Letters in Applied Microbiology 2004, 39, 221–225 doi:10.1111/j.1472-765X.2004.01555.

Detection of Helicobacter pylori in water by direct PCR

J.A. Benson, K.A. Fode-Vaughan and M.L.P. Collins

Department of Biological Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI, USA

2003/0959: received 22 October 2003, revised 25 February 2004 and accepted 30 April 2004

ABSTRACT
J . A . B E N S O N , K . A . F O D E - V A U G H A N A N D M . L . P . C O L L I N S . 2004.
Aims: This paper demonstrates a rapid, simple method for the detection of Helicobacter pylori in water that
eliminates the need for recovery of cells or DNA extraction prior to PCR.
Methods and Results: Direct polymerase chain reaction (DPCR) with primers specific for H. pylori ureA (urease,
subunit A) were used to detect H. pylori added to groundwater. DPCR also detected H. pylori in a naturally
contaminated water sample.
Conclusions: DPCR should provide an improved method to assess contamination of water by H. pylori.
Significance and Impact of the Study: This simple, rapid method for detection of H. pylori in water will
provide an improved means to investigate the possible role of water as a disease vector.

Keywords: detection, direct PCR, DPCR, Helicobacter pylori, PCR.

the Candidate Contaminant List compiled by the US

INTRODUCTION
Waterborne pathogens may cause acute or chronic disease.
Investigation of water as a disease vector requires methods to
assess the presence of pathogens in water sources and
drinking water. We have recently reported the use of direct
polymerase chain reaction (DPCR) for the detection of
bacteria in water and other environmental samples (Fode-
Vaughan et al. 2001, 2003). This streamlined approach
avoids recovery of cells or DNA extraction by including the
untreated sample directly in the PCR. We have used primers
specific for functional genes to detect methanotrophic and
phototrophic bacteria and the pathogen Escherichia coli
O157:H7 by DPCR (Fode-Vaughan et al. 2001, 2003). This
approach should be valuable for the detection of other
pathogens in water.
Helicobacter pylori causes gastric diseases in humans
including chronic gastritis and ulcers, and is associated with
gastric adenocarcinoma and lymphoma (reviewed in Brown
2000). Infection with H. pylori is estimated to be 40–70%
worldwide (Brown 2000). Helicobacter pylori is included in
Correspondence to: Mary Lynne Perille Collins, Department of Biological Sciences,
University of Wisconsin-Milwaukee, PO Box 413, Milwaukee, WI 53201, USA
(e-mail: mlpcolli@uwm.edu).
Present address: Kimberly A. Fode-Vaughan, Department of Biochemistry, Medical
College of Wisconsin, 8701 W. Watertown Plank Rd, Milwaukee, WI 53226, USA.
ª 2004 The Society for Applied Microbiology
Environmental Protection Agency (http://www.epa.gov).
This list includes drinking water contaminants that are a
priority for research, monitoring, and possible future
regulation.
While the source/s of H. pylori infection remain uncer-
tain, epidemiological evidence suggests that water is one
potential source (Klein et al. 1991; Goodman et al. 1996;
McKeown et al. 1999; Nurgalieva et al. 2002). No stan-
dardized method is in use, but H. pylori has been detected in
a small number of water samples that have been tested.
Helicobacter pylori has been detected in water by immuno-
fluorescent microscopy (Hegarty et al. 1999) and by immu-
nomagnetic capture followed by enrichment culture (Lu
et al. 2002). PCR using extracted DNA in combination with
either a secondary amplification or hybridization has detec-
ted H. pylori in environmental water sources and drinking
water (Hulten et al. 1996, 1998; McKeown et al. 1999;
Sasaki et al. 1999; Baker and Hegarty 2001; Mazari-Hiriart
et al. 2001). A recent investigation provided presumptive
evidence for the presence of H. pylori in biofilm in a water
distribution system (Park et al. 2001).
The characteristics of H. pylori present challenges in
developing methods for its detection. Helicobacter pylori
undergoes a morphological transformation from a helical to
a nonculturable coccoid form under various laboratory
222 J . A . B E N S O N ET AL.
conditions (Nilsson et al. 2002; Adams et al. 2003). The
coccoid form is suggested to be viable and infectious (West
et al. 1992; Shahamat et al. 1993; Wang et al. 1997; Nilsson
et al. 2002; Adams et al. 2003) implying that culture-based
methods may not reliably detect infectious H. pylori in water
samples. A recent study directly evaluated the effect of an
aquatic environment on the culturability and viability of
H. pylori (Adams et al. 2003). Cells in membrane diffusion
chambers were incubated in a natural freshwater environ-
ment. While viability was retained, cells became noncultur-
able much more rapidly than had been observed in
laboratory experiments (Adams et al. 2003). These findings
suggest that viable nonculturable H. pylori may persist in the
environment and be a source of infection.
A rapid, simple means to detect H. pylori in water samples
would be valuable for investigation of potential sources of
infection, for research and ultimately for public health
applications. In this work we apply DPCR to the detection
of H. pylori using primers that specifically amplify a portion
of the urease subunit A.
M A T E R I A LS A N D M E T H O D S
Bacterial growth and treatment conditions
Helicobacter pylori N6 (provided by S. Phadnis of the
Medical College of Wisconsin) was recovered from sheep
blood agar plates grown at 37
C in an atmosphere of 85% N2,
10% CO2 and 5% O2. To prepare control cells that would
not be infectious, we used fixation in paraformaldehyde
under conditions that we previously applied to E. coli (Fode-
Vaughan et al. 2003). After fixation, a portion of the cells in
fixative was retained for a direct cell count. The remainder of
the fixed cells was harvested and washed in phosphate
buffered saline and stored at )20
C until DPCR analysis.
Molecular techniques
Primer design and PCR conditions were optimized for
DPCR using recommendations reported previously (Fode-
Vaughan et al. 2001). The forward and reverse primers are:
HpF – ATATTATGGAAGAAGCGAGAGCTGG (modi-
fied from Sasaki et al. 1999) and HpR – ATGGAAGTG-
TGAGCCGATTTG (Sasaki et al. 1999). The HpF/HpR
primer pair was evaluated in silico. These primers are
predicted to bind with £2 mismatches to all 45 H. pylori
ureA sequences deposited in GenBank by February 2004. In
contrast, one or both of these primers would have ‡7
mismatches with the ureA sequences available from other
Helicobacter species or other genera suggesting that a
product should not be amplified from these templates.
The annealing time for PCR was 2 min for the first six
cycles and 1 min for the remaining 39 cycles. A ‘touchdown’
ª 2004 The Society for Applied Microbiology, Letters in Applied Microbiology, 39, 221–225, doi:10.1111/j.1472-765X.2004.01555.x
protocol was used for the annealing temperature (Fode-
Vaughan et al. 2001, 2003); this temperature was reduced
from 50 to 41
C by lowering it one degree every two cycles
for the first 19 cycles followed by a constant annealing
temperature of 45
C for 26 cycles.
Fixed bacterial cells were used in DPCR analysis.
Immediately before DPCR analysis, the cells were thawed
and serially diluted in double-distilled water, and each
dilution was used as a template for PCR. The final volume of
each PCR was 100 ll.
We have previously described the calculation of most
probable number (MPN-DPCR) (Fode-Vaughan et al.
2001). For this purpose, 50 ll of distilled water containing
107 H. pylori were decimally diluted to a theoretical
concentration of 10)1 cells. Samples were diluted to extinc-
tion in five replicate series and each dilution was used as a
template for PCR. A negative control with no template was
included in each dilution series.
PCR products were analysed on agarose gels with the
MBI Fermentas (Amherst NY) 100 bp DNA Ladder Plus
used as a size marker. PCR products were sequenced with
AmpliTaq DNA polymerase FS with a model 373 DNA
Sequencer Applied Biosystems (Foster City, CA, USA).
Figures were prepared with Adode Photoshop 5Æ5.
Environmental and other samples
The groundwater sample designated GLRF has been
previously described (Cheng et al. 1999). Municipal
drinking water from a city in the southeastern USA was
also tested. The source water for this municipality is lake
water.
RESULTS
When H. pylori cells were serially diluted in double-distilled
water and each dilution was used as a template for DPCR
with the HpF/HpR primer pair, a 314-bp amplification
product was formed in every tube with sufficient template
(Fig. 1). In repeated trials, 10–100 cells were required to
obtain a product.
The sensitivity of this method was evaluated by MPN-
DPCR. For this purpose, a sample determined to have
2 · 108 cells ml)1 by direct count was serially diluted to
extinction in five replicate series and subjected to DPCR.
MPN-DPCR estimated this sample to have 6Æ95 ·
106 cells ml)1 (95% confidence limits ¼ 2Æ11 · 106 to
2Æ3 · 107 ml)1). The 100-fold difference between the lower
limit and the actual number of cells in the PCR reaction
implies that up to 100 cells per 50 ll in the PCR reaction
(2 · 103 cells ml)1) would be required to detect H. pylori in
water samples. The sensitivity of DPCR using fixed cells
was equivalent within the 95% confidence intervals to PCR

H. pylori in ddH2O H. pylori in Groundwater
4 3 2 1 0 –1 4 3 2 1
M 10 10 10 10 10 10 10 10 10 10
Fig. 1 DPCR of Helicobacter pylori. Fixed cells (104) were added to
either 50 ll double-distilled water or groundwater. Serial dilutions
were carried out in double-distilled water and each tube was used in
PCR. A PCR product of the expected size was amplified in all tubes
with sufficient template and in which inhibition was relieved by
dilution. No PCR product was obtained in the negative control
containing no cells or DNA ()), in those tubes in which the template
was diluted below the level of detection (£10–100 cells), and in the
undiluted groundwater containing 104 cells. The lack of a product in
the latter is apparently because of inhibition of PCR by substances in
the groundwater; this inhibition is relieved by dilution
with purified DNA (not shown). This indicates that the
fixation treatment did not affect the adequacy of the cells to
serve as a temple for DPCR.
The usefulness of this DPCR approach for the
detection of H. pylori in water was evaluated by adding
fixed cells to a groundwater sample. When groundwater to
which H. pylori was added was decimally diluted and used in
DPCR, an amplification product was obtained (Fig. 1). No
product was obtained in the undiluted sample (104 cells in
undiluted groundwater). We have previously observed such
PCR failures in undiluted environmental samples and
attributed it to the presence of PCR inhibitors (Fode-
Vaughan et al. 2001). This inhibition was relieved by a 10-
fold dilution; a product was amplified from groundwater
diluted 1 : 10 containing 103 cells (Fig. 1). Replicate dilu-
tion series in which the initial tube contained 107 cells in
50 ll groundwater (2 · 108 ml)1) were used for MPN-
DPCR; the MPN was determined to be 2Æ6 · 106 (95%
confidence limits ¼ 7Æ87 · 105 to 8Æ58 · 106). This is
similar to the detection limit obtained with distilled water
and implies that DPCR should be applicable to the detection
of H. pylori in groundwater provided that the sample used
for analysis contains at least 2 · 103 cells ml)1. Alternat-
ively, if the sample contains a lower level of H. pylori cells or
inhibition requires dilution, it should be possible to
concentrate the sample prior to analysis.
DPCR for detection of H. pylori was applied to a naturally
contaminated water supply. Municipal drinking water was
subjected to centrifugation at 16 000 g. Pelleted material
ª 2004 The Society for Applied Microbiology, Letters in Applied Microbiology, 39, 221–225, doi:10.1111/j.1472-765X.2004.01555.x
DPCR DETECTION OF H. PYLORI 223
M 10
0
10
–1 –2
10 10
–3
– +
–
Fig. 2 DPCR detection of Helicobacter pylori in drinking water.
Particulate material concentrated from a drinking water sample was
decimally diluted and subjected to DPCR. A product was obtained
when the sample diluted 1 : 10 was used as a template but the band was
too faint for photodocumenation (not shown). These PCR products
were used as a template for a secondary PCR reaction, the products of
which are shown. Lanes are: M, molecular weight markers; undiluted
sample; sample diluted 10)1, 10)2, 10)3; ), negative control with no
template; +, positive control with H. pylori DNA
was resuspended in 1/40 of the original volume in distilled
water, serially diluted and subjected to DPCR analysis to
detect H. pylori. A PCR product was reproducibly obtained
in the sample diluted 1 : 10, however the PCR product
formed only a very faint band on the gel (not shown). An
abundant product was formed when the primary DPCR
reaction was used as a template in a secondary amplification
(Fig. 2). The identity of the PCR product was confirmed by
determination of its DNA sequence. These findings imply
that H. pylori was present in the drinking water at an
approximate concentration of 102 cells ml)1.
DISCUSSION
DPCR provides a rapid method for the detection of H. pylori
in water that is simpler than alternatives. Detection of
H. pylori in groundwater spiked with H. pylori indicates that
DPCR would be a valuable method for testing water sources
for contamination by this bacterium. Its usefulness is
demonstrated by detection of H. pylori in a municipal
drinking water sample. It should be possible to adapt the
DPCR approach to a 96-well format permitting efficient
analysis of a large number of samples.
The significance of the detection of H. pylori in drinking
water in this work or in an earlier study (Baker and Hegarty
2001) is unknown as few samples were tested. It is possible
that H. pylori is present in many water sources and drinking
water could be a source of infection. Alternatively, this may
224 J . A . B E N S O N ET AL.
be an episodic occurrence. In this regard, it should be noted
that while H. pylori was reproducibly detected in one
sample, it was not detectable by DPCR in another sample
obtained from the same source 41 days later. The negative
results from this latter sample reflect the absence of
detectable template rather than inhibition; when template
was added to this sample a PCR product was obtained. The
differences between water samples obtained on different
dates could reflect the transient nature of contamination of
the source water, and in particular, the impact of recent
precipitation. Variability in microbial load and in the
presence of pathogens in environmental water is not
unexpected (Kistemann et al. 2002). It could also reflect
inconsistency in the effectiveness of the chlorination process
used to treat the drinking water; H. pylori is sensitive to
treatment with chlorine but less so than the indicator
organism E. coli (Baker et al. 2002).
The DPCR method reported in this communication should
provide a better means to assess how frequent and widespread
H. pylori contamination of water sources and drinking water
is. This information would provide the opportunity to
correlate the presence of H. pylori in water with infections in
the population to assess water as a source of infection.
Every approach to the detection of microbes has advan-
tages and shortcomings. In contrast to culture-based meth-
ods, DPCR and other PCR methods may detect cells that
are nonculturable. As a result, detection of H. pylori by
DPCR does not necessarily indicate that a sample has live,
infectious bacteria. Because dead cells or free DNA would
also be detected, all PCR methods can result in false
positives. However, culture-based methods may result in
false negatives. Viable, nonculturable H. pylori, which may
be potentially infectious, would not be detected by culture
methods but would be detected by DPCR.
In summary, DPCR may be used to detect H. pylori in
water. This will provide an improved means to investigate the
possible importance of water as a vector of H. pylori infection.
ACKNOWLEDGEMENTS
This work was supported with funds from the Wisconsin
Department of Natural Resources (NMB00000187) and by
the Center for Water Security at the Great Lakes WATER
Institute through a grant from DARPA (NBCH1020016).
This is contribution no. 441 from the Great Lakes WATER
Institute.
REFERENCES
Adams, B.L., Bates, T.C. and Oliver, J.D. (2003) Survival of
Helicobacter pylori in a natural freshwater environment. Applied
and Environmental Microbiology 69, 7462–7466.
ª 2004 The Society for Applied Microbiology, Letters in Applied Microbiology, 39, 221–225, doi:10.1111/j.1472-765X.2004.01555.x
Baker, K.H. and Hegarty, J.P. (2001) Presence of Helicobacter pylori in
drinking water is associated with clinical infections. Scandanavian
Journal of Infectious Disease 33, 744–746.
Baker, K.H., Hegarty, J.P., Redmond, B., Reed, N.A. and Herson,
D.S. (2002) Effect of oxidizing disinfectants (chlorine, monochlor-
amine, and ozone) on Helicobacter pylori. Applied and Environmental
Microbiology 68, 981–984.
Brown, L.M. (2000) Helicobacter pylori: epidemiology and routes of
transmission. Epidemiologic Reviews 22, 283–297.
Cheng, Y.S., Halsey, J.L., Fode, K.A., Remsen, C.C. and Collins,
M.L.P. (1999) Detection of methanotrophs in groundwater by PCR.
Applied and Environmental Microbiology 65, 648–651.
Fode-Vaughan, K.A., Wimpee, C.F., Remsen, C.C. and Collins,
M.L.P. (2001) Detection of bacteria in environmental samples by
direct PCR without DNA extraction. Biotechniques 31, 598–607.
Fode-Vaughan, K.A., Maki, J.S., Benson, J.A. and Collins, M.L.P.
(2003) Direct PCR detection of Escherichia coli O157:H7. Letters in
Applied Microbiology 37, 239–243.
Goodman, K.J., Correa, P., Tengana Aux, H.J., Ramirez, H., DeLany,
J.P., Guerrero Pepinosa, O., Lopez Quinones, M. and Collazos
Parra, T. (1996) Helicobacter pylori infection in the Colombian
Andes: a population-based study of transmission pathways. American
Journal of Epidemiology 144, 290–299.
Hegarty, J.P., Dowd, M.T. and Baker, J.H. (1999) Occurrence of
Helicobacter pylori in surface water in the United States. Journal of
Applied Microbiology 87, 697–701.
Hulten, K., Han, S.W., Enroth, H., Klein, P.D., Opekun, A.R.,
Gilman, R.H., Evans, D.G., Engstrand, L. et al. (1996) Helicobacter
pylori in the drinking water in Peru. Gastroenterology 110, 1031–
1035.
Hulten, K., Enroth, H., Nystrom, T. and Engstrand, L. (1998)
Presence of Helicobacter species DNA in Swedish water. Journal of
Applied Microbiology 85, 282–286.
Kistemann, T., Classen, T., Koch, C., Dangendorf, F., Fischeder, R.,
Gebel, J., Vacata, V. and Exner, M. (2002) Microbial load of
drinking water reservoir tributaries during extreme rainfall and
runoff. Applied and Environmental Microbiology 68, 2188–2197.
Klein, P.D., Graham, D.Y., Gaillour, A., Opekun, A.R. and Smith,
E.O. (1991) Water source as risk factor for Helicobacter pylori
infection in Peruvian children. Lancet 337, 1503–1506.
Lu, Y., Redlinger, T.E., Avita, R., Galindo, A. and Goodman, K.
(2002) Isolation and genotyping of Helicobacter pylori from untreated
municipal wastewater. Applied and Environmental Microbiology 68,
1436–1439.
Mazari-Hiriart, M., Lopez-Vidal, Y., Castillo-Rojas, G., Ponce de
Leon, S. and Cravioto, A. (2001) Helicobacter pylori and other enteric
bacteria in freshwater environments in Mexico City. Archives of
Medical Research 32, 458–467.
McKeown, I., Orr, P., Macdonald, S., Kabani, A., Brown, R.,
Coghlan, G., Dawood, M., Embil, J. et al. (1999) Helicobacter pylori
in the Canadian arctic: seroprevalence and detection in community
water samples. American Journal of Gastroenterology 94, 1823–1829.
Nilsson, H.O., Blom, J., Al-Soud, W.A., Ljungh, A., Andersen, L.P.
and Wadstrom, T. (2002) Effect of cold starvation, acid stress, and
nutrients on metabolic activity of Helicobacter pylori. Applied and
Environmental Microbiology 68, 11–19.

Nurgalieva, Z.Z., Malaty, H.M., Graham, D.Y., Almuchambetova, R.,
Machmudova, A.A., Kapsultanova, D., Osato, M.S., Hollinger, F.B.
et al. (2002) Helicobacter pylori infection in Kazakhstan: effect of
water source and household hygiene. American Journal of Tropical
Medicine and Hygiene 67, 201–206.
Park, S.R., Mackay, W.G. and Reid, D.C. (2001) Helicobacter sp.
recovered from drinking water biofilm sampled from a water
distribution system. Water Research 35, 1624–1626.
Sasaki, K., Tajiri, Y., Sata, M., Fujii, Y., Matsubara, F., Zhao, M.,
Shimizu, S., Toyonaga, A. et al. (1999) Helicobacter pylori in the
natural environment. Scandinavian Journal of Infectious Disease 31,
275–279.
ª 2004 The Society for Applied Microbiology, Letters in Applied Microbiology, 39, 221–225, doi:10.1111/j.1472-765X.2004.01555.x
DPCR DETECTION OF H. PYLORI 225
Shahamat, M., Mai, U., Paszko-Kolva, C., Kessel, M. and Colwell,
R.R. (1993) Use of autoradiography to assess viability of Helicobacter
pylori in water. Applied and Environmental Microbiology 59, 1231–
1235.
Wang, X., Sturegard, E., Rupar, R., Nilsson, H.O., Aleljung, P.A.,
Carlen, B., Willen, R. and Wadstrom, T. (1997) Infection of BALB/
c A mice by spiral and coccoid forms of Helicobacter pylori. Journal of
Medical Microbiology 46, 657–663.
West, A.P., Millar, M.R. and Tompkins, D.S. (1992) Effect of physical
environment on survival of Helicobacter pylori. Journal of Clinical
Pathology 45, 228–231.