DNA and Genes

Thing to find out:

• What is DNA?
• The Genetic code
• The Human genome
• Passing on the genomic information
• Inheritance patterns
 Diversity of Life
• All biological
systems are
composed of the
same types of
molecules

• Similar organization
priciples are used
at the cellular level
 The Cell
• Basic component of
life

• Two main categories,

prokarytic and
eukaryotic cells

• Differences in the
nucleus
• Prokaryotes lack a
defined nucleus and
have a simplified
internal structure

• Eukaryotes have
membrane limited
nucleus and more
complicated internal
structure

• Three branches of
life
• Genetic material is located to the nucleus
• The genetic information is stored in
Deoxyribonucleic acid, DNA
• DNA contains all the information needed to
build an individual
 What is DNA needed for?
•Genetic information
is used for gene expression

•Information of a gene is
transferred from DNA and
converted to protein

•RNA molecules work as

messangers

•Proteins are the biological

workers
•Information of the DNA is copied by
directing the synthesis of a RNA molecule
in a process called transcription

•RNA directs the

protein synthesis in a
translation

•Protein’s 3D structure
determines it’s function

•Information can
transfer only in one
direction
 DNA (Deoxyribo Nucleic Acid)

•DNA is a polymer of nucleotide monomers

•2’-deoxyribose sugar
•Four bases: Base part
•Adenine, A
•Guanine, G
•Thymine, T
•Cytosine, C
• Together a sugar and
a base are called
a nucleoside
Sugar part
 Four bases...

Purine bases Pyrimidine bases

• Adenine and • Thymine and
guanine cytosine
• Two carbon rings • A single carbon
ring
DNA chains
• Nucleosides are
joiden together with
phospsodiesteri bond

• Sequence of bases
vary  genetic
information

• Chains are extremely

long!
DNA Molecules
• DNA molecules are
composed of two
polynucleotide
chains

• Double helix,
twisted in right
handed way

• Twists a full circle

in every 10 bases
•”ladder-structure”
–Bases = steps
–Sugars and phosphates =
suporting pilars

•Two nucleotide chains

run in opposite
directions  chemical
direction
 Complementary Pairing
• Bases interact with other bases
• Purines with two carbon rings interact only
with single ring pyrimidines  Space between
the chains is limited.
• AT
• GC
• Complementary pairing  Vital for retainins
of the genetic information!

•Interaction is stabilized by
hydrogen bonds
•A-T bond  two hydrogen bonds
•G-C bond  three hydrogen bonds
 The Genetic Code
• Describes how base sequences are
converted to protein sequence

• DNA sequence is divided into series of

units of three bases  a codon

• One codon is spesific to one amino

acid ( structural component of
protein)
• The four bases can
form 64 codons

• 20 amino acids are

found from the
nature

• Codons hava also

alternative
functions needed
to regulate protein
synthesis
 •Right reading frame is obligatory!!!

•Sequence of human HCR gene, which assosiates with psoriasis

atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc

ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaacc

•Many different reading frames can be used, but only one is the right one

•Transleate tools can found form the internet

Frame 1 The right one
Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I
PLVQ

Frame 2
C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F
PWSN

Frame 1
G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q
P S G T Stop R W K H
 Genes

• Genetic information is encoded in the base

sequence of the DNA
• A gene : DNA sequence that encodes amino
acid sequence of a protein
• Beside the coding area, also other elements
are needed  control elements and ”empty
areas”
• Genes vary a lot in size

•Genes are separeted from each others by

sequences which function is unknown

•Only other strand of the DNA carries

biological information  template strand

•Potential to store biological information is

enormous
Chromosome

Condenced scaffold

fibers connected to
chromosome scaffold

chromatin fibers

chromatin

DNA
 Mutations
• Mutations are alterations in DNA sequence

• Many chemical and physiological agents

and errors in DNA replication

• Cells can repaire some mistakes

•Once introduced and not repaired,

changes in DNA sequence are
made permanent by DNA replication
Sequence variations:
Single nucleotide polymorphims:

Alteration of a single base 

1. Causes an alteration in the amino

acid that the codon codes

2. Does not cause alteration on the

amino acid that the codon codes

3. Alters codon in the way that it

becomes stop-codon for protein
synthesis
• Frameshift mutation: insertion/deletion
of bases  reading frame is alterered
The Human Genome

The different types

of sequences that
make up the total
DNA of a human cell
 The Human genome...

• 3 billion base pairs

• about 30000 genes

• 23 chromosome pares  46 chromosomes

• 25 % of the DNA is gene related

• Only 5 % encodes proteins

• Genes include exons and introns

• Beside coding areas also additional secuences are found

 Two important terms...

Phenotype: The outlook of an organism

Genotype: The genetic information written in the DNA

Phenotypes

Genotype Genotype

GCCAAGAATGGCTCCCACCT
ATGTTTCCACCTTCAGGTTCC
GGCTCTCAGACATTCCCCTG
ACTGGGCTGATTCCCCCCTCC
GTCCAACCCCCAGGCCATCA
CACTTTCAAGCTCGGCCCCTT
AGATGTCTCAGAGAGGCGG
TCAACTCAGAGAGGCGGCTA
CTAGACACCCAGAGACCTCA
GACACCCAGAGACCTCAAGT
AGTGACCATGTGGGAACGG
GACCATGTGGGAACGGGATG
GATGTTTCCAGTGACAGGCA
TTTCCAGTGACAGGCAG
Passing on the genetic information:

• Information passed on in the sexual reproduction

• Needed for new characteristics to develope
All somatic cells
• 46 chromosomes Fertilization:
• Diploid cells, 2n
+
n n
Sperm cell
• 23 chromosomes
• Haploid cell, n

Egg cell
• 23 chromosomes Fertilized egg
• Haploid cell, n • 2n
• 46 chromosomes
Mitosis

• Every cell division

• The number of chromosomes

does not change

• DNA dublicates before entering

the mitosis

• Takes 1-2 hours

Meiosis

• Nuclear division

• Only in gamete formation

• Results formation of the haploid

gametosytes

• Mature gametocytes have 23

chromosomes (n)
Humans

•46 chromosomes ( 44 autosomes, 2 sex chromosomes)

•X and Y –chromosomes

•XX  female

•XY  Male
The chromosome pare:

• A locus
• An allele
• Heterozygous (Aa)
• Homozygous (AA or aa)
•We have two copies of each gene, one from the mother
and one from the father  Genotype

• Dominant character: only one allele needed to cause the

phenotype (heterozygous)

• Recessive character: both allels needed to cause the

phenotype (homozygous)
 Inherited diseases
• DNA mutations are significant in development of diseases

• Inherited diseases are caused by mutations passed from

a parent to a offspring

• Monogenic diseases: disease is caused by mutation in

one gene

•Multifactioria diseases: disease is caused by co-operative

action of different mutations in different genes and
environmental factors
• Mendelian inheritance: Presence or absence depends
of the genotype at the single locus
Autosomal dominant inheritance:
Autosomal recessive inheritance:
X-chromosome linked recessive inheritance:
X-chromosome linked dominant inheritance: