Water Air Soil Pollut (2008) 191:83–93
DOI 10.1007/s11270-007-9608-5
Detection and Quantification of Human Adenoviruses
in Surface Waters by Nested PCR, TaqMan Real-Time PCR
and Cell Culture Assays
M. Muscillo & M. Pourshaban & M. Iaconelli &
S. Fontana & A. Di Grazia & S. Manzara &
G. Fadda & R. Santangelo & G. La Rosa
Received: 17 August 2007 / Accepted: 16 December 2007 / Published online: 29 December 2007
# Springer Science + Business Media B.V. 2007
Abstract Adenoviruses are emerging pathogens
which may represent new indicators of microbial water
quality. In the present study, environmental samples of
seawater, estuarine water, and influents of sewage
treatment plants underwent both standard bacteriolog-
ical and viral analyses (adenovirus identification,
typing and quantification) in order to evaluate the role
of surface water contamination as a possible vehicle for
the transmission of adenovirus, and the relevance of
adenoviruses as an additional tool in water quality
assessment. Qualitative PCR methods were used for
the detection and typing of adenoviruses. This was
done through the sequencing and phylogenetic analysis
of segments of the hexon- and fiber-coding regions of
the viral genome. Subsequently, quantitative PCR
assays based on TaqMan probe hydrolysis technology
were used to assess virus concentrations in environ-
mental samples. Results showed a widespread presence
of adenovirus in the environment, even in the absence
of bacterial indicators, confirming the relevance of
M. Muscillo : M. Pourshaban : M. Iaconelli : S. Fontana :
A. Di Grazia : G. La Rosa (*)
Department of Environment and Primary Prevention,
Istituto Superiore di Sanità,
Viale Regina Elena 299,
00161 Rome, Italy
e-mail: giuseppina.larosa@iss.it
S. Manzara : G. Fadda : R. Santangelo
Policlinico A.Gemelli, Istituto di Microbiologia,
Università Cattolica del Sacro Cuore,
Rome, Italy
evaluating these viruses as possible indicators of viral
contamination of water.
Keywords Adenovirus . PCR . Real-time .
Sequencing . Water . Infectivity
1 Introduction
Exposure to recreational waters of poor microbial
quality is linked to different adverse health outcomes
(Turbow et al. 2003). Total coliforms, faecal coliforms
and enterococci are the standard indicators of human
fecal contamination in water environments; yet in
recent years the usefulness of these indicators for
human health risk assessment has been questioned
because they may underestimate the risk of virus-
associated waterborne diseases (Jiang and Chu 2004;
Noble and Fuhrman 2001; Griffin et al. 2003). Many
viruses, even at low concentrations, can cause adverse
health effects, including paralysis, meningitis, respira-
tory disease, gastroenteritis, myocarditis and eye
infections. Recently, adenoviruses have been found to
be prevalent in different water environments, including
wastewaters (Formiga-Cruz et al. 2005; Pusch et al.
2005; Sedmak et al. 2005; He and Jiang 2005), rivers
and seawaters (Jiang et al. 2001; Greening et al. 2002;
Van Heerden et al. 2003, 2005b), swimming pools
(Turner et al. 1987; Papapetropoulou and Vantarakis
1998; McMillan et al. 1992; Harley et al. 2001; Van
Heerden et al. 2005a) and drinking water supplies (Cho
et al. 2000; Grabow et al. 2001; Van Heerden et al.
84
2004). Still, to date, the only viral parameter included
in European regulations governing the quality of water
resources is the presence of enteroviruses. Different
authors have suggested including adenovirus as an
index of pollution of human origin in waters because
of their presence in greater numbers and high
persistence in surface waters (Fong et al. 2005; Irving
and Smith 1981; Jiang et al. 2001; Krikelis et al. 1985;
Pina et al. 1998).
Adenovirus identification is usually based on virus
isolation in cell culture, followed by antibody or
antigen detection, and visualization by electron
microscopy. These procedures however are laborious
and time-consuming. In recent years the advancement
of molecular technologies, especially the application of
PCR methods, has improved the speed and sensitivity
of adenovirus detection in water samples (Ko et al.
2003; Van Heerden et al. 2003, 2005b). Dichotomous
(presence/absence) data obtained from conventional
PCR assays, however, offer limited information on
human health risks associated with the exposure to
contaminated waters. The need for quantitative data,
crucial for health risk assessment, has recently driven
to the development of quantitative Real-Time PCR
(qPCR) assays, and their application to environmental
samples (Van Heerden et al. 2005b; Jiang et al. 2005;
He and Jiang 2005; Hernroth et al. 2002).
In Italy, few studies have evaluated the viral quality
of surface waters (Muscillo et al. 1999, 2001; Pianetti
et al. 2000; De Donno et al. 2005; Rose et al. 2006; La
Rosa et al. 2007), and – to the best of our knowledge –
none have specifically addressed the presence of
adenovirus. In this study, in order to evaluate adeno-
virus diffusion in water environment, adenoviruses
were detected, typed and quantified in both non
bathing and bathing waters of the Tyrrhenian sea; to
reinforce epidemiological data, samples from sewage
treatment plants were also examined.
2 Methods
2.1 Samples
Water samples were collected between 2004 and
2006, as described elsewhere (La Rosa et al. 2007).
Briefly, 14 river, estuarine, and seawater samples (10 l
each) were collected during 2004 on the Tiber River
mouth; 19 seawater (10 l each) samples were
Water Air Soil Pollut (2008) 191:83–93
collected during 2005 in swimming areas along the
coast of Latium; and 10 sewage samples (raw influent
at wastewater treatment plants, 50 ml each) were
collected in 2006 at two wastewater treatment plants
in Rome. A PostgreSQL database was previously
created to keep track of all primers, PCRs and
samples used. Samples were coded to enable us to
trace their origin. A convenient web interface allows
internet connection to this database, available to
registered users at https://cosmos.bio.uniroma1.it.
The complete list of water samples analyzed in this
study, with their respective qualitative/quantitative
PCR results, is shown in Table 1.
2.2 Bacteriological Assay
Total coliform (TC), faecal coliform (FC) and faecal
streptococcal (FS) assays were performed according
to Italian law in compliance with EEC directives and
were kindly provided by Arpalazio Agency. At the
time of this research they follow DPR 470/82 in
compliance to EC 76/160 directives of December 8th,
1975 (at present 76/160 are integrated with directives
2006/7/CE of February 2006).
2.3 Concentration of Water Samples
Seawater samples were concentrated with tangential
flow/PEG method as previously described (La Rosa
et al. 2007). Viruses were recovered by ultracentrifu-
gation at 200,000×g for 2 h at 4°C; the pellet was
resuspended in 2 ml of phosphate-buffered saline
(PBS) and stored at −80°C for future use. The
efficiency of the concentration system was evaluated
using three replicates of 10 L of artificial seawater
(Grasshoff et al. 1983) spiked with 100 μl of an
adenovirus type 2 stock (ID 146) from a collection of
clinical isolates (La Rosa et al. 2006) containing from
107–108 PFU/ml of virus. The yields were estimated
with Real Time PCR assays computing the genome
copies (GC) ratio after/before the concentration.
2.4 Extraction of Viral Nucleic Acid
Nucleic acids were extracted from 300 μl of pellet
suspension using the Extragen kit (Amplimedical,
Torino, Italy) according to the manufacturer’s instruc-
tions. Extracted DNAwas diluted in 60 μl of sterile water
and used directly in PCR assays or stored at −80°C.
Water Air Soil Pollut (2008) 191:83–93 85

Table 1 Environmental samples and qualitative/quantitative results

Sample ID Water source Year Sampling sites PCR hexon Type PCR fiber QPCR (genome copy)

323 River 2004 Fiumicino − n.d. n.d. –

324 Estuary Ostia − n.d. n.d. –
325 Seawater Fiumicino + 2 + 1.5×103/10 l
326 River Fiumicino + 2 + 2.3×106/10 l
327 Estuary Fiumicino + 41 + 3.4×105/10 l
328 Seawater Fiumicino + 41 + 1.9×103/10 l
329 Estuary Ostia + 2 + 4.5×105/10 l
330 Seawater Ostia + 2 + 2.7×103/10 l
331 Seawater Fiumicino + 2 + 7.7×103/10 l
332 Seawater Fiumicino + 2 + 8.7×102/10 l
333 Estuary Fiumicino − n.d. n.d. –
334 Estuary Fiumicino − n.d. n.d. –
335 Seawater Ostia + 2 + 1.8×103/10 l
336 Seawater Ostia + 2 + 5.9×103/10 l
632 Seawater 2005 Anzio + 2 + 1.0×103/10 l
633 S. Marinella − n.d. n.d. –
634 Fiumicino + 2 + 4.0/10 l
635 Nettuno + 2 + 4.6×102/10 l
636 Cerveteri − n.d. n.d. –
637 Ardea + 2 + 4.10/10 l
638 Cerveteri + 2 7.2×102/10 l
639 Fiumicino + 2 4.3×102/10 l
640 Ladispoli + 2 9.2×102/10 l
641 Pomezia + 2 4.0×102/10 l
642 Roma − n.d. n.d. –
644 Fiumicino − n.d. n.d. –
645 Fiumicino + 2 + 4.2×103 /10 l
646 Anzio + 2 + 29.3/10 l
647 Ardea − n.d. n.d. 34.9/10 l
648 Pomezia − n.d. n.d. 19.0/10 l
649 Cerveteri + 2 + 3.2×102/10 l
650 Civitavecchia − n.d. n.d. –
651 Fiumicino − n.d. n.d. −
671 Sewage 2006 Roma Sud + 2 + 1.1×103/ml
672 Roma Sud + 2 + 1.8×105/ml
677 Roma Sud + 41 + 4.2×103/ml
678 Roma Sud + 41 + 7.4×103/ml
679 Roma Sud + 2 + 3.1×103/ml
680 Roma Sud + 2 + 1.8×103/ml
699 Ostia + 41 + 2.9×103/ml
700 Ostia + 41 + 1.4×104/ml
703 Roma Sud + 41 + 4.8×103/ml
704 Roma Sud + 41 + 7.6×103/ml

n.d. Not determined

2.5 Qualitative-Nested Polymerase Chain Reaction
and Viral Gene Sequencing
The nested PCR method described by Allard and
collaborators (Allard et al. 2001) was used for
adenovirus DNA amplification. Primers used for the
first-round and nested PCRs were specific for
the detection of adenovirus hexon gene fragments.
The outer primer pair produces 301 bp amplicons; the
inner primer pair produces 171 bp fragments. All
86 Water Air Soil Pollut (2008) 191:83–93

standard precautions were taken and strict laboratory
practices employed to prevent PCR contamination.
In the first stage of PCR, 10 μl of extracted DNA
were amplified using the GoTaq® Green Master Mix
(Promega Corporation, Madison, WI, USA) under the
following conditions: 1 cycle 95°C for 3 min, 54°C
30 s and 72°C for 1 min followed by 35 cycles of 94°C
30 s, 54°C 30 s and 72°C for 1 min, plus one cycle of
elongation for 10 min at 72°C. Subsequently, 2 μl of
first-step product were used for the nested reaction in
35 amplification cycles under identical conditions.
Before sequencing, PCR products were purified using
Wizard® SV Gel and PCR Clean-Up System (Promega
Corporation, Madison, WI, USA).
Amplicons were sequenced in both directions using
ABI Prism BigDye® Terminator Cycle Sequencing
Ready Reaction kit (Applied Biosystems, Foster City,
CA) following manufacturer’s instructions with the
same primers used for the PCRs. Sequencing analysis
was performed in a capillary automatic sequencer (ABI
PRISM™ 310 Genetic Analyser, Applied Biosystems).
To exclude possible contaminations and confirm
validity, all positive samples were retested for the
presence of adenovirus through the amplification of
the fiber-coding region, using newly designed nested
PCR assays. We designed two different couples of
primers to amplify the fiber genes of adenovirus
species C and species F, respectively. Primers 1488
and 1489, specific for species C, were used to
generate an amplicon of 550 bp (PCR 511) in the
fiber region; primers 1490 and 1491 were used to
amplify a 499-bp fragment of adenovirus species F
(PCR 512). For the nested PCR assays, previously
published primers were used (Pehler-Harrington et al.
2004): primers 1433 and 1434 yield an amplicon of
202 bp for species C adenovirus (PCR 450 nested of
PCR511, shortly 450/511); primers 1439 and 1440
amplify a 147-bp fragment of species F (PCR 453/
512). Table 2 shows the list of PCR and primers used
in this study with ID code and references.
2.6 Analysis of Qualitative PCR Data
The consensus sequences were constructed by com-
paring forward and reverse electropherograms using
the AutoAssembler sequence assembly software,
version 2.1.1 (Applied Biosystems, Foster City, CA,
USA); they were exported in GCG format to a Sun
Blade 2000 workstation (Sun Microsystems, Palo
Alto, CA, USA) implemented with Wisconsin GCG
v. 10.3 (University of Wisconsin Genetic Computer
Group, Madison, WI, USA). Sequence database

Table 2 PCRs and primers used in this study

Primer Sequence Primer position PCR Product length Methodological

ID (5′>3′) 5′ to 3′a ID (bp) references

991-f GCCSCARTGGKCWTACATGCACATC 18858–18882 301 301 Allard et al. 2001

992-r CAGCACSCCICGRATGTCAAA 19138–19158
993-f GCCCGYGCMACIGAIACSTACTTC 18931–18954 432/301 171 Allard et al. 2001
994-r CCYACRGCCAGIGTRWAICGMRCYTTGTA 19075–19103
1254-f GAGCAAAATTTCCAACAAAAGG 18217–18238 390 1356 This study
1255-r ATAGCATGGTTTCATGGGAGTT 19551–19572
1488-f CATTGCCCAGGAATAAAGAA 32763–32782 511 550 This study
1489-r GAGACCACTGCCATGTTGTA 33293–33312
1433-f TCATATCATGGGTAACAGACAT 33000–33021 450/511 202 Pehler-Harrington et al. 2004
1434-r CCCATGTAGGCGTGGACTTC 33182–33201
1080-f CWTACATGCACATCKCSGG 18869–18887 494 69 Hernroth et al. 2002
1081-r CRCGGGCRAAYTGCACCAG 18919–18937
1082-r CCGGGCTCAGGTACTCCGAGGCGTCCT 18890–18916
1439-f AACATGCTCATCCAAATCTCGCCTA 29762–29786 453/512 147 Pehler-Harrington et al. 2004
1440-r TTCAGTTATGTAGCAAAATACAGC 29885–29908
1490-f AACTGTGCCTTGGAATCATC 29642– 29661 512 499 This study
1491-r TTAAGGTTAAAGCCCCGTTT 30121–30140
a
Primer positions are based on GeneBank sequence no. AC_000007, with the exception of PCRs 512 and 453/512, for which primer
positions are based on GeneBank sequence accession no. L19443.
Water Air Soil Pollut (2008) 191:83–93
searches for serotype identification were run using the
BLAST (Basic Local Alignment Search Tool) service
provided by the National Center for Biotechnology
Information (NCBI, Bethesda, MD, USA) web server.
Phylogenetic and molecular evolutionary analyses
were conducted using MEGA version 3.1 (Kumar
et al. 2004) with the Neighbor-Joining method based
on a matrix of distances. Significance of constructed
phylogenies was estimated by bootstrap analysis with
100 pseudoreplicate data sets, considering values
above 50% significant. The trees were displayed with
the Njplot program (Perriere and Gouy 1996) and the
postscript files were imported in CorelDraw (version
10) program for adjustments.
2.7 Accession Numbers
The nucleotide sequence data obtained in this study
have been submitted to GeneBank and assigned
accession numbers from AM920697 to AM920722).
2.8 Quantitative Real-Time PCR
The plasmid used to generate Real-Time PCR standard
curves was prepared as follows: a fragment of 1,356 bp
was obtained by PCR using specially designed primers
for the hexon protein-coding region: 1,254 and 1,255
(see Table 2) from a positive control (ID 146,
adenovirus type 2) belonging to our collection of
previously characterized clinical isolates (La Rosa et al.
2006). A partial hexon sequence of this sample was
previously submitted to GeneBank (Accession number
AM406690). The fragment was cloned into the
pCR®4 -TOPO® vector (Invitrogen, Carlsbad, CA) by
TA cloning strategy according to the manufacturer’s
protocol. The recombinant plasmid was purified with
Qiagen plasmid Midi Kit (GmbH, Hilden, Germany).
A HindIII linearized plasmid was prepared, purified,
and the DNA concentration was detected spectropho-
tometrically using the Nanodrop ND-1000 instrument
(Nanodrop, Wilmington, DE, USA). Standard curves
were generated by tenfold serial dilutions (108–100
genome equivalents per reaction) in nuclease-free
water containing carrier yeast tRNA (100 ng/μl),
aliquoted in small amounts and stored at −80°C.
Quantitative PCR was performed on the conserved
region of the first part of the adenovirus hexon gene
according to the assay described by Hernroth and
collaborators (Hernroth et al. 2002). Primers 1080 and
87
1081 (see Table 2) were used to amplify a fragment of
69 bp. The original protocol uses two different probes
(labeled 5′FAM-and 3′TAMRA) in order to ensure the
amplification and detection of all adenovirus types.
We used only one probe (ID 1082), after having
verified that it was able to detect all six (A–F)
previously genotyped adenovirus species in our
collection of clinical samples (La Rosa et al. 2006).
For qPCR, we performed a preliminary test of the
efficiency of three different kits (QuantiTect™ Probe
PCR Kit from Qiagen, TaqMan Universal PCR
Master Mix kit from Applied Biosystems, and
Sensimix™ DNA kit from Quantace).
Reactions were carried out in MicroAmp® optical
96-well reaction plates (Applied Biosystems), in a
25 μl mixture. The reaction mixture was heated at 50°C
for 2 min and then at 95°C for 10 min. Activation was
followed by a 40-cycle, two step process, with each
cycle consisting of denaturation at 95°C for 15 s and
annealing or extension at 60°C for 1 min. Each sample
was tested twice in separate runs, and assayed in
triplicate during each run to allow assessment of
within-run and between-run variability. Fluorescences
were measured using an ABI-PRISM® 7000 sequence
detection system (Applied Biosystems).
The standard curve was generated by plotting cycle
threshold (Ct) values against the concentration of viral
DNA, expressed as log copies/ml. Run acceptability
was defined as R2 ≥0.98 and 3.6≥slope≥3.1. For an
assessment of PCR inhibition, negative samples were
tested with serial dilutions of a control virus (ID-85,
Echovirus 7 Wallace, ATCC 37-VR) by specific RT-
PCR assays.
2.9 Cell Culture Analysis for Infectious Human
Adenoviruses
The infectivity of adenoviruses was analyzed using
two cell lines, Hep2 and A549. After concentration
and ultracentrifugation, 200 μl of viral suspension
was purified by chloroform extraction, and inoculated
into 25 cm2 flask in the presence of 0.1 g/l of
guanidium chloride, to inhibit enterovirus growth (for
Hep2 cells), and incubated for 1 h at 37°C. The
inoculum was discarded and cells were overlaid with
4 ml of maintenance medium. Cell cultures were
incubated for 5 to 8 days in 5% CO2 at 37°C. A few
samples were randomly selected and retested by a
second round of infection to confirm results.
88
3 Results
3.1 Concentration
The efficiency of the concentration system was
evaluated by Real Time PCR using artificial seawa-
ter spiked with an adenovirus type 2 stock (ID 146)
and computing the genome copies (GC) ratio after/
before the concentration; it was observed that the
recoveries yield has an averaged of 50% (data not
shown).
3.2 Bacterial Results
In 14 out 19 samples bacterial counts for total
coliform (TC), fecal coliform (FC) and fecal strepto-
cocci (FS) were low, and sometimes altogether
negative, suggesting that the sites were very clean.
3.3 Qualitative Results
The complete list of water samples analyzed in this
study, with their respective qualitative PCR results,
is shown in Table 1. Hexon DNA fragments were
found in 31 of 43 environmental samples in the
nested PCR assay. Specifically, 21 of 33 river,
estuarine and seawater samples (60%) were positive
for adenoviruses, while sewage samples were 100%
contaminated.
BLAST nucleotide sequence similarity searches
revealed that of 31 adenoviruses, 23 (74%) belonged
to serotype 2, and 8 (26%) to serotype 41; other
serotypes were not detected.
Positive results obtained from analyses of the
hexon region were confirmed in PCRs of the fiber
region as described above. A phylogenetic tree of the
hexon sequences was constructed (Fig. 1) in order to
characterize adenovirus strains and to study their
genetic relationships. Prototype sequences of sero-
types 2 and 41 were included (accession numbers
am406690, ay375454, aj293903, j01917 for type 2;
and dq464891, dq504434, dq315364, ay375458,
am406788, dq504431, for type 41, respectively), as
well as an outgroup sequence from a bovine adeno-
virus type 2 (af252854), obtained from GeneBank.
The tree shows two separate clusters for type 2 and
type 41 samples, supported by high bootstrap values.
In addition, within-cluster variability was found in
both groups.
Water Air Soil Pollut (2008) 191:83–93
3.4 Quantitative Results
Virus concentrations in water samples were then
determined by quantitative Real-Time PCR, as de-
scribed above. The recombinant plasmid used to
construct the standard curve for the Real-Time
reaction, drawn with either the GCG MapPlot or
PlasmidMap program, is shown in Fig. 2.
We were able to confirm a high degree of both
within-run and run-to-run reproducibility by assaying
each viral extract twice in triplicate (data not shown).
Three commercial kits to detect adenovirus DNA
were evaluated for efficiency; having found the three
to be similar in terms of efficiency, only the
Sensimix™ DNA kit from Quantace (London, UK)
was used.
We were able to quantify the number of viral particles
in 33 out of 43 samples. Of these, two samples (647 and
648), which were negative with qualitative nested PCR,
turned out positive when analyzed by qPCR. The
number of genome copies (corrected on the bases of
the efficiency of the concentration system) ranged from
4.0×100 to 7.7×103 in 10 l for seawaters, from 3.4×
105 to 2.3×106 in 10 l for estuarine and river samples,
and from 1.1×103 to 1.8×105 per ml in sewage
samples.
3.5 Infectivity Results
All the infectivity tests yielded negative results.
Cytotoxicity of samples, tested after purification,
was never observed. Tissue culture cells infected with
a positive control (ID 146, adenovirus type 2) showed
cytopathic effect (CPE) after 24–48 h, even at low
concentration (data not shown).
4 Discussion
Human adenoviruses cause a broad spectrum of diseases
including pharyngitis, acute respiratory infection,
pharyngoconjunctival fever, epidemic keratoconjuncti-
vitis, pneumonia, gastroenteritis and genitourinary
infections. Severe infections can occur especially in
infants, young children and immunocompromised
patients (Cevenini et al. 1985; Munoz et al. 1998;
Pichler et al. 2000).
Recently, these viruses have been found to be
prevalent in different water environments including
Water Air Soil Pollut (2008) 191:83–93
Fig. 1 Clustalw bootstrap-
100 phylogenetic tree of
environmental isolates
sewages, rivers, coastal waters, swimming pool
waters, and drinking water supplies worldwide (Jiang
2006; Heerden et al. 2005). Epidemiological inves-
tigations may be necessary to understand the link
between human health risks and the occurrence of
human viral pathogens in waters.
In this work, we performed viral analyses (adeno-
virus detection, typing and quantification) of different
89
kinds of surface water samples collected in and
around Rome, and bacteriological analyses (total
coliform, fecal coliform and fecal streptococci)
limited to seawater samples.
Adenoviruses were present in the majority of water
samples (72%), despite the fact that bacterial counts –
low, and sometimes altogether negative – suggested
the sites were very clean. Specifically, 11 out of 19
90
Fig. 2 The recombinant plasmid 146/Ad2/351 used to generate
standard curves for the Q-PCR. Genomic positions of the hexon
(nt 18217–19571) and fiber (nt 32763–33312) genes, which
include all PCR and RealTime PCR targets, are shown in the
MapPlot figure of the adenovirus 2 reference template
(accession no. J01917). The recombinant plasmid was obtained
samples from bathing waters collected in 2005 were
positive for adenoviruses; for 9 of these, bacterial
parameters were within the range permitted by law.
These results are in line with other studies,
showing that adenoviruses survive longer than faecal
indicator bacteria in sewage and the environment, and
are very resistant to UV light (Thurston-Enriquez
et al. 2003, 2005a, b; Enriquez et al. 1995). This
increased resistance may be owed to the double
stranded nature of their DNA genome which, if
Water Air Soil Pollut (2008) 191:83–93
by cloning the PCR-390 amplicon corresponding to the 18217–
19571 nt region of the hexon gene. The plasmid figure and its
map positions were derived by using sequentially the MAP-
SORT and PLASMIDMAP programs of the GCG package. D
Dalton
damaged, may be repaired by the host cell DNA-
repair mechanisms (Jiang 2006).
All adenoviruses detected in environmental sam-
ples were of either type 2 (74%) or type 41 (26%)
when tested in the hexon gene region. These findings
are consistent with the results of a molecular study of
adenoviruses characterization in clinical samples in
Italy during 2006, which showed serotypes 2 and 41
among the most common adenovirus types in hospi-
talized patients (La Rosa et al. 2006). To exclude
Water Air Soil Pollut (2008) 191:83–93
possible contaminations and confirm validity, all
positive samples were retested for the adenovirus
presence through the amplification of the fiber-coding
region, using nested PCR assays and concordant
results (positive/negative PCRs) were obtained. The
use of double-round PCR is needed when analyzing
water samples due the low concentration of viruses
recovered from large volumes. Because concentration
of viruses from large volumes of water is a process
that can concentrate inhibitors which may test falsely
negative by conventional PCR methods (Jiang 2006),
to discriminate true negative results from false
negative results due to PCR failure, we tested
negative samples with serial dilutions of a control
virus (ID-85, Echovirus 7 Wallace, ATCC 37-VR) by
specific PCR assays; we did not use adenovirus
standards in order to avoid possible contaminations
of environmental samples by PCR aerosol.
About adenovirus quantization, we were able to
confirm the broad reactivity of the TaqMan® PCR
assay used in this study, by testing a collection of
clinical samples containing all six adenovirus species
(A–F), previously sequenced and genotyped (La Rosa
et al. 2006).
Results from Real-Time quantification of viral
particles in water samples showed a gradient sewage >
estuary > seawater. The fact that raw sewage has a
higher concentration of viruses than rivers and
seawaters is not surprising. Because sewage treat-
ment is often absent or insufficient and even when
present, treatment processes are only partially effec-
tive at removing viruses, discharges constantly
release viruses into the water environment; once in
the environment, viruses can survive for weeks to
months either in the water or by attaching to
particulate matter and accumulating in sediments.
The sensitivity of Real-Time PCR was a little
superior to that of the traditional nested PCR assay:
two samples were negative with qualitative PCR and
positive when analyzed by qPCR. In addition, the
Real-Time PCR assay offers other advantages: it is
relatively rapid (entire processing time < 12 h),
provides quantitative information, and is less sensi-
tive to contamination. Therefore, the Real-Time PCR
assay is suitable for quantitative determination of
adenovirus in environmental samples impacted by
sewage contamination and represents a considerable
advancement in pathogen quantification in aquatic
environments. The most serious limitation of qPCR,
91
and of other molecular techniques, is that it fails to
discriminate between viable and inactivated viruses,
which may be present at higher levels than the
virulent forms (Richards 1999; Reynolds et al. 1996).
For these reasons we tested infectivity of adenovi-
ruses detected by PCR or qPCR using tissue culture
cell lines. Infectivity assays yielded negative results;
these findings are in line with previous studies
showing that environmental samples containing
viruses that have been inactivated by natural environ-
mental processes or disinfectants (UV light, heat, or
hypochlorite) have often yielded positive results by
genome-based methods (Blackmer et al. 2000; Gerba
et al. 2002; Sobsey et al. 1998). A study conducted by
Choi and Jiang (2005) found discrepancy between
high- number genome copies of adenoviruses detected
in California urban rivers by qPCR and infectivity
detected by tissue culture; the authors suggest as
possible explanation that most human viruses in the
aquatic environment are noninfectious (with integral
viral physical or genome structure) because inacti-
vated by natural or sewage treatment processes.
Therefore virus presence based on molecular detec-
tion may overestimate the occurrence of infectious
viruses in the environment and must be interpreted
with caution when predicting human health risks.
5 Conclusion
Results of this study showed a widespread presence
of adenovirus in the environment, even in the absence
of bacterial indicators.
The Real-Time PCR assay is suitable for determi-
nation of adenoviruses in environmental samples
impacted by sewage contamination and represents a
considerable advancement in pathogen quantification
in aquatic environments.
In our opinion, more information is needed on the
epidemiology of adenoviruses to understand the link
between the occurrence of viral pathogens in the
environment and human health and the ability of
these viruses to represent new indicators of microbial
water quality for human health risk assessment.
Acknowledgments We are grateful to M. Floccia and D.
Erroi of the Arpalazio Agency for collection of seawater
samples ad microbiological data. We are extremely grateful to
the Fiumicino Coast Guard for its help in collecting samples at
the Tiber estuary.
92
References
Allard, A., Albinsson, B., & Wadell, G. (2001). Rapid typing of
human adenoviruses by a general PCR combined with
restriction endonuclease analysis. Journal of Clinical
Microbiology, 39(2), 498–505.
Blackmer, F., Reynolds, K. A., Gerba, C. P., & Pepper, I. L.
(2000). Use of integrated cell culture-PCR to evaluate the
effectiveness of poliovirus inactivation by chlorine. Ap-
plied and Environmental Microbiology, 66, 2267–2268.
Cevenini, R., Varoli, O., Rumpianesi, F., Mazzaracchio, R.,
Nanetti, A., & La Placa, M. (1985). A two-year longitu-
dinal study on the etiology of acute diarrhea in young
children in Northern Italy. Microbiologica, 8, 51–58.
Cho, H. B., Lee, S. H., Cho, J. C., & Kim, S. J. (2000).
Detection of adenoviruses and enteroviruses in tap water
and river water by reverse transcription multiplex PCR.
Canadian Journal of Microbiology, 46, 417–424.
Choi, S., & Jiang, S. C. (2005). Real-time PCR quantification
of human adenoviruses in urban rivers indicates genome
prevalence but low infectivity. Applied and Environmental
Microbiololgy, 71(11), 7426–7433.
De Donno, A., Liaci, D., Bagordo, F., Guido, M., & Carducci, A.
(2005). Evaluation of viral and bacterial contamination of
coastal seawater. Valutazione dell’inquinamento virologico
e batteriologico per il biomonitoraggio delle acque costiere.
Igiene e Sanita Pubblica, 61, 585–600.
Enriquez, C. E., Hurst, C. J., & Gerba, C. P. (1995). Survival of
the enteric adenoviruses 40 and 41 in tap, sea, and waste
water. Water Research, 29, 2548–2553.
Fong, T. T., Griffin, D. W., & Lipp, E. K. (2005). Molecular
assays for targeting human and bovine enteric viruses in
coastal waters and their application for library-independent
source tracking. Applied and Environmental Microbiology,
71(4), 2070–2078.
Formiga-Cruz, M., Hundesa, A., Clemente-Casares, P., Albinana-
Gimenez, N., Allard, A., & Girones, R. (2005). Nested
multiplex PCR assay for detection of human enteric viruses
in shellfish and sewage. Journal of Virological Methods, 125
(2), 111–118.
Gerba, C. P., Gramos, D. M., & Nwachuku, N. (2002).
Comparative inactivation of enteroviruses and adenovirus
2 by UV light. Applied and Environmental Microbiology,
68, 5167–5169.
Grabow, W. O. K., Taylor, M. B., & de Villiers, J. C. (2001).
New methods for the detection of viruses: call for review
of drinking water quality guidelines. Water Science and
Technology, 43, 1–8.
Grasshoff, K., Ehrhardt, M., & Kremling, K. (1983). In
K. Grasshoff, M. Ehrhardt, & K. Kremling (Eds.), Artificial
seawater recipes (pp. 397–399). Weinheim: Verlag Chemie.
Greening, G. E., Hewitt, J., & Lewis, G. D. (2002). Evaluation
of integrated cell culture-PCR (C-PCR) for virological
analysis of environmental samples. Journal of Applied
Microbiology, 93(5), 745–750.
Griffin, D. W., Donaldson, K. A., Paul, J. H., & Rose, J. B.
(2003). Pathogenic human viruses in coastal waters.
Clinical Microbiology Reviews, 16(1), 129–143.
Harley, D., Harrower, B., Lyon, M., & Dick, A. (2001). A
primary school outbreak of pharyngoconjunctival fever
Water Air Soil Pollut (2008) 191:83–93
caused by adenovirus type 3. Communicable Disease
Intelligence, 25(1), 9–12.
He, J. W., & Jiang, S. (2005). Quantification of enterococci and
human adenoviruses in environmental samples by real-
time PCR. Applied and Environmental Microbiology, 71
(5), 2250–2255.
Heerden, J., Ehlers, M. M., Vivier, J. C., & Grabow, W. O.
(2005). Risk assessment of adenoviruses detected in
treated drinking water and recreational water. Journal of
Applied Microbiology, 99, 926–933.
Hernroth, B. E., Conden-Hansson, A. C., Rehnstam-Holm, A. S.,
Girones, R., & Allard, A. K. (2002). Environmental factors
influencing human viral pathogens and their potential
indicator organisms in the blue mussel, Mytilus edulis: the
first Scandinavian report. Applied and Environmental
Microbiology, 68, 4523–4533.
Irving, L. G., & Smith, F. A. (1981). One-year survey of
enteroviruses, adenoviruses, and reoviruses isolated from
effluent at an activated-sludge purification plant. Applied
and Environmental Microbiology, 41, 51–59.
Jiang, S. C. (2006). Human adenoviruses in water: occurrence
and health implications: a critical review. Environmental
Science & Technology, 40(23), 7132–7140.
Jiang, S. C., & Chu, W. (2004). PCR detection of pathogenic
viruses in southern California urban rivers. Journal of
Applied Microbiology, 97(1), 17–28.
Jiang, S., Dezfulian, H., & Chu, W. (2005). Real-time
quantitative PCR for enteric adenovirus serotype 40 in
environmental waters. Canadian Journal Microbiology,
51, 393–398.
Jiang, S., Noble, R., & Chu, W. (2001). Human adenoviruses and
coliphages in urban runoff-impacted coastal waters of South-
ern California. Applied and Environmental Microbiology,
67(1), 179–184.
Ko, G., Cromeans, T. L., & Sobsey, M. D. (2003). Detection of
infectious adenovirus in cell culture by mRNA reverse
transcription-PCR. Applied and Environmental Microbiology,
69, 7377–7384.
Krikelis, V., Markoulatos, P., Spyrou, N., & Serie, C. (1985).
Detection of indigenous enteric viruses in raw sewage
effluents of the city of Athens, Greece, during a two-year
survey. Water Science and Technology, 17, 159–164.
Kumar, S., Tamura, K., & Nei, M. (2004). MEGA3: Integrated
software for Molecular Evolutionary Genetics Analysis and
sequence alignment. Briefings in Bioinformatics, 5, 150–163.
La Rosa, G., Fontana, S., Di Grazia, A., Iaconelli, M.,
Pourshaban, M., & Muscillo, M. (2007). Molecular
identification and genetic analysis of noroviruses gen-
ogroups I and II in water environment: comparative
analysis of different RT-PCR assays. Applied and Envi-
ronmental Microbiology, 73(13), 4152–4161.
La Rosa, G., Muscillo, M., Iaconelli, M., Di Grazia, A.,
Fontana, S., Sali, M., et al. (2006). Molecular character-
ization of human adenoviruses isolated in Italy. New
Microbiology, 29(3), 177–184.
McMillan, N. S., Martin, S., Sobsey, M. D., Wait, D. A.,
Meriwether, R. A., & MacCormack, J. N. (1992).
Outbreak of pharyngoconjunctival fever at a summer
campsNorth Carolina. MMWR, 41, 342–347.
Munoz, F. M., Piedra, P. A., & Demmler, G. J. (1998).
Disseminated adenovirus disease in immunocompromised
Water Air Soil Pollut (2008) 191:83–93
and immunocompetent children. Clinical Infectious Dis-
eases, 27, 1194–1200.
Muscillo, M., La Rosa, G., Carducci, A., Cantiani, L., &
Marianelli, C. (1999). Molecular and biological character-
ization of poliovirus 3 strains isolated in Adriatic seawater
samples. Water Research, 33(14), 3204–3212.
Muscillo, M., La Rosa, G., Marianelli, C., Zaniratti, S.,
Capobianchi, R., Cantiani, L., & Carducci, A. (2001). A
new RT-PCR method for the identification of reoviruses in
seawater samples. Water Research, 35(2), 548–556.
Noble, R. T., & Fuhrman, J. A. (2001). Enteroviruses detected
by reverse transcriptase polymerase chain reaction from
the coastal waters of Santa Monica Bay, California: low
correlation to bacterial indicator levels. Hydrobiologia,
460, 175–184.
Papapetropoulou, M., & Vantarakis, A. C. (1998). Detection of
adenovirus outbreak at a municipal swimming pool by nested
PCR amplification. Journal of Infection, 36, 101–103.
Pehler-Harrington, K., Khanna, M., Waters, C. R., & Henrickson,
K. J. (2004). Rapid detection and identification of human
adenovirus species by adenoplex, a multiplex PCR-enzyme
hybridization assay. Journal of Clinical Microbiology, 42,
4072–4076.
Perriere, G., & Gouy, M. (1996). WWW-query: an on-line
retrieval system for biological sequence banks. Biochimie,
78, 364–369.
Pianetti, A., Baffone, W., Citterio, B., Casaroli, A., Bruscolini, F.,
& Salvaggio, L. (2000). Presence of enteroviruses and
reoviruses in the waters of the Italian coast of the Adriatic
Sea. Epidemiology and Infection, 125, 455–462.
Pichler, M. N., Reichenbach, J., Schmidt, H., Herrmann, G., &
Zielen, S. (2000). Severe adenovirus bronchiolitis in
children. Acta Paediatrica, 89, 1387–1389.
Pina, S., Puig, M., Lucena, F., Jofre, J., & Girones, R. (1998).
Viral pollution in the environment and in shellfish: human
adenovirus detection by PCR as an index of human
viruses. Applied and Environmental Microbiology, 64,
3376–3382.
Pusch, D., Oh, D. Y., Wolf, S., Dumke, R., Schroter-Bobsin, U.,
Hohne, M., et al. (2005). Detection of enteric viruses and
bacterial indicators in German environmental waters.
Archives of Virology, 150(5), 929–947.
Reynolds, K. A., Gerba, C. P., & Pepper, I. L. (1996). Detection
of infectious enteroviruses by an integrated cell culture-
PCR procedure. Applied and Environmental Microbiology,
62, 1424–1427.
Richards, G. P. (1999). Limitations of molecular biological
techniques for assessing the virological safety of foods.
Journal of Food Protection, 62, 691–697.
93
Rose, M. A., Dhar, A. K., Brooks, H. A., Zecchini, F., &
Gersberg, R. M. (2006). Quantitation of hepatitis A virus
and enterovirus levels in the lagoon canals and Lido beach
of Venice, Italy, using real-time RT-PCR. Water Research,
40, 2387–2396.
Sedmak, G., Bina, D., Macdonald, J., & Couillard, L. (2005).
Nine-year study of the occurrence of culturable viruses in
source water for two drinking water treatment plants and the
influent and effluent of a Wastewater Treatment Plant in
Milwaukee, Wisconsin (August 1994 through July 2003).
Applied and Environmental Microbiology, 71, 1042–1050.
Sobsey, M. D., Battigelli, D. A., Shin, G.-A., & Newland, S.
(1998). RT-PCR amplification detects inactivated viruses
in water and wastewater. Water Science and Technology,
38(12), 91–94.
Thurston-Enriquez, J. A., Haas, C. N., Jacangelo, J., &
Gerba, C. P. (2005a). Inactivation of enteric adenovirus
and feline calicivirus by chlorine dioxide. Applied and
Environmental Microbiology, 71, 3100–3105.
Thurston-Enriquez, J. A., Haas, C. N., Jacangelo, J., & Gerba,
C. P. (2005b). Inactivation of enteric adenovirus and feline
calicivirus by ozone. Water Research, 39, 3650–3656.
Thurston-Enriquez, J. A., Haas, C. N., Jacangelo, J., Riley, K.,
& Gerba, C. P. (2003). Inactivation of feline calicivirus
and adenovirus type 40 by UV radiation. Applied and
Environmental Microbiology, 69, 577–582.
Turbow, D. J., Osgood, N. D., & Jiang, S. C. (2003).
Evaluation of recreational health risk in coastal waters
based on enterococcus densities and bathing patterns.
Environmental Medicine, 111, 598–603.
Turner, M., Istre, G. R., Beauchamp, H., Baum, M., & Arnold, S.
(1987). Community outbreak of adenovirus type 7a
infections associated with a swimming pool. Southern
Medical Journal, 80, 712–715.
Van Heerden, J., Ehlers, M. M., & Grabow, W. O. (2005a).
Detection and risk assessment of adenoviruses in swim-
ming pool water. Journal of Applied Microbiology, 99(5),
1256–1264.
Van Heerden, J., Ehlers, M. M., Heim, A., & Grabow, W. O.
(2005b). Prevalence, quantification and typing of adeno-
viruses detected in river and treated drinking water in
South Africa. Journal of Applied Microbiology, 99(2),
234–242.
Van Heerden, J., Ehlers, M. M., Van Zyl, W. B., & Grabow, W.
O. (2003). Incidence of adenoviruses in raw and treated
water. Water Research, 37(15), 3704–3708.
Van Heerden, J., Ehlers, M. M., Van Zyl, W. B., & Grabow, W. O.
(2004). Prevalence of human adenoviruses in raw and treated
water. Water Science and Technology, 50(1), 39–43.