AP Biology Name:

Unit 7—Genetic Technology

The Case of the Druid Dracula

Peggy Brickman
Department of Plant Biology
University of Georgia

Part I—DNA Structure and PCR

In the northernmost corner of the Isle of Anglesey in Wales in a village called Llanfairpwll, the
windswept beaches and ancient Druid ruins provided a surreal backdrop for the murder of 90-
year-old Mabel Leyshon. Her murder was not only brutal—her heart had been hacked out—but
also creepy; it appeared as if the killer had collected Mabel’s blood in a small kitchen saucepan
that had lip marks on the rim indicating the contents had been tasted. The murder showed other
signs of the occult; a candlestick and a pair of crossed pokers had been arranged near the body.
Further investigation indicated that this was no supernatural villain at work. The murderer had
worn tennis shoes which had left distinctive footprint under the glass door that had been
shattered with a piece of broken garden slate in order to gain entrance to the victim’s home.
Inside the house, a windowsill had bloodstains on it. With luck, the evidence recovery unit
hoped to use it to find the killer.

In this investigation, your job is to understand the process of PCR and then to use agarose gel
electrophoresis to examine the PCR products from this case.

Questions

1. DNA is composed of nucleotides that are joined together by covalent bonds between
which two portions of each nucleotide?
a. Between deoxyribose and a phosphate group
b. Between two deoxyribose groups
c. Between the nitrogen-containing rings
d. Between a phosphate group and the nitrogen-containing ring.
e. Between the phosphate groups of both nucleotides.
2. In the hydrogen bonds between nitrogen-containing bases ____________.
a. A always pairs with C
b. A always pairs with G
c. C always pairs with T
d. G always pairs with T
e. G always pair with C
3. From which evidence mentioned in the above paragraph might we find DNA for DNA
analysis?
Differences in Amelogenin

Found on the X chromosome, the amelogenin gene (AMELX) encodes a protein that is critical
for the formation of the enamel on teeth. Individuals with deletions in this gene can have
problems forming the normal thickness of enamel on their teeth, and/or problems in the
mineralization of the enamel, so that their enamel may remain softer than normal. A duplicate
version of the amelogenin gene can be found on the Y chromosome in primates (AMELY), but
there are significant differences between these two amelogenins. One of those differences is
found in intron I of AMELX, which is missing 6 nucleotides found in AMELY. PCR can be
performed using primers flanking this region to amplify DNA sequences from both the AMELX
and AMELY. PCR products generated from AMELX will be 106 base-pairs in length; PCR
products from AMELY will be 112 base pairs in length.

Questions

1. DNA differences can be used to identify people. For example, the differences in
AMELX and AMELY can be used to tell if a blood stain, such as the one found on the
windowsill inside Mable Lyshon’s house, was left by a man or a woman. This stretch of
nucleotides shows one strand of the DNA double helix for the amelogenin gene; what is
the sequence of the other complementary strand?
5’CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG 3’

a. 3’ACTGTTAGATTTCCCTTTTTAGGTCTAGGTCCGTCGGCCTTATTTCCGAGGAATAA 5’
b. 3’GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC 5’
c. 5’GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC 3’
d. 3’CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG 5’
e. 5’CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG 3’

2. To assist the investigators with the crime, you will need to perform Polymerase Chain
Reaction (PCR) to create copies of this gene so the sizes can be compared to determine if
the blood was from a man or woman. During PCR it will be necessary to break the
hydrogen bonds of the base pairs. Where are those hydrogen bonds normally found?

a. Between two nitrogen-containing bases in a single strand of DNA.

b. Between the phosphate and sugar of the same nucleotide.
c. Between the sugar of one nucleotide and the phosphate of a different
nucleotide.
d. Between one nitrogen-containing base on a single strand of DNA and another
nitrogen-containing base on the complementary strand of DNA.
e. Between one phosphate on a single strand of DNA and a sugar on the
complementary strand of DNA.
3. PCR creates copies of DNA using the exact same mechanism used by your cells to copy
their own DNA (replication). Place the steps listed below in the order in which they
occur during replication:
A) two strands, one new and one original template, wind together to form the double
helix.
B) short stretch of primer (~20 nucleotides exactly complementary to the gene that is
going to be copied) is made.
C) separation of the double helix from two parental DNA strands.
D) use of parental DNA as a template so that nucleotides are covalently bonded together
to form a new chain that is complementary to the bases on the original template.
a. A, B, C, D
b. B, C, A, D
c. D, B, C, A
d. C, B, D, A
PCR

Polymerase Chain Reaction (PCR) is used to make many copies of a defined segment of a
DNA molecule. Here’s how it works. First, you decide which DNA segment you want to
duplicate, or amplify. Then you obtain two short, single-stranded DNA molecules that are
complementary to the very ends of the segment. These two short molecules must have specific
characteristics. Each of the single-stranded molecules must have a base sequence that is
complementary to only one strand of the target DNA, and each one must be complementary to
only one end of the segment. Furthermore, if you imagine these short molecules base paired to
the complementary regions in the target DNA molecule, their 3’ ends would point towards each
other. These short stranded molecules are the primers for PCR.

To begin the chain reaction, a large number of primers are mixed with the target molecule in a
test tube containing DNA polymerase enzyme, buffer and many deoxynucleoside triphosphates.
This mixture is heated at almost boiling, so that the base pairs holding the two strands of the
parental molecule separate, or denature.

Next, the mixture is allowed to cool. Ordinarily the two strands of the target DNA molecules
would eventually line up and re-form their base pairs. However, there are so many molecules of
primers in the mixture that the short primers find their complementary sites on the target strands
before the two target strands can line up correctly for base pairing. Therefore, a primer molecule
base pairs, or hybridizes, to each of the target strands.

Now DNA polymerase enzyme adds deoxynucleotides to the 3’ end of each primer, using the
bases on the target strand as a template. New complementary strands are synthesized, and the 5’
end of each is formed by a primer. In this manner, two double stranded molecules are formed
where before there was only the single-stranded target molecule.

This process of denaturation, hybridization, and DNA synthesis is repeated over and over.
Each time, the DNA molecules in the mixture is doubled. The overwhelming majority of the
newly synthesized molecules extend exactly from one primer sequence to the other. So by
choosing the primers, a scientist controls which segment of the target molecule is amplified. See
Figure 1.
How is PCR used to generate a DNA fingerprint? First, let’s remember the basic problem in
human DNA fingerprinting. Humans have about 3 billion base pairs of DNA, most of which are
identical from one person to another. This is too much DNA to examine simply by cutting with
restriction enzymes and comparing banded patterns in a gel. Those three billion base pairs
generate too many fragments, producing an overlapping smear of bands in a gel. Fortunately
many of the differences in the DNA of one person and another are concentrated at certain places
along the chromosome. To generate a DNA fingerprint, scientists have found ways to look
specifically at these regions where differences are concentrated. One of the ways they look is
through PCR.

PCR is used to detect a specific type of difference for DNA fingerprinting. Human DNA
contains end to end or “tandem repeats” of different short DNA sequences (from as few as three
bases up to 30 or more bases long) at many places scattered throughout the chromosomes.
Although the chromosomal locations and the base sequences of the repeats at a given site are the
same from person to person, the number of repeats at a given location varies highly from
individual to individual. Because of this variation, these repeated sequences are called variable
number of tandem repeats (VNTRs) or short tandem repeats (STRs). In fact, a single
individual usually has different numbers of repeats on the maternal and paternal members of a
chromosome pair. If you determined the number of repeated sequences at several different
VNTR sites throughout an individual’s genome, it is unlikely that a similar analysis of another
individual would give the same result. Thus, the number of repeats at VNTR locations
constitutes a kind of DNA fingerprint. It is critical that multiple VNTR sites be examined.
Otherwise, the probability of there being a random match between two people is too high for the
DNA fingerprint to reliably identify an individual.

PCR can reveal the number of repeats at VNTR sights. For instance, consider two fictitious
VNTR regions from two different individuals. Individual A has 3 and 8 repeats on her
Chromosome 1’s, while Individual B has 8 and 7 of the same repeats on her Chromosome 1’s.

Suppose we make a pair of primers that match the flanking regions around the VNTR on
Chromosome 1. These flanking regions are the same in both individuals. Now we run the PCR
reaction. The major products will be copies of the DNA segment between the two primer
sequences. In Individual A, these major products will be 30 and 80 base pairs long, plus the
length of the primers. In Individual B, the major products would be 80 and 70 base pairs long
plus the primer lengths.

Let us now use a second pair of primers, a pair that matches sequences flanking the repeats on
Chromosome 10. When we run the PCR reaction this time, we get products of 75 base pairs
(plus primer lengths) and 150 base pairs (plus primer lengths) from Individual A, and 75 and 100
base pairs (plus primer lengths) from Individual B.

See Figures 2, 3, & 4: Note—The bold arrows in Figure 3 and Figure 4 indicate the location of
each primer and the direction of DNA synthesis.
Below are some animations/simulations from Dolan DNA Learning Center and University of
Utah Genetic Science Learning Center to further your understanding of how PCR works. Please
watch the animation and complete the simulation before answering the questions below.

The Cycles of Polymerase Chain Reaction, 3D Animation

http://www.dnalc.org/view/15475-The-cycles-of-the-polymerase-chain-reaction-PCR-3D-
animation-with-no-audio.html

Making Many Copies of DNA

http://www.dnalc.org/view/15924-Making-many-copies-of-DNA.html

PCR Virtual Lab

http://learn.genetics.utah.edu/content/labs/pcr/
1. PCR can be used to selectively duplicate one single gene out of thousands because the
only primers available to start replication are the one unique pair that are complementary
to the regions on both sides of the gene. Which of these primers (one for each strand)
could you use to copy just the stretch (enlarged) of the amelogenin gene that differs
between the X and Y chromosomes?
3’GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTCTACAAAGAGTTCACCAG
GACTTTACAGTTCCTACCACCAGCTTCCCAGTTTAAGCTCTGAT 5’

5’CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTCAAGTGGTC
CTGAAATGTCAAGGATGGTGGTCGAAGGGTCAAATTCGAGACTA 3’
`
a. 3’ GGGACCCGAGACATTTCTTATCAC 5’ and 5’ CCCTGGGCTCTGTAAAGAATAGTG 3’
b. 5’ CCCTGGGCTCTGTAAAGAATAGTG 3’ and 5’ GTCGAAGGGTCAAATTCGAGACTA 3’
c. 5’ CCCTGGGCTCTGTAAAGAATAGTG 3’ and 3’ CAGCTTCCCAGTTTAAGCTCTGAT 5’

2. Draw the relative distances Individual A’s and Individual B’s VNTRs would travel on a
gel if amplified by the two sets of primers and separated by gel electrophoresis, as
described in the example on the previous page.

Size, bp
(+ primers)

160------

80--------

40--------

20--------

10--------

3. If the amelogenin gene is targeted in PCR and the products are run through gel
electrophoresis, which fragment do you expect to travel further on the gel?
a. AMELX
b. AMELY

Why?
Part II—The First Report—Male or Female

The blood collected from the windowsill was analyzed to determine if the perpetrator was a male
or female. The gel electrophoresis results are found below. The left lane is Lane 1, the middle is
Lane 2, and the third lane is Lane 3. Lanes 1 and 2 are standards. One is a male and the other is
a female. Lane 3 is the DNA found at the crime scene.

1. Is the blood found at the crime scene from a male or female? How do you know?
Part III—More Analysis

The crime was featured on BBC’s Crimewatch program in December 2001 and North Wales
Police received over 200 calls. Following up reports of a teenager who had attacked a German
student, the police went to the home of Matthew Hardman (Suspect X), who gave police a cheek
swab. During this visit, officers found a pair of Levi shoes. Forensic Science Service (FSS)
scientists matched Hardman’s shoes to the footwear marks found at the murder scene. Profiling
suggested a much older offender, so another suspect was also asked to give a cheek swab
(Suspect Y). Since both suspects were men, the officers needed to test for other genetic
differences.

In the forensics lab, scientists used two pairs of PCR primers to perform two separate PCR
reactions on the evidence DNA, Suspect X’s DNA, and Suspect Y’s DNA. The PCR products
obtained with the first set of primers were labeled Evidence-1, X-1, and Y-1. The products
obtained with the second set of primers were labeled Evidence-2, x-2, and Y-2.

Your job is to use agarose gel electrophoresis to examine the PCR products, compare the
products from the suspects’ DNA with the products from the evidence, and determine which
suspect might be the guilty party.

Procedure

1. Tape tray
2. Bead cooled agarose along tape
3. Put comb in
4. Pour cooled agarose into tray (50ml) – Cool− DO NOT MOVE WHILE COOLING!
5. Carefully remove tape and comb
6. Put tray in chamber− close to the middle−wells to black (−) side
7. Add chamber buffer 400mls−heat samples for 2 minutes
8. Load samples; *Be sure to use a fresh tip for each sample. Load set pipette at 30ml –but
load everything in tube!
You will load 6 lanes!
Lane 1 2 3 4 5 6 7 8 9 10

9. Put top on – match colors

10. Plug in electrodes
11. Set voltage at
12. Leave a note with the time your gel started!
13. Clean up! Throw away:
Return to tray: pipette, comb, tube rack, tape
Read sample labels to make sure you put in right spot!
Sample:
1. DNA− with primer 1− from crime scene/evidence-purple
2. DNA− with primer 2− from crime scene/evidence-white
3. DNA− with primer 1−from suspect X-blue
4. DNA− with primer 2−from suspect X-green
5. DNA− with primer 1−from suspect Y-yellow
6. DNA− with primer 2−from suspect Y-red

Individually turn in the following report:

A. Data for the Jury to Review

1. Photograph of the Gel
2. Drawing of the Gel with Clear Titles and Labels

B. Conclusion
1. State which suspect’s DNA (if either) matches the DNA found at the scene.
2. Summarize how this procedure allowed you to identify which suspect was the
criminal OR allowed you to exonerate both suspects. Be sure to include a
thorough explanation of the following:
a. How PCR works
b. The significance of VNTRs, and how PCR of these regions can create a
“fingerprint”
c. Why two primers were used
d. Why the samples were run on the same gel.
3. Any other comments, i.e., regarding how well our gel worked, accuracy of the
results, etc.

Note: Your report should be thorough and written in a manner that is understandable to a jury
member who may not have any experience with DNA or DNA testing.