Journal of Heredity, 2019, 651–661

doi:10.1093/jhered/esz049
Original Article
Advance Access publication August 17, 2019

Original Article

Genetic Diversity, Population Structure, and

Migration Scenarios of the Marsupial “Monito
del Monte” in South-Central Chile

Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021

Alejandro Valladares-Gómez, Juan L. Celis-Diez,
Constanza Sepúlveda-Rodríguez, Oscar Inostroza-Michael,
Cristián E. Hernández, and R. Eduardo Palma
From the Laboratorio de Biología Evolutiva, Departamento de Ecología, Facultad de Ciencias Biológicas, Pontificia
Universidad Católica de Chile, Casilla 114-D, Avda. Libertador Bernardo O´Higgins 340, Santiago 6513677, Chile
(Valladares-Gómez, Sepúlveda-Rodríguez, and Palma); the Escuela de Agronomía, Pontificia Universidad Católica de
Valparaíso, Casilla 4-D, Quillota 2260000, Chile (Celis-Diez); and the Laboratorio de Ecología Evolutiva y Filoinformática,
Facultad de Ciencias Naturales y Ocenográficas, Universidad de Concepción, Casilla 160-C, Concepción 40703868,
Chile (Inostroza-Michael and Hernández).

Address correspondence to A. Valladares-Gómez at the address above, or e-mail: avalladares@bio.puc.cl.

Received April 10, 2019; First decision June 2, 2019; Accepted August 6, 2019.

Corresponding Editor: Mark Springer

Abstract
In this study, we quantified the 3 pivotal genetic processes (i.e., genetic diversity, spatial genetic
structuring, and migration) necessary for a better biological understanding and management of
the singular “living-fossil” and near-threatened mouse opossum marsupial Dromiciops gliroides,
the “Monito del Monte,” in south-central Chile. We used 11 microsatellite loci to genotype 47
individuals distributed on the mainland and northern Chiloé Island. Allelic richness, observed
and expected heterozygosity, inbreeding coefficient, and levels of genetic differentiation were
estimated. The genetic structure was assessed based on Bayesian clustering methods. In addition,
potential migration scenarios were evaluated based on a coalescent theory framework and Bayesian
approach to parameter estimations. Microsatellites revealed moderate to high levels of genetic
diversity across sampled localities. Moreover, such molecular markers suggested that at least 2
consistent genetic clusters could be identified along the D. gliroides distribution (“Northern” and
“Southern” cluster). However, general levels of genetic differentiation observed among localities
and between the 2 genetic clusters were relatively low. Migration analyses showed that the most
likely routes of migration of D.  gliroides occurred 1)  from the Southern cluster to the Northern
cluster and 2) from the Mainland to Chiloé Island. Our results could represent critical information
for future conservation programs and for a recent proposal about the taxonomic status of this
unique mouse opossum marsupial.

Keywords: Dromiciops gliroides, geographic genetic variation, Microbiotheria, near-threatened

© The American Genetic Association 2019. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
651
652
The analyses of genetic diversity and population structure along
the geographic distribution of species have received substantial at-
tention in the literature (Almeida et al. 2005; Eckert et al. 2008;
Castellanos-Morales 2015). Such interest has increased, especially
in studies focused on threatened taxa due to the detrimental effects
of human activities resulting in fragmentation, habitat disturb-
ance, and connectivity loss among natural populations (Rodriguez
et  al. 2012; Fietz et  al. 2014; Napolitano et  al. 2014; Li et  al.
2016; Eldridge et al. 2017; Perl et al. 2018). This is because genetic
diversity is crucial for the adaptive potential of natural popula-
tions in the face of environmental changes (Frankham et al. 2005),
and it could be especially reduced in small populations due to the
stronger effects of genetic drift and inbreeding (Lacy et al. 1997;
Bijlsma and Loeschecke 2012). Moreover, on a regional scale,
analysis of genetic structuring has been essential to the identifi-
cation of potential conservation units (Kanthasamy et  al. 2006;
Abdul-Muneer 2014), contributing to setting the geographical
extensions of management programs (Li et  al. 2014; Caballero
et al. 2015). The patterns of migration, connectivity, and gene flow
across geographically separated populations are important inter-
related factors shaping genetic diversity and population structure
(Gustafson et  al. 2017; Thapa et  al. 2018). Gene flow contrib-
utes to maintaining genetic diversity and avoiding strong genetic
structuring (Song et al. 2013; Jangjoo et al. 2016). Low levels of
gene flow among fragmented populations could result in genetic
isolation and could consequently trigger a loss of genetic diver-
sity, a reduction in evolutionary potential and an increase in the
extinction risk of populations (Frankham 2005; Eizaguirre and
Baltazar-Soares 2014). Therefore, the study of genetic diversity,
spatial genetic structuring and patterns of migration, and gene
flow represents crucial information necessary for the better man-
agement of species populations in the current global change scen-
ario (Holland et al. 2017; Wang et al. 2017).
The “Monito del Monte” (Dromiciops gliroides, Thomas
1894) is a very peculiar marsupial due to its singular phylogenetic
relationships, biological characteristics, and key ecological role dis-
played in South American temperate forests (Hershkovitz 1999;
Palma and Spotorno 1999; Celis-Diez et  al. 2012). The “Monito
del Monte” is recognized as a major seed disperser of the flora in
temperate forests (Amico and Aizen 2000; Amico et al. 2009; Celis-
Diez et  al. 2012); thus, the presence of this small mammal is es-
sential for forest regeneration (Rodríguez-Cabal et al. 2007; García
et al. 2009). This mostly arboreal marsupial seems to be particularly
susceptible to the severe fragmentation that has affected the tem-
perate forests due to human activities (Armesto et  al. 2010; Lara
et al. 2012; Fontúrbel et al. 2014). Such susceptibility has been dem-
onstrated in terms of detrimental effects on population abundance
and ecological interactions (Rodriguez-Cabal et al. 2007). However,
understanding of the genetic consequences of forest fragmentation
on this “living-fossil” marsupial, which has been cataloged as “near-
threatened” by the IUCN, represents a critical gap (Martin et  al.
2015). Although intraspecific genetic diversity of D.  gliroides has
been estimated through phylogeographic (Himes et  al. 2008) and
phylogenetic approaches (Suárez-Villota et al. 2018), contemporary
levels of genetic diversity and population structure of this marsupial
remain unknown. Therefore, future studies in D.  gliroides should
be focused on generating such genetic baseline data, which is es-
sential to providing conservation and management guidelines for
threatened marsupials (Li et  al. 2016; Ruiz-Rodriguez et  al. 2016;
Hendricks et al. 2017).
Journal of Heredity, 2019, Vol. 110, No. 6
Dromiciops gliroides has a restricted geographical distribution
between 35 and 43°S in south-central Chile and the adjacent re-
gions of Argentina (Martin 2010). Within that range, D.  gliroides
populations are present both on the mainland and on Chiloé Island
in southern Chile. Former molecular analyses based on mtDNA
markers have suggested that populations of D. gliroides are struc-
tured into 3 phylogeographic clades (Himes et  al. 2008). Two of
these clades included specimens from the Chilean and Argentinean
distributional range: a northern clade or clade A  (36–39°S) and a
southern clade or clade C (40–43°S) that also included Chiloé Island.
A third clade, “B,” was geographically intermediate between clades
A and C but restricted to the Valdivian coastal range in Chile. A later
study that included cranial morphologic variation of the “Monito
Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021
del Monte” assessed by D’Elía et  al. (2016) showed an apparent
concordance with the tripartite phylogeographic structure observed
by Himes et  al. (2008) with mtDNA data. However, D’Elía et  al.
(2016) concluded that each phylogeographic clade (recovered in
Himes et al. [2008] study) constituted a different species of “Monito
del Monte”: Dromiciops bozinovici n.sp. (clade A), Dromiciops
mondaca n.sp. (clade B), and D.  gliroides (clade C). Nevertheless,
the apparent presence of three species of the “Monito del Monte”
has not been supported by recent morphological studies (Valladares-
Gómez et al. 2017; Martin 2018) or by a recent phylogenetic and co-
alescent species delimitation analysis of this species (Suárez-Villota
et al. 2018). Consequently, in light of the most recent morphological
and molecular data, in this study, we will refer to D.  gliroides as
the sole species of “Monito del Monte,” as it has been traditionally
considered.
The phylogeographic structure observed by Himes et al. (2008)
seemed to reflect the great influence of glacial cycles that affected
the biogeographic history of D. gliroides and the rest of the south-
central Chilean biota (Villagrán 1991; Vera-Escalona et  al. 2012;
Palma et al. 2012). In this sense, mtDNA data suggested that after
ice-sheet retreat in the southernmost distributional range of this spe-
cies, migration took place from Chiloé Island and coastal refuges to
the mainland territory that was covered by ice sheets during Last
Glacial Maximum. Conversely, the northernmost distributed indi-
viduals represented a more stable population that was not affected
by LGM ice sheet movements (Himes et al. 2008). However, recent
phylogeographic and genetic population studies using more variable
molecular markers (e.g., microsatellites) have revealed levels of gen-
etic structure, genetic diversity, and migration patterns shaped by the
recent history of diverse mammal species (Vignieri 2005; Napolitano
et al. 2014; Pérez-Alvarez et al. 2015). Microsatellite genotyping rep-
resents one of the most commonly used tools for evaluating the levels
of molecular variability and population structure (Guichoux et  al.
2011; Shamjana et al. 2015; Aranguren-Méndez et al. 2005). Several
examples of microsatellite applications have been reported in threat-
ened marsupial species (Li et al. 2016; Eldridge et al. 2017), as well
as in other mammal taxa (Fietz et al. 2014; Napolitano et al. 2015).
In this study, we analyzed the genetic variation of the “Monito
del Monte” along the distributional range in south-central Chile by
performing a microsatellite screening. Our goals were 1) to quantify
levels of genetic diversity, 2) to assess the genetic structure of popula-
tions, 3) to evaluate potential scenarios of migrations of this marsupial
along its geographic distribution in south-central Chile, and 4) to con-
textualize our data for future conservation planning for the “Monito
del Monte,” and in terms of the recent discussion about its taxonomic
status. Additionally, we provide the first description of highly variable
microsatellite loci for this unique and intriguing species.
Journal of Heredity, 2019, Vol. 110, No. 6
Methods
Study Area and Sample Collection
Samples were collected in native forest fragments along the distribu-
tional range of D. gliroides in mainland Chile, including the northeast
end of Chiloé Island (Figure 1; Table 1). Chiloé Island is located in
Southern Chile between 41 and 43°S, 73 and 74°30′W, in the Los
Lagos Region, and covers an area of approximately 9000 km2. The
island represents the sole insular territory where contemporary
populations of D. gliroides have been observed (Martin 2010). The
northern area of the island is approximately 2.5 km from the closest
point to the mainland, and it is separated by the Chacao channel
(Figure 1). Animal trapping and handling were conducted following
the protocol recommended by Celis-Diez et al. (2012). A 1 mm2 piece
of ear tissue was collected from each individual with an ear-clipper,
and tissue samples were immediately preserved in absolute ethanol
for molecular analysis and stored at room temperature. All specimens
Figure 1.  Map of the study area along Dromiciops gliroides distribution in south-central Chile. PNVPR, Parque Nacional Vicente Pérez Rosales.
653
were manipulated and released after handling, following the standard
bioethical and biosafety protocols proposed by the American Society
of Mammalogists (ASM: Sikes and Gannon 2011). In addition, we
obtained muscle tissue of specimens deposited at the “Colección
de Flora y Fauna Prof. Patricio Sánchez-Reyes,” Departamento de
Ecología, Pontificia Universidad Católica de Chile, Santiago, Chile.
Microsatellite Genotyping
DNA was extracted with the phenol-chloroform protocol. The
pellet was resuspended in 50 mL of ultrapure water and stored at
−20 °C. Samples were genotyped by 12 microsatellite loci designed
by Ecogenics, Zurich-Schlieren (Switzerland) in July 2014 (Table 2).
Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021
PCRs were performed according to the protocol provided by the
manufacturer as follows: 3.1  µL ultrapure water, 1.0  µL 10× PCR
Buffer, 1.0 µL 15 mM MgCl2, 1.0 µL dNTP mix, 0.2 µL F primer, µL
654 Journal of Heredity, 2019, Vol. 110, No. 6

Table 1.  Details of geographic area and sample size (n) of localities analyzed in this study

Geographic area Locality Latitude S Longitude W n Total

Mainland Vilches Alto 35°36′21.32″ 71°04′15.41″ 1 23

Caramávida 37°41′48″ 73°11′49″ 14
Panguipulli 39°31′12.2″ 72°16′57.3″ 2
Parque Oncol 39°42′03″ 73°18′29″ 5
PNVPR 41°10′16″ 72°30′58″ 1
Chiloé Island Caulín 41°50′18.22″ 73°36′21.20″ 6 24
Llanquihue 41°51′34.67″ 73°34′57.44″ 3
Senda Darwin 41°52′56.15″ 73°40′35.75″ 7
Quilar 41°55′50.66″ 73°36′34.95″ 8

PNVPR, Parque Nacional Vicente Pérez Rosales.

Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021

Table 2.  Description of 11 microsatellite loci used in this study to analyze Dromiciops gliroides populations

Locus Primer sequences 5′–3′ Repeat type Size bp No. of alleles HO HE

Drogli00135 F: ACTGAGGACAGTTCAGGCAG (TG)15 150–192 21 0.882 0.924

R: CTAGGCGGTGTCACTAGGAG
Drogli01010 F: GTCACTTAACCCCCACTTGC (ATAG)21 144–212 13 0.820 0.820
R: GAGCAAAACATCCCTGCTCC
Drogli01571 F: TGCCATTGTTATTTGGAAGGTG (AGAT)7 256–296 11 0.804 0.833
R: TGCTAGTCCAACCATTAGGGAG
Drogli01675 F: TTGGGTCTTGGGAATGAAGG (CA)15 225–251 11 0.823 0.742
R: AGAAGGGCTGGTGTGCTATG
Drogli02448 F: AATCTGTTGTGGCCTGAGTG (ATAG)14 209–269 12 0.777 0.764
R: GGATAAAACATGGTCCCTGCC
Drogli03185 F: GAGCTTATCCCCACCCTAGC (ATCT)12 204–324 12 0.639 0.756
R: AGCTGCCCAAAACTGTATGC
Drogli03567 F: CCAGAGTGTCTGCCAAATTCC (TAGA)10 238–358 16 0.937 0.884
R: CTTCTTTGCCTGTCAACATTGG
Drogli03651 F: TGTTGTGAGCCAAACCTGAC (TCTA)21 250–286 9 0.864 0.884
R: GCAGTCATCATACCTTGCCC
Drogli04369 F: GGCTGCCTTGAGTACACATC (GATA)16 184–244 12 0.791 0.885
R: CGACTAACTATTTCCAATGAACTTCTG
Drogli04394 F: GCTAGGCATGTTACCCAACC (ATAG)16 197–245 10 0.880 0.846
R: AGAGCTTAACTTCTGATTGGTCTC
Drogli06596 F: TGGAGCAGTCCCACAAGAAG (AGAT)17 157–201 13 0.776 0.833
R: GCTGCCCACTTGGATCCTC

0.8 R primer, 0.8 µL M13 primer, 0.1 µL HotStarTaq (Taq Platinium),
and 2.0 µL genomic DNA at 60 ng/µL (total PCR volume = 10 µL).
The thermocycling protocol (suggested by Ecogenics) consisted of
a denaturation phase of 95 °C for 15 min; 30 cycles of 95 °C for
30 s, annealing (56 °C) for 45 s, and extension of 72 °C for 45 s;
then, a final amplification round of 8 cycles of 95 °C for 30 s, an-
nealing temperature (56 °C) for 45 s, and 72 °C for 45 s, with a final
extension of 72 °C for 30 min. Microsatellite genotyping was per-
formed at “Servicio de Secuenciación y Genotipado,” Departamento
de Ecología, Facultad de Ciencias Biológicas, Pontificia Universidad
Católica de Chile, Santiago, Chile. Allele scores were obtained with
the program PEAK-SCANNER v1.0 (Applied Biosystems 2006).
Microsatellite Data Analyses
Genetic Diversity
We assessed evidence of genotyping errors, large allele dropouts or
null alleles in our dataset using the program MICRO-CHECKER
v2.2.3 (Van Oosterhout et  al. 2004). Deviations from Hardy–
Weinberg equilibrium (HWE) and evidence for disequilibrium
linkage across the loci were tested in GENEPOP v.4.2 (Raymond
and Rousset 1995; Rousset 2008). Genetic diversity was assessed by
calculating rarefied average allelic richness (Ar) to control for un-
equal population sample size with the program HP-Rare v. June-6-
2006 (Kalinowski 2005). In addition, observed heterozygosity (HO),
expected heterozygosity (HE), and inbreeding coefficient (FIS) were
estimated with the program Arlequin v3.5 (Excoffier et  al. 2005).
The significance of FIS was calculated by 100 000 rounds of permu-
tation tests in the same program.
Population Structure
We evaluated the degree of genetic differentiation of the populations
by calculating pairwise FST indices in GenoDive v2.0b23 (Meirmans
and Van Tienderen 2004). A permutation test with 1000 iterations
was performed to evaluate the significance of FST scores. Population
genetic structure across the D.  gliroides distribution was assessed
by applying the Bayesian clustering approach implemented in the
program STRUCTURE v.2.3.4 (Pritchard et al. 2000). STRUCTURE
was carried out with an admixture model and correlated allele fre-
quencies, a length of the burn-in period of 1  000  000 steps and
10 000 000 Markov Chain Monte Carlo (MCMC) repetitions after
burn-in (Napolitano et al. 2014; Li et al. 2016). STRUCTURE was
Journal of Heredity, 2019, Vol. 110, No. 6
run setting the probable number of genetic clusters or “K” present in
our data from 1 to 6, with 10 iterations of each K. Later, following
Eldridge et al. (2014), we inferred the best value of K applying on
the STRUCTURE output the maximum posterior probability or
L[K] (Pritchard et  al. 2000) and maximum delta log likelihood or
DK (Evanno et  al. 2005) methods. Both of these algorithms were
integrated into the program STRUCTURE HARVESTER v0.6.94
(Earl and vonHoldt 2012). In addition to STRUCTURE analyses, we
also applied the Bayesian algorithms implemented in GENELAND
v3.1.5 (Guillot et al. 2005) to assess the number of genetic popula-
tions present in our dataset and to delineate its spatial boundaries.
The latter analysis was performed based on the null allele and uncor-
related frequency model, with 5 000 000 MC iterations, 100 thin-
ning steps and defining the K value from 1 to 6. Finally, we explored
isolation by distances (IBD) calculating the correlation between geo-
graphic and genetic distance matrices by applying a Mantel test with
9999 permutations steps in the program GENEALEXv6.5.
Migration Scenarios
To evaluate the historical migration scenarios among the populations
of D.  gliroides, we used the software Migrate-n v 3.6 (Beerli and
Palczewski 2010). This program allows estimation of effective popu-
lation sizes (θ = 4Neµ, where Ne is the historical effective population
size) and migration rates (M = mh/µ, µ is the mutation rate per gener-
ation) between population pairs based on a coalescent theory frame-
work. We fit different migration models for 2 migration scenarios:
first, a set of models to evaluate migration between the Northern
and Southern clusters (see Results), and second, a set of models to
evaluate migration routes between the Mainland and Chiloé Island,
(Supplementary Figure 1). Within these 2 scenarios, we set 4 theor-
etically possible historical migration routes: 1)  a Panmictic model,
where the 2 populations (Northern-Southern or Mainland-Chiloé
Island) were assumed to be part of the same panmictic group; 2) a
one direction model, where each population has different population
sizes and only migration of individuals from a particular popula-
tion was allowed (from Southern to Northern cluster or from Chiloé
Island to Mainland); 3) same as the previous model, but migration
was allowed in the opposite direction (from Northern to Southern
cluster or from Mainland to Chiloé Island; and 4) a Full model, with
the 2 population sizes estimated and migration allowed to occur at
different rates between the 2 populations. We used the Brownian
motion approximation to the stepwise ladder model, and parameters
were estimated using a Bayesian approach. We estimated θ and M
of each model by means of slice sampling and exponential window
prior distribution (θ range: 0–1000, mean = 500, delta range = 100;
M range: 0–1,000, mean = 500, delta range = 100). Four long chains
were run, with 20 000 000 genealogies sampling each 2000th (i.e.,
saving 10  000 genealogies) iteration after a burn-in of the first
2 000 000 genealogies for each chain. We used the suggested static
Table 3.  Genetic diversity in Dromiciops gliroides by locality
Locality No. of alleles HO
Caramávida 9.455 ± 1.635 0.805 ± 0.197
Parque Oncol 5.273 ± 1.421 0.809 ± 0.158
Senda Darwin 5.727 ± 1.489 0.838 ± 0.197
Caulín 4.727 ± 1.009 0.752 ± 0.197
Quilar 5.818 ± 1.722 0.731 ± 0.182
Ar, allelic richness; HO, observed heterozygosity; HE, expected heterozygosity; FIS, inbreeding coefficient, P, P values for significance of FIS after a 1000 permu-
tation test. Localities with low sample sizes are not shown (Vilches Alto, Panguipulli, PNVPR, and Llanquihue).
655
heating scheme at 4 temperatures (1.0, 1.5, 3.0, 1  000  000) for a
better search in the genealogy parameter space. The marginal likeli-
hoods of each model were estimated by mean thermodynamic inte-
gration, which was used for the model comparison through the use
of the Bayes Factor (Kass and Raftery 1995).
Results
Genetic Diversity
MICROCHECKER did not detect the presence of genotyping errors,
allele dropouts, or null alleles in our data, except in the population
of Caramávida, where one null allele was detected (Drogli_04369).
Significant deviation from the HWE was only observed in the
Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021
loci Drogli_01675 and Drogli_04369 in Caramávida, locus
Drogli_03567 in Senda Darwin and locus Drogli_00135 in Caulín.
We did not detect the occurrence of linkage disequilibrium when
evaluating each pair of loci across all populations, except for pairs
Drogli_05055/Drogli_06596 and Drogli_05055/Drogli_00135. To
avoid pseudoreplication for statistical analyses, we discarded the
locus Drogli_05055 from our data set. Thus, the results presented in
this study correspond to the analysis of the remaining 11 microsatel-
lite loci. A summary of the overall genetic diversity per locus across
the 47 sampled individuals is given in Table 2. The number of alleles
per locus ranged from 9 (Drogli_03651) to 21 (Drogli_00135) al-
leles. The microsatellite size ranged from 144 to 358  bp. Loci ob-
served and expected heterozygosity ranged from 0.639 to 0.937 and
from 0.742 to 0.924, respectively.
Levels of genetic diversity along the distribution of the “Monito
del Monte” are given in Table 3. We presented data for localities with
sample sizes ≥5. In general, the observed heterozygosity values were
lower than the expected heterozygosity values within all sampled lo-
calities, except for Senda Darwin, Chiloé Island. Higher levels of gen-
etic diversity were detected in the mainland locality of “Caramávida,”
a remnant of a well-conserved temperate forest fragment of the
“Nahuelbuta mountains.” The last mountains extend along 200
km between 36°49′–38°38′S in the Chilean coastal range (Otavo
and Echeverría 2017). The localities from Chiloé Island, Caulín
and Quilar resulted in the lowest values of observed heterozygosity.
Higher values of inbreeding coefficients were observed in the local-
ities of Caulín and Quilar (Chiloé Island). However, inbreeding coef-
ficients were not significant for the analyzed localities in this study.
Population Structure
After running Structure Harvester, both DK and L[K] methods
indicated K  =  2 as the most likely number of genetic clusters
(Supplementary Figure 2). STRUCTURE analysis for K = 2 is shown
in Figure 2. The analysis suggested the presence of one relatively
well-defined genetic cluster that included individuals belonging to
HE FIS P
0.867 ± 0.042 0.024 0.283
0.823 ± 0.074 −0.076 0.914
0.813 ± 0.071 −0.036 0.733
0.799 ± 0.085 0.085 0.198
0.833 ± 0.074 0.101 0.063
656 Journal of Heredity, 2019, Vol. 110, No. 6

Figure 2.  Genetic structure analysis of Dromiciops gliroides in STRUCTURE. The STRUCTURE output is shown for K= 2. Each vertical bar represents a different
individual. The depth of color is proportional to the probability of belonging to the “Northern cluster” (dark gray) or to the “Southern cluster” (light gray).
PNVPR,Parque Nacional Vicente Pérez Rosales. The arrow indicates the limit between the mainland and Chiloé Island.

Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021

Figure 3.  Results of the spatial structuring analysis in GENELAND suggesting four genetic clusters. Maps of posterior probability belonging to the clusters 1,
2, 3, and 4 are shown.

the northernmost sampled distribution of the “Monito del Monte”
on the mainland. This “Northern cluster” included individuals from
Vilches Alto, Caramávida, and Panguipulli. The second cluster, or
“Southern cluster,” grouped all individuals from the southernmost
distribution of D.  gliroides, including mainland and insular local-
ities: 1) on the mainland: Parque Nacional Vicente Pérez Rosales or
PNVPR and Parque Oncol (Valdivian coastal range); and 2) Chiloé
Island: Senda Darwin, Caulín, Quilar, and Llanquihue.
The GENELAND analysis recovered 4 genetic clusters (Figure 3).
Cluster 1 corresponded to individuals from the Vilches Alto locality,
with a posterior probability of 0.8; Cluster 2 grouped together
individuals from Chiloé Island, Parque Nacional Vicente Pérez
Rosales and Parque Oncol (Valdivia), with a posterior probability
of 0.9; Cluster 3 corresponded to individuals from Caramávida
(Nahuelbuta mountains), with a posterior probability of 0.9; Cluster
4 corresponded to individuals from Panguipulli, with a posterior
probability of 0.7 (Figure 3).
The FST value indicated little genetic differentiation between
the “Northern” and “Southern” clusters (FST  =  0.034, P ≤ 0.001).
Moreover, when evaluating FST values between pairwise localities, the
latter score showed low to moderate levels of genetic differentiation
ranging from 0.016 to 0.074 (FST level interpretation followed that
of Freeland et al. 2011).
Migration Scenarios
The analysis with Migrate-n suggested that there would be asym-
metric gene flow between the Northern-Southern cluster and the
Mainland-Chiloé Island cluster. In fact, the most likely migration
scenario for the set of models that evaluated migration between
the Northern and Southern clusters was the “Southern-Northern”
model. On the other hand, the most likely migration scenario for the
set of models that evaluated migration between the Mainland and
Chiloé Island was the “Mainland-Chiloé Island” model (Table 4).
Discussion
To our knowledge, this is the first study that uses microsatellite
markers to assess geographic genetic variation (i.e., genetic diversity,
spatial genetic structuring and migration) in D.  gliroides. Former
mtDNA studies assessed the secular processes of historical biogeog-
raphy and the postglacial recolonization dynamics of this species
Journal of Heredity, 2019, Vol. 110, No. 6
Table 4.  Evaluation of the best migration models (values in bold) ac-
cording to the log-probability of data indicating“marginal likelihood”
(log ML), Bayes factor (BF), and model probability (MP)
Migration models Log ML BF MP
a) Between the Northern and Southern cluster
 Panmictic −1356.91 −222.26 5.5E-49
  Southern-Northern −1245.78 0.00 1 “Monito del Monte.” For example, individuals from Vilches Alto,
 Northern-Southern −1270.65 −49.74 1.6E-11
 Full −3336.64 −4181.72 0
b) Between the Chiloé Island and Mainland
 Panmictic −1408.02 −122.56 2.4E-27
  Chiloé Island-Mainland −1384.23 −74.98 5.2E-17
  Mainland-Island −1346.74 0 1
 Full −6329.28 −9965.08 0 Vilches Alto (sample size n = 1) and Panguipulli (sample size n = 2)
(Himes et al. 2008). Here, we described a set of highly polymorphic
microsatellite loci that were sufficiently sensitive to reveal the current
levels of genetic diversity and population structure of D.  gliroides
along its distribution in south-central Chile. This information par-
tially fills a critical gap within marsupials because microsatellite loci
are currently available for a few living marsupial species (Eldridge
2010). Furthermore, as microsatellite markers have been widely
used for conservation purposes (Arif et  al. 2011; Witzenberg and
Hochkirch 2011), our results represent valuable genetic data that
could be considered in the management of D. gliroides populations.
Moreover, conservation of this species is critical for marsupial rich-
ness and understanding evolution because Dromiciops represents the
last living lineage of the ancient order Microbiotheria (Reig 1955).
In this study, we detected moderate to high levels of genetic di-
versity across D. gliroides populations. The overall genetic diversity
along the sampled geographic range of this species was HO = 0.818 ±
0.023 and HE = 0.870 ± 0.012 (mean ± SD). Comparatively, such
levels of genetic diversity are relatively high within marsupial lin-
eages. For example, a review of published microsatellite data
estimating genetic diversity across 209 marsupial populations of
different marsupial families reported that values of HE ranged from
0.05 to 0.90 (0.66 ± 0.01; mean ± SE) (Eldridge 2010). Future con-
servation strategies for the “Monito del Monte” should be focused
on the maintenance of these levels of genetic diversity, which are
crucial for the persistence of populations of this unique marsupial
taxon (Lacy 1997; Bijlsma and Loeschcke 2012). Promotion of
connectivity and gene flow among local ecological populations of
the “Monito del Monte” is critical to preserve its genetic diversity
(Frankham et  al. 2005). Unfortunately, connectivity among popu-
lations of D. gliroides might be seriously threatened because of the
dramatic fragmentation of the native habitat as a consequence of
ongoing human activities from the last centuries through the present
(Echeverría et al. 2006; Lara et al. 2012). Arboreal marsupials are
particularly susceptible to habitat fragmentation due to their low
capacity to move through anthropogenic habitats such as prairies
and agriculture lands (Johnstone et al. 2010; Lancaster et al. 2011;
Pacioni et al. 2011). In D. gliroides, habitat fragmentation caused
a decrease in population abundance and an interruption of their
strong mutualistic relationships with the native flora of temperate
forests (Rodríguez-Cabal et al. 2007; García et al. 2009). However,
the genetic consequences of fragmentation remain unknown in this
species, an issue that should be urgently evaluated in future studies.
On the other hand, we assessed the population structure
of D.  gliroides by applying the Bayesian methods integrated in
STRUCTURE and GENELAND. Both of these analyses were
657
consistent in detecting a major “Southern cluster” (39°42′–41°55′S
approximately). This cluster suggested a genetic connection between
individuals from Chiloé Island and from the southernmost mainland
distribution of D.  gliroides, including the Valdivian coastal range.
Nevertheless, with respect to the “Northern cluster” detected by
STRUCTURE, the GENELAND analysis showed a more complex
pattern of structuring in the northernmost distribution of the
Caramávida and Panguipulli (the “Northern cluster” according to
the STRUCTURE analysis) were assigned to 3 different clusters in
GENELAND, with each individual assigned to its own cluster. A pos-
sible explanation for this would be that the low prior genetic infor-
mation for the Bayesian approach of two Cluster-Localities such as
Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021
produced spurious results in the posterior cluster assignment gener-
ated by GENELAND, recovering these localities as separate clusters.
The latter is consistent with the fact that the posterior probabilities
of these clusters were low (Vilches Alto  =  0.8; Panguipulli  =  0.7).
Therefore, we do not have enough evidence to support the exist-
ence of these apparent clusters in the northern distribution of the
“Monito del Monte.” On the other hand, if the sample size caused
difficulties in the clustering, the sole sample from Parque Nacional
Vicente Pérez Rosales in the southernmost distribution should also
have represented an independent cluster. Nevertheless, this sample
was successfully assigned to the “Southern cluster.” Another possi-
bility is that the georeferenced data included in the GENELAND
analysis (but not in STRUCTURE) provided evidence about the rele-
vance of latitudinal distance in shaping the current genetic popula-
tion structure of D. gliroides. Partial support for this hypothesis is
the observed significant correlation between geographic and genetic
distances in the Mantel test (r  =  0.597; P  =  0.015). When we dis-
carded all localities with low sample sizes in a second GENELAND
analysis (Vilches Alto n = 1, Panguipulli n = 2 and Parque Nacional
Vicente Pérez Rosales n = 1), we corroborated the occurrence of the
“Southern cluster” (Chiloé Island localities plus the Valdivian Coastal
range), whereas Caramávida in Nahuelbuta was recognized as a
different cluster (“Northern cluster”), as shown by STRUCTURE
(Supplementary Figure 3). In summary, our population structure
analyses consistently suggested the existence of at least 2 main gen-
etic clusters along the geographic distribution of the “Monito del
Monte”: a “Northern cluster” and a “Southern cluster,” with a geo-
graphic limit occurring at approximately 39°31′S. This geographic
limit could be an imprint of the Pleistocene ice dynamics that deeply
affected the molecular diversity of this marsupial, a scenario previ-
ously detected by mtDNA (Himes et al. 2008) and now recovered
by our microsatellite analysis. Gene flow interruption between the
2 genetic clusters due to current geographic barriers (such as rivers
or mountains) seems to be less likely at latitude 39°31′S. However,
the strong forest fragmentation that has been occurring around that
latitude represents an important barrier to the gene flow of arboreal
marsupials (Li et al. 2016). As the forests of south-central Chile have
been deeply fragmented during the last centuries (Lara et al. 2012),
this scenario could be an important barrier to the connectivity be-
tween the northern and southern populations of the “Monito del
Monte.” However, further studies are required to test this hypothesis.
The geographic genetic structure detected through the micro-
satellite data for D.  gliroides partially agreed with previous
phylogeographic structure revealed by mtDNA (Himes et al. 2008).
Our results might corroborate the occurrence of a differentiable
genetic group between 35–39°S, as Himes et al. (2008) proposed
(clade A). However, microsatellites did not recover the other two
658
genetic groups south of 39°S that were obtained with mtDNA
(clades B and C sensu Himes et  al. 2008). Rather, our analyses
were consistent in showing that clade B (Valdivian coastal range)
and clade C (Chiloé Island plus mainland territory south of 40°S)
were grouped in a unique “Southern” genetic cluster by microsatel-
lites. Clade B could correspond to a coastal refuge that might allow
populations to genetically intermingle with nearby populations
after glacial retreat, thus homogenizing any differentiation due to
isolation. Thus, this is the type of genetic signal of a fast-evolving
genetic marker that could now be detected through microsatellites.
In line with Himes’ et al. (2008) conclusions, genetic similarity be-
tween insular and mainland individuals of D. gliroides detected by
microsatellite screening could be a remnant of the historical gen-
etic interchanges that occurred from Chiloé Island to the mainland
during the Pleistocene glaciations. Furthermore, microsatellites
suggested that a low postglacial genetic differentiation occurred
between insular and nearby mainland populations. In addition, the
results of the MIGRATE analysis suggested a Southern-Northern
movement of Dromiciops with the highest probability (which
agreed with Himes et  al. (2008) results), and a Mainland-Island
scenario is also likely. In fact, the low genetic differentiation be-
tween the populations of the “Monito del Monte” on both sides
of the Chacao Channel suggests that this geographic separation
is recent and may be related to the glacial bridge created during
the LGM (from 26 000 to 14 700 years BP; Mercer 1976, Heusser
and Flint 1977). Indeed, a sea level drop of up to 120 m below the
present level has been reported during the LGM, connecting the
mainland with the island through a land bridge along the exposed
continental shelf (Moreno et  al. 1994). This land bridge might
have allowed the crossing of biota between the mainland and the
Chiloé archipelago. Colonization of D. gliroides toward the south,
and particularly to Chiloé Island, may have occurred from ice-free
zones (refugia) both from the southern portion of the coast in the
mainland and from the lowlands along the pre-Andean areas also
in the mainland. Similar colonization routes from the mainland to
Chiloé Island (although not contemporary) have been proposed for
the colonization of the iguanid lizard Liolaemus pictus from the
mainland (Antillanca, Las Cascadas) to Chiloé Island (Vidal et al.
2012). Finally, we do not have evidence of current waif dispersal,
rafting, or swimming of “Monito del Monte” (as has been evi-
denced for other small mammal taxa, Gascon et al. 2000; Matocq
et al. 2000) across the Chacao Channel, or promoted by anthropo-
genic activities. However, we cannot discard any of the former
scenarios to explain the relatedness between island and mainland
populations of this marsupial.
Furthermore, microsatellites showed that individuals from the
Valdivian coastal range were not genetically differentiable from individ-
uals from Chiloé Island and the nearby mainland. Such data could sug-
gest current contemporary gene flow among populations of the “Monito
del Monte” south of 39°S. This scenario was partially supported by the
MIGRATE analysis that suggested an alternative Southern-Northern
migration scenario as the most likely route for Dromiciops.
Despite the genetic structure detected with microsatellites,
our data showed that current levels of genetic differentiation in
D.  gliroides were low to moderate across the entire sampled geo-
graphic distribution. Even, FST analysis revealed a low degree of
genetic differentiation when overall “Northern” versus “Southern”
genetic clusters were compared. Low levels of geographical vari-
ation for the “Monito del Monte” were also observed by morpho-
logical data (Valladares-Gómez et al. 2017; Martin 2018). However,
in terms of spatial structuring, genetic and morphologic data did
Journal of Heredity, 2019, Vol. 110, No. 6
not show congruent patterns. Our data suggested that the current
genetic structure of this species could be partially shaped by histor-
ical processes, such as Pleistocene migrations, as well as an isolation
by distance scenario. On the other hand, morphological variation
could be determined mainly by variation in local environmental
conditions (Maldonado et al. 2001, 2004). Additionally, molecular/
morphological incongruence could result, for example, from similar
selection pressures at different places leading to similar forms with
different genetic backgrounds (Pissard et al. 2008).
Implications of Our Data for the Conservation of the
“Monito del Monte” and Recent Discussion About
Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021
Its Taxonomic Status
In a geographic context, where should conservation efforts be fo-
cused in D. gliroides? Our data suggested that conservation solely
based on isolated protected areas could be inadequate to ensure the
overall maintenance of genetic diversity of this species. However,
some of the localities analyzed in this study were characterized by
their genetic uniqueness (e.g., Senda Darwin in Chiloé Island and
Caramávida in the Nahuelbuta mountains). Therefore, such areas
could require special attention in conservation programs as poten-
tial reservoirs of the genetic identity of the “Monito del Monte.”
Alternative possibilities should focus on some of the genetic clusters
detected by microsatellites, that is, “Northern” or “Southern” clus-
ters. However, we should approach the value of these clusters as
eventual distinct conservation units with caution since the level of
genetic differentiation between these genetic clusters was low, and
no evidence of restricted gene flow between them was suggested by
our data. Overall, we think that the recommended level of conser-
vation strategies should consider the entire distributional range of
the “Monito del Monte” in south-central Chile. This is because our
data suggest that despite the genetic structuring detected by micro-
satellites, this species constitutes a unique taxonomic entity with po-
tential current gene flow among its populations distributed along
south-central Chile.
With respect to the recent discussion about the taxonomic status
of the “Monito del Monte,” a molecular study by Suarez-Villota
et  al. (2018) agreed with our data in rejecting the existence of 3
taxonomic entities [“species” as proposed by D`Elía et al. (2016)].
Thus, in agreement with the results of Suarez-Villota et al. (2018),
our microsatellite data recovered 2 main geographic genetic groups
along the distribution of Dromiciops. However, this genetic struc-
ture does not seem to be associated with the occurrence of different
species of the “Monito del Monte” (i.e., D. bozinovici in the north-
ernmost distribution vs. D.  gliroides in the southernmost range).
Additionally, the occurrence of D.  mondaca, the Chilean endemic
form of the “Monito del Monte” sensu D´Elía et al. (2016), does not
have any support according to our data. Microsatellites suggested
that Valdivian samples of Dromiciops (to which “mondaca” forms
would belong) constituted the same genetic population compared
with individuals from Chiloé Island and the mainland, south of 39°S.
Consequently, our data showed that despite the subtle genetic struc-
ture observed in the “Monito del Monte,” this taxon would repre-
sent a unique taxonomic entity along its entire geographic range,
as “Dromiciops gliroides.” Therefore, our results corroborate re-
cent findings that rejected the occurrence of additional species of
Dromiciops (Valladares-Gómez et  al. 2017; Martin 2018; Suárez-
Villota et al. 2018).
We hope that our study will stimulate researchers to generate
new genetic data for a better understanding of the genetic variation
Journal of Heredity, 2019, Vol. 110, No. 6
of D.  gliroides. For example, considering the eventual limitations
of microsatellite data interpretation in population genetics ana-
lyses (Putman and Carbone 2014), the application of new genetic
approaches, such as next-generation sequencing, could contribute
to corroborating our findings about the general levels of genetic di-
versity, the population structure and the migration scenarios of this
marsupial. In terms of sampling, additional efforts should be made
to increase the sample size and the geographical extension of a study
similar to this. For example, a recommendation would be to fill the
geographic gaps located between the Araucanía Region toward the
northernmost distributional range of the “Monito del Monte” in
Chile and along the temperate forests of Argentina. Insular sampling
is required to extend to south-central Chiloé Island. Furthermore,
broader sampling would be necessary to show the negative genetic
effects of forest fragmentation on the genetic diversity and connect-
ivity of D.  gliroides populations. This is crucial for the conserva-
tion of this unique “living fossil” marsupial that occurs in a highly
human-altered landscape.
Supplementary Material
Supplementary data are available in Journal of Heredity online.
Funding
This work was supported by projects of the Fondo Nacional de
Desarrollo Científico y Tecnológico, Chile (FONDECYT 1130467,
1170761, 1170815, and 1170486), Puente Project 2016 from
Vicerrectoría de Investigación, Pontificia Universidad Católica de
Chile to R.E.P., Comisión Nacional de Investigación Científica y
Tecnológica CONICYT PFB-23 to J.L.C.-D., Colegio de Programas
Doctorales, Vicerrectoría de Investigación, Pontificia Universidad
Católica de Chile and PMI UC1203  “Convenio de Desempeño de
Internacionalización de Programas de Doctorado,” MECESUP,
Ministerio de Educación, Gobierno de Chile, “Beca para estudios
de doctorado en Chile, CONICYT, to A. V.-G. (21100625) and to
O.  I.-M. (21161719), EDPG LPR-161 project of the Dirección de
Postgrado, Universidad de Concepción to C.E.H. and O.I.-M. This
research contributes to the Research Program of Senda Darwin
Biological Station and LTSER-Chile network.
Acknowledgments
We especially acknowledge the collaboration provided by Sr. Patricio
Zavala, Curator of the Colección de Flora y Fauna Prof. Patricio Sánchez
Reyes, Pontificia Universidad Católica de Chile, and Andrés Charrier from
the Institute of Ecology and Biodiversity. We also thank Servicio Agrícola
y Ganadero (SAG) and Corporación Nacional Forestal (CONAF) for their
collection permits. We thank Paulo Zepeda Lab. Manager, Laboratorio
de Biología Evolutiva, Departamento de Ecología, Facultad de Ciencias
Biológicas, Pontificia Universidad Católica de Chile, to Raúl Araya and
Alejandra Fabres, graduate students at the Facultad de Ciencias, Universidad
de Chile. J.L.C.-D.  is Associate Research of Instituto de Ecología y
Biodiversidad (IEB), Chile.
Data Availability
We have deposited the primary data underlying these analyses in
Dryad under doi:10.5061/dryad.5553b5q.
659
References
Abdul-Muneer  PM. 2014. Application of microsatellite markers in conser-
vation genetics and fisheries management: recent advances in popula-
tion structure analysis and conservation strategies. Genet Res Int. 2014,
691759.
Almeida  FC, Maroja  LS, Moreira  MAM, Seuánez  HN, Cerqueira  R. 2005.
Population structure and genetic variability of mainland and insular
populations of the Neotropical water rat, Nectomys squamipes (Rodentia,
Sigmodontinae). Genet Mol Biol. 28:693–699.
Amico G, Aizen MA. 2000. Mistletoe seed dispersal by a marsupial. Nature.
408:929–930.
Amico GC, Rodríguez-Cabal MA, Aizen MA. 2009. The potential key seed-
dispersing role of the arboreal marsupial Dromiciops gliroides. Acta
Oecol. 35:8–13.
Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021
Aranguren-Méndez  JA, Román-Bravo  R, Isea  W, Villasmil  Y, Jordana  J.
2005. Los microsatélites (STR’s), marcadores moleculares de ADN por
excelencia para programas de conservación: una revisión. Arch Latinoam
Prod Anim. 13:1–6.
Arif IA, Khan HA, Bahkali AH, Al Homaidan AA, Al Farhan AH, Al Sadoon M,
Shobrak  M. 2011. DNA marker technology for wildlife conservation.
Saudi J Biol Sci. 18:219–225.
Armesto JJ, Manuschevich D, Mora A, Smith-Ramirez C, Rozzi R, Abarzúa AM,
Marquet PA. 2010. From the Holocene to the Anthropocene: a historical
framework for land cover change in southwestern South America in the
past 15,000 years. Land Use Policy. 27:148–160.
Azzaroli  A. 1996. Processes of island colonization by terrestrial organism.
Biogeographia. 18: 33–50.
Beerli P, Palczewski M. 2010. Unified framework to evaluate panmixia and mi-
gration direction among multiple sampling locations. Genetics. 185:313–326.
Bijlsma R, Loeschcke V. 2012. Genetic erosion impedes adaptive responses to
stressful environments. Evol Appl. 5:117–129.
Caballero S, Correa-Cárdenas CA, Trujillo F. 2015. Population structure and
genetic diversity of the endangered south American giant otter (Pteronura
brasiliensis) from the Orinoco basin in Colombia: management im-
plications and application to current conservation programs. J Hered.
106(Suppl 1):469–477.
Castellanos-Morales G, Ortega J, Castillo-Gámez RA, Sackett LC, Eguiarte LE.
2015. Genetic variation and structure in contrasting geographic distribu-
tions: widespread versus restricted black-tailed prairie dogs (Subgenus
Cynomys). J Hered. 106(Suppl 1):478–490.
Celis-Diez  JL, Hetz  J, Marín-Vial  PA, Fuster  G, Necochea  P, Vásquez  RA,
Jaksic FM, Armesto JJ. 2012. Population abundance, natural history, and
habitat use by the arboreal marsupial Dromiciops gliroides in rural Chiloé
Island, Chile. J Mammal. 93:134–148.
D’Elía  G, Hurtado  N, D’Anatro  A. 2016. Alpha taxonomy of Dromiciops
(Microbiotheriidae) with the description of 2 new species of monito del
monte. J Mammal. 97:1136–1152.
Earl  DA, von  Holdt  BM. 2012. STRUCTURE HARVESTER: a website and
program for visualizing STRUCTURE output and implementing the
Evanno method. Conserv Genet Res. 4:359–361.
Echeverria C, Coomes D, Salas J, Rey-Benayas JM, Lara A, Newton A. 2006.
Rapid deforestation and fragmentation of Chilean temperate forest. Biol
Conserv. 130:481–494.
Eckert CG, Samis KE, Lougheed SC. 2008. Genetic variation across species’
geographical ranges: the central-marginal hypothesis and beyond. Mol
Ecol. 17:1170–1188.
Eizaguirre C, Baltazar-Soares M. 2014. Evolutionary conservation—evaluating
the adaptive potential of species. Evol Appl. 7:963–967.
Eldridge  MDB. 2010. Marsupial population and conservation genetics. In:
Deakin JE, Waters PD, Graves JAM, editors. Marsupial genetics and gen-
omics, 1st edn. Springer. p. 461–497.
Eldridge  MD, Miller  EJ, Neaves  LE, Zenger  KR, Herbert  CA. 2017. Exten-
sive genetic differentiation detected within a model marsupial, the tammar
wallaby (Notamacropus eugenii). PLoS One. 12:e0172777.
660
Eldridge  MD, Potter  S, Johnson  CN, Ritchie  EG. 2014. Differing impact
of a major biogeographic barrier on genetic structure in two large
kangaroos from the monsoon tropics of Northern Australia. Ecol Evol.
4:554–567.
Evanno G, Regnaut S, Goudet J. 2005. Detecting the number of clusters of in-
dividuals using the software STRUCTURE: a simulation study. Mol Ecol.
14:2611–2620.
Excoffier  L, Laval  G, Schneider  S. 2005. Arlequin v3.5: an integrated soft-
ware package for population genetic data analysis. Evol Bioinform On-
line. 1:47–50
Fietz J, Tomiuk J, Loeschcke V, Weis-Dootz T, Segelbacher G. 2014. Genetic
consequences of forest fragmentation for a highly specialized arboreal
mammal–the edible dormouse. PLoS One. 9:e88092.
Fontúrbel  FE, Candia  AB, Salazar  DA, Malebrán  J, González-Browne  C,
Botto-Mahan  C. 2014. How forest marsupials are affected by habitat
degradation and fragmentation? A  meta-analysis. Naturwissenschaften.
101:599–602.
Frankham R. 2005. Genetics and extinction. Biol Conserv. 126:131–140.
Freeland JR, Kirk H, Petersen SD. 2011. Molecular ecology. 2nd ed. Oxford,
UK: Wiley-Blackwell. p. 134–135.
García D, Rodríguez-Cabal MA, Amico GC. 2009. Seed dispersal by a frugiv-
orous marsupial shapes the spatial scale of a mistletoe population. J Ecol.
97:217–229.
Gascon  C, Malcolm  JR, Patton  JL, da  Silva  MNF, Bogart  JP, Lougheed  SC,
Peres CA, Neckel S, Boag PT. 2000. Riverine barriers and the geographic
distribution of Amazonian species. PNAS. 97:13672–13677.
Guichoux E, Lagache L, Wagner S, Chaumeil P, Léger P, Lepais O, Lepoittevin C,
Malausa T, Revardel E, Salin F, et al. 2011. Current trends in microsatellite
genotyping. Mol Ecol Resour. 11:591–611.
Guillot G, Mortier F, Estoup A. 2005. Geneland: a computer package for land-
scape genetics. Mol Ecol Notes. 5:712–715.
Gustafson  KD, Vickers  TW, Boyce  WM, Ernest  HB. 2017. A single migrant
enhances the genetic diversity of an inbred puma population. R Soc Open
Sci. 4:170115.
Hendricks S, Epstein B, Schönfeld B, Wiench C, Hamede R, Jones M, Storfer A,
Hohenlohe  P. 2017. Conservation implications of limited genetic diver-
sity and population structure in Tasmanian devils (Sarcophilus harrisii).
Conserv Genet. 18:977–982.
Hershkovitz  P. 1999. Dromiciops gliroides Thomas, 1894, last of
the Microbiotheria (Marsupialia), with a review of the family
Microbiotheriidae. Fieldiana Zool. 93:1–60.
Heusser  CJ, Flint  RF. 1977. Quaternary glaciations and environments of
northern Isla Grande de Chiloé, Chile. Geology. 5:305–308.
Himes CMT, Gallardo MH, Kenagy GJ. 2008. Historical biogeography and
post-glacial recolonization of South American temperate rain forest by
the relictual marsupial Dromiciops gliroides. J Biogeogr. 35:1415–1424.
Holland LP, Jenkins TL, Stevens JR. 2017. Contrasting patterns of population
structure and gene flow facilitate exploration of connectivity in two widely
distributed temperate octocorals. Heredity (Edinb). 119:35–48.
Jangjoo  M, Matter  SF, Roland  J, Keyghobadi  N. 2016.Connectivity rescues
genetic diversity after a demographic bottleneck in a butterfly population
network. PNAS. 113:10914–10919.
Johnstone CP, Reina RD, Lill A. 2010. Impact of anthropogenic habitat frag-
mentation on population health in a small, carnivorous marsupial. J
Mammal. 91:1332–1341.
Kalinowski ST. 2005. HP-Rare: a computer program for performing rarefac-
tion on measures of allelic diversity. Mol Ecol Notes. 5:187–189.
Kanthaswamy S, Kurushima JD, Smith DG. 2006. Inferring Pongo conserva-
tion units: a perspective based on microsatellite and mitochondrial DNA
analyses. Primates. 47:310–321.
Kass RE, Raftery AE. 1995. Bayes factors. J Am Stat Assoc. 90:773–795.
Lacy RC. 1997. Importance of genetic variation to the viability of mammalian
populations. J Mammal. 78:320–335.
Lancaster ML, Taylor AC, Cooper SJ, Carthew SM. 2011. Limited ecological
connectivity of an arboreal marsupial across a forest/plantation landscape
despite apparent resilience to fragmentation. Mol Ecol. 20:2258–2271.
Journal of Heredity, 2019, Vol. 110, No. 6
Lara  A, Solari  ME, Prieto  MDR, Peña  MP. 2012. Reconstrucción de la
cobertura de la vegetación y uso del suelo hacia 1550 y sus cambios a
2007 en la ecorregión de los bosques valdivianos lluviosos de Chile (35°–
43°30′S). Bosque. 33:13–23.
Li Y, Cooper SJ, Lancaster ML, Packer JG, Carthew SM. 2016. Comparative
population genetic structure of the endangered southern brown bandicoot,
Isoodon obesulus, in fragmented landscapes of Southern Australia. PLoS
One. 11:e0152850.
Li Y, Lancaster ML, Carthew SM, Packer JG, Cooper SJB. 2014. Delineation
of conservation units in an endangered marsupial, the southern brown
bandicoot (Isoodon obesulus obesulus), in South Australia/western Vic-
toria, Australia. Aust J Zool. 62:345–359.
Maldonado JE, Hertel F, Vilà C. 2004. Discordant patterns of morphological
variation in genetically divergent populations of ornate shrews (Sorex
ornatus). J Mammal. 85:886–896.
Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021
Maldonado JE, Vilà C, Wayne RK. 2001. Tripartite genetic subdivisions in the
ornate shrew (Sorex ornatus). Mol Ecol. 10:127–147.
Martin  GM. 2010. Geographic distribution and historical occurrence of
Dromiciops gliroides Thomas (Metatheria: Microbiotheria). J Mammal.
91:1025–1035.
Martin  GM. 2018. Variability and variation in Dromiciops Thomas, 1894
(Marsupialia, Microbiotheria, Microbiotheriidae). J Mammal. 99:159–173.
Martin GM, Flores D, Teta P. 2015. Dromiciops gliroides. The IUCN Red List
of Threatened Species 2015: e.T6834A22180239.
Matocq  M, Patton  JL, da  Silva  MNF. 2000. Population genetic structure of
two ecologically distant Amazonian spiny rats. Evolution 54:1423–1432.
Meirmans PG, Van Tienderen PH. 2004. GENOTYPE and GENODIVE: two
programs for the analysis of genetic diversity of asexual organism. Mol
Ecol Notes. 4:792–794.
Mercer JH. 1976. Glacial history of southernmost South America. Quat Res.
6:125–166.
Moreno  IP, Villagrán  C, Marquet  PA, Marshall  LG. 1994. Quaternary
paleobiogeography of northern and central Chile. Rev Chil Hist Nat.
67:487–502.
Napolitano  C, Díaz  D, Sanderson  J, Johnson  WE, Ritland  K, Ritland  CE,
Poulin  E. 2015. Reduced genetic diversity and increased dispersal in
Guigna (Leopardus guigna) in Chilean fragmented landscapes. J Hered.
106(Suppl 1):522–536.
Napolitano  C, Johnson  WE, Sanderson  J, O’Brien  SJ, Hoelzel  AR, Freer  R,
Dunstone  N, Ritland  K, Ritland  CE, Poulin  E. 2014. Phylogeography
and population history of Leopardus guigna, the smallest American felid.
Conserv Genet. 15:631–653.
Otavo S, Echeverría C. 2017. Progressive fragmentation and loss of nat-
ural forests habitat in one of the global biodiversity hotspots. Rev Mex
Biodivers. 88:924–935.
Pacioni C, Wayne AF, Spencer PBS. 2011. Effects of habitat fragmentation on
population structure and long-distance gene flow in an endangered marsu-
pial: the woylie. J Zool. 283:98–107.
Palma RE, Boric-Bargetto D, Torres-Pérez F, Hernández CE, Yates TL. 2012.
Glaciation effects on the phylogeographic structure of Oligoryzomys
longicaudatus (Rodentia: Sigmodontinae) in the southern Andes. PLoS
One. 7:e32206.
Palma  RE, Spotorno  AE. 1999. Molecular systematics of marsupials based
on the rRNA 12S mitochondrial gene: the phylogeny of didelphimorphia
and of the living fossil microbiotheriid Dromiciops gliroides Thomas. Mol
Phylogenet Evol. 13:525–535.
Peakall  R, Smouse  PE. 2012. GenAlEx 6.5: genetic analysis in Excel. Popu-
lation genetic software for teaching and research—an update. Bioinfor-
matics. 28:2537–2539.
Pérez-Alvarez MJ, Olavarría C, Moraga R, Baker CS, Hammer RM, Poulin E.
2015. Microsatellite markers reveal strong genetic structure in the en-
demic Chilean dolphin. PLoS One. 10:e0123956.
Perl RGB, Geffen E, Malka Y, Barocas A, Renan S, Vences M, Gafny S. 2018.
Population genetic analysis of the recently rediscovered Hula painted frog
(Latonia nigriventer) reveals high genetic diversity and low inbreeding.
Sci Rep. 8:5588.
Journal of Heredity, 2019, Vol. 110, No. 6
Pissard  A, Arbizu  C, Ghislain  M, Faux  AM, Paulet  S, Bertin  P. 2008. Con-
gruence between morphological and molecular markers inferred from the
analysis of the intra-morphotype genetic diversity and the spatial structure
of Oxalis tuberosa Mol. Genetica. 132:71–85.
Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure
using multilocus genotype data. Genetics. 155:945–959.
Putman  AI, Carbone  I. 2014. Challenges in analysis and interpretation of
microsatellite data for population genetic studies. Ecol Evol. 4:4399–
4428.
Raymond F, Rousset F. 1995. GENEPOP v4.2. Population genetics software
for exact tests and ecumenicism. J Hered. 86:248–249.
Reig  OA. 1955. Noticia preliminar sobre la presencia de microbiotherinos
vivientes en la fauna sudamericana. Invest Zool Chil. 2:121–130.
Rodriguez D, Forstner MRJ, McBride DL, Densmore LD III. 2012. Low gen-
etic diversity and evidence of population structure among subspecies of
Nerodia harteri, a threatened water snake endemic of Texas. Conserv
Genet. 13: 977–986.
Rodríguez-Cabal  MA, Aizen  MA, Novaro  AJ. 2007. Habitat fragmentation
disrupts a plant-disperser mutualism in the temperate forest of South
America. Biol Conserv. 139:195–202.
Rousset F. 2008. genepop’007: a complete re-implementation of the genepop
software for Windows and Linux. Mol Ecol Resour. 8:103–106.
Ruiz-Rodriguez  CT, Ishida  Y, Murray  ND, O’Brien  SJ, Graves  JA, Green-
wood AD, Roca AL. 2016. Koalas (Phascolarctos cinereus) from Queensland
are genetically distinct from 2 populations in Victoria. J Hered. 107:573–580.
Shamjana U, Bharadwaj T, Grace T. 2015. Microsatellites: a versatile marker
for genetic/evolutionary/ecological studies. Int J Adv Biol Res. 5:86–95.
Sikes RS, Gannon WL; The Animal Care and Use Committee of The American
Society of Mammalogists. 2011. Guidelines of the American Society of
Mammalogists for the use of wild mammals in research. J Mammal.
92:235–253.
Song G, Yu L, Gao B, Zhang R, Qu Y, Lambert DM, Li S, Zhou T, Lei F.
2013. Gene flow maintains genetic diversity and colonization poten-
tial in recently range-expanded populations of an Oriental bird, the
Light-vented Bulbul (Pycnonotus sinesis, Aves: Pycnonotidae). Diversity
Distrib. 19:1248–1262.
661
Suárez-Villota  EY, Quercia  CA, Nuñez  JJ, Gallardo  MH, Himes  CM,
Kenagy  GJ. 2018. Monotypic status of the South American relictual
marsupial Dromiciops gliroides (Microbiotheria). J Mammal. 99:803–
812.
Thapa  K, Manandhar  S, Bista  M, Shakya  J, Sah  G, Dhakal  M, Sharma N,
Llewellyn B, Wultsch C, Waits LP et al. 2018. Assessment of genetic diver-
sity, population structure, and gene flow of tigers (Panthera tigris tigris)
across Nepal´s Terai Arc Landscape. PLoS One. 13:e0193495.
Valladares-Gómez A, Celis-Diez JL, Palma RE, Manríquez GS. 2017. Cranial
morphological variation of Dromiciops gliroides (Microbiotheria) along
its geographical distribution in south-central Chile: a three-dimensional
analysis. Mamm Biol. 87:107–117.
Van  Oosterhout  C, Hutchinson  WF, Wills  DPM, Shipley  P. 2004. MICRO-
CHECKER: software for identifying and correcting genotyping errors in
microsatellite data. Mol Ecol Notes. 4:535–538.
Downloaded from https://academic.oup.com/jhered/article/110/6/651/5550913 by guest on 23 February 2021
Vera-Escalona  I, D’Elía  G, Gouin  N, Fontanella  FM, Muñoz-Mendoza  C,
Sites JW Jr, Victoriano PF. 2012. Lizards on ice: evidence for multiple re-
fugia in Liolaemus pictus (Liolaemidae) during the last glacial maximum
in the Southern Andean beech forests. PLoS One. 7:e48358.
Vidal MA, Moreno PI, Poulin E. 2012. Genetic diversity and insular coloniza-
tion of Liolaemus pictus (Squamata, Liolaeminae) in north-western Pata-
gonia. Austral Ecol. 37:67–77.
Vignieri SN. 2005. Streams over mountains: influence of riparian connectivity
on gene flow in the Pacific jumping mouse (Zapus trinotatus). Mol Ecol.
14:1925–1937.
Villagrán C. 1991. Postglacial History of the temperate forests of southern
Chile during the Late-Glacial and Holocene. Rev Chil Hist Nat.
64:447–460.
Wang W, Qiao Y, Li S, Pan W, Yao M. 2017. Low genetic diversity and strong
population structure shaped by anthropogenic habitat fragmentation in
a critically endangered primate, Trachypithecus leucocephalus. Heredity
(Edinb). 118:542–553.
Witzenberger  KA, Hochkirch  A. 2011. Ex situ conservation genetics:
a review of molecular studies on the genetic consequences of captive
breeding programmes for endangered animal species. Biodivers Conserv.
20:1843–1861.