Gene 627 (2017) 72–78

Contents lists available at ScienceDirect

Gene
journal homepage: www.elsevier.com/locate/gene

Research paper

Rapid prenatal diagnosis of aneuploidy for chromosomes 21, 18, 13, X, and MARK
Y using segmental duplication quantitative fluorescent PCR (SD-QF-PCR)
Lei Suna,⁎,1, Zuqian Fanb,1, Ju Longc, Xunjin Wengc, Weijun Tangc, Wanrong Pangc
a
Laboratory of Medical Genetics, Qinzhou Maternal and Child Health Hospital, Guangxi 535005, PR China
b
Laboratory of Medical Genetics, Qinzhou Maternal and Child Health Hospital, Guangxi 535099, PR China
c
Qinzhou Key Laboratory of Molecular and Cell Biology on Endemic Diseases, Qinzhou, Guangxi 535099, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: Background: In our previous studies, the rapid diagnosis of aneuploidy has been achieved using the segmental
Quantitative fluorescent-PCR duplication molecular markers-based SD-QF-PCR technique. However, it is also insufficient due to the drawbacks
Chromosomes including less detection loci and incompetence in single-tube detection.
Segmental duplication Methods: In this paper, we developed 13 new segmental duplications as molecular markers, as well as designed
Aneuploidies
13 pairs of primers and 1 fluorescence-labeled universal primer, which could detect chromosome aneuploidies in
Prenatal diagnosis
one PCR tube.
Results: Two hundred and thirty samples were detected using SD-QF-PCR, the samples were collected from
individuals with trisomy 21 (n = 16); trisomy 18 (n = 4); trisomy 13 (n = 3); 45,X (n = 3); 47,XXY (n = 2);
47,XYY (n = 2); suspected mosaic 46,XX/46,XY (n = 2); and unaffected controls (n = 198).
Conclusions: The detection results of SD-QF-PCR were consistent with those of conventional karyotype analysis.
SD-QF-PCR based on the newly developed segmental duplications enables the single-tube and multi-locus si-
multaneous detection on the number of chromosomes 13, 18, 21, X and Y. Therefore, this technique offers a new
alternative for the diagnosis of chromosome aneuploidies.

1. Introduction syndrome), trisomy 13 (Patau syndrome), 45,X (Turner's syndrome),

Genetic diseases induced by chromosomal abnormalities are re-
sponsible for over 50% of spontaneous abortion, stillbirth and pre-
mature deaths and exhibit an incidence rate of about 1% in newborns
(Yusuf and Naeem, 2004; Driscoll and Gross, 2009). Being important
causes for sexual abnormality as well as male and female infertility and
sterility, they also act as one of significant origins leading to congenital
heart disease, intelligence hypoplasia and other disorders. Chromo-
somal abnormalities consist of numerical abnormalities and structural
abnormalities, where chromosomal aneuploidy abnormalities prove to
be one of the most common human chromosomal aberrations, which
seriously threats human health considering the severe mental retarda-
tion and malformation of tissues and organs generally developed in the
sufferers. The most common chromosomal numerical abnormalities
include trisomy 21 (Down's syndrome), trisomy 18 (Edward's
47,XXY (Klinefelter syndrome), triploids, mosaicism, among others,
which together account for > 80% of prenatally diagnosed chromo-
somal abnormalities (Hochstenbach et al., 2005). Existing heavy mental
and financial burden to the society and the family, these diseases
cannot be effectively cured at present, and the only feasible approach is
to reduce or avoid the birth of such children via prenatal screening or
diagnosis. Consequently, it is particularly vital to perform prenatal di-
agnosis against chromosomal disorders.
Currently, as the main diagnostic methods for chromosomal dis-
orders, cell culture and karyotype analysis method is accompanied by
shortcomings like complicated operation and long diagnostic reporting
cycle (Caine et al., 2005). With the development of molecular biology, a
number of rapid diagnostic techniques and methods have been devel-
oped and reported in succession, such as fluorescence in situ hy-
bridization (FISH) (Ho et al., 2012), quantitative fluorescent PCR (QF-

Abbreviations: FISH, fluorescence in situ hybridization; QF-PCR, quantitative fluorescent PCR; qPCR, real-time quantitative PCR; MLPA, multiplex ligation-dependent probe amplifi-
cation; HGQ-PCR, homologous gene quantitative PCR; PSQ, paralogous sequence quantification; HRM, high-resolution melting curve; aCGH, array comparative genomic hybridization;
NGS, next generation sequencing; dPCR, digital PCR; SD-QF-PCR, segmental duplication quantitative fluorescent PCR
⁎
Corresponding author.
E-mail addresses: sunshijie12345@163.com (L. Sun), fanzq2009@163.com (Z. Fan), 114239199@qq.com (J. Long), wxj_qz_2009@163.com (X. Weng),
tangwj_gx@163.com (W. Tang), pangwanrong_gx@163.com (W. Pang).
1
These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.gene.2017.06.014
Received 13 January 2017; Received in revised form 23 May 2017; Accepted 8 June 2017
Available online 09 June 2017
0378-1119/ © 2017 Elsevier B.V. All rights reserved.
L. Sun et al.
PCR) (Mann et al., 2004), SNP melting curve analysis (Pont-Kingdon
and Lyon, 2003; Nagy et al., 2005), real-time quantitative PCR (qPCR)
(Zimmermann et al., 2002), multiplex ligation-dependent probe am-
plification (MLPA) (Schouten et al., 2002),homologous gene quantita-
tive PCR (HGQ-PCR) (Lee et al., 1997), paralogous sequence quantifi-
cation (PSQ) (Deutsch et al., 2004), MLPA/qPCR (Guo et al., 2010),
high-resolution melting curve analysis (HRM) of segmental duplication
(Guo et al., 2012), array comparative genomic hybridization (aCGH)
(Hung et al., 2012), next generation sequencing (NGS) (Norton et al.,
2015), and digital PCR (dPCR) (Fan and Quake, 2007). All these
methods have the ability to diagnose aneuploidies, and exhibit re-
spective disadvantages or shortcomings, such as complicated operation,
poor locus specificity, high requirements for technical conditions, and
expensive costs.
In order to pursue a more fast, simple and stable method, an in-
vestigation was carried out regarding the existing techniques and
methods. We found that the HGQ-PCR developed by Lee HH et al.
provided an excellent detection method for the rapid diagnosis of
Down's syndrome (Lee et al., 1997). However, in-depth exploration on
the study found that there was an incompletely matched nucleotide in
both upstream and downstream of the used primer, so it is difficult to
maintain the original ratio in PCR amplification providing incomplete
binding of the primer to the target sequence. At the same time, with
single agarose gel electrophoresis as the quantitative method, the
quantitative accuracy and stability could not be guaranteed in different
laboratory tests. Nevertheless, the study did exhibit a highly promising
prospect in the homologous gene-based detection of gene copy number.
In 2012, Guo Q et al. developed the segmental duplication molecular
markers based on the same principle with homologous genes, whose
integration with the high-resolution melting analysis of segmental du-
plication (SD-HRM) permitted the rapid diagnosis of aneuploidy (Guo
et al., 2012), thus markedly simplifying the assays and reducing costs.
Regrettably, this method required a multi-tube operation, and 6 tubes
would be involved in order to detect 3 chromosomes. At all events, it
once again highlighted the advantage of segmental duplication-based
detection methodology. We started to develop segmental duplication
molecular markers considering their potential application prospects. In
the early development and application, we combined segmental du-
plication molecular markers with STR molecular markers, which were
used to simultaneously detect aneuploidies and showed the advantage
of mutual diagnosis and mutual verification (Long et al., 2013). Un-
fortunately, STR required several fluorescent labels, so the labeling
costs were higher; besides, STR's requirement for multi-locus detection
could easily cause the reduction in reaction system stability. In addi-
tion, we further combined the developed segmental duplications mo-
lecular markers with QF-PCR technique. The detection system consisted
of two tubes, which could enable the aneuploidy screening of 5 chro-
mosomes (Kong et al., 2014). However, the less detection loci, excessive
fluorescent labels and incompetence in single tube detection, may lead
to reduced stability and accuracy of the experiment.
In view of the shortcomings in the previous detection system, we re-
screened and verified a series of new segmental duplication molecular
markers. The new molecular markers can realize the single-tube and
multi-locus simultaneous detection of the abnormalities in chromo-
somes 13, 18, 21, X and Y, thus providing a new theoretical basis and
diagnostic alternative for the diagnosis of prenatal common chromo-
some aneuploidies. In this paper, 230 cases of routine clinical amniotic
fluid samples were further detected using SD-QF-PCR, whose clinical
application value in the diagnosis of aneuploidy abnormalities was
explored via a more in-depth comparison with the conventional kar-
yotype analysis.
73
Gene 627 (2017) 72–78
2. Materials and methods
2.1. Ethics statement
This study was conducted according to the principles expressed in
the Declaration of Helsinki. The protocol for this study was approved
through the Research Ethics Committee of Qinzhou Maternal and Child
Health Hospital. Written informed consent was obtained from each
participant for the collection of samples and subsequent analyses.
2.2. Samples
A total of 230 samples were collected in this study, of which 16
samples were obtained from individuals with trisomy 21, 4 samples
from individuals with trisomy 18, 3 samples from individuals with
trisomy 13, 3 samples with 45,X, 2 samples from individuals with
47,XXY and with 47,XYY respectively, 2 samples of suspected mosaic
46,XX/46,XY, and 198 samples from unaffected individuals. All sam-
ples have been verified through amniotic fluid karyotype analysis.
2.3. DNA extraction
DNA was extracted from uncultured amniotic fluid samples and
umbilical cord blood samples using the DNA extraction kit (Tiangen)
according to the manufacturer's instructions. The concentration and
purity of the extracted genomic DNA were determined via spectro-
photometry (Quawell); with the concentration adjusted to 30 ng/μL,
the DNA samples were stored at − 80 °C for subsequent molecular de-
tection.
2.4. Development of segmental duplication molecular markers
The segmental duplications used in this study referred to the in-
terspersed repeats with two copies in their genome rather than the
tandem repeats in the form of unique sequences, such as satellite DNA,
minisatellite DNA and microsatellite DNA. Such segmental duplication
included two sequences with highly similar bases (similar sequences)
and were blasted against the human chromosomal segmental duplica-
tions in NCBI; we selected two copies: one copy must be located on the
target chromosome, and the other must be located on a chromosome
other than the target chromosome (Fig. 1A). For the screened similar
segmental duplications, both the high base similarity and the differ-
ences in the number of some bases were required, since the identical
bases could be used for subsequent universal primer design while those
with numerical or structural differences for subsequent capillary elec-
trophoresis analysis (Fig. 1B). Using capillary electrophoresis to acquire
the fluorescence ratio between the PCR products of two similar se-
quences of segmental duplication, their ratio on the initial template
could be determined, thereby allowing to judging the number of target
chromosomes (Fig. 1C).
Primers were designed according to the selected segmental dupli-
cations respectively, followed by the single-primer and multi-primer
verification. After that, the segmental duplication molecular markers
and their amplification primers were finally developed.
2.5. SD-QF-PCR and capillary electrophoresis
The PCR amplification was performed using PCR System 9700
(Applied Biosystems) in a total reaction volume of 25 μL containing
1 × Reaction Master Mix (CWBio Biological Technology Co., Ltd.),
30 ng genomic DNA and 0.5 m mol/L of each forward and reverse
primer. The reaction mixture was preheated at 95 °C for 3 min, fol-
lowed by 28 cycles of 30 s at 95 °C and 30 s at 60 °C, an extension step
at 72 °C for 10 min, and the final preservation at 15 °C for subsequent
use.
1 μL of the PCR product was mixed with 23 μL of formamide and
L. Sun et al. Gene 627 (2017) 72–78

Fig. 1. The principle and process of SD-QF-PCR.

(A), The segmental duplication molecule markers located on Chr 6 and Chr 13. (B), A single pair of primers was used to simultaneously amplify a 129-bp sequence on chr6 and a 132-bp
sequence on Chr 13 from segmental duplications. (C), Normal samples with a 1:1 pattern ratio of chromosome dosages, trisomy 13 samples with a 2:3 pattern ratio of chromosome
dosages.

Table 1 ratio between the segmental duplications was calculated based on the
Information for primers and amplicons. fluorescence signal height of two similar sequences, and the changes in
copy number between two chromosomes were identified via the
Segmental Primer sequence (5′ → 3′) Amplicon size
duplications (bp) quantitative ratio. The detection results of SD-QF-PCR were recorded
and compared with those of karyotype analysis.
SD1QF13 Tail-CCTGATCCAGTGACTGCTCTC Chr 6: 129
GCAAGATGAAGGGGATGTCCA Chr 13: 132
SD2QF13 Tail-CTTTTTGGGATTTCTACTGCAATCT Chr 13: 144 3. Results
TGCAAGATAGTGCAGCCTGG Chr 5: 148
SD3QF13 Tail-GGCCAAAATCAGCTCAAGGG Chr 9: 157
3.1. Development of segmental duplication molecular markers and primer
GGGCTGCTCAGGGTTCC Chr 13: 161
SD4QF18 Tail-TGCTGGATATATGAAACTCAGACC Chr 18: 167
design
TCATGCCTGGTCATTTGGGT Chr 8: 170
SD5QF18 Tail-GGGCCAAACCCAACCCT Chr 19: 177 Through blasting the segmental duplication of target chromosomes,
ATATCTGTGTTTTGTCCCACACC Chr 18: 181 a total of 13 new segmental duplication molecular markers, located on
SD6QF18 Tail-TGCTGTAGAGCAAGGTGAGT Chr 5: 190
different loci in chromosomes 13, 18, 21, X and Y, were developed in
CAGCCTCACTTAATTCTGAGGT Chr 18: 194
SD7QF21 Tail-AGCTCCAGATCACCATGCTC Chr 21: 214 this study. With the screened segmental duplications of chromosomes
AAAACTGGCCCGAAGGGTAG Chr 2: 218 13, 18 and 21 as target sequences, three loci were screened out for each
SD8QF21 Tail-AGGCAAACATTATACACACAATGG Chr 9: 227 chromosome to detect the number of chromosomes 13, 18 and 21.
TCTGCTGCCTGTCAATATTTGT Chr 21: 233 Segmental duplications SD1QF13, SD2QF13 and SD3QF13 were used
SD9QF21 Tail-TCCACAGAATCTGAAGGCTCC Chr 21: 245
TACTTTAATTAGCTGACAGCATGTG Chr 15: 251
for the number detection of chromosomes 13, SD4QF18, SD5QF18 and
SD10QF1Y GGTTGTGCTAAAAACACTCTTTGC Chr 1: 273 SD6QF18 for chromosome 18, whereas SD7QF21, SD8QF21 and
Tail-TCTGGAATGTGGCTGCTGT Chr Y: 277 SD9QF21 for chromosome 21. With the screened segmental duplica-
SD11QFYX Tail-ACTGTCTAGACAATCACCCCA Chr Y: 284 tions of chromosome X and Y as target sequences, four segmental du-
AAAAGTATGATCCAGCTACTACAGA Chr X: 289
plication loci were screened, i.e., SD10QF1Y, SD11QFYX, SD12QFX16
SD12QFX16 Tail-AGTAAGAAACAATGGGCAGAAAGC Chr X: 302
TTTCCCTCCAGGACCACCTT Chr 16: 306 and SD13QF3X, which were used for the number detection of chro-
SD13QF3X Tail-GGTTTTGCCTAGGTCCAGTG Chr 3: 335 mosomes X and Y.
CCTGGTAATACAGCTCAGTGTCA Chr X: 341 With the developed segmental duplication molecular markers as the
FAM-tail: FAM-tgcacgctgacgactggtac target sequences, we designed and synthesized the corresponding seg-
mental duplication amplification primers, one consensus tailed se-
quence, and fluorescence-labeled universal amplification primers. The
1 μL of the size standard (Applied Biosystems). The mixture was de-
sequence 5′-tgcacgctgacgactggtac-3′ was used to tail the upstream or
natured at 95 °C for 3 min and placed on ice to prevent re-annealing
downstream primers in the segmental duplication amplification primers
until further analysis. The electrophoretic analysis was performed using
(Fig. 1B), that is, 13 of 26 primers were tailed (Table 1). Meanwhile, the
a POP4 gel (ABI) on the ABI 3130xl Genetic Analyzer (Applied
FAM fluorescence-labeled tailed primer was used as the universal am-
Biosystems).
plification primers to co-amplify 26 segmental duplications. Table 1
presents the specific primers and product length of segmental dupli-
2.6. Results analysis
cations. Fig. 2 presents the loci and electrophoresis results of segmental
duplications.
The PCR products of the segmental duplications with different
fragment sizes were separated using capillary electrophoresis, and there
were also differences in capillary electrophoresis fluorescence signals 3.2. The sensitivity and stability of SD-QF-PCR
between the amplification products of different concentrations.
GeneMapper ID Software V3.2 (Applied Biosystems) was used for the A serial dilution of template DNA was used to evaluate the sensi-
data analysis of product length and amplification volume. The peak tivity and stability of SD-QF-PCR. Genomic DNA was extracted from

74
L. Sun et al.
Fig. 2. The loci and electrophoresis results of segmental duplication.
blood samples of six normal individuals which have been analyzed by
karyotype analysis. Each template DNA was serially 10-fold diluted
from 300 ng to 3 pg, and tested for SD-QF-PCR for three times.
Although the signal could be detected when 300 pg DNA was used, it
was not quantified exactly. Therefore, the expected values can be ob-
tained when the concentration of template DNA was between 300 ng
and 3 ng.
3.3. Judgment on the detection results of autosomal aneuploidies using SD-
QF-PCR
In normal samples, the amplification volume ratio of the segmental
duplications (two similar sequences) between the sequences of chro-
mosomes 13, 18 and 21 and the sequences of reference chromosomes
was 2:2, that is, the ratio was 1:1 (Fig. 3A and B). In the target trisomy
chromosomes, the ratio turned to be 3:2, i.e., 1.5:1 (Fig. 3C–E).
3.4. Judgment on the detection results of sex chromosomal aneuploidies
using SD-QF-PCR
In normal male samples with X:Y = 1:1, the ratio of autosome to sex
chromosome (X or Y) was 2:1 (Fig. 3B); in normal female samples with
Y = 0, the ratio of autosome to chromosome X was 2:2 (Fig. 3A). In
47,XXY samples with X:Y = 2:1, the ratio of autosome to chromosome
Y was 2:1, and the ratio of autosome to chromosome X was 2:2
(Fig. 3G). In 45,X samples with Y = 0, the ratio of autosome to chro-
mosome X was 2:1 (Fig. 3F). In 47,XYY samples with X:Y = 1:2, the
ratio of autosome to chromosome Y was 2:2, and the ratio of autosome
to chromosome X was 2:1 (Fig. 3H).
3.5. SD-QF-PCR detection results
Two hundred and thirty clinical amniotic fluid samples were
75
Gene 627 (2017) 72–78
detected using SD-QF-PCR, of which 16 samples were obtained from
individuals with trisomy 21, 4 samples from patients with trisomy 18, 3
samples from individuals with trisomy 13, 3 samples with 45,X, and 2
samples from individuals with 47,XXY and with 47,XYY respectively.
Two samples of suspected mosaic 46,XX/46,XY in amniotic fluid
karyotype analysis, only one sample was identified as true mosaic
sample by SD-QF-PCR, the segmental duplication ratios of 46,XX/46,XY
sample were X:Y = 1008:710 = 1.42, which was consistent with the
results of cord blood (the cord blood karyotypes 46, XY/47, XXY with
the mosaic proportions of 18:82) and amniotic fluid karyotype analysis
(the amniotic fluid karyotypes 46, XY/47, XXY with the mosaic pro-
portions of 17:83) (Fig. 3I).
In the detection of aneuploidies and mosaic from clinical samples,
the detection results of chromosomal aneuploidies using SD-QF-PCR
were consistent with those using conventional karyotype analyses.
Significant differences in the SD-QF-PCR results regarding chromo-
somes 13, 18 and 21 were observed between normal samples and
trisomy samples (Fig. 4), and the statistical results of means and stan-
dard deviations of chromosomes 13, 18 and 21 using SD-QF-PCR have
been shown in Table 2, indicating 100% sensitivity and specificity of
SD-QF-PCR in the diagnosis of clinical samples.
4. Discussion
SD-QF-PCR is based on the co-amplification of segmental duplica-
tions located on two different chromosomes using a single pair of pri-
mers. The PCR products of different sizes were subsequently analyzed
through capillary electrophoresis, and the aneuploidies were de-
termined based on the relative dosage between the two chromosomes
(Fig. 3). The detection over 230 clinical samples showed that the results
of chromosomal aneuploidies using SD-QF-PCR were consistent with
that using conventional karyotype analysis, demonstrating 100% sen-
sitivity and specificity for both. Therefore, SD-QF-PCR is able to quickly
L. Sun et al.
Fig. 3. The electrophoresis results of segmental duplication.
and stably detect the abnormalities in common chromosomal aneu-
ploidies.
Human genomic repetitive sequences exist in two organizational
forms, tandem repeats and interspersed repeats. Tandem repeats in-
clude satellite DNA, minisatellite DNA and microsatellite DNA, all of
which have been widely applied in the field of biology (Neusser et al.,
2015); interspersed repeats refer to those sequences whose repeated
units are not coterminous but interspersed on the chromosomal loci
throughout the entire genome. At present, research on interspersed
repeats mainly focuses on their structures, functions and homology
(Sethi et al., 2016), while studies on their applications appear to be few
in the clinical diagnosis of genetic diseases. In our study, the segmental
duplications with two copies in the genome, as new molecular markers,
were found to have an unparalleled advantage in relative quantification
detection. Because of the identical amplification primers, these two
sequences are always capable of maintaining almost identical amplifi-
cation efficiencies and the exact same product amplification volume
upon the changes in DNA concentration or purity, PCR system, or
76
Gene 627 (2017) 72–78
amplification temperature. Therefore, the segmental duplication mo-
lecular markers with two copies exhibit favorable application ad-
vantages and promotion prospects in the clinical diagnosis of gene or
chromosome number.
In order to ensure that the relative dosage of segmental duplication
amplification products between two chromosomes can be detected via
SD-QF-PCR, the selected segmental duplications should not be entirely
identical but those with identical primer ends and exhibiting different
base number in the middle segment (Fig. 1). Meanwhile, since the small
fragments of DNA are amplified preferentially during PCR, the base
difference between two similar sequences should be not > 8 bases in
general; excessive base number difference may lead to imbalanced
number of amplification products and further affect the final results
judgment. In our previous studies, each primers of segmental duplica-
tion were labeled, so there would be 13 FAM-labeled primers in the
present study according to the approach. In order to save the costs for
reagents and facilitate the preservation of primers, one of the segmental
duplication amplification primers was tailed by a segment of the
L. Sun et al. Gene 627 (2017) 72–78

Fig. 4. Individual relative ratios of chromosomes 21, 18 and 13 in

normal and trisomic samples.

consensus sequence 5′-tgcacgctgacgactggtac-3′, while a fluorescence-
labeled tailed primer, FAM-tgcacgctgacgactggtac, was added to the
reaction system. With the help of this fluorescence-labeled primer, 26
segmental duplications can be co-amplified with their products labeled
by FAM fluorescence. The peak ratio between two similar segmental
duplications can be thus calculated based on the fluorescence signal
height, that is, the changes in copy number between two chromosomes
can be identified through quantifying the fluorescence ratio between
two segmental duplications.
In previous studies, it is difficult to make the designed primers ar-
ranged in a certain order due to the limited loci for developed seg-
mental duplication molecular markers, so an assist from product re-
ference diagrams is required for the results judgment; furthermore,
considering the incompetence in the co-amplification in a single tube, it
will involve multiple tubes, thus leading to relatively complicated
judgment procedure. In our study, after screening a large number of
sequences, 3 sets of detection primers were designed respectively for
chromosomes 13, 18 and 21 and arranged in order; 4 sets of detection
primers were designed for chromosome X and Y. Consequently, the
detection results could be intuitively judged according to the electro-
phoretogram (Fig. 3).
A serial dilution of the DNA template concentration was used to
evaluate the sensitivity and stability of the SD-QF-PCR. Although the
low template DNA concentration might led to imbalanced amplification
due to the Poisson distribution of the template DNA, overall the results
demonstrated that all samples generated average values close to the
theoretically expected values when the DNA template concentration
≥ 3 ng.
In conventional cytogenetic method, it is often necessary to differ-
entiate the true mosaic or pseudomosaicism. True mosaic are mainly
induced by cell mitotic nondisjunction or chromosome loss (Wieczorek
et al., 2003). By contrast, the pseudomosaicism may be generated by
maternal cell contamination or in vitro culture aberration of fetal ex-
foliated cells (Eggermann et al., 2015). The true mosaic may seriously
affect fetal growth and mental development (Ferguson-Smith and
Bianchi, 2010), while the pseudomosaicism may trigger incorrect pre-
natal interventions, both of which may exert great mental and physical
damage to the pregnant women. In order to identify whether the am-
niotic fluid cells are true mosaic or pseudomosaicism, two or more in-
dependent media would be required to be established in the conven-
tional amniotic fluid cell culture approach, and the operation and
interpretation should be performed by two technicians parallels. Cur-
rently, the molecular methods capable of mosaic detection are limited.
Although FISH can be applied for mosaic identification and ratio con-
firmation, it is restricted by the relatively complicated detection pro-
cedure and expensive costs. According to our experience in prenatal
diagnosis, SD-QF-PCR can not only realize the rapid diagnosis of an-
euploidy but also effectively suggest the mosaic samples. Two cases of
mosaic were identified in amniotic fluid cell karyotype analysis. Of
them, only one sample was identified as true mosaic sample by SD-QF-
PCR, the segmental duplication ratios of 46,XX/46,XY sample were
X:Y = 1.42, which corresponded to mosaic proportions of 17:83, when

Table 2
Specificity and sensitivity of chromosomes 13, 18, and 21.

Segmental duplication Chr13:Chr6 Chr13:Chr15 Chr13:Chr9 Chr18:Chr8 Chr18:Chr19 Chr18:Chr5 Chr21:Chr2 Chr21:Chr9 Chr21:Chr15

Mean control 1.02 1.05 0.92 0.91 0.93 0.99 1.00 1.04 1.02
SD control 0.06 0.04 0.07 0.05 0.04 0.02 0.04 0.05 0.05
Control samples 227 227 227 226 226 226 214 214 214
Mean trisomic 1.43 1.65 1.37 1.41 1.45 1.50 1.50 1.50 1.50
SD trisomic 0.02 0.06 0.05 0.06 0.03 0.03 0.02 0.03 0.04
trisomic samples 3 3 3 4 4 4 16 16 16
Total samples 230 230 230 230 230 230 230 230 230
Sensitivity 1 1 1 1 1 1 1 1 1
Specificity 1 1 1 1 1 1 1 1 1

77
L. Sun et al.
the segmental duplication ratios were converted into karyotype pro-
portions. And the result is consistent with cord blood karyotype analysis
(18:82) and amniotic fluid karyotype analysis (17:83). For another
amniotic fluid sample, karyotype analysis considered it as a mosaic
sample while SD-QF-PCR detected it as a normal sample; the sub-
sequent cord blood karyotype analysis verified that the sample was
normal. The mosaic result as identified by the karyotype analysis on
amniotic fluid cells might be caused by mutations in the culture pro-
cess.
In the present study, a series of new segmental duplication molecule
markers were screened out, and their integration with QF-PCR devel-
oped the SD-QF-PCR technique. Subject to the comparative study in-
volving 230 clinical samples, SD-QF-PCR can not only simultaneously
detect the aneuploidies of chromosome 21, 18, 13, X and Y in a single
reaction tube, but also suggest mosaic samples. The detection results of
SD-QF-PCR are entirely consistent with those of conventional cytoge-
netics, indicating that it represents a reliable and rapid diagnostic al-
ternative and can be used for the prenatal diagnose of clinical samples.
Conflict of interests
The authors have no conflict of interests to declare.
Acknowledgments
All the authors have accepted responsibility for the entire content of
this submitted manuscript and approved submission.
The study was supported by the National Natural Science
Foundation of China (project no. 81660259) and Scientific Research
and Technological Development of Guangxi (project no. 1598012-35).
References
Caine, A., Maltby, A.E., Parkin, C.A., Waters, J.J., Crolla, J.A., Cytogeneticists, U.K.A.o.C.,
2005. Prenatal detection of Down's syndrome by rapid aneuploidy testing for chro-
mosomes 13, 18, and 21 by FISH or PCR without a full karyotype: a cytogenetic risk
assessment. Lancet 366, 123–128.
Deutsch, S., Choudhury, U., Merla, G., Howald, C., Sylvan, A., Antonarakis, S.E., 2004.
Detection of aneuploidies by paralogous sequence quantification. J. Med. Genet. 41,
908–915.
Driscoll, D.A., Gross, S., 2009. Clinical practice. Prenatal screening for aneuploidy. N.
Engl. J. Med. 360, 2556–2562.
Eggermann, T., Soellner, L., Buiting, K., Kotzot, D., 2015. Mosaicism and uniparental
disomy in prenatal diagnosis. Trends Mol. Med. 21, 77–87.
Fan, H.C., Quake, S.R., 2007. Detection of aneuploidy with digital polymerase chain re-
action. Anal. Chem. 79, 7576–7579.
Ferguson-Smith, M.A., Bianchi, D.W., 2010. Prenatal diagnosis: past, present, and future.
78
Gene 627 (2017) 72–78
Prenat. Diagn. 30, 601–604.
Guo, Q., Zhou, Y., Wang, X., Li, Q., 2010. Simultaneous detection of trisomies 13, 18, and
21 with multiplex ligation-dependent probe amplification-based real-time PCR. Clin.
Chem. 56, 1451–1459.
Guo, Q., Xiao, L., Zhou, Y., 2012. Rapid diagnosis of aneuploidy by high-resolution
melting analysis of segmental duplications. Clin. Chem. 58, 1019–1025.
Ho, S.S., Chua, C., Gole, L., Biswas, A., Koay, E., Choolani, M., 2012. Same-day prenatal
diagnosis of common chromosomal aneuploidies using microfluidics-fluorescence in
situ hybridization. Prenat. Diagn. 32, 321–328.
Hochstenbach, R., Meijer, J., van de Brug, J., Vossebeld-Hoff, I., Jansen, R., van der Luijt,
R.B., Sinke, R.J., Page-Christiaens, G.C., Ploos van Amstel, J.K., de Pater, J.M., 2005.
Rapid detection of chromosomal aneuploidies in uncultured amniocytes by multiplex
ligation-dependent probe amplification (MLPA). Prenat. Diagn. 25, 1032–1039.
Hung, C.C., Lin, C.H., Lin, S.Y., Shin, J.C., Lee, C.N., Su, Y.N., 2012. Prenatal diagnosis of
a fetus with a de novo trisomy 12p by array-comparative genomic hybridization
(array-CGH). Gene 495, 178–182.
Kong, X., Li, L., Sun, L., Fu, K., Long, J., Weng, X., Ye, X., Liu, X., Wang, B., Yan, S., 2014.
Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent
PCR. PLoS One 9, e88932.
Lee, H.H., Chang, J.G., Lin, S.P., Chao, H.T., Yang, M.L., Ng, H.T., 1997. Rapid detection
of trisomy 21 by homologous gene quantitative PCR (HGQ-PCR). Hum. Genet. 99,
364–367.
Long, J., Ye, X., Weng, X., Fu, K., Sun, L., Pang, W., 2013. Rapid diagnosis of aneuploidy
in chromosomes 13, 18, 21, X and Y by quantitative fluorescence-PCR combined with
short tandem repeat and fluorescence-labeled homologous gene quantitative PCR
using 4-color fluorescently labeled universal primers. Mol. Med. Rep. 8, 1601–1605.
Mann, K., Donaghue, C., Fox, S.P., Docherty, Z., Ogilvie, C.M., 2004. Strategies for the
rapid prenatal diagnosis of chromosome aneuploidy. Eur. J. Hum. Genet. 12,
907–915.
Nagy, B., Bán, Z., Lázár, L., Nagy, R.G., Papp, C., Tóth-Pál, E., Papp, Z., 2005. Rapid
determination of trisomy 21 from amniotic fluid cells using single-nucleotide poly-
morphic loci. Prenat. Diagn. 25, 1138–1141.
Neusser, M., Rogenhofer, N., Durl, S., Ochsenkuhn, R., Trottmann, M., Jurinovic, V.,
Steinlein, O., von Schonfeldt, V., Muller, S., Thaler, C.J., 2015. Increased chromo-
some 16 disomy rates in human spermatozoa and recurrent spontaneous abortions.
Fertil. Steril. 104 (1130–7), e1–10.
Norton, M.E., Jacobsson, B., Swamy, G.K., Laurent, L.C., Ranzini, A.C., Brar, H.,
Tomlinson, M.W., Pereira, L., Spitz, J.L., Hollemon, D., Cuckle, H., Musci, T.J.,
Wapner, R.J., 2015. Cell-free DNA analysis for noninvasive examination of trisomy.
N. Engl. J. Med. 372, 1589–1597.
Pont-Kingdon, G., Lyon, E., 2003. Rapid detection of aneuploidy (trisomy 21) by allele
quantification combined with melting curves analysis of single-nucleotide poly-
morphism loci. Clin. Chem. 49, 1087–1094.
Schouten, J.P., McElgunn, C.J., Waaijer, R., Zwijnenburg, D., Diepvens, F., Pals, G., 2002.
Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent
probe amplification. Nucleic Acids Res. 30 (e57–e57).
Sethi, K., Siwach, P., Verma, S.K., 2016. Simple sequence repeats (SSR) and interspersed
sequence repeats (ISSR) markers for genetic diversity analysis among selected gen-
otypes of Gossypium arboreum race bengalense. Afr. J. Biotechnol. 15, 7–19.
Wieczorek, D., Prott, E.C., Robinson, W.P., Passarge, E., Gillessen-Kaesbach, G., 2003.
Prenatally detected trisomy 4 and 6 mosaicism—cytogenetic results and clinical
phenotype. Prenat. Diagn. 23, 128–133.
Yusuf, R.Z., Naeem, R., 2004. Cytogenetic abnormalities in products of conception: a
relationship revisited. Am. J. Reprod. Immunol. 52, 88–96.
Zimmermann, B., Holzgreve, W., Wenzel, F., Hahn, S., 2002. Novel real-time quantitative
PCR test for trisomy 21. Clin. Chem. 48, 362–363.