ß 2014. Published by The Company of Biologists Ltd | Journal of Cell Science (2014) 127, 3017–3023 doi:10.1242/jcs.
144386
SHORT REPORT
A cytosolic degradation pathway, prERAD, monitors pre-inserted
secretory pathway proteins
Tslil Ast, Naama Aviram, Silvia Gabriela Chuartzman and Maya Schuldiner*
ABSTRACT
The endoplasmic reticulum (ER) identifies and disposes of
misfolded secretory pathway proteins through the actions of ER-
associated degradation (ERAD) pathways. It is becoming evident
that a substantial fraction of the secretome transiently resides in the
cytosol before translocating into the ER, both in yeast and in higher
eukaryotes. To uncover factors that monitor this transient cytosolic
protein pool, we carried out a genetic screen in Saccharomyces
cerevisiae. Our findings highlighted a pre-insertional degradation
mechanism at the cytosolic leaflet of the ER, which we term
prERAD. prERAD relies on the concurrent action of the ER-
localized ubiquitylation and deubiquitylation machineries Doa10
and Ubp1. By recognizing C-terminal hydrophobic motifs, prERAD
tags for degradation pre-inserted proteins that have remained
on the cytosolic leaflet of the ER for too long. Our discoveries
delineate a new cellular safeguard, which ensures that every
stage of secretory pathway protein biogenesis is scrutinized and
regulated.
KEY WORDS: Doa10, ERAD, GPI-anchored protein
SRP-independent substrate, Quality control, Translocation
INTRODUCTION
Cellular quality control has an essential role in shaping and
maintaining a functional cellular proteome (Princiotta et al.,
2003; Schubert et al., 2000). One of the best-characterized quality
control triaging systems is that of the endoplasmic reticulum
(ER), which comprises the central folding site of the secretory
pathway. Disposal of misfolded ER proteins occurs through
the ER-associated degradation (ERAD) pathway (Brodsky and
McCracken, 1997), which involves the recognition of misfolded
substrates by the membrane-embedded ERAD complexes, retro-
translocation to the cytosol, ubiquitylation and handover to the
proteasome for degradation (Hebert and Molinari, 2007; Meusser
et al., 2005).
Two key pathways mediate ERAD for yeast secretory pathway
proteins and they are centered around the Hrd1 and the Doa10 E3
ubiquitin ligases (Carvalho et al., 2006; Huyer et al., 2004;
Vashist and Ng, 2004). The Hrd1 complex takes part in the
degradation of proteins that bear misfolded lesions in the
ER lumen or membrane, and is therefore also referred to as
the ERAD-L/M pathway. The Doa10 complex recognizes
transmembrane proteins with misfolded cytosolic domains, and
Department of Molecular Genetics, Weizmann Institute of Science, Rehovot
7610001, Israel.
*Author for correspondence (maya.schuldiner@weizmann.ac.il)
Received 21 October 2013; Accepted 22 April 2014
is known as the ERAD-C pathway. Some auxiliary factors are
common to both ERAD-L/M and ERAD-C pathways, such as the
Cdc48 complex, which generates the driving force that is required
for membrane extraction in both pathways (Rabinovich et al.,
2002 Ravid et al., 2006).
To date, quality control in the secretory pathway has primarily
been studied in the context of proteins that have successfully
translocated into the ER. However, a large fraction of the
secretome fails to engage the signal recognition particle (SRP),
and is temporarily found in the cytosol prior to its translocation
(Ast et al., 2013; Chen et al., 1993; Hessa et al., 2011; Shao and
Hegde, 2011). We reasoned that additional cytosolic monitoring
measures might be in effect during this stage of SRP-independent
substrate biosynthesis. Here, we used an unbiased, systematic
genetic screen with an SRP-independent substrate to reveal
that this is indeed the case. If SRP-independent substrates do
not enter the ER, they are tagged for degradation on the cytosolic
face of the ER leaflet in a pathway we term prERAD. prERAD
relies on opposing forces of ubiquitylation and deubiquitylation
machineries, ensuring that nascent SRP-independent proteins are
provided sufficient time to translocate but are efficiently cleared
from the membrane if they fail to do so.
RESULTS AND DISCUSSION
An unbiased screen for pre-insertional degradation reveals a
role for ERAD-C
Proteins that undergo SRP-independent targeting to the ER must
transiently reside in the cytosol. Given that such secretory proteins
contain hydrophobic targeting signals, should they remain within
the cytosol, they would needlessly engage the cytosolic folding
machinery or possibly generate cytosolic aggregates. We therefore
hypothesized that monitoring measures must be in place to clear
the cytosol of proteins that have reached the ER membrane but
have not translocated.
To uncover which proteins might mediate such pre-insertional
degradation we performed an unbiased and systematic genetic
screen in which we visualized the fluorescently tagged RFP–Gas1,
an SRP-independent substrate of the glycosylphosphatidylinositol
(GPI) family (Ast et al., 2013; Ng et al., 1996) on the background
of mutations in 210 proteins that are affiliated with quality control
(Fig. 1A). Although the majority of mutations did not affect the
Journal of Cell Science
localization of RFP–Gas1, we identified nine mutations that
generated a mislocalized pattern (Fig. 1B). These mutants could be
grouped into three functional categories: those that affected the
proteasome, the cytosolic arm of ER-associated degradation
(ERAD-C) or protein deubiquitylation (DUBs).
To date, ERAD has been primarily studied in the context of
misfolded secretory pathway proteins that have translocated into
the ER (Hampton, 2002; Meusser et al., 2005). However,
translocated Gas1 is completely luminal (Conzelmann et al.,
1988), and would not be available to the cytosolic-sensing
3017
SHORT REPORT
Fig. 1. A screen for pre-insertional degradation effectors of SRP-
independent proteins reveals components of the proteasome, ERAD-C
and DUBs. (A) To uncover pathways that take part in the pre-insertional
degradation of SRP-independent substrates, a genetic screen was carried
out in the budding yeast Saccharomyces cerevisiae. A strain bearing a
fluorescently tagged model SRP-independent protein, RFP–Gas1, was
crossed against a quality control mutation library, utilizing the synthetic
genetic array (SGA) technique. This custom library was visually screened for
mutants in which RFP–Gas1 was mislocalized within the cell.
(B) Representative images of control (WT) and mutation backgrounds that
affected RFP–Gas1 localization (660 lens). These nine proteins can be
grouped into three functional categories, affecting either proteasome, ERAD-
C or deubiquitylating enzyme (DUB) function.
ERAD-C pathway. Moreover, the absence of the luminal arm of
ERAD (ERAD-L) had no affect on the localization of RFP–Gas1,
precluding an indirect effect on RFP–Gas1 localization in strains
lacking functional ERAD pathways (supplementary material
Fig. S1). Therefore, we hypothesized that ERAD-C could be
interacting with the pre-inserted (cytosolic) form of RFP–Gas1.
ERAD-C takes part in the cytosolic degradation of the SRP-
independent substrate Gas1
To measure which form of RFP–Gas1 was being stabilized by
deletions in the ERAD-C pathway, we halted translation with
cycloheximide and followed the remaining protein pool by
western blot analysis (Fig. 2A). In wild-type (WT) cells, we
found that the cytosolic form of RFP–Gas1 disappeared after
60 minutes of translational halt. When translocation was
attenuated, by utilizing the sec61-DAmP background, nearly all
of RFP–Gas1 was found in the cytosol at the start of the
experiment. Within 60 minutes, this cytosolic protein pool
had been cleared, indicating that a pre-insertional degradation
pathway was indeed in effect. In Ddoa10 cells, the amounts of
cytosolic RFP–Gas1 was both elevated and stabilized over the
time course of 60 minutes, suggesting that ERAD-C is indeed
responsible for tagging the cytosolic form of RFP–Gas1 for
degradation. Moreover, it appears that the translocation pathway
3018
Journal of Cell Science (2014) 127, 3017–3023 doi:10.1242/jcs.144386
is independent of the pre-insertional degradation pathway, as
mature RFP–Gas1 is present in normal levels in Ddoa10 cells at
the initial time point.
We hypothesized that Doa10 might degrade a subpopulation of
the pre-inserted RFP-Gas1 for two reasons: (1) degradation is the
result of protein folding, as folded proteins have lost their
translocation competence; or (2) degradation is triggered by
the cytosolic concentration or dwell time of the substrates. To
differentiate between these two scenarios, we attenuated both
translocation and degradation using a sec61-DAmP/Ddoa10 double
mutant. Interestingly, we saw that at the initial time point, there is
more mature protein when compared to the single mutant (sec61-
DAmP). Furthermore, following 60 minutes of cycloheximide
treatment, the majority of the cytosolic RFP–Gas1 had been
translocated and trafficked onwards to the Golgi and cell
membrane. Thus, it seems that the cytosolic pool of RFP–Gas1
is competent for translocation. When we imaged RFP–Gas1 in
cells that were attenuated for both translocation and ERAD-C
(supplementary material Fig. S2), we saw that the absence of the
E3 ubiquitin ligase, DOA10, altered RFP–Gas1 localization from
cytosolic inclusion bodies to an ER pattern. This phenomenon is in
line with findings that trafficking to some inclusion bodies depends
on ubiquitylation (Kaganovich et al., 2008). We therefore suggest
that Doa10 can tag pre-inserted RFP–Gas1 for degradation, in a
process that we term prERAD. prERAD does not appear to be
based on the folding state or translocational competence of the
substrate, but rather on its cytosolic occupancy time.
prERAD is triggered by the presence of hydrophobic
C-terminal GPI-anchoring sequences
We next set out to test the protein motifs that engage prERAD.
We reasoned that hydrophobic motifs might flag SRP-
independent proteins as mislocalized, should they be exposed in
the cytosol. Our previous work has indicated that although all
SRP-independent proteins have hydrophobic targeting signals in
the form of a signal sequence, the subgroup of GPI anchor
proteins have an additional hydrophobic patch at their C-
terminus, their GPI-anchoring sequence (Ast et al., 2013).
As our model SRP-independent protein Gas1 is one such GPI-
anchored protein, we set out to examine which of its hydrophobic
domains direct Doa10-dependent degradation. To this end, we
tagged GFP with either the signal sequence or GPI anchoring
sequence of Gas1, and measured the stability of these fusion
proteins in the cytosol. Although both GFP and the signal-
sequence-bearing GFP remained stable in the cytosol (Fig. 2B;
supplementary material Fig. S3A), regardless of the presence or
absence of Doa10, the anchor-sequence-bearing GFP was
degraded in the cytosol in a Doa10-dependent manner.
We next analyzed two additional fluorescently tagged GPI-
anchored proteins, Ccw14 and Tos6, in WT and Ddoa10 cells
(Fig. 2C). In control cells, Gas1, Ccw14 and Tos6 all localized to
the cell surface, whereas in the absence of Doa10, all three
Journal of Cell Science
proteins accumulated intracellularly in addition to their normal
localization at the cell surface. In contrast to Gas1, Ccw14 and
Tos6 appeared to aggregate in Ddoa10 cells, possibly owing to a
dosage difference, as they were expressed from a multi-copy
plasmid whereas Gas1 was expressed from a chromosomal copy.
In addition, cycloheximide assays on YFP–Ccw14 confirmed the
specific dependence on Doa10 and not on Hrd1 for cytosolic
clearance (Fig. 2D). Thus, it appears that prERAD is indeed
required for the elimination of pre-inserted GPI-anchored
proteins. In contrast, when we analyzed the cytosolic clearance
SHORT REPORT Journal of Cell Science (2014) 127, 3017–3023 doi:10.1242/jcs.144386

Fig. 2. prERAD mediates the pre-insertional degradation of GPI-anchored proteins by employing Doa10, but not Hrd1 or the Cdc48 complex. (A) The
degradation of RFP–Gas1 following translational shut-off (by addition of cycloheximide) was analyzed by western blot with anti-RFP antibody. The cytosolic
RFP–Gas1 pool is efficiently degraded when translocation is attenuated in sec61-DAmP cells. In cells lacking Doa10, this cytosolic pool is stable. When both
translocation and degradation are attenuated, the cytosolic protein can mature through the few translocons present. Histone H3 was used as a loading
control. (B) The cytosolic stability of GFP tagged with the Gas1 signal sequence (SS-GFP) or the GPI anchoring sequence (GFP-AS) was tested by western blot
with anti-GFP antibody. Although the signal-sequence-bearing GFP is stable in the cytosol, anchor-sequence-bearing GFP is degraded in the cytosol in a
Doa10-dependent manner. PGK was used as a loading control. (C) Three fluorescently tagged GPI-anchored proteins, Gas1, Ccw14 and Tos6 were imaged in
either control or Ddoa10 strains (lens 660). In the WT background, all three proteins are localized to the cell surface, but they undergo accumulation in
cytosolic forms in the Ddoa10 strain. (D) The degradation of YFP–Ccw14 following translational shut-off was analyzed by western blot with anti-GFP antibody.
prERAD of cytosolic YFP–Ccw14 is independent of the ERAD-M/L (Dhrd1) pathway, as well as Cdc48 and Ufd1 (cdc48ts and ufd1ts, respectively). As a control,
the stability of CPY*–HA, a known substrate of Hrd1, Cdc48 and Ufd1 was analyzed. Histone H3 was used as a loading control.

of a protein bearing only a signal sequence, CPY (also known as
Prc1), we could not detect any pre-insertional degradation
following a translational halt (supplementary material Fig.
S3B). These findings indicate that the prERAD pathway
recognizes the hydrophobic C-terminal patches displayed by
GPI-anchored proteins.
degradation of the misfolded luminal protein CPY* (Fig. 2D).
The lack of dependence on the Cdc48 complex further
demonstrates that these cytosolic proteins represent a bona fide
pre-insertional protein population. Moreover, these results
indicate that only a subset of proteins comprising the ERAD-C
complex are required to carry out prERAD.

prERAD does not involve extraction from the ER membrane Effective prERAD depends on deubiquitylation by Ubp1
Journal of Cell Science

The Cdc48 complex has previously been shown to generate the
mechanical force needed to extract ERAD-C substrates from the
membrane (Rabinovich et al., 2002). We rationalized that
because prERAD deals with pre-inserted proteins there would
be no need for Cdc48 function in this pathway. To test this
hypothesis, we expressed YFP–Ccw14 in temperature-sensitive
strains of the Cdc48 complex, namely cdc48ts and ufd1ts, grown
at the restrictive temperature. Indeed, neither Cdc48 nor
Ufd1 were required for the degradation of pre-inserted YFP–
Ccw14, although their inactivation significantly attenuated the
Finally, we set out to understand how the regulatory aspect of
prERAD is maintained. A key force in any such pathway is a
negative regulator, such as a deubiquitylation enzyme, ensuring
that translocation substrates are not immediately degraded.
Indeed, of the 20 DUB deletion strains present in our screen,
two affected RFP–Gas1 localization, UBP1 and UBP11. We set
out to further test the effect of these DUBs on RFP–Gas1 by
overexpressing them (Fig. 3A). The overexpression of UBP11
had no effect on the localization of RFP–Gas1, which makes
sense in light of its mitochondrial localization (supplementary

3019
SHORT REPORT Journal of Cell Science (2014) 127, 3017–3023 doi:10.1242/jcs.144386

Fig. 3. Immediate prERAD degradation is attenuated by the ER-bound DUB UBP1. (A) RFP–Gas1 was imaged in WT strain, or strains overexpressing
UBP1 or UBP11 (lens 6100). The normal cell surface localization of RFP–Gas1 is not altered when overexpressing UBP11. However, upon overexpression of
UBP1, RFP-Gas1 is found in an additional ER pattern, which colocalizes with the ER marker, Scs2–GFP. (B) RFP–Gas1 was analyzed by western blot
in strains overexpressing (OE) UBP1 or UBP11 with anti-RFP antibody. Overexpression of UBP1 stabilized the cytosolic fraction of RFP–Gas1. Histone H3 was
used as a loading control. (C) The fraction of cytosolic and mature amounts of RFP–Gas1 was quantified in a WT strain, and strains overexpressing UBP1 or
UBP11 as detected by western blotting (the normalized mean6s.e.m. is depicted). Although the overexpression of UBP11 does not alter this ratio, the
overexpression of UBP1 significantly raises this balance by over twofold. *P,0.025.

material Fig. S4). The mitochondrial localization of Ubp11 raises
the possibility that the RFP–Gas1 puncta generated in Dubp11
were a secondary effect of an aberrant mitochondrial quality
control overloading the cell and would be interesting to follow up
on. In contrast, the overexpression of the ER-localized UBP1
(Schmitz et al., 2005) phenocopied the loss of DOA10, resulting
in accumulation of RFP–Gas1 on the ER surface. Indeed, the
amounts of pre-inserted RFP–Gas1 were elevated in cells
overexpressing UBP1, as could be measured by western blot
(Fig. 3B). In fact, the overexpression of UBP1 elevated the
fraction of pre-inserted:inserted RFP–Gas1 by over twofold,
when compared to WT cells (P,0.025) (Fig. 3C). Thus, it
appears that DOA10 and UBP1 mediate opposing forces in
prERAD, working concurrently to fine-tune the amount of pre-
inserted proteins at the ER surface.
Although SRP-independent targeting and translocation is
an efficient process (Fig. 4), the newly identified cytosolic
degradation mechanism, prERAD, ensures the clearance of
pre-inserted proteins. prERAD is regulated by opposing
forces of Doa10-dependent ubiquitylation and Ubp1-mediated
deubiquitylation. It is tempting to suggest that the prERAD
pathway monitors the extent of time a pre-inserted substrate has
remained in the cytosol through ubiquitin chain length, along the
lines of the calnexin–calreticulin cycle (Caramelo and Parodi,
2008). However, it is also possible that prERAD is activated
when the pre-inserted protein concentration has accumulated
GPI-anchoring sequence and the isolated sequence itself
demonstrated Doa10-dependent degradation.
As SRP-independent substrates must remain in a loosely folded
confirmation prior to their translocation (Tsukazaki et al., 2008;
Van den Berg et al., 2004), pre-insertional degradation cannot
hinge on the distinction between folding and misfolding. To
overcome this challenge, it seems that immediate degradation is
attenuated by the action of the ER-localized DUB Ubp1, whose
overexpression rescues the pre-inserted form of RFP–Gas1. It
should be noted that the exact role of Ubp1 in prERAD remains
elusive – although it is appealing to suggest that Ubp1 is directly
deubiquitylating pre-inserted substrates, it is also possible that
Ubp1 serves to regulate other factors (Bernardi et al., 2013; Liu
et al., 2014). This balance between E3 ubiquitin ligase and DUBs
is not unique to our system, and has been recently shown to fine-
tune degradation in the case of CD4 (Zhang et al., 2013).
Furthermore, in the case of pre-inserted tail-anchored proteins,
which bear a C-terminal transmembranal domain, antagonizing
forces of protein ubiquitylation and protection appear to be at
play in the cytosol (Leznicki and High, 2012). Little is known
regarding Ubp1 – it has been shown to localize to both the ER and
cytosol, and has been implicated in the stabilization of Ste6 and
Golgi proteins (Poulsen et al., 2012; Schmitz et al., 2005). Thus,
it seems that Ubp1 is involved in shaping and regulating the
degradation of proteins within the secretory pathway.
The discovery of such a pre-insertional degradation pathway
Journal of Cell Science

above a given threshold.
Although Doa10 has been extensively implicated in the
degradation of translocated malfolded ER proteins, there have
also been reports of Doa10-dependent degradation of cytosolic
and nuclear factors (Furth et al., 2011; Hochstrasser et al., 1991;
Metzger et al., 2008; Ravid et al., 2006). Our findings add an
additional group of substrates for this important E3 ligase, namely
pre-inserted GPI-anchored proteins. It appears that Doa10
reacts to the cytosolic presence of the hydrophobic GPI-
anchoring sequence because both various substrates bearing a
raises questions as to when and to what extent it is required.
Although the translocation of SRP-independent substrates is
fairly efficient, upon ER stress, Gas1 will undergo cytosolic
degradation if the unfolded protein response is not effectively
activated (Liu and Chang, 2008). Similar findings in higher
eukaryotes have revealed that, during ER stress, the translocation
of proteins bearing a mildly hydrophobic signal sequence is
attenuated, and these proteins are cleared from the cytosol in a
proteasome-dependent manner (Kang et al., 2006; Rutkowski
et al., 2007). Furthermore, it has been previously shown that in

3020
SHORT REPORT
unstressed mammalian systems, the efficiency of substrate
translocation can range from 95% to 60% (Levine et al., 2005).
This would indicate that, at any given time, the cell must identify
and degrade a significant untranslocated cytosolic protein pool.
Although secretory pathway degradation has long been thought to
take place predominantly within the ER following translocation,
this emerging understanding of prERAD highlights the multiple
checkpoints that must be in place at every stage of secretory
pathway function.
MATERIALS AND METHODS
Yeast strains and strain construction
All yeast strains in this study are based on the BY4741 laboratory strain
(Baker Brachmann et al., 1998). General laboratory strains and strains
created in this study are listed in supplementary material Table S2.
Unless otherwise stated, strains harboring a deletion in a specific open
reading frame (ORF) were taken from the yeast deletion library (Giaever
et al., 2002) and verified, whereas strains harboring a hypomorphic allele
of an essential gene were taken from the DAmP (Decreased Abundance
by mRNA Perturbation) library (Breslow et al., 2008). To construct the
quality control mutation library, YeastMine was queried for genes
that bear GO terms related to quality control (i.e. Ubiquitylation,
Degradation, Proteasome and Microautophagy), resulting in a list of 210
genes found in supplementary material Table S1. In order to construct
the SRP-independent query strain, RFP–Gas1, kindly provided by
Howard Riezman (Department of Biochemistry, University of Geneva,
Switzerland), was inserted into the URA3 locus, including sequences
from ,800 bp upstream and ,300 bp downstream of the Gas1 ORF.
Primers and plasmids utilized in this study are listed in supplementary
material Tables S3 and S4, respectively. To study their effect, cdc48-2
and ufd1-1, kindly provided by Randy Hampton (Division of Biological
Sciences, UC San Diego, CA) were grown at the restrictive temperature
of 37 ˚C for 4–6 hours prior to any experiment.
Yeast media and growth conditions
Cultures were grown at 30 ˚C in either rich medium [1% Bacto-yeast
extract (BD), 2% Bacto-peptone (BD) and 2% dextrose (Amresco)] or
synthetic medium [0.67% yeast nitrogen base with ammonium sulfate
and without amino acids (CondaPronadisa) and 2% dextrose (Amresco),
Journal of Cell Science (2014) 127, 3017–3023 doi:10.1242/jcs.144386
Fig. 4. Schematic model of prERAD. Should a protein
bearing a GPI anchor sequence (AS) fail to translocate in a
timely manner, it will be engaged by the E3 ligase Doa10.
The presence of deubiquitylating machinery (Ubp1) allows
this SRP-independent substrate to elude immediate
degradation and undergo translocation. However, should
the substrate loiter in the cytosol, the chance of degradation
by the proteasome will increase, linking cytosolic
occupancy with degradation. Ub, ubiquitin.
containing the appropriate supplements for plasmid selection] (Sherman,
1991). When needed as selection markers, G418 (200 mg/ml,
Calbiochem) or Nourseothricin (Nat) (200 mg/ml WERNER
BioAgents) were added. In cases where G418 was required in a
synthetic medium, yeast nitrogen base without ammonium sulfate
(CondaPronadisa) was added and supplemented with monosodium
glutamate (Sigma) as an alternative nitrogen source.
Robotic library manipulations
All genetic manipulations were performed using Synthetic Genetic
Array (SGA) techniques to allow efficient introduction of RFP–Gas1
into systematic yeast libraries. SGA was performed as previously
described (Cohen and Schuldiner, 2011; Tong and Boone, 2006).
Briefly, using a RoToR bench top colony arrayer (Singer Instruments,
UK) to manipulate libraries in 384-colony high-density formats,
haploid strains from opposing mating types, each harboring a
different genomic alteration, were mated on rich-medium plates.
Diploid cells were selected on plates containing all selection markers
found on both parent haploid strains. Sporulation was then induced by
transferring cells to nitrogen-starvation plates. Haploid cells containing
all desired mutations were selected for by transferring cells to plates
containing all selection markers alongside the toxic amino acid
derivatives Canavanine and Thialysine (Sigma-Aldrich) to select
against remaining diploids. Each SGA procedure was validated by
inspecting representative strains for the presence of RFP–Gas1 and for
the correct genotype using PCR.
High-throughput microscopy
Microscopic screening was performed using an automated microscopy
Journal of Cell Science
set-up as previously described (Breker et al., 2013; Cohen and
Schuldiner, 2011). Briefly, liquid cultures were grown overnight in
minimal medium, in a shaking incubator (LiCONiC Instruments) at
30 ˚C. Cells were grown to logarithmic stage and were transferred onto
glass-bottomed 384-well microscope plates (Matrical Bioscience)
coated with Concanavalin A (Sigma-Aldrich). The strains were
imaged with an automated inverted fluorescent microscopic ScanR
system (Olympus), equipped with a cooled CCD camera. Images were
acquired using a 606 air lens; excitation was at 555 nm (28-nm
bandpass) and emission at 617 (73-nm bandpass). After acquisition,
images were manually reviewed using the ScanR analysis program.
3021
SHORT REPORT
Images were processed by the Adobe Photoshop CS3 program for slight
contrast and brightness adjustments.
Manual microscopy
Manual microscopy was performed using an Olympus IX71
microscope controlled by the Delta Vision SoftWoRx 3.5.1 software
with a 660 oil lens. Images were captured by a Photometrics
CoolSNAP HQ camera with excitation at 490 nm (20-nm bandpass)
and emission at 528 (38-nm bandpass) for GFP, or excitation at
555 nm (28-nm bandpass) and emission at 617 (73-nm bandpass) for
mCherry and RFP. Images were transferred to Adobe Photoshop CS3
for slight contrast and brightness adjustments.
Protein extraction and detection
Yeast protein extraction and cycloheximide assays were performed as
previously described (Bhamidipati et al., 2005). In brief, mid-
logarithmic yeast cells at an optical density at 600 nm (OD600) of
,2.5 were treated with 150 mg/ml of cycloheximide (Sigma) for the
length of time indicated. Cells were then harvested, and re-suspended in
10% trichloroacetic acid (TCA) on ice for 20 minutes. Following this
incubation, cells were centrifuged for 15 minutes at 20,000 g at 4 ˚C, and
the supernatant was removed. The pellet was washed in acetone, and
resuspended in 100 ml of loading buffer (0.05 M Tris-HCl pH 6.8, 10%
glycerol, 2% SDS, 5% b-mercaptoethanol, 0.1% Bromophenol Blue).
100 ml of glass beads (Scientific Industries Inc.) were added to the
loading dye, and the samples were bead-beaten for 5 minutes at 4 ˚C.
The samples were then incubated at 95 ˚C for 5 minutes, and centrifuged
for 5 minutes at 6000 g at room temperature. 20 ml from the supernatant
of the samples was resolved on 7.5 or 10% polyacrylamide gels, and
probed with antibodies against RFP (ab62341, Abcam), GFP (ab290,
Abcam), histone H3 (ab1791, Abcam), HA (MMS-101P, Covance),
CPY (ab113685, Abcam) or PGK (459250, Life Technologies).
Secondary antibodies consisted of goat anti-rabbit or anti-mouse Ig
conjugated to IRDye800 or to IRDye680 (LI-COR Biosciences), and
were scanned for infrared signal using the Odyssey Imaging System (LI-
COR Biosciences). Protein amount was quantified using the Image
Studio software (LI-COR Biosciences), and was tested for statistically
significant variation using Student’s t-test.
Acknowledgements
We wish to thank Howard Riezman (Department of Biochemistry, University of
Geneva, Switzerland), Jeffrey Gerst (Department of Molecular Genetics, The
Weizmann Institute of Science, Israel), Jodi Nunnari (College of Biological
Sciences, UC Davis, CA) and Jeffrey Brodsky (Department of Biological Sciences,
University of Pittsburgh, PA) for their generosity in sharing plasmids, and Randy
Hampton (Division of Biological Sciences, UC San Diego, CA) for providing us with
temperature-sensitive strains. We are grateful to Shachar Dagan (Department of
Biological Chemistry, The Weizmann Institute of Science, Israel), Idan Frumkin
(Department of Molecular Genetics, The Weizmann Institute of Science, Israel),
Ofer Moldavski (Department of Molecular Genetics, The Weizmann Institute of
Science, Israel) and Tommer Ravid (Department of Biological Chemistry, The
Hebrew University of Jerusalem, Israel) for critical reading of the manuscript.
Competing interests
The authors declare no competing interests.
Author contributions
M.S., T.A., N.A. and S.G.C. designed and performed the experiments as well as
analyzed the data. M.S. and T.A. wrote the manuscript.
Funding
This study was supported by the Miel du Botton Aynsley fund; the Minerva
Foundation; and the European Research Council Starting Grant (ERC-StG [grant
number 260395]. T.A. is supported by the Adams Fellowship Program of the Israel
Academy of Sciences and Humanities. M.S. is supported by an EMBO Young
Investigator programme grant and the Israeli Ministry of Science.
Supplementary material
Supplementary material available online at
http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.144386/-/DC1
3022
Journal of Cell Science (2014) 127, 3017–3023 doi:10.1242/jcs.144386
References
Ast, T., Cohen, G. and Schuldiner, M. (2013). A network of cytosolic factors
targets SRP-independent proteins to the endoplasmic reticulum. Cell 152, 1134-
1145.
Bernardi, K. M., Williams, J. M., Inoue, T., Schultz, A. and Tsai, B. (2013). A
deubiquitinase negatively regulates retro-translocation of nonubiquitinated
substrates. Mol. Biol. Cell 24, 3545-3556.
Bhamidipati, A., Denic, V., Quan, E. M. and Weissman, J. S. (2005). Exploration
of the topological requirements of ERAD identifies Yos9p as a lectin sensor of
misfolded glycoproteins in the ER lumen. Mol. Cell 19, 741-751.
Baker Brachmann, C., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P. and
Boeke, J. D. (1998). Designer deletion strains derived from Saccharomyces
cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene
disruption and other applications. Yeast 14, 115-132.
Breker, M., Gymrek, M. and Schuldiner, M. (2013). A novel single-cell screening
platform reveals proteome plasticity during yeast stress responses. J. Cell Biol.
200, 839-850.
Breslow, D. K., Cameron, D. M., Collins, S. R., Schuldiner, M., Stewart-
Ornstein, J., Newman, H. W., Braun, S., Madhani, H. D., Krogan,
N. J. and Weissman, J. S. (2008). A comprehensive strategy enabling
high-resolution functional analysis of the yeast genome. Nat. Methods 5, 711-
718.
Brodsky, J. L. and McCracken, A. A. (1997). ER-associated and
proteasomemediated protein degradation: how two topologically restricted
events came together. Trends Cell Biol. 7, 151-156.
Caramelo, J. J. and Parodi, A. J. (2008). Getting in and out from calnexin/
calreticulin cycles. J. Biol. Chem. 283, 10221-10225.
Carvalho, P., Goder, V. and Rapoport, T. A. (2006). Distinct ubiquitin-ligase
complexes define convergent pathways for the degradation of ER proteins. Cell
126, 361-373.
Chen, P., Johnson, P., Sommer, T., Jentsch, S. and Hochstrasser, M. (1993).
Multiple ubiquitin-conjugating enzymes participate in the in vivo degradation of
the yeast MAT alpha 2 repressor. Cell 74, 357-369.
Cohen, Y. and Schuldiner, M. (2011). Advanced methods for high-throughput
microscopy screening of genetically modified yeast libraries. Methods Mol. Biol.
781, 127-159.
Conzelmann, A., Riezman, H., Desponds, C. and Bron, C. (1988). A major
125-kd membrane glycoprotein of Saccharomyces cerevisiae is attached to
the lipid bilayer through an inositol-containing phospholipid. EMBO J. 7, 2233-
2240.
Furth, N., Gertman, O., Shiber, A., Alfassy, O. S., Cohen, I., Rosenberg, M. M.,
Doron, N. K., Friedler, A. and Ravid, T. (2011). Exposure of bipartite
hydrophobic signal triggers nuclear quality control of Ndc10 at the
endoplasmic reticulum/nuclear envelope. Mol. Biol. Cell 22, 4726-4739.
Giaever, G., Chu, A. M., Ni, L., Connelly, C., Riles, L., Véronneau, S., Dow, S.,
Lucau-Danila, A., Anderson, K., André, B. et al. (2002). Functional profiling of
the Saccharomyces cerevisiae genome. Nature 418, 387-391.
Hampton, R. Y. (2002). ER-associated degradation in protein quality control and
cellular regulation. Curr. Opin. Cell Biol. 14, 476-482.
Hebert, D. N. and Molinari, M. (2007). In and out of the ER: protein folding, quality
control, degradation, and related human diseases. Physiol. Rev. 87, 1377-1408.
Hessa, T., Sharma, A., Mariappan, M., Eshleman, H. D., Gutierrez, E. and
Hegde, R. S. (2011). Protein targeting and degradation are coupled for
elimination of mislocalized proteins. Nature 475, 394-397.
Hochstrasser, M., Ellison, M. J., Chau, V. and Varshavsky, A. (1991). The short-
lived MAT alpha 2 transcriptional regulator is ubiquitinated in vivo. Proc. Natl.
Acad. Sci. USA 88, 4606-4610.
Huyer, G., Piluek, W. F., Fansler, Z., Kreft, S. G., Hochstrasser, M., Brodsky,
J. L. and Michaelis, S. (2004). Distinct machinery is required in
Saccharomyces cerevisiae for the endoplasmic reticulum-associated
degradation of a multispanning membrane protein and a soluble luminal
protein. J. Biol. Chem. 279, 38369-38378.
Kaganovich, D., Kopito, R. and Frydman, J. (2008). Misfolded proteins
partition between two distinct quality control compartments. Nature 454, 1088-
1095.
Kang, S. W., Rane, N. S., Kim, S. J., Garrison, J. L., Taunton, J. and Hegde, R.
S. (2006). Substrate-specific translocational attenuation during ER stress
defines a pre-emptive quality control pathway. Cell 127, 999-1013.
Levine, C. G., Mitra, D., Sharma, A., Smith, C. L. and Hegde, R. S. (2005). The
efficiency of protein compartmentalization into the secretory pathway. Mol. Biol.
Cell 16, 279-291.
Journal of Cell Science
Leznicki, P. and High, S. (2012). SGTA antagonizes BAG6-mediated protein
triage. Proc. Natl. Acad. Sci. USA 109, 19214-19219.
Liu, Y. and Chang, A. (2008). Heat shock response relieves ER stress. EMBO J.
27, 1049-1059.
Liu, Y., Soetandyo, N., Lee, J. G., Liu, L., Xu, Y., Clemons, W. M., Jr and Ye, Y.
(2014). USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-
associated degradation. Elife 3, e01369.
Metzger, M. B., Maurer, M. J., Dancy, B. M. and Michaelis, S. (2008).
Degradation of a cytosolic protein requires endoplasmic reticulum-associated
degradation machinery. J. Biol. Chem. 283, 32302-32316.
Meusser, B., Hirsch, C., Jarosch, E. and Sommer, T. (2005). ERAD: the long
road to destruction. Nat. Cell Biol. 7, 766-772.
Ng, D. T., Brown, J. D. and Walter, P. (1996). Signal sequences specify the targeting
route to the endoplasmic reticulum membrane. J. Cell Biol. 134, 269-278.
SHORT REPORT
Poulsen, J. W., Madsen, C. T., Young, C., Kelstrup, C. D., Grell, H. C.,
Henriksen, P., Juhl-Jensen, L. and Nielsen, M. L. (2012). Comprehensive
profiling of proteome changes upon sequential deletion of deubiquitylating
enzymes. J. Proteomics 75, 3886-3897.
Princiotta, M. F., Finzi, D., Qian, S. B., Gibbs, J., Schuchmann, S., Buttgereit,
F., Bennink, J. R. and Yewdell, J. W. (2003). Quantitating protein synthesis,
degradation, and endogenous antigen processing. Immunity 18, 343-354.
Rabinovich, E., Kerem, A., Fröhlich, K. U., Diamant, N. and Bar-Nun, S.
(2002). AAA-ATPase p97/Cdc48p, a cytosolic chaperone required for
endoplasmic reticulum-associated protein degradation. Mol. Cell. Biol. 22,
626-634.
Ravid, T., Kreft, S. G. and Hochstrasser, M. (2006). Membrane and soluble
substrates of the Doa10 ubiquitin ligase are degraded by distinct pathways.
EMBO J. 25, 533-543.
Rutkowski, D. T., Kang, S. W., Goodman, A. G., Garrison, J. L., Taunton, J.,
Katze, M. G., Kaufman, R. J. and Hegde, R. S. (2007). The role of p58IPK in
protecting the stressed endoplasmic reticulum. Mol. Biol. Cell 18, 3681-3691.
Schmitz, C., Kinner, A. and Kölling, R. (2005). The deubiquitinating enzyme
Ubp1 affects sorting of the ATP-binding cassette-transporter Ste6 in the
endocytic pathway. Mol. Biol. Cell 16, 1319-1329.
Journal of Cell Science (2014) 127, 3017–3023 doi:10.1242/jcs.144386
Schubert, U., Antón, L. C., Gibbs, J., Norbury, C. C., Yewdell, J. W. and
Bennink, J. R. (2000). Rapid degradation of a large fraction of newly
synthesized proteins by proteasomes. Nature 404, 770-774.
Shao, S. and Hegde, R. S. (2011). A calmodulin-dependent translocation pathway
for small secretory proteins. Cell 147, 1576-1588.
Sherman, F. (1991). Getting started with yeast. Methods Enzymol. 194, 3-21
Tong, A. H. and Boone, C. (2006). Synthetic genetic array analysis in
Saccharomyces cerevisiae. Methods Mol. Biol. 313, 171-192.
Tsukazaki, T., Mori, H., Fukai, S., Ishitani, R., Mori, T., Dohmae, N., Perederina,
A., Sugita, Y., Vassylyev, D. G., Ito, K. et al. (2008). Conformational transition
of Sec machinery inferred from bacterial SecYE structures. Nature 455, 988-
991.
Van den Berg, B., Clemons, W. M., Jr, Collinson, I., Modis, Y., Hartmann, E.,
Harrison, S. C. and Rapoport, T. A. (2004). X-ray structure of a protein-
conducting channel. Nature 427, 36-44.
Vashist, S. and Ng, D. T. (2004). Misfolded proteins are sorted by a sequential
checkpoint mechanism of ER quality control. J. Cell Biol. 165, 41-52.
Zhang, Z. R., Bonifacino, J. S. and Hegde, R. S. (2013). Deubiquitinases
sharpen substrate discrimination during membrane protein degradation from the
ER. Cell 154, 609-622.
Journal of Cell Science
3023
Fig. S1. The SRP-independent substrate, Gas1, does not accumulate
intracellularly in the absence of the ERAD-L/M pathway

(A) A fluorescently tagged model SRP-independent protein, RFP-Gas1, was imaged

in both WT and ∆hrd1 strains generated by the SGA (lens x60). Gas1 is correctly
localized to the cell surface in both strains. (B) To verify the deletion strain from the
deletion library, the presence of the HRD1 gene is verified by check PCR for the
presence of the HRD1 coding sequence in the WT and ∆hrd1 strain. Indeed, the
∆hrd1 strain is missing HRD1, while the actin control is present in both strains.

Fig. S2. RFP-Gas1 cannot be targeted to inclusion bodies when ubiquitination is

attenuated

RFP-Gas1 was imaged in a single or double mutant strain with the ER marker Scs2-
GFP (lens x100). In a strain lacking the SRP-independent translocation machinery
(∆sec72), RFP-Gas1 accumulates in cytosolic inclusion bodies. In contrast, in a
double mutant lacking both the translocation and ubiquitin ligase machinery
(∆sec72∆doa10), RFP-Gas1 cannot be targeted to the inclusion bodies, and remains
on the ER surface.

Fig. S3. Proteins lacking a hydrophobic C-terminal GPI anchor are stable in the
cytosol

(A) The cytoplasmic stability of untagged GFP was tested following translational halt,
by western blot analysis with αGFP. GFP is stable is the cytoplasm in both the
presence and absence of Doa10. PGK was used as a loading control. (B) The
degradation of the soluble protein CPY (Prc1) following translational shut-off was
analyzed by western blot with αCPY. Degradation was checked both in control and
translocation-attenuated (sec61-DAmP) strains. The cytosolic pool that is generated in
the sec61-DAmP strain is stable during the 45 minutes of translational halt.

Fig. S4. GFP-Ubp11 is localized to mitochondria.

UBP11 was N'-terminally tagged with the fluorophore GFP and imaged with the
mitochondria marker MTS-RFP (lens x100). GFP-Ubp11 localizes to the ribbon-like
structures of mitochondria.

Figure S1-Ast et al.

Journal of Cell Science | Supplementary Material

Journal of Cell Science | Supplementary Material
Figure S2-Ast et al.

Journal of Cell Science | Supplementary Material

Figure S3-Ast et al.

Journal of Cell Science | Supplementary Material

Figure S4-Ast et al.

Supplementary Table 1. Quality control library

Download Table S1

Journal of Cell Science | Supplementary Material

 Table S2. Yeast strains used in this study

Systematic Mating
Strain Genetic Background Utilization Source
Name Type
his3Δ1 leu2Δ0 met15Δ0 (Brachmann
WT BY4741 MATa ura3Δ0 WT strain et al., 1998)
his3Δ1 leu2Δ0 met15Δ0 Deletion of the DOA10 (Giaever et
∆doa10 MATa ura3Δ0 ∆doa10::KanR (SSM4) gene al., 2002)
his3Δ1 leu2Δ0 met15Δ0 Deletion of the HRD1 (Giaever et
∆hrd1 MATa ura3Δ0 ∆hrd1::KanR gene al., 2002)
his3Δ1 leu2Δ0 met15Δ0 Deletion of the SEC72 (Giaever et
∆sec72 MATa ura3Δ0 ∆sec72::KanR gene al., 2002)
Double mutant which
his3Δ1 leu2Δ0 met15Δ0 combines the deletions
∆sec72 ura3Δ0 ∆sec72::KanR of the SEC72 and
∆doa10 MATa ∆doa10::NatR DOA10 (SSM4) genes This study

ura3–52 leu2–3,112 Temperature sensitive

cdc48ts RHY2456 MATalpha cdc48–2 strain of CDC48-ts R. Hampton
his3Δ1 leu2Δ0 met15Δ0
GFP- ura3Δ1 Tef2p-GFP- N'- terminal GFP
Ubp11 Mata Ubp11::NatR tagging of UBP11 This study
his3Δ1 leu2Δ0 met15Δ0 Overexpression of
ura3Δ1 GPDp- UBP1 with the GPD
OE-Ubp1 Mata Ubp1::NatR promoter This study
his3Δ1 leu2Δ0 met15Δ0 Overexpression of
OE- ura3Δ1 GPDp- UBP11 with the GPD
Ubp11 Mata Ubp11::NatR promoter This study
his3delta1 leu2delta0
lys2+/lys+ met15delta0
ura3delta0
can1∆::STE2pr-sp HIS5
lyp1∆::STE3pr-LEU2
RFP-Gas1 MATalpha RFP-Gas1::URA RFP-Gas1 SGA strain This study
his3Δ1 leu2Δ0 met15Δ0
sec61- ura3Δ0 sec61- Hypomorphic allele of (Breslow et
DAmP MATa DAmP::KanR SEC61 al., 2008)

Journal of Cell Science | Supplementary Material

 Double mutant strain
his3Δ1 leu2Δ0 met15Δ0 which combines the
sec61- ura3Δ0 sec61- hypomorphic allele of
DAmP DAmP::KanR SEC61 with the deletion
∆doa10 MATa ∆doa10::NatR of DOA10 (SSM4) This study

BWG- ade1-100 his4-519 leu 2- Temperature sensitive

ufd1ts 7a/RHY2680 MATa 3,112 ura3-52 ufd1-1 strain of UFD1-ts R. Hampton

Journal of Cell Science | Supplementary Material

Table S3. Primers used in this study

Primer
Primer Sequence Primer purpose
Name
ACT1- TGTCACCAACTGGGACGATA Amplifies WT ACT1.
chk-F Product of 200p
Act1-chk- GGCTTGGATGGAAACGTAGA Amplifies WT ACT1.
R Product of 200p
Doa10- TACCACTAATTGAATCAAAGAGACTAGAAGTG Amplifies a KO
KO-F1 TGAAAGTCCGGATCCCCGGGTTAATTAA casette for DOA10
(SSM4) from the
pFA6a plasmids
Doa10- TATGCTAGCATTCATTTTAAATGTAAGGAAGA Amplifies a KO
KO-R AAACGCCTACTGGATGGCGGCGTTAGTATCGA casette for DOA10
ATCG (SSM4) from the
pFA6a plasmids
Doa10- TGAACATGCCAGCCGCAGCA Amplifies WT
WTCHK- DOA10 (SSM4).
F Product of 400bp
Doa10- AAACCGGAGCGTTGGGCCTG Amplifies WT
WTCHK- DOA10 (SSM4).
R Product of 400bp
Gas1- AGTTTTGACCATCAAAGAAGGTTAATGTGGCT Amplifies the RFP-
Clone- GTGGTTTCCGATTACTGGCATACAATGGTG Gas1 construct
URA-F (including Gas1's
endogenous
promoter) for
insertion into into the
URA3 locus
Gas1- AGCTTTTTCTTTCCAATTTTTTTTTTTTCGTC Amplifies the RFP-
Clone- ATTATAGATGGGAAATGGTTCAAGAAGG Gas1 construct
URA-R (including Gas1's
endogenous

Journal of Cell Science | Supplementary Material

 promoter) for
insertion into into the
URA3 locus
Hrd1- CACGACACAGACCACCGTAACAG Amplifies WT
WTCHK- HRD1. Product of
F 350p
Hrd1- TTGCTCGCCCCCGTCTCCAT Amplifies WT
WTCHK- HRD1. Product of
R 350p
Sec66- TGGTGGTGTCCCTTGTGATG Amplifies WT
WTCHK- SEC66. Product of
F 360bp
Sec66- CAGCCCGGTTGCAATCTTTC Amplifies WT
WTCHK- SEC66. Product of
R 360bp
Sec72- TGCGAGTGATGCTGTTGTTGCACT Amplifies WT
WTCHK- SEC72. Product of
F 255bp
Sec72- GCAAAAGCTTCCCAAGGCGCT Amplifies WT
WTCHK- SEC72. Product of
R 255bp
Ubp11- CCGTTTTCTTTTCGCTAAATCGGAAGTCATAA Tags UBP11 at it's N
Ntag-F AGACAATGCGTACGCTGCAGGTCGAC ter with the pYM-N
series.
Ubp11- CTTTTCGAACTAGGTTTAGAATTTGATCTGGG Tags UBP11 at it's N
Ntag-R TTTAATAACATCGATGAATTCTCTGTCG ter with the pYM-N
series.
Ubp1- TCGAACACTTCTCCCCTTTTAATCTACAAAAT Tags UBP1 at it's N
Ntag-F TTTGTATGCGTACGCTGCAGGTCGAC ter with the pYM-N
series.
Ubp1- ATTGTAATAAACTGTTTATCTTGCTTTCAATA Tags UBP1 at it's N
Ntag-R AACAAATCCATCGATGAATTCTCTGTCG ter with the pYM-N
series.

Journal of Cell Science | Supplementary Material

Table S4. Plasmids used in this study

Plasmid Utilization Source (Reference)

Localization of yeast GPI- Kindly provided by
pRS416 RFP-Gas1 anchored proteins Howard Riezman
Localization of yeast GPI-
pRS416 Venus-Ccw14 anchored proteins (Castillon et al., 2009)
Localization of yeast GPI-
pRS416 Venus-Tos6 anchored proteins (Castillon et al., 2009)
Yeast knockout cassette
via-PCR based homologous (Goldstein and
pFA6a-NatMX6 recombination McCusker, 1999)
Switch the endogenous
pYM-N15 promoter with GPD (Janke et al., 2004)
N terminal tagging with a
pYM-N21 Tef2p-GFP (Janke et al., 2004)
Galactose induced
pYES2-GFP expression of GFP (Ast et al., 2013)
Galactose induced
expression of GFP tagged N
terminally with the signal
pYES2-SS-GFP sequence of Gas1 (Ast et al., 2013)
Galactose induced
expression of GFP tagged C
terminally with the GPI
pYES2- GFP-AS anchoring sequence of Gas1 (Ast et al., 2013)
Kindly provided by
Scs2-GFP Localization of the ER Jeffrey Gerst
Localization of the Kindly provided by
MTS-RFP mitochondria Jodi Nunnari
Expresses the model Kindly provided by
CPY*-HA misfolded protein CPY* Jeffrey Brodsky

Journal of Cell Science | Supplementary Material