DENTAL

ANKYLOSIS: CLINICAL AND MOLECULAR CHARACTERIZATION

Gabriel Senties-Ramirez

A thesis submitted to the faculty at the University of North Carolina at Chapel Hill in partial
fulfillment of the requirements for the degree of Master of Science in the School of Dentistry
(Orthodontics).

Chapel Hill
2016

Approved by:

Sylvia A. Frazier-Bowers

Ching Chang Ko

John Timothy Wright

© 2016
Gabriel Senties-Ramirez
ALL RIGHTS RESERVED

ii
 ABSTRACT

Gabriel Senties-Ramirez: Dental Ankylosis: Clinical and Molecular Characterization

(Under the direction of Sylvia A. Frazier-Bowers.)


Introduction: Dental ankylosis is a histological definition for a condition that is often

clinically indistinguishable from other eruption disorders. C onfusion between ankylosis

and PFE can result in an inaccurate diagnosis, and inappropriate orthodontic

management. In this study, we tested the central hypothesis that ankylosis is a distinct

pathology compared to PFE due to PTH1R mutations. Methods: 1) We completed

mutational analysis of PTH1R on patients with PFE (based on familial segregation) or

suspected ankylosis. 2) We performed expression studies to compare PFE and ankylosis in

PDL tissue of control and affected extracted teeth. Collected PDL tissue from extracted

teeth was used to create primary cell cultures for genetic expression studies. Differences in

genetic expression of PTH1R, RANKL, BMP-2, BMP-4, and BMP-6 at the PDL between

ankylosed, control, and PFE teeth were tested. Results: Differences in the expression of

BMP-4, BMP-6, and PTH1R were found between control, PFE, and ankylosed teeth.

iii
 ACKNOWLEDGMENTS

I would like to thank the members of my thesis committee, Dr. Sylvia Frazier-Bowers, Dr.

Ching Chang Ko, and Dr. Timothy Wright for their advice and guidance during this project. I also

have a debt of gratitude towards Dr. William “Todd” Seaman and Yizu Jiao for their technical

counsel and aid, as well as Dr. Melanie Alazzam, who advised me during the drafting of my

protocol proposal. This project would have never been possible without the logistical support of

Marisa Sears, Teresa Estcovitz, and Ying Wan, for whom I am deeply appreciative as well. I

would like to thank all full time and adjunct faculty in the Department of Orthodontics for their

support and encouragement, and my co-residents for their camaraderie and endless provision

of motivation. Last but not least, I would like to thank the UNC School of Dentistry and the

Southern Association of Orthodontists for the generous grants that made this project possible.

iv
 TABLE OF CONTENTS

LIST OF TABLES ..................................................................................................................... VII

LIST OF FIGURES .................................................................................................................. VIII

LIST OF ABBREVIATIONS ........................................................................................................ XI

LIST OF SYMBOLS ................................................................................................................. XIII

A REVIEW OF THE LITERATURE ................................................................................................ 1

TOOTH ERUPTION, AND ITS DISORDERS ................................................................................................. 1

DENTAL ANKYLOSIS: A DIAGNOSTIC CHALLENGE .................................................................................... 3

INCIDENCE AND CLINICAL PRESENTATION .............................................................................................. 4

ETIOLOGY OF DENTAL ANKYLOSIS: WHAT IS CURRENTLY KNOWN .............................................................. 6

Animal Studies on the Etiology of Dental Ankylosis. ............................................................ 8

THE POSSIBLE ROLE OF RANKL AND BONE MORPHOGENETIC PROTEINS (BMPS) IN DENTAL ANKYLOSIS ........ 10

PRIMARY FAILURE OF ERUPTION AND ITS POSSIBLE RELATION TO DENTAL ANKYLOSIS .................................. 12

CONCLUSION ................................................................................................................................ 14

REFERENCES ............................................................................................................................. 16

DENTAL ANKYLOSIS: CLINICAL AND MOLECULAR CHARACTERIZATION .................................. 19

v
 BACKGROUND AND INTRODUCTION ................................................................................................... 19

MATERIALS AND METHODS ............................................................................................................. 21

Patient Recruitment ............................................................................................................ 21

Sample Procurement ........................................................................................................... 24

Primary Cell Cultures ........................................................................................................... 25

RNA Extraction ..................................................................................................................... 30

RT-PCR .................................................................................................................................. 31

Real Time PCR ...................................................................................................................... 32

Mutational Analysis ............................................................................................................. 32

RESULTS ...................................................................................................................................... 33

DISCUSSION. ................................................................................................................................. 52

REFERENCES. ............................................................................................................................ 57

vi
 LIST OF TABLES

TABLE 1: PRIMER SEQUENCES USED IN QPCR .......................................................................................... 32

TABLE 2: PTH1R PRIMER SEQUENCES USED DURING MUTATIONAL ANALYSIS .................................................. 33

TABLE 3: QPCR RESULTS BY CT VALUE ................................................................................................... 51

TABLE 4: ΔCT VALUES OF POSITIVE QPCR RESULTS (ΔCT = CTTEST – CTGAPDH) ................................................ 52

vii
 LIST OF FIGURES

Figure 1 a: Patient A Intraocclusal Photographs ........................................................................... 22

Figure 1 b: Patient A Panoramic Radiograph ................................................................................ 22

Figure 2 a: Patient B Intraocclusal Photographs………………………………………………………….……………23

Figure 2 b: Patient B’s sibling, Intraocclusal Photographs ............................................................ 23

Figure 2 c: Patient B’s mother, Intraocclusal Photographs .......................................................... 24

Figure 2 d: Patient B panoramic radiograph ................................................................................. 24

Figure 3 a: Patient A, tooth #29 cell culture…………………………………………………………………….……….26

Figure 3 b: Patient A, tooth #19 cell culture ................................................................................. 27

Figure 3 c: Patient B, tooth #1 cell culture ................................................................................... 28

Figure 3 d: Patient B, tooth #16 cell culture ................................................................................. 29

Figure 3 e: Patient B, tooth #17 cell culture ................................................................................. 30

Figure 4 a: Patient A, PTH1R Exon 8F chromatogram…………………………………………………………..….34

Figure 4 b: Patient B, PTH1R Exon 3 chromatogram .................................................................... 34

Figure 4 c: Patient A, #29 (control), GAPDH qPCR analysis.Ct=15.68 ........................................... 35

Figure 4 d: Patient A, #19 (ankylosed), GAPDH qPCR analysis.Ct=15.8 ........................................ 36

Figure 4 e: Patient B, #1 (control), GAPDH qPCR analysis.Ct=15.54 ............................................. 36

Figure 4 f: Patient B, #16 (PFE), GAPDH qPCR analysis. Ct=13.74 ................................................ 37

Figure 4 g: Patient B, #17 (PFE), GAPDH qPCR analysis. Ct=15.39 ................................................ 37

Figure 5 a: Patient A, #29 (control), BMP-2 qPCR analysis………………………………………………………..38

viii
Figure 5 b: Patient A, #19 (ankylosed), BMP-2 qPCR analysis. ..................................................... 38

Figure 5 c: Patient B, #1 (control), BMP-2 qPCR analysis. ............................................................ 39

Figure 5 d: Patient B, #16 (PFE), BMP-2 qPCR analysis. ................................................................ 39

Figure 5 e: Patient B, #17 (PFE), BMP-2 qPCR analysis. ................................................................ 40

Figure 6 a: Patient A, #29 (control), BMP-4 qPCR analysis. Ct=15.66…………..……………………………40

Figure 6 b: Patient A, #19 (ankylosed), BMP-4 qPCR analysis. Ct=18.78 ...................................... 41

Figure 6 c: Patient B, #1 (control), BMP-4 qPCR analysis. Ct=15.14 ............................................. 41

Figure 6 d: Patient B, #16 (PFE), BMP-4 qPCR analysis. ................................................................ 42

Figure 6 e: Patient B, #17 (PFE), BMP-4 qPCR analysis. ................................................................ 42

Figure 7 a: Patient A, #29 (control), BMP-6 qPCR analysis……………………………………………..…………43

Figure 7 b: Patient A, #19 (ankylosed), BMP-6 qPCR analysis. ..................................................... 43

Figure 7 c: Patient B, #1 (control), BMP-6 qPCR analysis. ............................................................ 44

Figure 7 d: Patient B, #16 (PFE), BMP-6 qPCR analysis. Ct=14.17 ................................................ 44

Figure 7 e: Patient B, #17 (PFE), BMP-6 qPCR analysis. ................................................................ 45

Figure 8 a: Patient A, #29 (control), RANKL qPCR analysis………………………………………………….…….45

Figure 8 b: Patient A, #19 (ankylosed), RANKL qPCR analysis. ..................................................... 46

Figure 8 c: Patient B, #1 (control), RANKL qPCR analysis. ............................................................. 46

Figure 8 d: Patient B, #16 (PFE), RANKL qPCR analysis. ................................................................ 47

Figure 8 e: Patient B, #17 (PFE), RANKL qPCR analysis. ................................................................ 47

Figure 9 a: Patient A, #29 (control), PTH1R qPCR analysis…………………………………….………………….48

ix
Figure 9 b: Patient A, #19 (ankylosed), PTH1R qPCR analysis. Ct= 14.54 ..................................... 48

Figure 9 c: Patient B, #1 (control), PTH1R qPCR analysis. ............................................................. 49

Figure 9 d: Patient B, #16 (PFE), PTH1R qPCR analysis. ................................................................ 49

Figure 9 e: Patient B, #17 (PFE), PTH1R qPCR analysis. ................................................................ 50

x
 LIST OF ABBREVIATIONS

ALP-------Alkaline Phosphatase

BMPs-------Bone Morphogenetic Proteins

C--------------------Celsius

cDNA------Complementary Deoxyribonucleic acid.

DNA------- Deoxyribonucleic acid

dNTP---------deoxynucleoside triphosphate

DTE-------Delayed Tooth Eruption

FBS----------Fetal Bovine Serum

GAPDH----Glycderaldehyde-3-phosphate dehydrogenase

H2O--------Water

IAN----------Inferior Alveolar Nerve

ME----------Malassez Epithelium

MEM-------Minimum Essential Media

ml-----------Milliliters

PCR--------Polymerase Chain Reaction

PDL---------Periodontal Ligament

PFE---------Primary Failure of Eruption

PTGF ----------------Platelet Derived Growth Factor

qPCR------Real Time Polymerase Chain Reaction

xi
RANK------ Receptor activator of nuclear factor kappa-B

RANKL------- Receptor activator of nuclear factor kappa-B Ligand

RFA-------Resonance Frequency Analysis

RNA--------Ribonucleic Acid

RT-PCR----Reverse transcriptase polymerase chain reaction

Sec-----------------seconds

TGF- β-------Transforming Growth Factor Beta

μL------Microliters

xii
 LIST OF SYMBOLS

° Degrees

© Copyright Symbol

® Registered Trademark

™ Trademark Symbol

xiii
 A REVIEW OF THE LITERATURE

Tooth Eruption, and its disorders

Tooth eruption is the developmental process behind the movement of a dental unit

from the crypt where it forms, across the bone of the jaws, and into the oral cavity, towards its

place across a functional occluding counterpart 31. Some clinicians use the term eruption to

refer to the appearance of a tooth in the oral cavity, but a more accurate term for this

milestone is emergence or moment of eruption. Authors in the literature advocate against using

the terms “eruption” and “emergence” interchangeably in order to preserve their more specific

and separate meanings31. Tooth eruption in the true sense of the word is without a doubt a

complex process, involving many tissues and cell types that are coordinated with precision and

specificity in time and space31. The downside of this very complexity, however, is that it

presents many elements and mechanisms that have the potential to go awry. A functional

occlusion may not be maintained without proper eruption of the teeth, which is why this

process is an area of study of upmost importance, not only to orthodontics, but to all of

dentistry. Based on population studies, there are expected timelines for teeth to both erupt

and emerge during human growth and development, either from a perspective of chronological

age, or from the viewpoint of cell and tissue development. Many different conditions and

phenomena have the potential to cause a deviation from the expected timelines in tooth

eruption, but in spite of their extensive study, the nature of the forces behind dental eruption is

1
still a controversial topic31. The variety of conditions that may result in delayed tooth eruption

is indeed vast, and it ranges from systemic conditions and affecting all of the dentition and even

other organ systems as well, to localized elements that only affect one dental unit at a time31.

Conditions that affect the eruption of all teeth can also affect their development, size, shape

structure and color when they are syndromic; such is the case with Dentinogenesis Imperfecta,

Amelogenesis Imperfecta, and Dentinal Dysplasia31. Malnutrition, Downs Syndrome and

Hypopituitarism can also result in teeth having shorter roots than expected when they erupt

compared to the general population31. Localized elements that can result in physical

obstruction of dental eruption include supernumerary teeth, tumors or either odontogenic or

non-odontogenic origin, cysts, scar tissue secondary trauma or surgical procedures, and gingival

fibromatosis31. The current understanding of tooth eruption is surprisingly poor, as is our

knowledge of many of the conditions in which this process is impaired31. Dental ankylosis is a

very illustrative example of the gaps in our current knowledge with regard to tooth eruption

and its related pathology.

Dental ankylosis is a phenomenon that was described in the literature as early as 1932

when Noyes referred to primary teeth that appeared to be “sinking into the tissues” 23.

Normal and healthy teeth are in a state of continual eruption and any stoppage of this

movement can be considered abnormal7. In ankylosis, the cementum of the affected tooth

becomes fused with alveolar bone7. A tooth may become ankylosed along any part of its

root8. As teeth adjacent to one that is ankylosed retain their eruption potential and keep

erupting over time, the ankylosed tooth becomes progressively apical to the plane of

occlusion, giving the appearance of “sinking into bone” 30. Not only can ankylosis lead to a

2
tooth that is infra-occluded, but it can also be detrimental to the development of the

alveolar process30. Although this condition was observed in many patients in the early

twentieth century, limitations in the diagnostic aides and laboratory techniques of those days

narrowed the scope and depth of studies that could be carried out in an attempt to elucidate

its causes and pathological process. Early research on dental ankylosis provided better

information on its incidence and clinical presentation, while theories on its etiology were

more speculative in nature.

Dental Ankylosis: A Diagnostic Challenge

One of the complications in gathering data during clinical studies of dental ankylosis is

that the condition can be challenging to detect and diagnose correctly compared to other

causes of delayed tooth eruption31. The methods most relied upon by dental professionals to

diagnose this condition in a clinical setting are percussion and mobility tests as well as

radiographic examination5. Ankylosed teeth are thought to lack any mobility due to the fusion

of their root surface with the surrounding bone, and to produce a clear and high-pitched

noise, which in healthy teeth would be dampened by the PDL6. The percussion, mobility, and

radiographic methods however provide no histological assessment of the relationship

between the root surface of a tooth and its surrounding bone. Andersson et al. contrasted

these three widely used clinical methods with a subsequent histological analysis in a monkey

animal model by examining incisors that were extracted and replanted experimentally4. They

found that in order for a tooth to consistently present abnormal mobility and sound on

tapping, ankylosis must affect more than twenty percent of its root surface4. These abnormal

results are only present approximately half of the time in teeth that have an affected root

3
surface that is between ten and twenty percent of the total, and teeth with an affected

surface of less than ten percent of the total show no clinical difference with unaffected

teeth4. Diagnosis of dental ankylosis based on radiological evaluations can be even more

problematic. When ankylosis is present at the buccal or lingual surfaces of the dental root, it

is not radiologically evident; it can only be detected by that method if it is present on the

proximal surfaces of the tooth, giving rise to many false negatives4. Furthermore, it has been

observed that a thin layer of bone on the root surface can be linked to the surrounding

alveolar bone by thin trabeculae and give the appearance of a periodontal ligament in a

radiograph, which contributes to false negatives even when the condition affects proximal

root surfaces4.

In 2012, Resonance Frequency Analysis was proposed as a new diagnostic tool for

dental ankylosis6. This technique is most often used as a measure of stability in dental

implants by measuring the implant to bone interface based on resonance frequencies during

oscillations exerted into the implant and bone contact point6,21,32. Although initial studies

suggest that RFA might provide greater sensitivity than more traditional methods in the

diagnosis of dental ankylosis, more testing will have to take place before it is implemented

widely. The practicality and economic feasibility of using this technique and the equipment it

requires in a private orthodontic office is not yet clear throughout the literature. For a

conclusive diagnosis of dental ankylosis, histological examination of a specimen removed

from the oral cavity remains the diagnostic gold standard.

Incidence and Clinical Presentation

Despite the diagnostic challenge that dental ankylosis represents, in the mid 1950’s,

4
 reports in the literature described the growing knowledge regarding the epidemiological

factors of this condition in its different clinical presentations. The primary second molar

was identified early on as the dental unit that was affected most often even though the

condition could be observed in both permanent and deciduous dentition8. Work by

Biederman in 1956 illustrated that dental ankylosis was a selective condition with regard to

its onset during dental development and the location of the dental units it affected8. By

comparing 119 patients who presented with two ankylosed deciduous second molars each,

he statistically determined that the clinical presentation of dental ankylosis followed a

discreet pattern that was not random8. Among his findings, he showed that the condition

occurred in the teeth of the mandible more than twice as frequently as the teeth of the

maxillary arch and that more than ninety percent of the affected teeth were either first or

second primary molars8. Biederman’s work also laid an early foundation towards

elucidating the pathophysiology of dental ankylosis through his observation that the

condition being present in one dental unit did not correlate with its occluding counterpart

being affected as well, thus undermining the early theory that dental ankylosis was caused

by traumatic or heavy occlusal forces8. As an alternative theory, Biederman postulated that

dental ankylosis was probably caused by “some metabolic disturbance of a local character”
8
. In a later study, nearly ten years afterward, Biederman went to greater length to

contrast dental ankylosis with the natural dental eruption process and characterize it as

pathology. He contrasted ankylosed teeth with impacted teeth by pointing out how the

later retain their eruption potential and can continue to progress into the oral cavity and

occlusal plane once mechanical obstructions are removed from their eruption path, while

5
 ankylosed teeth do not have an eruption potential any longer and will not emerge into the

oral cavity or occlusal plane once mechanical obstacles are cleared from their path7. The

body of literature available by that time confirmed the earlier observations that dental

ankylosis was specific with respect to its location in the oral cavity, with nearly all affected

teeth being primary or permanent molars and mandibular teeth being represented more

than twice as often as maxillary teeth7. Additionally, this phenomenon also appeared to be

specific with respect to time of onset since deciduous teeth were represented over

permanent teeth by a ratio greater than ten to one7.

Two different presentations have been observed in the roots of teeth with dental

ankylosis4. In some cases, resorption of cementum and dentin has been observed, while in

others there is direct deposition of bone on top of cementum in the root of the ankylosed

tooth4. By the nineteen-eighties, Andersson et al. had enough sources and evidence to

report that ankylosis was also observed as a common complication of avulsed permanent

teeth that were replanted4, while Kurol reported that a familial tendency in the pattern of

ankylosis of primary molars could be demonstrated19.

Although the epidemiology and clinical presentation of dental ankylosis has been well

documented in the literature, the exact pathologic mechanism that gives rise to this condition

remains unclear. Advances in elucidating its pathological process are discussed next.

Etiology of Dental Ankylosis: What is Currently Known

Although theories have been offered to explain the biologic process that leads to

dental ankylosis, its mechanism has never been demonstrated. 4,7. Dental ankylosis, being

the fusion of a tooth’s cementum with bone, may not occur as long as the periodontal

6
 ligament of said tooth is intact2. Biederman was among the first to speculate that ankylosis

could be caused either by an incompletely developed periodontal ligament or by its partial

local ossification8. He further hypothesized that a disturbed local metabolism would cause

an alteration of the periodontal membrane and lead to the fusion of the surrounding bone

with the tooth’s cementum by way of lysis of the membrane8. Biederman’s work also

showed that dental ankylosis was not likely to have a systemic cause, since the dental units

were not all affected equally nor did the condition present itself at the same rate

throughout dental development8. During the middle of the twentieth century, it was

hypothesized that traumatic occlusal forces might be a causative factor for ankylosis;

Biederman, however, observed that in patients who displayed multiple ankylosed teeth,

these were most of the time not in occlusion with each other8. Furthermore, although

molars are subjected to greater occlusal forces, and they also suffer from ankylosis at a

greater rate than other types of dental units, the occlusal forces in an adult’s permanent

dentition are much greater than the ones deciduous teeth experience in a primary or

mixed dentition patient. The fact that dental ankylosis occurs in primary molars at ten

times the rate of permanent molars suggests that traumatic occlusal forces are not a

significant etiologic factor7.

An alternative hypothesis that has been offered is that a congenital or genetic gap in

the periodontal membrane of some patients not only may lead to dental ankylosis7, but

would also account for the familial tendency in its development reported by Kurol19. Sharawy

et al. (1968) also implicated genetic factors in addition to environmental insults when

7
describing and analyzing dental ankylosis that was produced experimentally using a rat

animal model28.

Biederman’s theory of “arrhythmic metabolism” postulated that as a tooth erupts,

there are alternate phases of local resorption and deposition of bone on one side of the

periodontal ligament and of cementum on the other side, which allows for adjustment of

Sharpey fibers along the root surface while the periodontal ligament remains intact7. Under

normal circumstances, the periodontal ligament disappears after the roots of a deciduous

tooth are resorbed, but if the PDL disappears or is not continuous any longer before root

resorption, then cementum and bone can come into contact, leading to dental ankylosis7.

Animal Studies on the Etiology of Dental Ankylosis.

Andersson et al. made further inroads into elucidating the pathophysiology of dental

ankylosis in the 1980’s when they created the condition experimentally through dental

extractions and re-plantations in a monkey animal model4. After carrying out histological

examinations, they further subdivided dental ankylosis into two distinct categories: the

majority in which ankylosis had been preceded by resorption of both cementum and dentine,

and no cementum was found at the ankylosed site; and a smaller subset in which apposition

of bone on the cemental surface had occurred without previous resorption of the

cementum4. The latter type was found to be more common along the apical part of the root

surface4. Rubin et al. also employed a monkey animal model in order to experimentally cause

dental ankylosis in deciduous teeth26. In their study, five different methods were used in an

attempt to create dental ankylosis in four separate animal subjects: one subject had its

periodontal ligament surgically exposed and injured with a periodontal curette (mechanical

8
periodontal trauma); a second subject had one tooth subjected to chemical trauma (using

phenol) at the PDL following surgical exposure, while a second tooth was denuded of its PDL

at the distal root using a dental bur; a third subject received a stainless steel crown that

would contact the opposing tooth prematurely; and the final subject had a tooth luxated with

forceps26. Follow up histological analysis revealed that the three animals that underwent

periodontal trauma, root trauma, and hyperocclusion showed no evidence of dental

ankylosis; wound repair resulted in new bone that was still separated from the root

cementum by a thin periodontal ligament26. The subject that had its tooth luxated was the

only one to display histologic evidence of true ankylosis, making the case against occlusion or

damage to parts of the PDL as possible etiologic factors 26.

More recently, Fujiyama et al. (2004) were able to experimentally produce dental

ankylosis in the rat by transecting the Inferior Alveolar Nerve (IAN); this procedure resulted in

dento-alveolar ankylosis and a decrease in width of periodontal spaces14. Malassez

Epithelium (ME) is imbedded in the periodontal ligament predominantly along the coronal

root surface; after denervation, it has been observed that its distribution decreases within

one week postsurgcially14. This reduction in Malassez Epithelium precedes dental ankylosis

along the coronal root surface by a margin of approximately six weeks14. No degenerative

changes were reported along the apical periodontal ligament region, which is densely

innervated by the IAN, suggesting that it is not the denervation that directly results in

ankylosis, but the decrease in Malassez Epithelium, which must have a role in maintaining the

periodontal space, preventing alveolar bone fragments from migrating into the cementum

surface14. Fujiyama et al. (2004) put forward the explanation that the ME and cementoblasts

9
secrete molecules to inhibit osteogenesis in the periodontal space; suggesting that the ME

plays an inhibitory role in the appearance of osteoclasts and odontoclasts in this anatomical

region14. The ME has also been implicated in the formation of acellular cementum through

epithelium to mesenchyme interactions, and it is hypothesized that its absence results in

lesser cementum formation, which leads to root resorption14. In cases in which the ME

recovered by regeneration after the surgical denervation, the reduced periodontal spaces

increased in width once again14. The ME, however, is located predominantly on the coronal

end of the PDL, which means that other mechanisms that are less well understood must play

a role in maintaining the width of the periodontal space towards the apical end of the root

surface14. These reports in the literature make the case for a multitude of possible etiological

processes resulting in dental ankylosis and/or replacement resorption, with a compromise of

the inhibitory effect of the Malassez Epithelium playing a role in the coronal end of the root

surface, while other unidentified mechanisms predominate in the apical end14.

The Possible Role of RANKL and Bone Morphogenetic Proteins (BMPs) in Dental Ankylosis

Earlier in this review, it was described how some works in the literature argue for the

secretion by cementum and the Malassez Epithelium of inhibiting factors that prevent dental

ankylosis and/or replacement resorption along the dental root surface. The tissues of the PDL

also contain progenitor cells that are capable of forming bone, cementum and PDL connective

tissue matrix, as well as endogenous growth factors that facilitate tissue homeostasis22. Some

of those endogenous growth factors are Bone Morphogenetic Proteins (BMPs); molecules

that facilitate periodontal bone regeneration but have also been implicated in causing

ankylosis and root resorption22. BMPs are a group of approximately twenty distinct proteins

10
belonging to the superfamily of transforming growth factor-β (TGF- β). They play critical parts

in cardiac, neural, and cartilage development and one of their main functions is to induce

pluripotent cells to commit to the osteoblastic lineage and form new bone22. Because of their

ability to stimulate intramembranous bone formation, BMPs are of interest in periodontal bone

regeneration16; research has shown, however, that their use could result in tooth ankylosis and

root resorption15. There is evidence in the literature that BMPs induce apoptosis in

progenitor cells22. With regard to the progenitor cells of the PDL specifically, Muthukuru et al.

have demonstrated that their cytotoxicity when exposed to BMP-2 is ten times greater

compared to osteoblasts22. It has been postulated that disruption of PDL homeostasis by

BMP-induced apoptosis could play a role in dental ankylosis22. Together with BMP-2, other

members of this cytokine family such as BMP-4 and BMP-6 have been reported to have high

osteoinductive potential, influencing regeneration and healing of bone27,29, bone

formation18,33, and odontogenesis1,9. The precise roles that these cytokines may or may not

play during Dental Ankylosis are an active area of research where much remains to be

learned.

The Receptor Activator of Nuclear factor-Kappa B, also known as RANK, is a membrane

bound receptor that has been identified in many tissues of the human body, such as muscle,

liver, brain, kidney, lung, and trabecular bone3. RANK is activated by binding to RANK-ligand,

also known as RANKL and osteoclast differentiation factor, resulting in osteoclastic

differentiation and activation20. Some authors have proposed that altered expression of

RANKL may be related to, or even play a key role in root resorption during orthodontic tooth

11
movement10. Additionally, mice with a compromised RANKL gene have been shown to have

severe osteopetrosis and defects in tooth eruption by Kong et al.17

Although the precise etiology of dental ankylosis within the larger spectrum of

eruption disorders remains unclear, the involvement of BMPs and RANKL in the homeostasis

and remodeling of bone as well as their possible link to dental root resorption make them

ideal subjects to study in order to confirm or rule out their relevance in the etiology of dental

ankylosis.

Primary Failure of Eruption and its Possible Relation to Dental Ankylosis

Primary Failure of Eruption (PFE) was first described in the literature by Proffit and

Vig24 and its subcategories have since been characterized in the literature25. These

subcategories, or types, are defined in terms of timing of onset and presentation. Type I

PFE is characterized by a progressive posterior open bite. In Type 1 PFE all teeth distal to

the most mesial infra- occluded tooth are affected and do not erupt into occlusion. Type II

PFE, on the other hand, displays greater eruption as compared to Type 1, yet it is still

inadequate for the more distal teeth, such as second molars25.

Clinical signs common to PFE and ankylosis include supracrestal position of the

affected teeth and involvement of the first permanent molar25. Although teeth with PFE

present with anomalies in their eruption mechanism, they do not display fusion of

cementum to bone as is the case in ankylosis25. It has been observed that in ankylosis,

the affected tooth is confined to only 1 dental arch, while in PFE 74% of the patients are

affected in both arches25. Rhoads et al. (2013) have also shown that without knowledge of

prior trauma, treatment history of the tooth, damage to the PDL, or genetic mutations,

12
 PFE and Ankylosis might be indistinguishable clinically25.

Rhoads et al. described PFE as mainly affecting posterior teeth25. Moreover, the

defect in eruption caused by PFE manifests as a lateral open bite and the teeth affected

by it do not respond to orthodontic treatment25. Recent studies have shown that some

cases of eruption failure as caused by a genetic mutation. Specifically, genetic mutations

in one gene, PTH1R, have been associated with PFE and 10%-40% of cases have a familial

component25. Those genetic mutations identified include but are not limited to, missense,

substitution and intron-skipping mutations11-13. Rhoads et al.identified a mutation that

revealed PFE in the deciduous dentition25. Although a mutation in PTH1R confirms a

diagnosis of PFE, a lack of it is not definitive in ruling out this diagnosis, as PFE is believed

to be caused by more than one gene since PFE cases were identified without a causative

mutation in PTH1R25. Recent genotype:phenotype studies revealed that the hallmark

features of PFE that provide a definitive diagnosis include: 1) involvement of the first

permanent molar, supracrestal presentation of the affected teeth, and a posterior lateral

open bite25. Provided that other alternative causes for it are ruled out, such as mechanical

failure of eruption or skeletal discrepancies, these diagnostic criteria serve as a definitive

clinical rubric25. Other clinical hallmarks associated with a mutation in PTH1R, are

involvement of the second premolar and the second molar, multiple adjacent teeth

affected, supracrestal presentation of the infraoccluded teeth, bilateral presentation,

involvement of teeth in both the maxilla and the mandible, frequent Class III

malocclusion, and a high prevalence of concurrent dental anomalies25. Definitive diagnosis

of PFE is currently made through the identification of a mutation in the PTH1Rgene, which

13
 has been shown to be largely consistent with the diagnosis of PFE based on clinical

parameters.

Gaining a deeper understanding of the relationship between ankylosis and Primary

Failure of Eruption has the potential to impact the treatment decision process in

orthodontics. Ankylosis can be successfully treated by extraction of the ankylosed tooth

and subsequent orthodontic movement of all other teeth. This is in contrast to patients

suffering from PFE, which have more limited treatment options at their disposal, including

small segmental osteotomies and prosthetic restorations of the occlusion25. For a patient

suffering from PFE, orthodontic treatment with a continuous archwire results in

exacerbation of the lateral open bite by intrusion of the adjacent teeth and, frequently,

ankylosis of the affected teeth regardless of whether or not the most affected of them are

extracted25. Unlike cases of ankylosis, no treatment or limited esthetic treatment is often

the best option for patients suffering from PFE. Cases of PFE that are misdiagnosed and

treated with a continuous archwire can actually lead to an inferior occlusal end result,

leaving the patient in worse condition compared to the start of treatment. Investigating

the clinical and molecular differences or similarities between Dental Ankylosis and PFE will

form the basis of future genetic tests that will improve the diagnosis and clinical

management of the two conditions.

Conclusion

Dental ankylosis has been reported in the scientific literature at least since the early

twentieth century. The clinical presentation and epidemiology of this phenomenon were

documented and characterized early on in spite of the difficulties in diagnosing this

14
pathology and contrasting it to other cases of delayed tooth eruption. Such diagnostic

difficulties persist to this day in spite of advances in genetics, radiology, and other imaging

techniques, forcing dental professionals to rely on methods that present limited sensitivity

and a high degree of subjectivity. New approaches to diagnose the condition are being

explored, but they are still in their infancy conceptually and technically.

Advances in biochemistry and molecular biology have led to the elucidation of many

physiological pathways with regard to metabolism, remodeling and repair in the tissues of

the alveolar bone, PDL and dental root surface. Progress in these areas provides us with

multiple areas to study as we examine the possible factors that play a role in the

pathological process leading to dental ankylosis, a condition whose etiology is not

completely understood to this day.

By comparing dental ankylosis with other eruption disorders such as Primary Failure

of Eruption at a molecular and genetic level, it will be possible to establish whether these

conditions are completely distinct and unrelated or part of a wider spectrum of aberrant

physiology. A greater understanding of their differences and similitudes as well as the exact

processes that give rise to them will lead to improved diagnosis in terms of sensitivity and

accuracy, resulting in better-informed clinical decisions and improved outcomes for all

dental patients.

15
 REFERENCES

1. Expression of bone morphogenetic proteins and msx genes during root formation - ProQuest.
http://search.proquest.com/docview/209480047?pq-origsite=summon. Accessed
3/27/2016, 2016.

2. Oral pathology, 7th edition | joseph regezi, james sciubba, richard jordan | ISBN
9780323297684. http://store.elsevier.com/Oral-Pathology/Joseph-Regezi/isbn-
9780323297684/. Accessed 3/26/2016, 2016.

3. Anderson D, Maraskovsky E, Billingsley W, Dougall W, Tometsko M, Roux E. A homologue of

the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function : Article :
Nature. http://www.nature.com/nature/journal/v390/n6656/full/390175a0.html.
Accessed 3/27/2016, 2016.

4. Andersson L, Blomlöf L, Lindskog S, Feiglin B, Hammarström L. Tooth ankylosis: Clinical,

radiographic and histological assessments. Int J Oral Surg. 1984;13(5):423-431. doi:
http://dx.doi.org.libproxy.lib.unc.edu/10.1016/S0300-9785(84)80069-1.

5. Andreasen JO. Periodontal healing after replantation of traumatically avulsed human teeth:
Assessment by mobility testing and radiography. Acta Odontol Scand. 1975;33(6):325
<last_page> 335. doi: 10.3109/00016357509004637.

6. Bertl MH, Weinberger T, Schwarz K, Gruber R, Crismani AG. Resonance frequency analysis: A
new diagnostic tool for dental ankylosis. Eur J Oral Sci. 2012;120(3):255-258. doi:
10.1111/j.1600-0722.2012.00959.x.

7. Biederman W. Etiology and treatment of tooth ankylosis. Am J Orthod. 1962;48(9):670-684.

doi: http://dx.doi.org.libproxy.lib.unc.edu/10.1016/0002-9416(62)90034-9.

8. Biederman W. The incidence and etiology of tooth ankylosis. Am J Orthod. 1956;42(12):921-

926. doi: http://dx.doi.org/10.1016/0002-9416(56)90193-2.

9. Botchkarev VA. Bone morphogenetic proteins and their antagonists in skin and hair follicle
biology. J Invest Dermatol. 2003;120(1):36 <last_page> 47. doi: 10.1046/j.1523-
1747.2003.12002.x.

10. Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature.
2003;423(6937):337-342. doi: 10.1038/nature01658 [doi].

11. Decker E, Stellzig-Eisenhauer A, Fiebig BS, et al. PTHR1 loss-of-function mutations in familial,
nonsyndromic primary failure of tooth eruption. Am J Hum Genet. 2008;83(6):781-786. doi:
10.1016/j.ajhg.2008.11.006 [doi].

16
12. Frazier-Bowers SA, Hendricks HM, Wright JT, et al. Novel mutations in PTH1R associated
with primary failure of eruption and osteoarthritis. J Dent Res. 2014;93(2):134-139. doi:
10.1177/0022034513513588 [doi].

13. Frazier-Bowers SA, Puranik CP, Mahaney MC. The etiology of eruption Disorders—Further
evidence of a “Genetic paradigm”. Semin Orthod. 2010;16(3):180-185. doi:
http://dx.doi.org.libproxy.lib.unc.edu/10.1053/j.sodo.2010.05.003.

14. Fujiyama K, Yamashiro T, Fukunaga T, Balam TA, et al. Denervation resulting in dento-
alveolar ankylosis associated with decreased malassez epithelium. J Dent Res.
2004;83(8):625-9. http://search.proquest.com/docview/209479134?accountid=14244.

15. King G, Hughes F. Effects of occlusal loading on ankylosis, bone, and cementum formation
during bone morphogenetic protein-2-stimulated periodontal regeneration in vivo. Journal
of Periodontology. ;70(10):1125-1135.

16. Kobayashi M, Takiguchi T, Suzuki R, Yamaguchi A. Recombinant human bone morphogenetic

protein-2 stimulates osteoblastic differentation in cells isolated from human periodontal
ligament. J Dent Res. 1999;78(10):1624--33.

17. Kong YY, Feige U, Sarosi I, et al.. Activated T cells regulate bone loss and joint destruction in
adjuvant arthritis through osteoprotegerin ligand. Nature. 1999;402(6759):304-309. doi:
10.1038/46303 [doi].

18. Kugimiya F, Kawaguchi H, Kamekura S, et al. Involvement of endogenous bone

morphogenetic protein (BMP) 2 and BMP6 in bone formation. J Biol Chem.
2005;280(42):35704 <last_page> 35712. doi: 10.1074/jbc.M505166200.

19. Kurol J. Infraocclusion of primary molars: An epidemiologic and familial study. Community
Dent Oral Epidemiol. 1981;9(2):94-102.

20. Lacey DL, Timms E, Tan H-, et al. Osteoprotegerin ligand is a cytokine that regulates
osteoclast differentiation and activation. Cell. 1998;93(2):165 <last_page> 176. doi:
10.1016/S0092-8674(00)81569-X.

21. Meredith N, Alleyne D, Cawley P. Quantitative determination of the stability of the implant-
tissue interface using resonance frequency analysis. Clin Oral Implants Res. 1996;7(3):261
<last_page> 267. doi: 10.1034/j.1600-0501.1996.070308.x.

22. Muthukuru M. Bone morphogenic protein-2 induces apoptosis and cytotoxicity in

periodontal ligament cells. J Periodontol. 2013;84(6):829-838. doi:
10.1902/jop.2012.120339 [doi].

23. Noyes FB. Submerging deciduous molars. Angle Orthod. 1932;2(2):77-87.

17
24. Proffit WR, Vig KWL. Primary failure of eruption: A possible cause of posterior open-bite.
Am J Orthod. 1981;80(2):173 <last_page> 190. doi: 10.1016/0002-9416(81)90217-7.

25. Rhoads SG, Hendricks HM, Frazier-Bowers SA. Establishing the diagnostic criteria for
eruption disorders based on genetic and clinical data. Am J Orthod Dentofacial Orthop.
2013;144(2):194-202. doi: 10.1016/j.ajodo.2013.03.015 [doi].

26. RUBIN PL, WEISMAN EJ, BISK F. Experimental tooth ankylosis in the monkey. Angle Orthod.
1984;54(1):67-72. http://www.angle.org/doi/abs/10.1043/0003-
3219%281984%29054%3C0067%3AETAITM%3E2.0.CO%3B2. doi: 10.1043/0003-
3219(1984)054<0067:ETAITM>2.0.CO;2.

27. Sakou T. Bone morphogenetic proteins: From basic studies to clinical approaches. Bone.
1998;22(6):591 <last_page> 603. doi: 10.1016/S8756-3282(98)00053-2.

28. Sharawy AM, Mills PB, Gibbons RJ. Multiple ankylosis occurring in rat teeth. Oral Surgery,
Oral Medicine, Oral Pathology. 1968;26(6):856 <last_page> 860. doi: 10.1016/0030-
4220(68)90360-5.

29. Shen HC, Peng H, Usas A, Gearhart B, Fu FH, Huard J. Structural and functional healing of
critical-size segmental bone defects by transduced muscle-derived cells expressing BMP4. J
Gene Med. 2004;6(9):984-991. doi: 10.1002/jgm.588 [doi].

30. Silver EI. Ankylosed teeth. Am J Orthod. 1951;37(1):28-34. doi:

http://dx.doi.org.libproxy.lib.unc.edu/10.1016/0002-9416(51)90145-5.

31. Suri L, Gagari E, Vastardis H. Delayed tooth eruption: Pathogenesis, diagnosis, and
treatment. A literature review. American Journal of Orthodontics and Dentofacial
Orthopedics. 2004;126(4):432 <last_page> 445. doi: 10.1016/j.ajodo.2003.10.031.

32. Turkyilmaz I, Sennerby L, Tumer C, Yenigul M, Avci M. Stability and marginal bone level
measurements of unsplinted implants used for mandibular overdentures: A 1-year
randomized prospective clinical study comparing early and conventional loading protocols.
Clin Oral Implants Res. 2006;17(5):501 <last_page> 505. doi: 10.1111/j.1600-
0501.2006.01261.x.

33. Wan M, Cao X. BMP signaling in skeletal development. Biochem Biophys Res Commun.
2005;328(3):651 <last_page> 657. doi: 10.1016/j.bbrc.2004.11.067.

18
 DENTAL ANKYLOSIS: CLINICAL AND MOLECULAR CHARACTERIZATION

Background and Introduction

Tooth eruption is the developmental process behind the movement of a dental unit

from the crypt where it forms, across the bone of the jaws, and into the oral cavity, towards

its place across a functional occluding counterpart 15. It is without a doubt a complex process,

involving many tissues and cell types that are coordinated with precision and specificity in

time and space 15. The downside of this very complexity, however, is that it presents many

elements and mechanisms that have the potential to go awry. Based on population studies,

there are expected timelines for teeth to both erupt and emerge during human growth and

development, either from a perspective of chronological age, or from the viewpoint of cell

and tissue development. Many different conditions and phenomena have the potential to

cause a deviation from the expected timelines in tooth eruption, but in spite of their

extensive study, the nature of the forces behind dental eruption is still a controversial topic
15
. The current understanding of tooth eruption is surprisingly poor, as is our knowledge of

many of the conditions in which this process is impaired 15. Dental ankylosis is a very

illustrative example of the gaps in our current knowledge with regard to tooth eruption and

its related pathology. Biederman compared 119 patients who presented with two ankylosed

deciduous second molars each, and he statistically determined that the clinical

presentation of dental ankylosis followed a discreet pattern that was not random 4. Among

19
his findings, he showed that the condition occurred in the teeth of the mandible more than

twice as frequently as the teeth of the maxillary arch and that more than ninety percent of

the affected teeth were either first or second primary molars 4. In the 1980s, Andersson et

al. had enough sources and evidence to report that ankylosis was also observed as a

common complication of avulsed permanent teeth that were replanted 3, while Kurol

reported that a familial tendency in the pattern of ankylosis of primary molars could be

demonstrated 9.

Dental ankylosis has been reported in the scientific literature at least since the early

twentieth century. The clinical presentation and epidemiology of this phenomenon were

documented and characterized early on in spite of the difficulties in diagnosing this

pathology and contrasting it to other cases of delayed tooth eruption. Such diagnostic

difficulties persist to this day in spite of advances in genetics, radiology, and other imaging

techniques, forcing dental professionals to rely on methods that present limited sensitivity

and a high degree of subjectivity. New approaches to diagnose the condition are being

explored, but they are still in their infancy conceptually and technically.

Advances in biochemistry and molecular biology have led to the elucidation of many

physiological pathways with regard to metabolism, remodeling and repair in the tissues of

the alveolar bone, PDL and dental root surface. Progress in these areas provides us with

multiple areas to study as we examine the possible factors that play a role in the

pathological process leading to dental ankylosis, a condition whose etiology is not

completely understood to this day.

One of the complications in gathering data during clinical studies of dental ankylosis

20
is that the condition can be challenging to detect and diagnose correctly compared to other

causes of delayed tooth eruption 15. For a conclusive diagnosis of dental ankylosis,

histological examination of a specimen removed from the oral cavity remains the diagnostic

gold standard.

By comparing dental ankylosis with other eruption disorders such as Primary Failure

of Eruption at a molecular and genetic level, it will be possible to establish whether these

conditions are completely distinct and unrelated or part of a wider spectrum of aberrant

physiology. A greater understanding of their differences and similitudes as well as the exact

processes that give rise to them will lead to improved diagnosis in terms of sensitivity and

accuracy, resulting in better-informed clinical decisions and improved outcomes for all

dental patients.

Materials and Methods

Patient Recruitment

This study was approved by the the Institutional Review Board at the University of North

Carolina at Chapel Hill. Two patients were recruited to participate in this study: one from the

Graduate Orthodontic Clinic at the University of North Carolina School of Dentistry, and one

from a private Oral and Maxillofacial Surgery practice in Charlotte, North Carolina. Assent and

consent forms were obtained from the patients and their legal guardians and the medical and

dental histories of both patients were carefully recorded. Patient A was selected to participate

in the study due to a dental history presenting an infraoccluded mandibular first molar which

did not respond to orthodontic therapy. The affected tooth was the only one to display this

21
presentation, and the patient’s family history was not indicative of any recurring eruption

disorders across generations, putatively ruling out the possibility of a familial case of Primary

Failure of Eruption (PFE) and suggesting Patient A suffered from dental ankylosis.

Figure 1 a: Patient A Intraocclusal Photographs

Figure 1 b: Patient A Panoramic Radiograph

22
 Patient B on the other hand, did present with a family history of dental eruption issues.

The patient’s dental presentation showed a supracrestal but infraoccluded first molar, as well

as posterior teeth being affected distal to that tooth. Both Patient B’s dental and family history

suggested the patient suffers from a familial case of PFE. Not only did Patient B’s mother and

sibling were affected by a lateral open bite like Patient B was, but they all shared a presentation

in which the same side of the dental arches was consistently affected across generations. This

inherited specificity in the location of PFE affected teeth has not been reported in a familial

case in the literature before. The presence of a contralateral unaffected tooth allowed for

comparison to a control during the study as well. Based on this dental presentation and family

history, Patient B was recruited to serve as a putative PFE patient in this study.

Figure 2 a: Patient B Intraocclusal Photographs

Figure 2 b: Patient B’s sibling, Intraocclusal Photographs

23
 Figure 2 c: Patient B’s mother, Intraocclusal Photographs

Figure 2 d: Patient B panoramic radiograph

Sample Procurement

Both patients were scheduled to undergo dental extractions which were treatment

planned prior to their involvement in this study regardless of the subjects’ participation. Patient

A had extractions of the maxillary first premolars, mandibular right second premolar, and

mandibular left first molar (affected tooth) as part of orthodontic treatment. His mandibular

right second premolar (#29 in the Universal System of Dental Nomenclature) and his

24
mandibular left first molar (#19) were collected to serve as the control and affected tooth for

Patient A, respectively. Patient B had all third molars extracted in preparation for corticotomies

to address a lateral open bite. The maxillary left, mandibular left, and maxillary right third

molars were collected from Patient B for use in the study; teeth #16 and #17 served as affected

or experimental, while #1 served as the unaffected control (tooth #32 was too damaged during

extraction to be useful in the study). Collected specimens were placed in Minimal Essential

Medium (MEM) and immediately used to start a primary cell culture following the protocol of

Scanlon et al. 14. After plating of the primary cell culture, the extracted teeth were transferred

to RNAlater in order to preserve the RNA in the PDL tissue.

Primary Cell Cultures

Tissues from the Periodontal Ligament (PDL) of the extracted teeth specimens were

used to start primary cell culture lines following the protocol of Scanlon et al. 14. Sections of PDL

tissue were dissected from the root surfaces using a sterile scalpel blade and pinned down

against the bottom of a 100 mm petri dish using a glass microscope cover slip that was slightly

smeared with sterile petroleum jelly in one of its sides for retention purposes. 12 mL of

Minimum Essential Media containing 10% Fetal Bovine Serum, 1% antimycotic and 1%

antibacterial agents was added to each plate and the plates were incubated at 37° Celsius and

5% CO2. When the cells reached approximately 75% to 80% confluence, they were separated

from their plates and re-plated for a new passage.

25


Figure 3 a: Patient A, tooth #29 cell culture

26

Figure 3 b: Patient A, tooth #19 cell culture

27

Figure 3 c: Patient B, tooth #1 cell culture

28

Figure 3 d: Patient B, tooth #16 cell culture

29

Figure 3 e: Patient B, tooth #17 cell culture

RNA Extraction

Each cell line was harvested after 3 passages in order to extract RNA to be used

in genetic expression studies. RNA was extracted from the cell cultures using TRIzol® reagent

and following the manufacturer’s instructions (ThermoFisher Scientific, Waltham, MA): Growth

media was removed from culture dish and 8mL of TRIzol® were added to the 100mm petri

dishes. Cells in the culture were lysed by pipetting up and down several times and were then

incubated at room temperature for 5 min. A volume of 1.6mL of chloroform was then added to

each sample and the tubes were shaken vigorously for 15 sec prior to incubation at room

30
temperature for 3 min. Next, the samples were centrifuged at 12,000g for 15 min at 4°C. The

aqueous phase of the sample was removed by pipetting and placed in a new tube. 4mL of 100%

isopropanol was added to the aqueous phase of each sample, incubated for 10 min at room

temperature and centrifuged at 12,000g for 10 min at 4°C.

After the supernatant was discarded, the RNA pellet was washed with 8 mL of 75% ethanol,

vortexed, and centrifuged at 7500g for 5 min at 4°C. The wash was discarded and the pellets

were air dried for 10 minutes before being reuspended in 50 μL of RNase-free water. The RNA

samples were incubated at 60°C for 10 min and stored at -70°C afterwards.

RT-PCR

A Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) was performed on the

extracted RNA samples using Superscript® III Reverse Transcriptase (Thermofisher Scientific,

Waltham, MA). For each reaction using RNA, a negative control using an equal volume of water

instead of reverse transcriptase was run was well. For each reaction, the following reagents

and conditions were employed: 1 μL of Random Primers (ThermoFisher Scientific, Waltham,

MA), 2 μL of 10 mM dNTP (ThermoFisher Scientific) and 13 μL of H2O at 65° C for 5 min before

addition of 8 μL 5X Superscript® III buffer (ThermoFisher Scientific, Waltham, MA), 2 μL 0.1 M

DTT (ThermoFisher Scientific, Waltham, MA), 1 μL RNasin (Promega), and 1 μL H2O. Samples

were then incubated at room temperature for 5 min, followed by 60 min at 50°C. The reactions

were inactivated for 15 min at 70°C and 80 μL of H2O was added to each final cDNA sample.

31
Real Time PCR

The resulting cDNA samples were amplified by quantitative real time polymerase chain

reaction (qPCR) using primers specific for the housekeeping gene Glycderaldehyde-3-phosphate

dehydrogenase (GAPDH), as well as the candidate genes PTH1R, RANKL, BMP2, BMP4, and

BMP6. A StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA) was

employed for the qPCR under the following conditions: 10 min at 95°C activation/premelt, then

45 cycles of 10 sec at 95°C, 10 sec at 60°C and 20 sec at 72°C. The Melt Curve stage consisted of

15 sec at 95°C, then 1 min at 60°C, and 15 sec at 95°C. Primer sequences are displayed in Table

1:

Table 1: Primer sequences used in qPCR

Annealing
Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Reference
(°C)
BMP-2 atggattcgtggtggaagtg gtggagttcagatgatcagc 58 7
BMP-4 agcagccaaactatgggcta tggttgagttgaggtggtca 60 20
BMP-6 cgtgaaggcaatgctcacct cctgtggcgtggtatgctgt 64 6
RANKL ctatttcagagcgcagatggat tatgagaacttgggattttgatgc 61 16
Roche
PTH1R ggggcttcacagtcttcg tggccagggtagctctga 60 Probefinder
NM_000316.2
GAPDH acacccactcctccaccttt tgacaaagtggtcgttgagg 60

Mutational Analysis

Saliva samples were collected from both patients in order to extract DNA (Oragene, DNA

Genotek, Toronto, Canada) for downstream mutational analysis. Our working hypothesis, that

Patient A has ankylosis and Patient B has PFE, required that we identify or rule out mutations in

the PTH1R gene. DNA samples were amplified by PCR using primers specific for all coding exons

of the PTH1R gene under the following conditions: under the following conditions: 2min 95°C

32
activation/premelt, followed by 35 cycles of 30 sec at 95°C melt, 1 min at 60°C anneal, and 3

min of 72°C extension. PCR Products were then purified using ExoSaplt (USB, Cleveland OH),

and sequenced at the University of North Carolina at Chapel Hill Genome Analysis Core facility.

Primer sequences are listed in Table 2.

Table 2: PTH1R primer sequences used during mutational analysis

PTH1R Primer Sequence (5' to 3')

PTHR1050MutF gaatgaccttgtggacagca
PTHR1050MutR gaagcctcctaggtccctgt
PTHR1543AND463Mut
F gccctgtccggactacatt
PTHR1543AND463Mut
R cagggagagcatcagggtaa
PTHR1ex3F ctctgcaccccctacca
PTHR1ex3R cccaaacgaggcttcag
PTHR1ex4F aaatcccaccttccctct
PTHR1ex4R ccttcacctggctctgtat
PTHR1ex5F cacctggcaagcacttta
PTHR1ex5R aagagccaagaagcatgag
PTHR1ex6F ttcatccttctgggtcacta
PTHR1ex6R aggttgctggaggagtca
PTHR1ex8F tgactcctccagcaacct
PTHR1ex8R cgccgtaggtagggaca
PTHR1ex10F ccactctacctcttcactttg
PTHR1ex10R ggaatagggtcaggatcac
PTHR1ex11F aagctgttagggcaccac
PTHR1ex11R cttgaggctggactgagaa
PTHR1ex12F ttctcagtccagcctcaag
PTHR1ex12R gctctgtcactgcatctctg
PTHR1ex14F tattagcacttagccaggaca
PTHR1ex14R agggtggaagaatggagaa

Results

Sequencing analysis of patient A revealed no obvious mutations. A representative

example of a chromatogram is provided in Figure 4a. The mutational analysis for patient B

33
revealed a possible frameshift mutation due to insertion at gene PTH1R, and further deep

sequencing will be carried out to corroborate this finding (Figure 4b).

Figure 4 a: Patient A, PTH1R Exon 8F chromatogram

Figure 4 b: Patient B, PTH1R Exon 3 chromatogram

Differences in expression were observed between some candidate genes across the five

samples. Amplification plots with positive results for the housekeeping gene GAPDH (Figures

4c-g) were observed for all samples tested. The candidate genes RANKL and BMP-2 (Figures 8a-

e and 5a-e, respectively) were found not to be genetically expressed across any of the samples.

34
Candidate gene BMP-4, however, was found to be expressed in the control samples for both

Patient A and Patient B as well as in the ankylosed tooth of Patient A; this candidate gene was

not found to be expressed in the teeth affected by PFE of Patient B (Figures 6a-e). Additionally,

candidate gene BMP-6 was found to be expressed in one of the teeth affected by PFE on

Patient B, #16, while it was not found to be expressed in any of the other samples (Figure 7a-e).

Candidate gene PTH1R, was only found to be expressed in tooth #19 of Patient A (Figures 9a-e).

GAPDH

Figure 4 c: Patient A, #29 (control), GAPDH qPCR analysis.Ct=15.68

35

Figure 4 d: Patient A, #19 (ankylosed), GAPDH qPCR analysis.Ct=15.8

Figure 4 e: Patient B, #1 (control), GAPDH qPCR analysis. Ct=15.54

36


Figure 4 f: Patient B, #16 (PFE), GAPDH qPCR analysis. Ct=13.74

Figure 4 g: Patient B, #17 (PFE), GAPDH qPCR analysis. Ct=15.39

37
 BMP-2

Figure 5 a: Patient A, #29 (control), BMP-2 qPCR analysis.

Figure 5 b: Patient A, #19 (ankylosed), BMP-2 qPCR analysis.

38

Figure 5 c: Patient B, #1 (control), BMP-2 qPCR analysis.

Figure 5 d: Patient B, #16 (PFE), BMP-2 qPCR analysis.

39

Figure 5 e: Patient B, #17 (PFE), BMP-2 qPCR analysis.

BMP-4

Figure 6 a: Patient A, #29 (control), BMP-4 qPCR analysis. Ct=15.66

40


Figure 6 b: Patient A, #19 (ankylosed), BMP-4 qPCR analysis. Ct=18.78

Figure 6 c: Patient B, #1 (control), BMP-4 qPCR analysis. Ct=15.14

41

Figure 6 d: Patient B, #16 (PFE), BMP-4 qPCR analysis.

Figure 6 e: Patient B, #17 (PFE), BMP-4 qPCR analysis.

42
 BMP-6

Figure 7 a: Patient A, #29 (control), BMP-6 qPCR analysis.

Figure 7 b: Patient A, #19 (ankylosed), BMP-6 qPCR analysis.

43


Figure 7 c: Patient B, #1 (control), BMP-6 qPCR analysis.

Figure 7 d: Patient B, #16 (PFE), BMP-6 qPCR analysis. Ct=14.17

44


Figure 7 e: Patient B, #17 (PFE), BMP-6 qPCR analysis.

RANKL

Figure 8 a: Patient A, #29 (control), RANKL qPCR analysis.

45


Figure 8 b: Patient A, #19 (ankylosed), RANKL qPCR analysis.

Figure 8 c: Patient B, #1 (control), RANKL qPCR analysis.

46


Figure 8 d: Patient B, #16 (PFE), RANKL qPCR analysis.

Figure 8 e: Patient B, #17 (PFE), RANKL qPCR analysis.

47
 PTH1R

Figure 9 a: Patient A, #29 (control), PTH1R qPCR analysis.

Figure 9 b: Patient A, #19 (ankylosed), PTH1R qPCR analysis. Ct= 14.54

48


Figure 9 c: Patient B, #1 (control), PTH1R qPCR analysis.

Figure 9 d: Patient B, #16 (PFE), PTH1R qPCR analysis.

49


Figure 9 e: Patient B, #17 (PFE), PTH1R qPCR analysis.

The results of the qPCR analysis are summarized by Table 3:

50
Table 3: qPCR results by Ct value

GAPDH BMP-2 BMP-4 BMP-6 RANKL PTH1R

(Ct) (Ct) (Ct) (Ct) (Ct) (Ct)
Patient A, 15.68 Negative 15.66 Negative Negative Negative

#29

Patient A, 15.8 Negative 18.78 Negative Negative 14.54

#19

Patient B, 15.54 Negative 15.14 Negative Negative Negative

#1

Patient B, 13.74 Negative Negative 14.17 Negative Negative

#16

Patient B, 15.39 Negative Negative Negative Negative Negative

#17

In order to compare the candidate genes’ relative expression level compared to that of

the housekeeping gene GAPDH, ΔCt values were calculated for those samples that tested

positive by subtracting the Ct value of GAPDH from the Ct value of the positive assay. The

resulting values are shown on Table 4:

51
 Table 4: ΔCt values of positive qPCR results (ΔCt = Cttest – CtGAPDH)

Sample and gene Positive Ct Value GAPDH value ΔCt value

tested
Patient A, #29,
15.66 15.68 -0.02
BMP-4
Patient A, #19,
18.78 15.8 2.98
BMP-4
Patient A, #19,
14.54 15.8 1.26
PTH1R
Patient B, #1, BMP-
15.14 15.54 -0.4
4
Patient B, #16,
14.17 13.74 0.43
BMP-6

Candidate gene BMP-4 was found to be expressed at a higher rate with respect to

GAPDH across all positive samples with exception of Patient A’s ankylosed tooth (#19).

Candidate gene BMP-6 was expressed at a higher rate compared to GAPDH for Patient B’s

affected upper PFE tooth, #16. Candidate gene PTH1R was expressed at a higher rate than the

housekeeping gene in the ankylosed tooth of Patient A only at a higher rate than the

housekeeping gene.

Discussion.


Bone Morphogenetic Proteins are key players in many processes of bone metabolism

such as formation, repair, regeneration, healing and callus formation. Although the

physiological process of bone turnover involves at least 200 different elements that influence

the cells of bone metabolism, such as osteoblasts and osteoclasts, and interact with one

another as well 7, BMPs have been described as the most important factors, together with

Platelet Derived Growth Factor (PTGF) and Transforming Growth Factor Beta (TGF-β), in the

52
process of bone healing 7. Not only are BMPs important for bone physiology, but they have also

been documented to regulate apoptosis in many other types of tissues 5,12. In this study, the

BMPs studied showed differences in expression between each other and across the different

samples provided. Amplification plots with positive results for the housekeeping gene GAPDH

(Figures 4a-e) attest to the metabolic health of the primary cell cultures and viability of the RNA

sample they yielded after their harvest and processing. RANKL was not found to be expressed in

any of the samples tested and there are several possible explanations to this finding. Liu et al.

(2005) demonstrated that the expression of RANKL significantly peaks at postnatal days 9-11 in

a rat animal model 10. Differentiation of progenitor cells into osteoclasts and bone resorption

are both promoted by RANKL and the expression of this factor could be regulated in a time

dependent manner to coincide with active eruption of a dental unit through bone 10.

Furthermore, expression of RANKL in order to achieve a burst of osteoclast activity has also

found to be site specific. It is known that RANKL is expressed in both the dental follicle 21 and

alveolar bone 18, yet in knockout mice that lack RANKL, rescue with a transgene in B and T

lymphocytes does not restore tooth eruption and only leads to bone resorption in long bones,

while alveolar bone does not show an increase in this metabolic process 2. If the source of

RANKL that leads to tooth eruption and resorption in alveolar bone is the dental follicle as has

been theorized in the literature 10, then the samples analyzed in this study would not be

expected to show expression of RANKL. All of the samples in this study came from teeth that

had already emerged into the oral cavity and they did not present a dental follicle proper any

longer, as it had long differentiated into PDL. The age of both patients at the time of the study

would also suggest that RANKL was not going through an expression peak either.

53
 BMP-2 was found not to be expressed across any of the samples tested. We speculate

that this result is due to the fact that no active bone formation was being induced. BMP-2 is

osteoinductive and it has been shown to induce osteoblast differentiation in a variety of cell

types 11 , whereas RANKL stimulates progenitor cells to differentiate into osteoclasts, leading to

bone resorption 10. BMP-2 has been shown to down-regulate RANKL in vitro and it has been

proposed to promote growth of alveolar bone around a dental unit 10. Just like RANKL,

expression of BMP-2 has been shown to go through a temporal peak in a rat animal model, in

this case around day 9 post-natally in the dental follicle 17,19. The developmental stage of the

teeth in this study and level of differentiation of the dental follicle concur with the finding that

BMP-2 was not expressed in any of the samples tested.

BMP-6 was only found to be expressed in one of the PFE affected teeth of Patient B

(#16). Literature on the expression of BMP-6 across different bones of the human body, such as

the cranial flat bones, corpus mandibulae, diaphysis radii, distal epiphysis radii, alaossis ilii,

diaphysis femoris and distal epiphysis femoris has shown similar results. Kochanowska et al., in

a study of all of the bones mentioned above, found the BMP-6 gene not to be expressed in any

of the samples studied during baseline 7. It appears that the role of BMP-6 is more closely

associated with bone repair, leading to its expression only as a response to a localized insult 7.

We theorize that the positive result in our study was due to a localized insult to alveolar bone

of tooth #16 in Patient B since she reported a previous corticotomy attempt in that quadrant

and it is not a result of different expression levels between ankylosed teeth and teeth affected

by PFE or between affected teeth and controls, as this result was not observed in tooth #17 of

patient B, which is affected by PFE as well.

54
 PTH1R was another candidate gene with observed differences in expression across the

samples tested. In bone, PTH1R is a receptor expressed on the cell surface. Activation of the

receptor by binding to its substrate, PTH, leads to expression of RANKL, which leads to an

increase in the differentiation of osteoclasts and bone resorption. Bone resorption and

remodeling have been observed to accompany root replacement resorption in teeth that suffer

from dental ankylosis 3. In a patient that suffers from a tooth with dental ankylosis, such as

Patient A, PTH1R would be expected to be expressed in order to see the changes in vertical

height of the alveolar bone and replacement resorption that often coincides with dental

ankylosis. PTH1R was found to be expressed in the putatively ankylosed tooth, we therefore

speculate that this tooth does not suffer from PFE.

BMP-4 was found to be expressed in all teeth with the exception of the 2 teeth affected

by PFE on patient B. This candidate gene is important for bone and cartilage metabolism as a

member of the Bone Morphogenetic Protein family 7. Specifically to the craniofacial complex,

tooth formation relies on BMP4 expression 8and mutations in this gene are associated with

orofacial cleft and microphthalmia 1. It is an especially compelling result that only the teeth

affected by PFE failed to display any expression of BMP-4, since not all of the genes responsible

for PFE have been identified so far. Only 10 to 40% of PFE cases have been shown to be familial,

with a mutation present on gene PTH1R and not all causative mutations for this condition have

been identified 13. In light of the observed expression pattern of BMP-4 for the patients in this

study, we propose that BMP-4 may be a downstream effector in a pathway affected by PTH1R

mutations. An Ingenuity Pathway analysis would help elucidate this and should be done in

future studies that also look at a RNA-SeQ analysis of ankylosis versus PFE affected teeth.

55
These and other future studies will provide immeasurable insights into the understanding and

future translational strategies to manage PFE, ankylosis and other eruption disorders.

56
 REFERENCES

1. BMP4 bone morphogenetic protein 4 [homo sapiens (human)] - gene - NCBI.

http://www.ncbi.nlm.nih.gov/gene/652. Accessed 4/3/2016, 2016.

2. The role of RANKL (TRANCE/TNFSF11), a tumor necrosis factor family member, in skeletal
development: Effects of gene knockout and transgenic rescue. - PubMed - NCBI.
http://www.ncbi.nlm.nih.gov/pubmed/12952207. Accessed 4/4/2016, 2016.

3. Andersson L, Blomlöf L, Lindskog S, Feiglin B, Hammarström L. Tooth ankylosis: Clinical,

radiographic and histological assessments. Int J Oral Surg. 1984;13(5):423-431. doi:
http://dx.doi.org.libproxy.lib.unc.edu/10.1016/S0300-9785(84)80069-1.

4. Biederman W. The incidence and etiology of tooth ankylosis. Am J Orthod. 1956;42(12):921-

926. doi: http://dx.doi.org/10.1016/0002-9416(56)90193-2.

5. Botchkarev VA. Bone morphogenetic proteins and their antagonists in skin and hair follicle
biology. J Invest Dermatol. 2003;120(1):36 <last_page> 47. doi: 10.1046/j.1523-
1747.2003.12002.x.

6. Crews L, Adame A, Patrick C, et al. Increased BMP6 levels in the brains of alzheimer's disease
patients and APP transgenic mice are accompanied by impaired neurogenesis. J Neurosci.
2010;30(37):12252-12262. doi: 10.1523/JNEUROSCI.1305-10.2010 [doi].

7. Kochanowska I, Chaberek S, Wojtowicz A, et al. Expression of genes for bone morphogenetic

proteins BMP-2, BMP-4 and BMP-6 in various parts of the human skeleton. BMC
Musculoskelet Disord. 2007;8:128. doi: 1471-2474-8-128 [pii].

8. Kriangkrai R, Iseki S, Eto K, Chareonvit S. Dual odontogenic origins develop at the early stage
of rat maxillary incisor development. Anat Embryol. 2006;211(2):101 <last_page> 108. doi:
10.1007/s00429-005-0068-7.

9. Kurol J. Infraocclusion of primary molars: An epidemiologic and familial study. Community

Dent Oral Epidemiol. 1981;9(2):94-102.

10. Liu D, Yao S, Pan F, Wise GE. Chronology and regulation of gene expression of RANKL in the
rat dental follicle. Eur J Oral Sci. 2005;113(5):404 <last_page> 409. doi: 10.1111/j.1600-
0722.2005.00245.x.

11. Marie PJ, Debiais F, Hay E. Regulation of human cranial osteoblast phenotype by FGF-2,
FGFR-2 and BMP-2 signaling. Histol Histopathol. 2002;17(3):877-885.

57
12. Reddi AH. Interplay between bone morphogenetic proteins and cognate binding proteins in
bone and cartilage development: Noggin, chordin and DAN. Arthritis Res. 2001;3(1):1-5.
doi: 10.1186/ar133 [doi].

13. Rhoads SG, Hendricks HM, Frazier-Bowers SA. Establishing the diagnostic criteria for
eruption disorders based on genetic and clinical data. Am J Orthod Dentofacial Orthop.
2013;144(2):194-202. doi: 10.1016/j.ajodo.2013.03.015 [doi].

14. Scanlon C, Marchesan J, Soehren S, Matsuo M, Kapila Y. Capturing the regenerative

potential of periodontal ligament fibroblasts. J Stem Cells Regen Med. 2011;7(1):54-56.

15. Suri L, Gagari E, Vastardis H. Delayed tooth eruption: Pathogenesis, diagnosis, and
treatment. A literature review. American Journal of Orthodontics and Dentofacial
Orthopedics. 2004;126(4):432 <last_page> 445. doi: 10.1016/j.ajodo.2003.10.031.

16. Wara-aswapati N, Surarit R, Chayasadom A, Boch JA, Pitiphat W. RANKL upregulation

associated with periodontitis and porphyromonas gingivalis. J Periodontol.
2007;78(6):1062-1069. doi: 10.1902/jop.2007.060398 [doi].

17. Wise GE, Ding D, Yao S. Regulation of secretion of osteoprotegerin in rat dental follicle cells.
Eur J Oral Sci. 2004;112(5):439-444. doi: 10.1111/j.1600-0722.2004.00156.x [doi].

18. Wise GE, Lumpkin SJ, Huang H, Zhang Q. Osteoprotegerin and osteoclast differentiation
factor in tooth eruption. J Dent Res. 2000;79(12):1937 <last_page> 1942. doi:
10.1177/00220345000790120301.

19. Wise GE, Yao S. Expression of tumour necrosis factor-alpha in the rat dental follicle. Arch
Oral Biol. 2003;48(1):47 <last_page> 54. doi: 10.1016/S0003-9969(02)00153-X.

20. Wu Q, Yao J. BMP4, a new prognostic factor for glioma. World J Surg Oncol. 2013;11:264-
7819-11-264. doi: 10.1186/1477-7819-11-264 [doi].

21. Yao S, Ring S, Henk WG, Wise GE. In vivo expression of RANKL in the rat dental follicle as
determined by laser capture microdissection. Arch Oral Biol. 2004;49(6):451-456. doi:
10.1016/j.archoralbio.2004.01.009 [doi].

58