [3]. Impairment of müller cell under hyperglycemic condition can
certainly induce injury to the neuroretina. Therefore, researches in the
relationship between müller glia cell and DR are recommended.
Thioredoxin interacting protein (TXNIP) was first isolated from HL-
60 cells after vitamin D3 treatment and named vitamin D3
kind of protein binding to thioredoxin (TRX) that inhibits the redox
function of TRX [5]. TXNIP was confirmed to play a vital role in the
homeostasis of glucose regulation and lipid metabolism. Overexpression
of TXNIP was noted in various tissues under different diseases, including
diabetes [6]. Previous study showed that TXNIP was overexpressed in
the rat müller glia under hyperglycemia which was related to the
oxidative stress and inflammation [2]. Recent research reported the
activation of TXNIP/NLRP3 axis in diabetic nephropathy to damage the
renal function via inducing inflammation and pyroptosis [7]. Down­
regulation of TXNIP may elicit a potential therapeutic effect on diabetes.
Thielen et al. discovered a small molecule named SRI-37330, inhibiting
the expression of TXNIP and mediating the function of glucagon, could
restore diabetic mice to health [8]. Amin et al. demonstrated that
dimethyl fumarate attenuated the vascular complications in diabetic rat
model by down-regulating the ROS/TXNIP/NLRP3 inflammasome

* Corresponding author.
E-mail address: lulin@gzzoc.com (L. Lu).

https://doi.org/10.1016/j.lfs.2020.118988
Received 22 October 2020; Received in revised form 15 December 2020; Accepted 23 December 2020
Available online 4 January 2021
0024-3205/© 2021 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
H. Ao et al.
signaling axis [9]. However, the role of TXNIP in the pathogenesis of DR
is not entirely understood, which needs further exploration.
Autophagy is a primary physiological process that cells eliminate the
damaged organelles and flawed proteins. It is also regarded as an
important regulator of homeostasis [10]. Although autophagy serves as
an essential cell survival mechanism, it has been identified to cause
programmed cell death under extreme stress [11]. Autophagic flux
represents the dynamic procedure of autophagic activity and serves as a
monitor of autophagy [12]. It can be detected by assessing the changes
in the levels of autophagosome formation after blocking the fusion of
autophagosomes and lysosomes in the autophagosome degradation
process like inactivating lysosome through the inhibitors (e.g., by using
bafilomycin A1 or chloroquine) [13]. Several researches reported that
excessive autophagic flux was induced both in the brains of diabetic
mice and in the high glucose-treated neuronal cells [14,15]. Similarly, it
was found that autophagic flux was promoted in the high glucose-
treated myocardial cells [16]. As for DR, a study showed that auto­
phagy was increased in human retinal capillary pericytes, the role of
which can switch from protective process under mild stress to fatal
program under severe stimulus [17]. Meanwhile, it is well-known that
apoptosis is a basic process leading to programmed cell death. Various
studies have been demonstrated the vital role of apoptosis in the path­
ogenesis of DR [18]. Nonetheless, investigating the interaction between
TXNIP and autophagy as well as apoptosis in the DR is helpful for further
understanding of the pathogenesis.
In this study, we evaluated the expression of TXNIP both in vivo and
in vitro under hyperglycemic condition. Moreover, our study demon­
strated that TXNIP positively regulates the autophagy in the rat müller
cell under high glucose condition by inhibiting the PI3K/AKT/mTOR
signaling pathway.
2. Materials and methods
2.1. Cell culture and treatments
Rat retinal müller cell line (rMC-1) used in this study was purchased
from TONGPAI BIOTECHNOLOGY (Shanghai, China). The rMC-1 was
propagated in DMEM (Hyclone, Logan, UT, USA) containing low con­
centrations of glucose (5.6 mM) with 10% fetal bovine serum (Corning,
New York, USA) and 1% penicillin/streptomycin (HyClone) in 5% CO2
environment cell incubator. High glucose concentration (35 mM)
treatment for 48 h was applied for the establishment of the high glucose
group. Bafilomycin A1 (400 nM) was added into the medium for 4 h to
block the autophagic flux. LY294002 (10 μM) was added into the cell
culture medium for 48 h to inhibit the PI3K signaling pathway. The D-
(+) -Glucose (#G8270), bafilomycin A1 (#19-148) and LY294002
(#L9908) were from Sigma-Aldrich (St. Louis, USA).
The mCherry-GFP-LC3 lentivirus (Ubigene, Guangzhou, China) was
obtained and delivered to rMC-1 for monitoring the autophagic flux
between different groups. Briefly, one day before adding 500 μl/well
culture medium containing 1 × 106 TU/ml lentiviral vector and 5 μg/ml
polybrene, rMC-1s were seeded in 24-well plates at a density of 3 × 104
cells per well and cultured overnight. After 24 h, the medium was
replaced with fresh normal culture medium. To detect the changes of the
levels of the autophagic flux, the transfected rMC-1s from different
groups were seeded onto coverslips and observed with Olympus BX51
fluorescence microscope (Tokyo, Japan). The mCherry signal is red
while the GFP signal is green. When the red channel overlaps with the
green channel, there will be the yellow signal. Besides, the GFP signal
can be quenched under the acidic condition. Therefore, the yellow
puncta refer to autophagosomes and the red puncta refer to autolyso­
somes because of the acidic condition in the lysosome. The number of
the puncta in the cytoplasm of each group was counted manually.
2
Life Sciences 267 (2021) 118988
2.2. Generation of TXNIP overexpressing stable rMC-1 cell line
Lentivirus overexpressing rat gene TXNIP (ID: 117514) and the
lentivirus with negative control scramble were constructed by Vector­
Builder (Website: https://en.vectorbuilder.com/vector/VB900083-604
2ctx.html and https://en.vectorbuilder.com/vector/VB160420-1011m
qh.html) . Then we transfected rMC-1 to establish the TXNIP over­
expressing or control vector cell line. Briefly, one day before adding 1
ml/well culture medium containing 1 × 106 TU/ml lentiviral vector and
5 μg/ml polybrene, rMC-1s were seeded in 6-well plates at a density of 5
× 104 cells per well and cultured overnight. After 24 h incubation, the
culture medium was discarded and changed to fresh culture medium.
After another 24 h culture, the culture medium was replaced with the
medium containing 2 μg/ml puromycin (Sigma–Aldrich, St. Louis, USA)
for stable cell line selection. 3 days after the cell selection, the medium
was changed to fresh culture medium with 0.25 μg/ml puromycin. The
stable rMC-1 cell line was then verified by RT-qPCR and western
blotting.
2.3. CRISPR/cas9 for knockout of TXNIP in rMC-1
Two target sites of rat gene TXNIP (ID: 117514) containing the NGG
protospacer adjacent motif (PAM) were identified as A1:
AAAACGCTTCCATCTCCCGGGGG and A2: TGCGTTCTCTTGCAATCG­
GATGG. CRISPR/cas9 guide RNAs (gRNAs) specific to the two target
sites were designed and synthesized by Cyagen Biotech Company
(Suzhou, China). According to the manufacturer’s instructions, mMES­
SAGE mMACHINE™ T7 ULTRA Transcription Kit (#AMB13455, Invi­
trogen™, USA) was applied to in vitro transcribe Cas9 and
MEGAshortscript™ T7 Transcription Kit (#AM1354, Invitrogen™, USA)
was used to in vitro transcribe gRNAs. The mRNAs collected from in
vitro transcription were integrated into rMC-1 by electroporation with
Gene Pulser Xcell Electroporation Systems (Bio-Rad, CA, USA). Briefly, 5
× 106 rMC-1s were collected and resuspended in 250 μl of Opti-MEM
(Gibco, New York, USA) in a 2 mm gap cuvette on ice. Then 40 μg of
Cas9/gRNAs was loaded in the cuvette and gently mixed with the cells.
The cuvette was transferred to the electroporator with the parameters as
follows: 300 V, 975 μF and 3 pulses. The electroporated rMC-1s were
seeded into 96-well plates by limited dilution with fresh normal culture
medium to obtain single-cell colonies. The single-cell colonies were
passaged and expanded in new 96-well plates once confluent.
The knockout of TXNIP was verified via Sanger sequencing by Cya­
gen Biotech Company (Suzhou, China) until the number of cells is suf­
ficient for detecting the deleted genomic region of TXNIP. Briefly, the
genomic DNA of the electroporated rMC-1s was extracted and amplified
with the TIANcombi DNA Lyse & Det PCR Kit (#KG203, TIANGEN,
Beijing, China), according to the manufacturer’s instructions. The for­
ward primer was 5′ - TACAGGTGAGAACGAGATGGTGA-3′ and the
reverse primer was 5′ -TTGAGTTGGCTGGCTGGGAC-3′ . The conditions
of PCR were as follows: 94 ◦ C for 3 min; 35 cycles of 94 ◦ C for 30 s, 62 ◦ C
for 30 s, and 72 ◦ C for 1 min; and 72 ◦ C for 5 min. Sequencing was then
performed with the PCR amplicon using the BigDye Terminator V3.1
cycle sequencing kit (Applied Biosystem, CA, USA) according to the
sequencing facility’s guidelines. The DNA sequences were analyzed via
SeqMan (DNASTAR, Madison, USA) software. For further verification,
RT-qPCR and western blotting were also carried out to characterize valid
knockout clones.
2.4. Reverse transcription-quantitative polymerase chain reaction (RT-
qPCR)
RNA Purification Kit (#B0004D, EZBioscience, Roseville, USA) was
applied to extract total RNA and Transcriptor First Strand cDNA
H. Ao et al.
Synthesis Kit (# 04379012001, Roche, USA) was utilized for reverse
transcription. LightCycler® 480 SYBR Green I Master (#04707516001,
Roche) was used to perform qPCR on LightCycler® 480 (Roche). The
primer sequences were as follows: TXNIP-F (5′ -3′ ): TACAGGTGA­
GAACGAGATGGTGA; TXNIP-R (5′ -3′ ): TTGAGTTGGCTGGCTGGGAC;
GAPDH-F (5′ -3′ ): AACGACCCCTTCATTGACCTC; GAPDH-R (5′ -3′ ):
CGCCAGTAGACTCCACGACATA. The reaction conditions were listed as
follows: 95 ◦ C for 5 min; 45 cycles of 95 ◦ C for 10 s, 60 ◦ C for 20 s and
72 ◦ C for 20 s. The results of RT-qPCR were normalized to the control via
2-ΔΔCt method and the GAPDH was regarded as the internal control.
2.5. Western blotting
Total protein was isolated by RIPA lysis buffer (#P0013B, Beyotime,
Shanghai, China) and quantified with a BCA protein assay kit (#P0009,
Beyotime, Shanghai, China) following the manufacturer’s illustrations.
Briefly, 30 μg of protein samples from different groups were used for
SDS-PAGE and thereafter transferred to PVDF membranes (Millipore,
Bedford, USA). The membranes were blocked with 5% bovine serum
albumin (BSA) solution for 2 h at room temperature and incubated
overnight at 4 ◦ C with primary antibodies. Primary antibodies against
TXNIP (#14715, 1:1000), LC3B (#3868, 1:1000), GAPDH
(#5174,1:1000), β-actin (#4970, 1:1000), SQSTM1/p62 (#23214,
1:1000), Beclin-1 (#3495, 1:1000), Atg12-Atg5 (#4180, 1:1000), Bax
(#14796, 1:1000), Cleaved Caspase-3 (#9664, 1:1000), Phospho-mTOR
(#5536, 1:1000), Phospho-Akt (#4060, 1:2000) were from Cell
Signaling Technology (Massachusetts, USA). The anti-Bcl-2
(#ab194583, 1:1000) was purchased from Abcam (Cambridge, En­
gland). The anti-Phospho-PI3K (#AP0152, 1:1000) was from Bioworld
(Bloomington, USA). After washing with TBST solution for 3 times, the
membranes were incubated with HRP-linked antibody at room tem­
perature for 1 h. The anti-rabbit IgG (HRP-linked Antibody, #7074,
1:3000) was from Cell Signaling Technology. Then the membranes were
washed with TBST solution for 3 times and incubated with ECL HRP
substrate (#K-12045-D50, advansta, CA, USA) for 5 min. ChemiDoc
Imaging Systems (Bio-Rad, CA, USA) and Image Lab software (Bio-Rad)
were applied to analyze the protein level.
2.6. EdU cell proliferation assay
Cell-Light EdU Apollo488 In Vitro Kit (RIBOBIO, Guangzhou, China)
was applied to investigate the cell proliferation between the groups. EdU
solution was added into the cell culture medium and incubated with
cells for 2 h. After cell fixation with 4% paraformaldehyde for 30 min at
room temperature, glycine solution was used to neutralize the excess
aldehyde group. 0.5% TritonX-100 PBS was utilized for 10 min followed
by the reaction solution for 30 min. Hoechst 33342 was applied to mark
the nucleus of the cells. Olympus BX51 fluorescence microscope (Tokyo,
Japan) was applied to observe the fluorescence.
2.7. TdT-mediated dUTP Nick-End Labeling (TUNEL)
One Step TUNEL Apoptosis Assay Kit (#C1088, Beyotime, Shanghai,
China) was applied to detect the apoptosis. Cells were fixed with 4%
paraformaldehyde for 30 min at room temperature followed by 0.3%
TritonX-100 PBS for 5 min. Then TUNEL solution was added in and
incubated for 1 h at 37 ◦ C avoiding illumination. DAPI solution
(#C1005, Beyotime, Shanghai, China) was used to label the cell nucleus.
Olympus BX51 fluorescence microscope (Tokyo, Japan) was applied to
observe the fluorescence.
2.8. Flow cytometry
Annexin V-FITC/PI Apoptosis Detection Kit (#KGA106, KeyGEN
BioTECH, Nanjing, China) was applied to perform flow cytometry.
Briefly, cells from different groups were collected respectively, and
3
Life Sciences 267 (2021) 118988
washed twice with PBS followed by resuspension in binding buffer.
Subsequently, Annexin V-FITC was incubated with the cells for 15 min
avoiding illumination. The mixture was centrifuged for 5 min and the
liquid supernatant was discarded. Then the cells were mixed with
binding buffer and propidium iodide (PI). Flow cytometer (FACS Cal­
ibur, BD Bioscience, USA) and FlowJo software (FlowJo, LLC) were
utilized to analyze the results.
2.9. Cell viability assay
Cell Counting Kit-8 (CCK-8) was purchased from Dojindo (Kyushu
Island, Japan). Briefly, cells from different groups were distributed into
5 × 103 cells/100 μl per well in 96-well plate, pre-culturing for 48 h.
After incubation with 10 μl/well CCK-8 solution for 4 h at 37 ◦ C, the
absorbance of cells was analyzed with VARIOSKAN LUX microplate
reader (Thermo Fisher Scientific Inc., Waltham, MA, USA) at 450mn.
2.10. Diabetic rat model establishment
The animal experiments were approved by the Institutional Animal
Care and Use Committee of State Key Laboratory of Ophthalmology,
Zhongshan Ophthalmic Center, Sun Yat-sen University, the reference
number of which is 2017–027. Male Sprague-Dawley rats with an
average weight of 180 g were recruited for this study and maintained in
the specific pathogen-free animal laboratory of Zhongshan Ophthalmic
Center with the condition of environment temperature (22±2 ◦ C) and
humidity (55 ± 5%). The animals were kept on a 12-h light and dark
cycle and allowed to gain water and food allodially.
Before intraperitoneal injection of 60 mg/kg 2% streptozocin (STZ)
(#S0130, Sigma-Aldrich, St. Louis, USA), the rats were fasted overnight.
The fasting blood glucose of treated rats was measured with a gluc­
ometer (Precision PC, Cambridge, UK) 48 h later, the level of which
above 16.7 mmol/L was considered diabetic. The experimental model
duration was 3 months. After that the rat models were euthanized with
CO2 and the eyeballs of which were collected for further experiments.
The Male Sprague-Dawley rats were randomly divided into 6 groups
with 6 animals in each group as follows: the Normal group, the STZ
treated group, the STZ+sh-NC treated group, the STZ+sh1 treated
group, the STZ+sh2 treated group and the STZ+sh3 treated group.
2.11. Intravitreal injection
For knockdown the expression of TXNIP in rat retinas, 3 parallel
adeno-associated virus (AAV) shRNAs targeting TXNIP and 1 control
vector were constructed by VectorBuilder as follows: sh1 (5′ -CTCAA­
GACAGCCCTATCTTTACTCGAGTAAAGATAGGGCTGTCTTGAG-3′ ,
available at https://en.vectorbuilder.com/vector/VB180528-1020fny.
html); sh2 (5′ -AGTCAGAGGCAATCACATTATCTCGAGA­
TAATGTGATTGCCTCTGACT-3′ , available at https://en.vectorbuilder.
com/vector/VB180528-1021ukh.html); sh3 (5′ -ACATCCTTCAAAGG­
GAAATATCTCGAGATATTTCCCTTTGAAGGATGT-3′ , available at
https://en.vectorbuilder.com/vector/VB180528-1015zqe.html) and sh-
NC (5′ -CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACT­
TAACCTTAGG-3′ , available at https://en.vectorbuilder.com/vector/VB
180117-1020znr.html). 10 days after the diabetic rat model establish­
ment, the diabetic rats were anesthetized by intraperitoneal injection of
ketamine (100 mg/kg) and xylazine (5 mg/kg). 1.5 μl (1×1012 TU/ml)
of AAVs were injected into the vitreous cavity using a 33-gauge injection
syringe (Hamilton, Reno, NV). Briefly, after anesthetizing the diabetic
rats, sodium carboxymethylcellulose was used to lubricate the ocular
surface and tropicamide was applied for pupillary dilation. The intra­
vitreal injection was performed under the stereoscopic microscope (Carl
Zeiss, Germany) using the 33-gauge injection syringe containing 1.5 μl
(1×1012 TU/ml) of AAVs. The position of inserting the injection syringe
was 0.5 mm outside the corneal limbus. The injection syringe should
reach in the vitreous cavity in front of the retina before injecting the
H. Ao et al.
AAVs and avoid injuring the lens. The shRNAs and control vector were
Intravitreally injected another twice at 10 days of interval to maximize
delivery efficiency.
2.12. Retinal immunohistochemistry
After euthanizing the rats with CO2, the eyeballs of which were fixed
in 4% paraformaldehyde for 24 h. After dehydration in ethanol, the
eyeballs were immersed in xylene for 30 min followed by being
embedded in paraffin. The embedding eyeballs were sectioned (5 μm).
And the sections close to the optic nerve (within 200 μm) were obtained
to analyze. The selected sections were then immersed in xylene and
ethanol to remove paraffin and rehydrate. Hydrogen peroxide and
methanol were applied for the inactivation of internal peroxidase. After
washing with distilled water, the sections were immersed in 0. 01 M
sodium citrate buffer (pH 6.0) and heated in a microwave oven for 10
min to repair antigen. Subsequently, before incubating the sections with
primary antibody TXNIP (#ab188865, 1:100, Abcam, Cambridge, En­
gland) overnight, 10% normal goat serum was used to block for 30 min.
The sections were rinsed with PBS and then incubated with biotin-
labeled secondary antibody (#31820, 1:500, Thermo Fisher Scientific)
for 30 min at 37 ◦ C and horseradish peroxidase-conjugated SP complex
(#SE068, 1:100, Solarbio, Beijing, China) for 30 min at room temper­
ature. Thereafter diaminobenzidine (DAB) (Solarbio) was used for
coloration and hematoxylin was applied for the counterstain of the
sections. Olympus BX51 microscope (Tokyo, Japan) was applied to
observe the images.
2.13. Retinal frozen section immunofluorescence
After euthanizing the rats, the eyeballs were fixed with 4% para­
formaldehyde for 1 h and then dehydrated with sucrose solution. Sub­
sequently, the eyeballs were embedded in optimal cutting temperature
(O.C.T) medium (Sakura Tissue Tek, West Chester, PA) overnight at
− 80 ◦ C. The Leica CM1860 slicer (Leica Microsystems, Germany) was
applied to prepare the retinal frozen sections (6 μm). The sections close
to the optic nerve (within 200 μm) were obtained to analyze. 0.5%
Triton X-100 was used to enhance the permeability for 15 min and 10%
normal goat serum was used to block for 30 min. Primary antibodies
were incubated with the sections at 4 ◦ C overnight followed by sec­
ondary antibodies for 1 h at room temperature avoiding illumination.
Primary antibody against LC3B (#3868, 1: 200) was from Cell Signaling
Technology. The anti-Glutamine Synthetase (#ab64613, 1:100) was
from Abcam. The secondary antibodies rabbit IgG (H+L) (#4413, Alexa
Fluor® 555 Conjugate, 1:1000) and mouse IgG (H+L) (#4408, Alexa
Fluor® 488 Conjugate, 1:1000) were from Cell Signaling Technology.
DAPI was used to label the cell nucleus. Olympus BX51 microscope
(Tokyo, Japan) was applied to observe the images.
2.14. Electroretinogram (ERG) recording
Electroretinogram revealing the visual function of the retina was
recorded using Electroretinography Technology (Roland consult®
RETIanimal ERG, Germany). Briefly, the rats were kept in the dark
overnight before the ERG test started under dim red light. The rats were
anesthetized by intraperitoneal injection of ketamine (100 mg/kg) and
xylazine (5 mg/kg) followed by eye dropping tropicamide for pupillary
dilation and hypromellose for eye lubrication. Then the loop electrode
was placed on the cornea and the needle electrode was fixed under the
skin of the cheek, while the ground electrode was fixed under the skin
near the tail. Subsequently, the rat was placed in the center of illumi­
nating sphere. Scotopic 0.01, 3.0, 10.0 ERG and Scotopic 3.0 oscillatory
potentials ERG were recorded. The amplitude of a-wave was noted from
the base line to the negative bottom and the amplitude of b-wave was
recorded from the bottom of the a-wave to the peak of the b-wave.
Oscillatory potentials (OPs) are four wavelets in the rising phase of b-
4
Life Sciences 267 (2021) 118988
wave, and the second wave of OPs (OP2) was recorded for analysis.
2.15. Statistical analysis
The Shapiro-Wilk test method was used to perform the normality test
of the results in our study with the Graphpad Prism software (San Diego,
USA). When the P value of each group was greater than 0.10, it was
considered that the data passed normality test. Then the results were
analyzed via student’s t-test or one-way ANOVA method and were
shown as mean ± standard deviation (SD) of at least 3 independent
experiments. If the data did not pass normality test, the Mann-Whitney
test or Kruskal-Wallis test method was applied to calculate the differ­
ences between the groups. And the results were shown as median ±
interquartile range (IQR) of at least 3 independent experiments. A P
value less than 0.05 suggested statistical significance.
3. Results
3.1. TXNIP was overexpressed both in vivo and in vitro with diabetes
To establish type 1 diabetic rat model, intraperitoneal injection of
streptozocin was applied. Weight measurement was carried out after 3
months of diabetes and the weight of diabetic rats was much lower than
that of normal control rats (average weight: 294.3 g to 431.7 g)
(Fig. 1A). Besides, the blood glucose level of diabetic rats was much
higher than that of control group (average blood glucose: 24.9 mmol/l to
4.7 mmol/l) (Fig. 1B). For further investigation of TXNIP expression
level, RT-qPCR and western blotting were implemented. We identified
that the expression of TXNIP mRNA and protein level were increased in
the retinas of diabetic rats (Fig. 1C, E). In addition, we exposed the rMC-
1 to high glucose condition (35 mmol/l) and the results showed that the
expression of TXNIP was up-regulated in rMC-1 under high glucose
condition both at mRNA (Fig. 1D) and protein levels (Fig. 1F).
3.2. Overexpression of TXNIP enhanced the autophagy and apoptosis in
rMC-1
To confirm the role of TXNIP in rMC-1, we designed a lentivirus
overexpressing rat gene Txnip (Fig. 2A). RT-qPCR revealed that TXNIP
mRNA level of the overexpression group was significantly higher than
that of the control vector group (Fig. 2B). In addition, western blotting
showed similar increased expression of TXNIP protein level in over­
expression group (Fig. 2C). To evaluate the autophagic flux in rMC-1
under TXNIP overexpressing condition, bafilomycin A1 was applied
for blocking autophagic flux. As shown in Fig. 2D, the LC3B-II protein
level of TXNIP overexpression group significantly increased with bafi­
lomycin A1, which meant that autophagic flux was enhanced. Besides,
the expression of autophagy marker p62 declined while Beclin-1 and
Atg12-Atg5 compound increased in the overexpression group. Further­
more, we found that the Bcl-2 protein level decreased while Bax and
Cleaved Caspase-3 rose in TXNIP overexpression group (Fig. 2E), which
suggested that overexpressing TXNIP upregulated apoptosis.
3.3. Knockout of TXNIP downregulated the autophagy and apoptosis in
rMC-1
We next applied CRISPR/Cas9 method for knockout of the rat TXNIP
gene. As shown in Fig. 3A, a brief diagram illustrated that two gRNAs
were designed to target the wildtype gene NGG PAM. Sanger sequencing
was performed after gene knockout, which showed that 3747 bp was
deleted from the coding sequence of TXNIP (Fig. 3B). In addition, RT-
qPCR and western blotting suggested that the expression of TXNIP
significantly decreased in the TXNIP knockout (TKO) group (Fig. 3C, D).
Bafilomycin A1 was applied for studying the autophagic flux in rMC-1.
The LC3B-II protein level in the high glucose (HG) group was
increased with bafilomycin A1 while the HG+TKO group showed no
H. Ao et al. Life Sciences 267 (2021) 118988

Fig. 1. TXNIP was overexpressed both in vivo and in vitro with diabetes. (A) The weight of normal and STZ treatment rats 3 months after diabetic model estab­
lishment. (B) The blood glucose level of normal and STZ treatment rats 3 months after diabetic model establishment. (C) RT-qPCR was performed to test the TXNIP
mRNA level of normal and STZ treatment groups. (D) RT-qPCR was carried out to study the TXNIP mRNA level of NG and HG treatment rMC-1 groups. (E) Western
blotting was utilized to explore the TXNIP protein level of normal and STZ treatment groups. (F) Western blotting was utilized to explore the protein level of NG and
HG treatment rMC-1 groups. NG referred to normal glucose group and HG referred to high glucose group. All data were shown as mean ± SD from at least 3 in­
dependent repeated experiments. *P<0. 05; **P<0. 01.

difference with bafilomycin A1 (Fig. 3E). Besides, the autophagy marker
p62 reduced while Beclin-1 and Atg12-Atg5 compound rose in the HG
group. Furthermore, the Bcl-2 protein level decreased while Bax and
Cleaved Caspase-3 increased in the HG group. However, the HG+TKO
group showed opposite results (Fig. 3F). EdU assay was carried out to
explore cell proliferation between the groups. The HG group showed
decreased EdU positive rate compared to the NG group, while HG+TKO
group displayed increased positive rate (Fig. 4A). Moreover, TUNEL
assay and flow cytometry assay revealed a high apoptotic rate in the HG
group, which was reduced by TKO (Fig. 4B, C). CCK-8 assay demon­
strated that the high glucose condition impaired the cell viability while
knockout of TXNIP reversed the effect caused by HG (Fig. 4D). The
above results demonstrated that knockout of TXNIP downregulated the
autophagy and apoptosis enhanced by high glucose condition. Besides,
knockout of TXNIP rose the cell proliferation and cell viability under
HG.
3.4. TXNIP regulated autophagy via the PI3K/AKT/mTOR signaling
pathway
To investigate the mechanism between TNXIP and autophagy,
LY294002 (PI3K pathway inhibitor) was applied. As shown in Fig. 5A,
LY294002 led to the reduction of p62 and the accumulation of Atg12-
Atg5 compound in HG+TKO+LY group compared to HG+TKO group.
Furthermore, phosphorylated PI3K, AKT and mTOR were reduced in the
HG group compared with NG group, while knockout of TXNIP reversed

5
H. Ao et al. Life Sciences 267 (2021) 118988
6
H. Ao et al.
Fig. 2. Overexpression of TXNIP up-regulated the autophagic flux and apoptosis in rMC-1. (A) The schematic diagram of the construction of TXNIP overexpression
lentivirus. (B) RT-qPCR results of the TXNIP mRNA level of control, overexpression and vector groups. (C) Western blotting results of the TXNIP protein level in
control, overexpression and vector groups. (D) Western blotting results of the LC3B protein level in control, overexpression and vector groups. Bafilomycin A1
(400nM) was added into the three groups for 4 h before extracting protein. (E) Western blotting results of the p62, Beclin-1, Atg12-Atg5, Bcl-2, Bax, and Cleaved
Caspase-3 protein level of control, overexpression and vector groups. All data were shown as mean ± SD from at least 3 independent repeated experiments. *P<0. 05;
**P<0. 01.
the reduction. After utilizing the LY294002, phosphorylated PI3K, AKT
and mTOR were decreased in the HG+TKO+LY group in contrast to
HG+TKO group (Fig. 5B). In addition, the mCherry-GFP-LC3 lentivirus
transaction was performed to observe the autophagic flux. The auto­
phagosomes (yellow puncta) and autolysosomes (red puncta) were
increased in the HG group and reduced in the HG+TKO group, which
were upregulated by LY294002 (Fig. 6). The results above demonstrated
that TXNIP enhanced the autophagy partially via inhibiting the activa­
tion of the PI3K/AKT/mTOR signaling pathway.
3.5. TXNIP regulated autophagy and apoptosis in vivo with diabetes
We next explored the role of TXNIP in retinal function of diabetic
rats. Three parallel adeno-associated virus shRNAs targeting TXNIP and
control vector were designed and intravitreally injected into diabetic
rats as the scheme in Fig. 7A showed. RT-qPCR and western blotting
revealed that the AAV-sh3 treatment significantly downregulated the
mRNA and protein level of TXNIP (Fig. 7B, C). And the immunohisto­
chemistry assay also supported the above results (Fig. 7D). We further
investigated the effects of TXNIP expression level blocked by AAV-sh3
treatment on autophagy and apoptosis in STZ-induced diabetic rat ret­
inas. We found that p62 protein level was enhanced and associated with
the downregulation of Beclin-1 protein level in STZ+sh3 group
compared to the STZ+sh-NC group (Fig. 7E), which revealed the auto­
phagy was reduced after knockdown of TNXIP. In addition, the Bcl-2
protein level increased while the Bax protein level declined in
STZ+sh3 group (Fig. 7E), which explained that the apoptosis also
decreased after shRNA treatment. In addition, we performed retinal
frozen section immunofluorescence and found the inner retinal LC3B
fluorescence of STZ+sh3 group was weaker than that of STZ+sh-NC
group (Fig. 7F).
3.6. TXNIP caused retinal dysfunction with diabetes
To investigate the effect of TNXIP on retinal function with diabetes,
we performed electroretinogram, the representative waveforms of
which were shown at Fig. 8. In the scotopic 0.01 ERG, the b-wave
amplitude showed the rod response of the retina. We found that the b-
wave amplitude of STZ group decreased and the treatment of AAV-sh3
alleviated the reduction of b-wave amplitude (Fig. 8A, E). Scotopic 3.0
ERG reveals the standard combined rod-cone response of the retina. The
a-wave amplitude of STZ group reduced while there was no significant
difference between STZ+sh-NC group and STZ+sh3 group. The
decreased b-wave amplitude of STZ group was observed while a
remarkable recovery of b-wave amplitude of STZ+sh3 group was
recorded (Fig. 8B, E). Given that diabetes could lead to cataract or other
eye diseases which can cause refractive interstitial clouding, we applied
scotopic 10.0 ERG to provide an enhanced combined rod-cone response
measurement. The results illustrated that the a-wave amplitude and b-
wave amplitude of STZ group decreased, while the a-wave amplitude
and b-wave amplitude of STZ+sh3 group increased compared to
STZ+sh-NC group (Fig. 8C, E). Oscillatory potentials are four wavelets
in the rising phase of b-wave, which suggest the inner retinal function.
As shown in Fig. 8D & E, the OP2 amplitude of STZ group declined
compared to the normal group. However, the AAV-sh3 treatment
improved the OP2 amplitude of STZ+sh3 group compared with STZ+sh-
NC group.
7
Life Sciences 267 (2021) 118988
4. Discussion
Diabetic retinopathy is a great threat to the vision of the working-age
and aged population with diabetes worldwide. Though substantial
studies aiming at DR were carried out and conventional treatments of
DR were proved effective in attenuating the disease, the DR remained
incurable [19]. Previous studies suggested that TXNIP, suppressing the
anti-oxidant thioredoxin, takes part in the pathogenesis of diabetes
[20,21]. The present research was performed to explore the role of
TXNIP in the pathogenesis of diabetic retinopathy and the potential
novel therapeutic target of DR.
Various studies have demonstrated that TXNIP plays a pivotal role in
glucose metabolism [6]. It was verified that TXNIP was upregulated
both in diabetic retinopathy and in high glucose condition in our study.
A similar phenomenon was reported by Devi et al. that TXNIP was
overexpressed in HG in rat müller cell cytosol and mitochondria [22]. In
addition, Ke R et al. provided evidence that TXNIP was activated in
diabetic nephropathy [7]. Su et al. revealed that TXNIP was increased in
diabetic mice [23] while the enhanced expression of TXNIP in serum
level of type 2 diabetes mellitus patients was reported by Gao et al. [24].
Our study indicated that TXNIP may be considered as a potential
biomarker of DR which is involved in the pathogenesis of DR.
It is well known that dysregulation of autophagy and apoptosis
contributes to the pathogenesis of diabetes. Devi et al. reported that
mitophagy (a kind of macroautophagy specifically eliminating damaged
mitochondria) was induced by high glucose condition [22]. Besides,
Kong et al. revealed that autophagy was enhanced in diabetic mice [25].
Of note, autophagy can cause dual effects in the DR as promoting cell
survival under mild stress while leading to programmed cell death under
serious stimulus [11]. In the procedure of the autophagy, the Atg12-
Atg5-Atg16L and the LC3 complexes are the two essential ubiquitin-
like conjugating systems for phagophore elongation and autophago­
some closure [26]. Beclin-1 is a key factor in promoting the autopha­
gosome formation by combining with the Vps34. The Beclin-1- Vps34
complex can accelerate the extention of lipid membrane, the maturation
of autophagosome and the gather of cellular cargo [27]. P62 is a cargo
receptor which binds the cellular cargo to autophagosome membrane
and eliminated by lysosome. Reduced p62 mainly represents enhanced
autophagy [28]. In the present study, we validated that p62 declined
while Beclin-1 and Atg12-Atg5 complex rose in the HG group, revealing
that autophagy was induced in rMC-1 under high glucose condition.
Apoptosis is a process of programmed cell destruction which has
been defined long time ago. In the procedure of apoptosis, the bcl-2 gene
plays an important role in anti-apoptotic effect. However, the bax gene
that belongs to the bcl-2 family can resist the function of bcl-2 and
thereby induce the apoptosis [29]. Besides, the caspase family is
responsible for activating the degradation activity of apoptosis. The
Caspase-3 can be activated by the Caspase-9 and the Caspase-8 and
finally leads to cellular apoptosis. Detecting the Cleaved Caspase-3 is
widely regarded as a robust hallmark of apoptosis [30]. In our study, the
Bcl-2 protein level was down-regulated while the Bax and Cleaved
Caspase-3 level was enhanced in the HG group, suggesting the induction
of apoptosis in rMC-1 under high glucose condition.
Next we focused on the role of TXNIP in mediating the autophagy
and apoptosis in diabetic retinopathy. We elucidated that over­
expression of TXNIP by lentivirus upregulated the autophagy markers
Beclin-1 and Atg12-Atg5 complex and downregulated the autophagy
receptor p62 in rMC-1. In addition, we observed that in the TXNIP
H. Ao et al. Life Sciences 267 (2021) 118988

Fig. 3. Knockout of TXNIP downregulated the autophagic flux and apoptosis in rMC-1. (A) The brief graph showed the target sites of the gRNAs. (B) The result of
Sanger sequencing of the knockout of TXNIP in rMC-1. The green A referred to adenine, the black G referred to guanine, the blue C referred to cytosine, the red T
referred to thymine. The blue highlighted area referred to the left side of the cleavege site by the CRISPR/cas9 editing. (C) The TXNIP mRNA level of control and
TXNIP knockout groups. (D) Western blotting was applied to test the TXNIP protein level of NG, HG, NG+TKO, HG+TKO groups. (E) Western blotting results of the
LC3B protein level in NG, HG, and HG+TKO groups. (F) The p62, Beclin-1, Atg12-Atg5, Bcl-2, Bax, and Cleaved Caspase-3 protein level in NG, HG, and HG+TKO
groups. NG referred to normal glucose group, HG referred to high glucose group and TKO referred to TXNIP knockout group. All data were presented as mean ± SD
from at least 3 independent repeated experiments. *P<0. 05; **P<0. 01. (For interpretation of the references to colour in this figure legend, the reader is referred to
the web version of this article.)

8
H. Ao et al. Life Sciences 267 (2021) 118988

Fig. 4. Knockout of TXNIP enhanced the cell proliferation and cell viability and inhibited apoptosis in rMC-1. (A) EdU assay was applied to explore the cell pro­
liferation of the NG, HG and HG+TKO groups. Scale bar: 50 μm. (B, C) TUNEL assay and flow cytometry were performed to investigate the apoptosis of NG, HG and
HG+TKO groups. Scale bar: 50 μm. (D) CCK-8 assay was carried out to test the cell viability of NG, HG and HG+TKO groups. NG referred to normal glucose group,
HG referred to high glucose group and TKO referred to TXNIP knockout group. All data were shown as mean ± SD or median ± IQR from at least 3 independent
repeated experiments. *P<0. 05; **P<0. 01.

9
 H. Ao et al.
10

Fig. 5. TXNIP regulated autophagy via the PI3K/AKT/mTOR signaling pathway. (A) Western blotting was applied to test the p62, Beclin-1 and Atg12-Atg5 protein level of NG, HG, HG+TKO, HG+TKO+LY294002
groups. LY294002 (10 μM) was added into the HG+TKO group for 48 h before harvesting the protein. (B) The protein level of p-mTOR, p-PI3K, p-AKT of NG, HG, HG+TKO, HG+TKO+LY294002 groups. NG referred to
normal glucose group, HG referred to high glucose group and TKO referred to TXNIP knockout group. All data were shown as mean ± SD from at least 3 independent repeated experiments. *P<0. 05; **P<0. 01.

Life Sciences 267 (2021) 118988

H. Ao et al.
Fig. 6. TXNIP mediated the quantitative change of autophagosomes and autolysosomes under HG condition. The mCherry-GFP-LC3 lentivirus was transfected into
rMC-1 to investigate the autophagic flux between NG, HG, HG+TKO, HG+TKO+LY294002 groups. Yellow puncta represented autophagosomes and red puncta
represented the autolysosomes. Scale bar: 5 μm. NG referred to normal glucose group, HG referred to high glucose group and TKO referred to TXNIP knockout group.
All data were shown as mean ± SD from at least 3 independent repeated experiments. *P<0. 05; **P<0. 01. (For interpretation of the references to colour in this
figure legend, the reader is referred to the web version of this article.)
overexpression group, the LC3B-II protein level was significantly
increased by applying bafilomycin A1 to block the autophagic flux,
which meant overexpression of TXNIP enhanced the autophagic flux.
Meanwhile, the apoptosis biomarkers Bcl-2 protein level was decreased
while the Bax and Cleaved Caspase-3 level increased after up-regulation
of TXNIP, meaning that the apoptosis also rose. Similarly, Gao et al.
identified that TXNIP aggravated the excessive autophagy, leading to
myocardial ischemia/reperfusion injury [31]. Alvarez et al. reported
that downregulation of TXNIP in human primary chondrocytes leading
to the reduction of autophagy [32]. Besides, it was demonstrated that
overexpression of TXNIP enhanced apoptosis in mixed-lineage leuke­
mia-rearranged acute myeloid leukemia cells [33]. Moreover, several
researches revealed that TXNIP induced apoptosis in pancreatic β-cells
[34,35]. To further investigate the relationship between TXNIP and
autophagy as well as apoptosis in high glucose condition, we utilized the
CRISPR/Cas9 gene editing method to remove rat gene TXNIP in rMC-1.
The data illustrated that the LC3B-II protein level showed no significant
difference after the treatment of bafilomycin A1 in the HG+TKO group,
meaning that knockout of TXNIP inhibits the autophagic flux. Mean­
while, the expression of Beclin-1 and Atg12-Atg5 complex was down­
regulated and the p62 protein level was up-regulated in the HG+TKO
group, suggesting that the autophagy was blocked. Besides, the Bcl-2
protein level rose while the Bax and Cleaved Caspase-3 level declined
after knockout of TXNIP, meaning that the apoptosis was also down­
regulated. Furthermore, the TUNEL assay and flow cytometry were
performed to detect apoptosis in rMC-1, the results of which supported
that knockout of TXNIP reversed the pro-apoptotic effect caused by high
glucose condition. Our EdU assay determined that knockout of TXNIP
enhanced the cell proliferation under high glucose condition. Besides,
the result of CCK-8 assay demonstrated that knockout of TXNIP rescued
the cell viability under high glucose condition. However, some re­
searchers had shown opposite results as knockout of TXNIP enhanced
the autophagy in pancreas islets while overexpression of TXNIP blocked
the autophagic flux [36]. Additionally, it was also reported that TXNIP
inhibited the autophagic flux in Parkinson’s disease [37]. We speculated
that TXNIP plays a two-sided role in the internal environment, which
can reverse the effects on autophagy in different disorders and cells. The
mechanism of how the TXNIP switching its role in autophagy still needs
11
Life Sciences 267 (2021) 118988
further exploration. In brief, our study revealed that TXNIP serves as a
positive regulator of autophagy and apoptosis in rat müller cell,
knockout of which restores the cell proliferation and cell viability under
high glucose condition.
While the role of TXNIP in mediating the autophagy under high
glucose condition was confirmed, the specific mechanism remained
unknown. Previous study displayed that calcium dobesilate can serve as
a therapeutic method by enhancing autophagy via suppressing the
VEGF/PI3K/AKT/mTOR signaling pathway in diabetic kidney disease
[38]. Wang et al. suggested that PI3K/AKT/mTOR signaling deteriorates
diabetic encephalopathy by inhibiting the macrophage autophagy [39].
Tian et al. reported that PI3K/AKT/mTOR signaling pathway was
inhibited by high glucose treatment, resulting in the activation of
autophagy [40]. As having been shown by previous researches that
mTOR serves as a component of downstream effectors of the PI3K/AKT
pathway, which is a pivotal negative regulator of autophagy [41,42]. To
uncover the underlying mechanism of how TXNIP positively mediating
the autophagy, our study hypothesized that the PI3K/AKT/mTOR
signaling pathway was involved in the pathogenesis. Our study evalu­
ated that the protein levels of phosphorylated PI3K, AKT and mTOR
decreased under high glucose condition, while knockout of TXNIP
reversed the effect caused by high glucose condition. An inhibitor of
PI3K protein family, LY294002, was utilized to block the activation of
the PI3K/AKT/mTOR signaling pathway. The result showed that the
protein levels of phosphorylated PI3K, AKT and mTOR declined after
applying LY294002 in HG+TKO+LY294002 group. In addition, the
downregulation of p62 and increased Beclin-1 with Atg12-Atg5 complex
after using LY294002 suggested that autophagy was negatively regu­
lated by PI3K/AKT/mTOR signaling pathway. Furthermore, we applied
The mCherry-GFP-LC3 lentivirus to infect rMC-1 for observing the
autophagic process. The data suggested that the autophagosomes and
autolysosomes were increased in the HG group, representing the acti­
vation of autophagic flux. Knockout of TXNIP reduced the number of
autophagosomes and autolysosomes, while the LY294002 reversed the
reduction of autophagosomes and autolysosomes, meaning that PI3K/
AKT/mTOR signaling pathway partially mediates the autophagy pro­
cess. Therefore, our study validated for the first time that TXNIP posi­
tively regulates the autophagy under high glucose condition by
H. Ao et al. Life Sciences 267 (2021) 118988

Fig. 7. TXNIP regulated autophagy and apoptosis in vivo with diabetes. (A) The brief schematic graph explained the process of diabetic rat model establishment. (B)
RT-qPCR was carried out to study the TXNIP mRNA level of normal, STZ treatment, STZ+sh-NC, STZ+sh1, STZ+sh2 and STZ+sh3 groups. (C) Western blotting was
performed to explore the TXNIP protein level of normal, STZ treatment, STZ+sh-NC, STZ+sh1, STZ+sh2 and STZ+sh3 groups. (D) Immunohistochemistry was
applied to test the expression of TXNIP between STZ, STZ+sh-NC and STZ+sh3 groups. GCL: ganglion cell layer; INL: inner nuclear layer; ONL: outer nuclear layer.
Scale bar: 50 μm. (E) Western blotting results revealed the p62, Beclin-1, Bcl-2, Bax protein level between STZ, STZ+sh-NC and STZ+sh3 groups. (F) Retinal frozen
section immunofluorescence was performed to test the expression of LC3B between STZ, STZ+sh-NC and STZ+sh3 groups. Scale bar: 50 μm. All data were shown as
mean ± SD from at least 3 independent repeated experiments. *P<0. 05; **P<0. 01.

12
H. Ao et al. Life Sciences 267 (2021) 118988

Fig. 8. TXNIP mediated retinal dysfunction with diabetes. (A, E) Scotopic 0.01 ERG and the amplitude statistics of the normal, STZ, STZ+sh-NC and STZ+sh3 groups.
(B, E) Scotopic 3.0 ERG and the a-wave and b-wave amplitude statistics of the normal, STZ, STZ+sh-NC and STZ+sh3 groups. (C, E) Scotopic 10.0 ERG and the a-
wave and b-wave amplitude statistics of the normal, STZ, STZ+sh-NC and STZ+sh3 groups. (D, E) Scotopic 3.0 oscillatory potential ERG and the OP2 amplitude
statistics of the normal, STZ, STZ+sh-NC and STZ+sh3 groups. All data were shown as mean ± SD from at least 3 independent repeated experiments. *P<0. 05;
**P<0. 01.

13
H. Ao et al.
inhibiting the PI3K/AKT/mTOR signaling pathway. However, it is
certain that there are more related pathways connecting the TXNIP to
autophagy, which requires further researches.
To unveil the role of TXNIP in the function of the retina in diabetic
rats, we designed adeno-associated virus to deliver the shRNAs to the
retina by intravitreal injection. As shown in our study, the protein level
of p62 rose while Beclin-1 reduced after knockdown of TXNIP in STZ
induced diabetic rats, and the fluorescence intensity of LC3B in retinas of
TXNIP knockdown group was attenuated, revealing that the autophagy
was downregulated. Meanwhile, the Bcl-2 protein level was enhanced
while the Bax protein level was reduced after knockdown of TXNIP,
suggesting that the apoptosis was also inhibited. Furthermore, scotopic
ERG was performed to evaluate the visual function of the retina. The
amplitude of a, b and OP2 waves in STZ treatment group declined
compared to the normal control group, while knockdown of TXNIP
improved the responses to light stimulation in STZ induced diabetic rats.
Thus, the data demonstrated that knockdown of TXNIP can improve the
visual function of the diabetic rat model.
5. Conclusion
In conclusion, based on the findings of our study, we validated the
overexpression of TXNIP in vivo and in vitro under hyperglycemic
condition, which may serve as a potential biomarker in assessing the
severity of diabetic retinopathy. Our study unraveled for the first time
that TXNIP positively regulates the autophagy in rat müller cell under
high glucose condition by inhibiting the PI3K/AKT/mTOR signaling
pathway. Downregulation of TXNIP leads to the reduction of autophagy
as well as apoptosis, restoring the cell proliferation and cell viability
under high glucose condition, and improves the visual function of dia­
betic rats. This study sheds light on a potential novel therapeutic
approach for DR.
CRediT authorship contribution statement
Haocheng Ao: Conceptualization, Methodology, Software, Investi­
gation, Writing – original draft, Visualization. Haichun Li: Methodol­
ogy, Software, Investigation. Xiujuan Zhao: Validation, Formal
analysis, Data curation. Bingqian Liu: Resources, Software, Formal
analysis, Data curation. Lin Lu: Conceptualization, Writing – review &
editing, Supervision, Project administration, Funding acquisition.
Declaration of competing interest
The authors declare that there are no potential conflicts of interest in
this work.
Acknowledgements
The study was supported by the National Natural Science Foundation
of China (Grant number: 81570862).
References
[1] R. Rodriguez-Acuña, E. Mayoral, M. Aguilar-Diosdado, R. Rave, B. Oyarzabal,
C. Lama, A. Carriazo, M.A. Martinez-Brocca, Andalusian program for early
detection of diabetic retinopathy: implementation and 15-year follow-up of a
population-based screening program in Andalusia, southern Spain, BMJ Open
Diabetes Res. Care 8 (2020), https://doi.org/10.1136/bmjdrc-2020-001622.
[2] T.S. Devi, I. Lee, M. Hüttemann, A. Kumar, K.D. Nantwi, L.P. Singh, TXNIP links
innate host defense mechanisms to oxidative stress and inflammation in retinal
Muller glia under chronic hyperglycemia: implications for diabetic retinopathy,
Exp. Diabetes Res. 2012 (2012), 438238, https://doi.org/10.1155/2012/438238.
[3] J. Zhai, Z. Li, H. Zhang, L. Ma, Z. Ma, Y. Zhang, J. Zou, M. Li, L. Ma, X. Wang, X. Li,
Berberine protects against diabetic retinopathy by inhibiting cell apoptosis via
deactivation of the NF-κB signaling pathway, Mol. Med. Rep. 22 (2020)
4227–4235, https://doi.org/10.3892/mmr.2020.11505.
14
Life Sciences 267 (2021) 118988
[4] K.S. Chen, H.F. DeLuca, Isolation and characterization of a novel cDNA from HL-60
cells treated with 1,25-dihydroxyvitamin D-3, Biochim. Biophys. Acta 1219 (1994)
26–32, https://doi.org/10.1016/0167-4781(94)90242-9.
[5] P.C. Schulze, J. Yoshioka, T. Takahashi, Z. He, G.L. King, R.T. Lee, Hyperglycemia
promotes oxidative stress through inhibition of thioredoxin function by
thioredoxin-interacting protein, J. Biol. Chem. 279 (2004) 30369–30374, https://
doi.org/10.1074/jbc.M400549200.
[6] E. Yoshihara, TXNIP/TBP-2: a master regulator for glucose homeostasis,
Antioxidants (Basel, Switzerland) 9 (2020), https://doi.org/10.3390/
antiox9080765.
[7] R. Ke, Y. Wang, S. Hong, L. Xiao, Endoplasmic reticulum stress related factor IRE1α
regulates TXNIP/NLRP3-mediated pyroptosis in diabetic nephropathy, Exp. Cell
Res. 396 (2020), 112293, https://doi.org/10.1016/j.yexcr.2020.112293.
[8] L.A. Thielen, J. Chen, G. Jing, O. Moukha-Chafiq, G. Xu, S. Jo, T.B. Grayson, B. Lu,
P. Li, C.E. Augelli-Szafran, M.J. Suto, M. Kanke, P. Sethupathy, J.K. Kim, A. Shalev,
Identification of an anti-diabetic, orally available small molecule that regulates
TXNIP expression and glucagon action., Cell Metab.. 32 (2020) 353–365.e8. doi:htt
ps://doi.org/10.1016/j.cmet.2020.07.002.
[9] F.M. Amin, R.R. Abdelaziz, M.F. Hamed, M.A. Nader, G.S.G. Shehatou, Dimethyl
fumarate ameliorates diabetes-associated vascular complications through ROS-
TXNIP-NLRP3 inflammasome pathway, Life Sci. 256 (2020), 117887, https://doi.
org/10.1016/j.lfs.2020.117887.
[10] D. Glick, S. Barth, K.F. Macleod, Autophagy: cellular and molecular mechanisms,
J. Pathol. 221 (2010) 3–12, https://doi.org/10.1002/path.2697.
[11] E. Dehdashtian, S. Mehrzadi, B. Yousefi, A. Hosseinzadeh, R.J. Reiter, M. Safa,
H. Ghaznavi, M. Naseripour, Diabetic retinopathy pathogenesis and the
ameliorating effects of melatonin; involvement of autophagy, inflammation and
oxidative stress, Life Sci. 193 (2018) 20–33, https://doi.org/10.1016/j.
lfs.2017.12.001.
[12] H.J. Zheng, X. Zhang, J. Guo, W. Zhang, S. Ai, F. Zhang, Y. Wang, W.J. Liu,
Lysosomal dysfunction-induced autophagic stress in diabetic kidney disease,
J. Cell. Mol. Med. 24 (2020) 8276–8290, https://doi.org/10.1111/jcmm.15301.
[13] L. Esteban-Martínez, P. Boya, Autophagic flux determination in vivo and ex vivo,
Methods 75 (2015) 79–86, https://doi.org/10.1016/j.ymeth.2015.01.008.
[14] H. Che, H. Li, Y. Li, Y.-Q. Wang, Z.-Y. Yang, R.-L. Wang, L.-H. Wang, Melatonin
exerts neuroprotective effects by inhibiting neuronal pyroptosis and autophagy in
STZ-induced diabetic mice, FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. (2020),
https://doi.org/10.1096/fj.202001328R.
[15] N. Wei, S.-P. Yu, X.-H. Gu, D.-D. Chen, M.K. Whalin, G.-L. Xu, X.-F. Liu, L. Wei, The
involvement of autophagy pathway in exaggerated ischemic brain damage in
diabetic mice, CNS Neurosci. Ther. 19 (2013) 753–763, https://doi.org/10.1111/
cns.12123.
[16] L.-G. Zhao, P.-L. Li, Y. Dai, J.-L. Deng, M.-Y. Shan, B. Chen, K.-B. Zhang, S.-D. Guo,
Z.-H. Xu, Mibefradil alleviates high-glucose-induced cardiac hypertrophy by
inhibiting PI3K/Akt/mTOR-mediated autophagy, J. Cardiovasc. Pharmacol. 76
(2020) 246–254, https://doi.org/10.1097/FJC.0000000000000844.
[17] D. Fu, J.Y. Yu, S. Yang, M. Wu, S.M. Hammad, A.R. Connell, M. Du, J. Chen, T.
J. Lyons, Survival or death: a dual role for autophagy in stress-induced pericyte loss
in diabetic retinopathy, Diabetologia 59 (2016) 2251–2261, https://doi.org/
10.1007/s00125-016-4058-5.
[18] E. Beltramo, M. Porta, Pericyte loss in diabetic retinopathy: mechanisms and
consequences, Curr. Med. Chem. 20 (2013) 3218–3225, https://doi.org/10.2174/
09298673113209990022.
[19] W.M. Amoaku, F. Ghanchi, C. Bailey, S. Banerjee, S. Banerjee, L. Downey, R. Gale,
R. Hamilton, K. Khunti, E. Posner, F. Quhill, S. Robinson, R. Setty, D. Sim, D.
Varma, H. Mehta, Diabetic retinopathy and diabetic macular oedema pathways
and management: UK Consensus Working Group., Eye (Lond). 34 (2020) 1–51. doi:
https://doi.org/10.1038/s41433-020-0961-6.
[20] H. Parikh, E. Carlsson, W.A. Chutkow, L.E. Johansson, H. Storgaard, P. Poulsen, R.
Saxena, C. Ladd, P.C. Schulze, M.J. Mazzini, C.B. Jensen, A. Krook, M. Björnholm,
H. Tornqvist, J.R. Zierath, M. Ridderstråle, D. Altshuler, R.T. Lee, A. Vaag, L.C.
Groop, V.K. Mootha, TXNIP regulates peripheral glucose metabolism in humans.,
PLoS Med.. 4 (2007) e158. doi:https://doi.org/10.1371/journal.pmed.0040158.
[21] Y. Han, X. Xu, C. Tang, P. Gao, X. Chen, X. Xiong, M. Yang, S. Yang, X. Zhu,
S. Yuan, F. Liu, L. Xiao, Y.S. Kanwar, L. Sun, Reactive oxygen species promote
tubular injury in diabetic nephropathy: the role of the mitochondrial ros-txnip-
nlrp3 biological axis, Redox Biol. 16 (2018) 32–46, https://doi.org/10.1016/j.
redox.2018.02.013.
[22] T.S. Devi, M. Somayajulu, R.A. Kowluru, L.P. Singh, TXNIP regulates mitophagy in
retinal Müller cells under high-glucose conditions: implications for diabetic
retinopathy, Cell Death Dis. 8 (2017) e2777, https://doi.org/10.1038/
cddis.2017.190.
[23] C.-J. Su, Z. Shen, R.-X. Cui, Y. Huang, D.-L. Xu, F.-L. Zhao, J. Pan, A.-M. Shi, T. Liu,
Y.-L. Yu, Thioredoxin-interacting protein (TXNIP) regulates Parkin/PINK1-
mediated mitophagy in dopaminergic neurons under high-glucose conditions:
implications for molecular links between Parkinson’s disease and diabetes,
Neurosci. Bull. 36 (2020) 346–358, https://doi.org/10.1007/s12264-019-00459-5.
[24] Y. Gao, S. Chen, M. Peng, Z. Wang, L. Ren, S. Mu, M. Zheng, Correlation between
thioredoxin-interacting protein and nerve conduction velocity in patients with type
2 diabetes mellitus., Front. Neurol. 11 (2020) 733. doi:https://doi.org/10.33
89/fneur.2020.00733.
[25] F.-J. Kong, L.-L. Ma, J.-J. Guo, L.-H. Xu, Y. Li, S. Qu, Endoplasmic reticulum stress/
autophagy pathway is involved in diabetes-induced neuronal apoptosis and
cognitive decline in mice., Clin. Sci. (Lond). 132 (2018) 111–125. doi:https://doi.
org/10.1042/CS20171432.
H. Ao et al.
[26] I. Tanida, Autophagosome formation and molecular mechanism of autophagy,
Antioxid. Redox Signal. 14 (2011) 2201–2214, https://doi.org/10.1089/
ars.2010.3482.
[27] Y. Maejima, M. Isobe, J. Sadoshima, Regulation of autophagy by Beclin 1 in the
heart, J. Mol. Cell. Cardiol. 95 (2016) 19–25, https://doi.org/10.1016/j.
yjmcc.2015.10.032.
[28] A. Danieli, S. Martens, p62-mediated phase separation at the intersection of the
ubiquitin-proteasome system and autophagy, J. Cell Sci. 131 (2018), https://doi.
org/10.1242/jcs.214304.
[29] J.B. Dietrich, Apoptosis and anti-apoptosis genes in the Bcl-2 family, Arch. Physiol.
Biochem. 105 (1997) 125–135, https://doi.org/10.1076/apab.105.2.125.12927.
[30] M. Brentnall, L. Rodriguez-Menocal, R.L. De Guevara, E. Cepero, L.H. Boise,
Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis,
BMC Cell Biol. 14 (2013) 32, https://doi.org/10.1186/1471-2121-14-32.
[31] C. Gao, R. Wang, B. Li, Y. Guo, T. Yin, Y. Xia, F. Zhang, K. Lian, Y. Liu, H. Wang,
L. Zhang, E. Gao, W. Yan, L. Tao, TXNIP/Redd1 signalling and excessive
autophagy: a novel mechanism of myocardial ischaemia/reperfusion injury in
mice, Cardiovasc. Res. 116 (2020) 645–657, https://doi.org/10.1093/cvr/cvz152.
[32] O. Alvarez-Garcia, M. Olmer, R. Akagi, Y. Akasaki, K.M. Fisch, T. Shen, A.I. Su, M.
K. Lotz, Suppression of REDD1 in osteoarthritis cartilage, a novel mechanism for
dysregulated mTOR signaling and defective autophagy, Osteoarthr. Cartil. 24
(2016) 1639–1647, https://doi.org/10.1016/j.joca.2016.04.015.
[33] M. Noura, H. Matsuo, A. Koyama, S. Adachi, H. Masutani, TXNIP induces growth
arrest and enhances ABT263-induced apoptosis in mixed-lineage leukemia-
rearranged acute myeloid leukemia cells, FEBS Open Bio 10 (2020) 1532–1541,
https://doi.org/10.1002/2211-5463.12908.
[34] G. Saxena, J. Chen, A. Shalev, Intracellular shuttling and mitochondrial function of
thioredoxin-interacting protein, J. Biol. Chem. 285 (2010) 3997–4005, https://doi.
org/10.1074/jbc.M109.034421.
15
Life Sciences 267 (2021) 118988
[35] S.R. Filios, G. Xu, J. Chen, K. Hong, G. Jing, A. Shalev, MicroRNA-200 is induced by
thioredoxin-interacting protein and regulates Zeb1 protein signaling and beta cell
apoptosis, J. Biol. Chem. 289 (2014) 36275–36283, https://doi.org/10.1074/jbc.
M114.592360.
[36] W. Deng, Y. Li, Z. Ren, Q. He, Y. Jia, Y. Liu, W. Zhang, X. Gan, D. Liu, Thioredoxin-
interacting protein: a critical link between autophagy disorders and pancreatic
β-cell dysfunction, Endocrine (2020), https://doi.org/10.1007/s12020-020-02471-
6.
[37] C.-J. Su, Y. Feng, T.-T. Liu, X. Liu, J.-J. Bao, A.-M. Shi, D.-M. Hu, T. Liu, Y.-L. Yu,
Thioredoxin-interacting protein induced α-synuclein accumulation via inhibition
of autophagic flux: implications for Parkinson’s disease, CNS Neurosci. Ther. 23
(2017) 717–723, https://doi.org/10.1111/cns.12721.
[38] Y. Wang, Y.-H. Lu, C. Tang, M. Xue, X.-Y. Li, Y.-P. Chang, Y. Cheng, T. Li, X.-C. Yu,
B. Sun, C.-J. Li, L.-M. Chen, Calcium dobesilate restores autophagy by inhibiting
the VEGF/PI3K/AKT/mTOR signaling pathway., Front. Pharmacol. 10 (2019) 886.
doi:https://doi.org/10.3389/fphar.2019.00886.
[39] B. Wang, Y. Zhong, Q. Li, L. Cui, G. Huang, Autophagy of macrophages is regulated
by PI3k/Akt/mTOR signalling in the development of diabetic encephalopathy,
Aging (Albany NY) 10 (2018) 2772–2782, https://doi.org/10.18632/
aging.101586.
[40] Y. Tian, Y.-H. Xiao, T. Geng, C. Sun, J. Gu, K.-F. Tang, B. Liu, Y.-M. Liu, F. Sun,
Clusterin suppresses spermatogenic cell apoptosis to alleviate diabetes-induced
testicular damage by inhibiting autophagy via the PI3K/AKT/mTOR axis., Biol.
Cell. (2020). doi:https://doi.org/10.1111/boc.202000030.
[41] X. Huang, G. Liu, J. Guo, Z. Su, The PI3K/AKT pathway in obesity and type 2
diabetes, Int. J. Biol. Sci. 14 (2018) 1483–1496, https://doi.org/10.7150/
ijbs.27173.
[42] E.A. Dunlop, A.R. Tee, mTOR and autophagy: a dynamic relationship governed by
nutrients and energy., Semin. Cell Dev. Biol. 36 (2014) 121–129. doi:https://doi.
org/10.1016/j.semcdb.2014.08.006.