American Journal of Medical Genetics (Neuropsychiatric Genetics) 88:158–163 (1999)

Tourette Syndrome and the Norepinephrine

Transporter Gene: Results of a Systematic
Mutation Screening
Gerald Stöber,1,2* Johannes Hebebrand,3 Sven Cichon,1 Michael Brüss,4 Heinz Bönisch,4
Gerd Lehmkuhl,5 Fritz Poustka,6 Martin Schmidt,7 Helmut Remschmidt,3 Peter Propping,1 and
Markus M. Nöthen1
1
Institute of Human Genetics, University of Bonn, Bonn, Germany
2
Department of Psychiatry, University of Würzburg, Würzburg, Germany
3
Department of Child and Adolescent Psychiatry, University of Marburg, Marburg, Germany
4
Institute of Pharmacology and Toxicology, University of Bonn, Bonn, Germany
5
Department of Child and Adolescent Psychiatry, University of Köln, Cologne, Germany
6
Department of Child and Adolescent Psychiatry, University of Frankfurt/Main, Frankfurt am Main, Germany
7
Department of Child and Adolescent Psychiatry, Zentralinstitut für Seelische Gesundheit, Mannheim, Germany

Tourette syndrome (TS) is a complex inher-
ited neuropsychiatric disorder character-
ized by multiple motor and phonic tics. In-
volvement of central norepinephrine
mechanisms is suggested by central norepi-
nephrinic hyperactivity in patients with TS
and by the therapeutic effects of the presyn-
aptic ␣2-adrenergic agonist clonidine. The
norepinephrine transporter gene (NET) was
systematically screened by single-strand
conformation analysis for genetic variants,
including the whole coding region and adja-
cent exon-intron boundaries in 43 patients
with TS and 46 healthy controls. We de-
tected 12 DNA sequence variants, among
them four missense mutations (Val69Ile,
Thr99Ile, Val245Ile, and Gly478Ser). The ob-
served missense mutations may alter con-
formational rearrangements during gating
of the transporter, assembly of subunits,
and norepinephrine-specific uptake affin-
ity. Allele frequency and genotype distribu-
tion of the genetic variants showed no dif-
ferences between TS patients and controls.
No mutation of likely functional signifi-
cance was found that distinguished TS pa-
tients from healthy controls, indicating that
genetic variants of the NET gene are not
causally related to Tourette syndrome. Am.
Contract grant sponsor: Deutsche Forschungsgemeinschaft;
Contract grant number: SFB 400 ‘‘Molekulare Mechanismen zen-
tralnervöser Erkrankungen,’’ Teilprojekt A3.
*Correspondence to: Gerald Stöber, M.D., Department of Psy-
chiatry, University of Würzburg, Füchsleinstraße 15, 97080
Würzburg, Federal Republic of Germany.
Received 16 June 1998; Accepted 4 August 1998
© 1999 Wiley-Liss, Inc.
J. Med. Genet. (Neuropsychiatr. Genet.) 88:
158–163, 1999. © 1999 Wiley-Liss, Inc.
KEY WORDS: Tourette syndrome; norepi-
nephrine; noradrenaline;
transporter; genetics; muta-
tion analysis
INTRODUCTION
Tourette syndrome (TS) is a complex disorder of mo-
tor and vocal tics starting in childhood or adolescence
with a lifetime prevalence of 0.1–1.0%, preponderantly
affecting males [Robertson and Stern, 1997]. The short,
involuntary repetitive movements and phonic tics tend
to occur in bouts with brief intertic intervals. Motor tics
vary from simple abrupt movements to more complex
behaviors, as do vocal tics, ranging from simple throat
cleaning or guttural sounds to whole phrases. Tourette
syndrome improves during late adolescence and early
adulthood, with relative decrement in severity and
number of symptoms accompanied by an ameliorated
social adjustment. Segregation analysis studies in TS
have suggested either autosomal-dominant patterns of
inheritance, or mixed models with a major locus and
multifactorial background, or a major locus with addi-
tional minor susceptibility loci [Pauls and Leckman,
1986; Eapen et al., 1993; Walkup et al., 1996]. Bilineal
transmission due to assortative mating has been re-
peatedly observed [Hasstedt et al., 1995; McMahon et
al., 1996]. Using the single major locus model with au-
tosomal-dominant inheritance, linkage mapping ex-
cluded more than 90% of the human autosomes for To-
urette syndrome susceptibility loci [Patel, 1996].
The application of linkage analysis in complex ge-
netic disorders has many difficulties, such as locus het-
erogeneity, assortative mating, reduced penetrance,
 Tourette Syndrome and Norepinephrine Transporter
phenocopies, or considerable comorbidity of other dis-
orders. This dilemma may be of particular relevance to
the etiology of Tourette syndrome [Patel, 1996; Hebe-
brand et al., 1997a]. A complementary approach to
identify pathogenetically relevant genes represents the
study of candidate genes using association studies [Nö-
then et al., 1993]. Favored hypotheses of pathophysi-
ological mechanisms in Tourette syndrome are dopa-
mine receptor hypersensitivity and dopaminergic over-
activity [Leckman et al., 1995], but the initial reports of
an association between dopamine D2, D3, and D4 re-
ceptor gene polymorphisms to TS were not able to be
confirmed [Comings et al., 1991, 1993; Hebebrand et
al., 1993, 1997b; Nöthen et al., 1994; Brett et al., 1995].
Compelling evidence of norepinephrine involvement in
the pathophysiology of Tourette syndrome, in particu-
lar via central norepinephrine hyperactivity, comes
from the beneficial, but usually incomplete effective-
ness of clonidine and guanfacine [Leckman et al., 1991;
Fras, 1996]. The therapeutic mechanism of these drugs
is activation of central ␣2-autoreceptors, resulting in a
reduced release of norepinephrine from central neu-
rons that seems to improve symptomatology in 40–60%
of clonidine-treated TS patients [Lichter and Jackson,
1996]. The exaggerated norepinephrine levels in TS are
preponderantly related to motor-tic severity, and cloni-
dine seems to be more effective in ameliorating motor
tics than phonic tics [Leckman et al., 1991; Chappell et
al., 1996]. TS patients show a significantly blunted
growth hormone response to clonidine compared to con-
trols [Müller et al., 1994] and tend to have stress-
induced overactivity of the hypothalamic-pituitary-
adrenal axis and related central and peripheral norepi-
nephrine systems, which is manifested in increased
norepinephrine excretion prior to lumbar puncture
[Chappell et al., 1994]. Furthermore, treatment with
antidepressants that are prevailing inhibitors of nor-
epinephrine transport (e.g., nortriptyline) was observed
to cause exacerbation of tics in TS [Müller, 1992]. The
altered norepinephrine turnover in TS patients led us
to assume that genetic variants of the norepinephrine
transporter gene may be associated with TS.
The human norepinephrine transporter (NET) be-
longs to the family of monoamine transporter genes,
including the dopamine transporter (DAT) and the se-
rotonin transporter (SERT) gene. The NET gene is a
Na+ and Cl− coupled, high-affinity, and substrate-
specific transporter which reaccumulates and recycles
released norepinephrine into presynaptic terminals,
aiding termination of synaptic transmission [Pacholc-
zyk et al., 1991]. The human NET gene was assigned to
16q12 by FISH [Brüss et al., 1993] and to 16q11.2–12
by linkage analysis in CEPH families [Gelernter et al.,
1993]. The genomic organization of the human NET
gene consists of 14 exons spanning 45 kilobases (kb)
[Pörzgen et al., 1996]. Intron sizes range between 0.37–
13 kb [Pörzgen et al., 1995, 1996]. Transmembrane do-
mains (TMD), hydrophilic loops, and N- and C-termini
of the NET gene are encoded by individual exons span-
ning 72–274 bp (EMBL/GenBank Accession no.
X91122). The human NET is a 617-amino-acid protein
with 12 putative TMDs and a large extracellular loop
between TMDs 3–4 containing 2–4 potential glycosyla-
159
tion sites [Amara and Kuhar, 1993]. In a previous
study we carried out a systematic mutation analysis of
the NET gene, using single-strand conformation analy-
sis (SSCA) in patients suffering from schizophrenia or
bipolar affective disorder and in controls [Stöber et al.,
1996]. Thirteen DNA sequence variants were identi-
fied, among them five missense substitutions resulting
in amino-acid substitutions. The missense variants
Val69Ile, Thr99Ile, Val245Ile, Val449Ile, and
Gly478Ser are located at putative TMDs 1, 2, 4, 9, and
10, respectively. Three sequence variants were silent
mutations, 955T/C, 1287G/A, and 1779G/A, and five
were intron variants in flanking intron sequences that
did not alter splice site acceptor/donor consensus se-
quences. In a case-control study of bipolars, schizo-
phrenics, and controls, genotype distribution and allele
frequencies revealed no significant association of the
missense substitutions with schizophrenia or bipolar
affective disorder [Stöber et al., 1996].
To assess the possible dysregulation of the norepi-
nephrine system in Tourette syndrome, we carried out
a systematic mutation scan of the coding region and
the adjacent exon-intron boundaries of the norepineph-
rine transporter gene for nucleotide sequence varia-
tions in 43 unrelated patients with Tourette syndrome.
SUBJECTS AND METHODS
Subjects
The mutation screening sample included 43 patients
with Tourette syndrome (TS) and 46 blood donors as
control probands. The diagnostic assessment of TS pa-
tients included both a clinical evaluation according to
DSM-IV criteria [American Psychiatric Association,
1994] and the use of the German version of the Child or
Adult Schedule for Tourette and Other Behavioral Dis-
orders [Nöthen et al., 1994]. All TS patients were
younger than 25 years at the time of assessment. The
male/female ratio was 37/6 among TS patients.
Twenty-three TS individuals (53%) had a positive fam-
ily history of Tourette syndrome or of tic symptoms in
first- or second-degree relatives. All probands were un-
related and of German descent. Written informed con-
sent was obtained from all patients.
Laboratory Methods
EDTA-anticoagulated venous blood samples were
drawn from all probands. DNA was isolated by salting
out with saturated NaCl solution [Miller et al., 1988].
Fifteen sets of primers were chosen to screen the whole
coding region and the exon-intron junctions of the hu-
man NET. Exon 1 (spanning 274 bp) was screened us-
ing two overlapping fragments, whereas exon 2–14
fragments encompassed the exons and adjacent exon-
intron junctions. Fragment sizes ranged from 186–288
bp (Table I). Standard PCR was carried out in a 25-␮l
volume containing 40 ng genomic DNA, 10 pmol of each
primer, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM
MgCl2, 0.01% gelatin, 200 ␮M of each dNTP, and 0.5 U
Taq DNA polymerase (Life Technologies, Merelbeke,
Belgium). PCR amplification with primer sets 8, 9, 12,
and 14 was processed with additional 5% formamide
and 10% glycerol. Samples were amplified in a UNO
160 Stöber et al.

TABLE I. PCR Primers for Amplification of Fragments Covering the Coding Region and Exon/Intron
Junctions of the Human NET Gene
Nucleotide position Genomic PCR product
Primer Primer sequences (5–3⬘)* localization (bp)
14-F 5⬘AAGTTCCTCTCGCCAGCC 3⬘ −24– −6 5⬘UTR 245
14-R 5⬘ACTGCGAAGCCGACTACG 3⬘ 204–221 Exon 1
15-F 5⬘CAAAACTGCGGAGCTGCT 3⬘ 83–101 Exon 1 235
15-R 5⬘GTGGACCTCCCAGATTCAAA 3⬘ +25– +44 Intron 1
1-F 5⬘AGGGGTCTGTCAGGTCACAC 3⬘ −40– −20 Intron 1 201
1-R 5⬘ACCGTGACTTTCTCCCACC 3⬘ +11– +29 Intron 2
2-F 5⬘TCCTACCTTACCCCCTGTCC 3⬘ −28– −9 Intron 2 286
2-R 5⬘GCACAAGGGGTCTGTGACTT 3⬘ +3– +22 Intron 3
3-F 5⬘ATTTACCCTGGTCCCCTCC 3⬘ −35– −17 Intron 3 222
3-R 5⬘CCAAGGTTGATCACCCAAGT 3⬘ +28– +48 Intron 4
4-F 5⬘GGGATTGGGGCCAGAG 3⬘ −49– −34 Intron 4 214
4-R 5⬘CCCAAGGCTTGGTGGTC 3⬘ +14– +30 Intron 5
5-F 5⬘GGCTTTTGTCTGCTGGTTTC 3⬘ −22– −3 Intron 5 186
5-R 5⬘CACCCCACAAGAGTCAATCC 3⬘ +42– +61 Intron 6
6-F 5⬘ACTTGACCTCACTGTGCTTCTTC 3⬘ −29– −7 Intron 6 211
6-R 5⬘TGGGCTTCTCAGCTCCC 3⬘ +40– +56 Intron 7
7-F 5⬘CAGCCATTGATGAGGTCCTT 3⬘ −34– −15 Intron 7 216
7-R 5⬘CACTGTGTGTTGGGGAAGG 3⬘ +51– +69 Intron 8
8-F 5⬘TCCAGGGAGACCCTAATTCC 3⬘ −49– −30 Intron 8 241
8-R 5⬘TTGACTTTATTGAAATGCGGC 3⬘ +43– +63 Intron 9
9-F 5⬘CACAACAATCAGTTCCCACG 3⬘ −64– −45 Intron 9 214
9-R 3⬘CAGGATTCTAGGAGGACTGGG 3⬘ +30– +50 Intron 10
10-F 5⬘AGAACCTCATGGGAGGACCT 3⬘ −73– −54 Intron 10 245
10-R 5⬘ATCCTCACCCAGCTCCATC 3⬘ +53– +71 Intron 11
11-F 5⬘TGTCCTGTCTTCCTTTCTCTCC 3⬘ −41– −20 Intron 11 246
11-R 5⬘CTCCCACCCTGTTCCCCT 3⬘ +20– +37 Intron 12
12-F 5⬘CAGGCTGCTAGAAGGGTGTC 3⬘ −62– −43 Intron 12 251
12-R 5⬘CTCACACTGGGTTTCTGGGT 3⬘ +98– +117 Intron 13
13-F 5⬘CCCTTTCTGGGCCTCTGT 3⬘ −172– −145 Intron 13 265
13-R 5⬘TTGACGTAGCAGCGGATG 3⬘ 1906–1923 3⬘UTR
*Numbering of intron and exon sequences is according to Pacholczyk et al. [1991], Pörzgen et al. [1995], and our
unpublished results.

Thermoblock (Biometra, Göttingen, Germany). After
an initial 5-min denaturation at 94°C, 35 temperature
cycles were carried out consisting of 30 sec at 94°C, 30
sec at 57°C (primers 1–3 and 5–15) or 58°C (primer 4),
and 30 sec at 72°C, followed by a final extension step of
5 min at 72°C. For SSCA, 8 ␮l of the PCR product were
mixed with 12 ␮l formamide (containing 0.0125 brom-
phenol blue and 0.75% Ficoll 400 in 1 × TBE), dena-
tured at 94°C for 5 min, and subsequently chilled on
ice. Seven microliters of the product were loaded on
10% (acrylamide:bisacrylamide ⳱ 49:1) polyacryl-
amide (PAA) gels (Multigel-Long, Biometra) containing
0.5 × TBE. PAA-gels were run for 12–15 hr at 6 V/cm at
room temperature and 7 V/cm at +4°C, respectively.
For exon 11, we used a modified procedure at 4°C with
10% PAA gels (29 AA:1 BAA) in 1 × TBE, running 8 hr
at 7 V/cm to get appropriate banding patterns. Bands
were visualized by silver-staining [Budowle et al.,
1991].
PCR products from individuals displaying variant
banding patterns in SSCA were cloned into pUC 18
SmaI/BAP vector (Pharmacia, Uppsala, Sweden). Ly-
sates of single colonies were used as templates for PCR
with insert-specific primers. SSCA of PCR products of
different colonies allowed the identification of clones
containing different alleles in heterozygous individu-
als. From selected colonies a hemibiotinylated PCR
product was generated, using one biotylinated vector
primer and one normal vector primer. The PCR prod-
uct was incubated with streptavidine Dynabeads
M-280 (Dynal Ltd., Oslo, Norway), washed, and dena-
tured to separate the complementary DNA strands.
Subsequently, both biotylinated single-stranded tem-
plates were sequenced manually by the dideoxy nucleo-
tide chain termination method, using a Sequenase Ver-
sion 2.0 Kit (US Biochemicals, Cleveland, USA).
To allow rapid genotyping, PCR-based restriction
fragment length polymorphism (RFLP) methods were
established. For fragments 1, 3, 7, 10, 12, and 15, we
used mutagenic primers to create appropriate restric-
tion sites (nucleotide substitutions are underlined): 15-
MR 5⬘ CCACTGCGAAGCCGAGTA 3⬘ (+25–+44), 1-MF
5⬘ GCCTTCTTGATCCCGTGCA (277–295), 3-MR 5⬘
GCTAAAATACAAGACGGTGA 3⬘ (734–753), 7MF 5⬘
CAGCCATTGATGAGGTCATTG 3⬘ (−34–−14), 10-MR
5⬘ CCCTCCCCACAT-GCCGG (+24–+40), and 12-MF
5⬘ AGACTGGCCTATGGCATGAC (1759–1778). For
detection of the exon 1 variant (Val69Ile), we per-
formed a seminested PCR to reduce unspecific PCR
products. First-round PCR was performed with primer
pair 14F/15 MR, and second-round PCR with primer
set 15F/15MR. After amplification of genomic DNA, 5
␮l of the respective PCR products were digested in 5 U
BsiHKAI, 5 U DdeI, 4 U BstNI, 4 U NciI, 4 U BsaHI, 4
U RsaI, 2 U BsrDI, 0.8 U Tsp45I, or 15 ␮l template in
3 U MnlI, according to the suppliers’ recommendations.
After separation on a 10% PAA gel containing 0.5 ×
TBE at 15 V/cm, the restriction profiles were visualized
 Tourette Syndrome and Norepinephrine Transporter 161

by silver staining. Allele frequency and genotype dis- vealed no significant differences between both diagnos-
tribution comparisons between patients with Tourette tic groups. This indicates that the presence or absence
syndrome and controls were carried out using Fisher’s of NET genetic variants is not causally related to To-
exact test. urette syndrome.

RESULTS
Systematic screening for nucleotide variation in pa-
tients with Tourette syndrome (TS) and controls re-
vealed 12 sequence variants (Table II). No mutation of
likely functional significance was found in our sample
that distinguished TS patients from healthy controls.
Four missense variants were detected. A C→T substi-
tution at nt 296 resulted in Thr99Ile, and a G→A tran-
sition at nt position 205 led to Val69Ile exchange, at nt
position 733 to Val245Ile replacement, and at nt posi-
tion 1432 to Gly478Ser exchange. One band-shift indi-
cating DNA sequence variation was detected among TS
patients but not among controls. Sequence analysis re-
vealed a silent G→A substitution at nt position 1779
(Thr593). Two further silent mutations, 955T/C
(Leu319) and 1287G/A (Thr429), and five mutations in
flanking intron sequences (introns 5, 7, 9, 11, and 13)
were found among TS probands as well as among con-
trols.
Allele frequencies for the 12 polymorphisms ob-
served in the screening sample of TS patients and con-
trols are given in Table II. Thr99Ile was found in both
TS patients and controls, with an allele frequency of
1.2% and 2.2%, respectively. Val69Ile, Val245Ile, and
Gly478Ser showed a low allele frequency of 1.1% and
were observed only among control probands. The rare
silent 1287G/A substitution (Thr593) was found in 2 TS
patients heterozyous for the mutation. Genotype dis-
tribution (data not shown) and allele frequency re-
DISCUSSION
The norepinephrine transporter gene (NET) has to
be considered a candidate gene for Tourette syndrome
because several lines of evidence point to the involve-
ment of norepinephrine mechanisms in TS [Chappell et
al., 1994; Leckman et al., 1995]. Increased norepineph-
rine levels as well as the effectiveness of the central
␣2-agonist clonidine indicated that genetic variants of
the NET leading to reduced norepinephrine turnover
may be involved in the pathogenesis of Tourette syn-
drome. In the current study, we have presented data to
exclude the involvement of the coding region of the hu-
man NET and adjacent exon-intron boundaries as a
major susceptibility locus for TS.
Among TS patients and controls, 12 single base-pair
nucleotide sequence variants were detected. The amino
acid (aa) substitutions Val69Ile, Thr99Ile, Val245Ile,
and Gly478Ser are located at putative transmembrane
domains (TMDs) 1, 2, 4, and 10. As discussed previ-
ously [Stöber et al., 1996], Val69Ile is localized at a
highly conserved region of TMD 1 and is adjacent to a
conserved asparagine acid (Asp75) which seems to play
a key role in determining substrate uptake. Thr99Ile is
located in the fifth position of a 22-aa-spanning puta-
tive leucine-zipper in TMD 2. Since the Thr99Ile vari-
ant changes aa polarity from hydrophobic to hydro-
philic, it may alter leucine-zipper function and thereby
affect assembling stability during activation or stabil-
ity of transporter complexes during folding or insertion

TABLE II. Characterization of DNA Sequence Variants in the Human NET and Allele Frequency of Variants in Patients With
Tourette Syndrome and Controls
Allele frequency (%)
TS patients Controls
Exon/intron Location Sequence change Protein variant Primer Allele (n ⳱ 86) (n ⳱ 92) P value
Exon 1 205 G→A Val69Ile 15-F/15-MR A1 0.0 1.1
A2 100.0 98.9 1.00
Exon 2 296 C→T Thr99Ile 1-MF/1-R B1 1.2 2.2
B2 98.8 97.8 1.00
Exon 4 733 G→A Val245Ile 3-F/3-MR C1 0.0 1.1
C2 100.0 98.9 1.00
Intron 5 918 + 11 A→G 4-F/4-R D1 4.7 5.4
D2 45.3 94.6 1.00
Exon 6 955 T→C 5-F/5-R E1 1.2 3.3
E2 98.8 96.7 0.62
Intron 7 1148 − 13 C→A 7-MF/7-R F1 37.2 40.2
F2 62.8 59.8 0.76
Exon 9 1287 G→A 8-F/8-R G1 27.9 34.8
G2 72.1 65.2 0.34
Intron 9 1389 + 9 G→A 8-F/8-R I1 27.9 34.8
I2 72.1 65.2 0.34
Exon 10 1432 G→A Gly478Ser 9-F/9-R J1 0.0 1.1
J2 100.0 98.9 1.00
Intron 11 1590 + 23 T→C 10-F/10-MR K1 24.4 21.7
K2 75.6 78.3 0.72
Exon 13 1779 G→A 12-MF/12-R L1 1.2 0.0
L2 98.8 100.0 1.00
Intron 13 1830 + 66 T→C 12-F/12-R M1 32.6 35.9
M2 67.4 64.1 0.75
162 Stöber et al.
processes. Val245Ile is located in a nonconserved re-
gion of TMD4, whereas Gly478Ser occurs at a highly
conserved generic residue and introduces a second ser-
ine residue at the extracellular side of TMD 10. Serine
residues are thought to act as hydrogen bond donors for
interaction with substrates, and thus, Gly478Ser may
be involved in dynamically regulated functions of the
NET. The three silent mutations are likely to be with-
out functional consequences on transporter function,
since they should not introduce aberrant splice sites
according to their Senapathy score; similarly, the five
intron variants do not affect known splice sites [Sha-
piro and Senapathy, 1987].
We failed to reveal any significant association of the
missense substitutions with Tourette syndrome.
Thr99Ile was observed with a low, but equal allele fre-
quency among TS patients and controls, whereas
Val69Ile, Val245Ile, and Gly478Ser were observed at a
low allele frequency of 1.1% among controls. Genotype
and allele frequency statistics indicate that the NET
gene displays no common genetically determined struc-
tural variants associated with TS. A silent 1287G/A
substitution (Thr593) was lacking among controls, but
appeared to show an equivocal allelic frequency among
TS patients, schizophrenics, and bipolars [Stöber et al.,
1996]. Furthermore, a rare missense mutation
(Val449Ile) was detected in a single schizophrenic pa-
tient [Stöber et al., 1996], but was lacking in the TS
sample.
The 12 DNA sequence variants identified in our TS
sample occurred in similar frequency in TS patients
and controls. This indicates that the increased norepi-
nephrine levels in TS as well as the therapeutic effect
of clonidine are not causally related to genetically de-
termined structural variants of the NET, but may
originate due to other molecular mechanisms, such as
NET expression or altered second-messenger path-
ways. The NET is the first monoamine transporter
which has been systematically screened for genetic
variation in patients with Tourette syndrome. Using
linkage analysis in three extended pedigrees, the do-
pamine transporter gene has also been excluded as the
causative gene in TS [Gelernter et al., 1995]. However,
linkage analysis is more susceptible to an underlying
heterogeneity than are association studies, and is
mainly designed to detect major gene effects. Genes
with a relatively small albeit significant contribution to
the disease may escape detection by a linkage ap-
proach, but might well be detected in a conventional
case-control association study [Nöthen et al., 1993].
Our sample size of 43 patients with TS would have
allowed a 90% chance of finding a mutation if the fre-
quency of the mutation had been at least 5% in the
patient sample. However, if the NET is defective in
rare cases, we may have missed such individuals. The
occurrence of phenotypic expression of NET variants
depending on maternal or paternal inheritance is im-
probable, because the NET gene is not imprinted in the
adult human brain [Stöber et al., 1996]. The focus of
the study was on the coding region of the NET gene
and, thus, mutations in regulatory sequences of the
NET such as promoter, enhancer, or silencer sequences
cannot be excluded in the etiology of TS. Since none of
the common mutations in the NET gene showed an
association with TS, a hypothetical causative variant
in the regulatory region should be in linkage equilib-
rium with the known polymorphisms. Finally, it might
be the case that we missed a mutation by relying on
SSCA as a mutation screening procedure because the
sensitivity of SSCA is not 100% [Hayashi and Yandell,
1993]. This probability has been reduced by performing
SSCA under two partly different conditions. However,
the existence of undetected variants cannot be com-
pletely excluded.
In conclusion, the coding sequence and exon-intron
boundaries of the NET gene were screened for muta-
tions related to Tourette syndrome. Our data suggest
that genetic variation of the NET does not play a major
role in the development of TS. It remains a matter for
future studies to delineate the relevance of these mis-
sense substitutions to transporter function and regula-
tion, and to investigate their possible association with
other psychiatrically relevant disorders.
ACKNOWLEDGMENTS
We thank Dr. M. Knapp for statistical analysis.
REFERENCES
Amara SG, Kuhar MJ. 1993. Neurotransmitter transporters: Recent prog-
ress. Annu Rev Neurosci 16:73–93.
American Psychiatric Association. 1994. Diagnostic and statistical manual
of mental disorders, 4th ed. Washington, DC: American Psychiatric
Press.
Brett PM, Curtis D, Robertson MM, Gurling HM. 1995. The genetic sus-
ceptibility to Gilles de la Tourette syndrome in a large multiple affected
British kindred: Linkage analysis excludes a role for the genes coding
for dopamine D1, D2, D3, D4, D5 receptors, dopamine beta hydroxy-
lase, tyrosinase, and tyrosine hydroxylase. Biol Psychiatry 37:533–540.
Brüss M, Kunz J, Lingen B, Bönisch H. 1993. Chromosomal mapping of the
human gene for the tricyclic antidepressant-sensitive noradrenaline
transporter. Hum Genet 91:278–280.
Budowle B, Chakraborty R, Giusti AM, Eisenberg AJ, Allen RC. 1991.
Analysis of the VNTR locus D1S80 by the PCR followed by high-
resolution PAGE. Am J Hum Genet 48:137–144.
Chappell P, Riddle M, Anderson G, Scahill L, Hardin M, Walker D, Cohen
D, Leckman J. 1994. Enhanced stress responsivity of Tourette syn-
drome patients undergoing lumbar puncture. Biol Psychiatry 36:35–43.
Chappell P, Leckman J, Goodman W, Bissette G, Pauls D, Anderson G,
Riddle M, Scahill L, McDougle C, Cohen D. 1996. Elevated cerebrospi-
nal fluid corticotropin-releasing factor in Tourette’s syndrome: Com-
parison to obsessive compulsive disorder and normal controls. Biol Psy-
chiatry 39:776–783.
Comings DE, Comings BG, Muhleman D, Dietz G, Shahbahrami B, Tast D,
Knell E, Kocsis P, Baumgarten R, Kovacs BW, Levy DL, Smith M,
Borison RL, Evans DD, Klein DN, MacMurray J, Tosk JM, Sverd J,
Gysin R, Flanagan SD. 1991. The dopamine D2 receptor locus as a
modifying gene in neuropsychiatric disorders. JAMA 266:1793–1800.
Comings DE, Muhlemann D, Dietz G, Dino M, LeGro R, Gade R. 1993.
Association between Tourette’s syndrome and homozygosity at the do-
pamine D3 receptor gene. Lancet 341:906.
Eapen V, Pauls DL, Robertson MM. 1993. Evidence for autosomal domi-
nant transmission in Tourette’s syndrome. United Kingdom Cohort
Study. Br J Psychiatry 162:593–596.
Fras I. (1996). Guanfacine for Tourette’s disorder. J Am Acad Child Adolesc
Psychiatry 35:3–4.
Gelernter J, Kruger S, Pakstis AJ, Pacholczyk T, Sparkes RS, Kidd KK,
Amara SG. 1993. Assignment of the norepinephrine transporter pro-
tein (NET 1) locus to chromosome 16. Genomics 18:690–692.
Gelernter J, Vandenbergh D, Kruger SD, Pauls DL, Kurlan R, Pakstis AJ,
Kidd KK, Uhl G. 1995. Dopamine transporter protein gene (SLC6A3):
 Tourette Syndrome and Norepinephrine Transporter
Primary linkage mapping and linkage studies in Tourette syndrome.
Genomics 30:459–463.
Hasstedt SJ, Leppert M, Filloux F, van de Wetering BJ, Mc Mahon WM.
1995. Intermediate inheritance of Tourette syndrome, assuming assor-
tative mating. Am J Hum Genet 57:682–689.
Hayashi K, Yandell DW. 1993. How sensitive is PCR-SSCP? Hum Mutat
2:338–346.
Hebebrand J, Nöthen MM, Lehmkuhl G, Poustka F, Schmidt M, Propping
P, Remschmidt H. 1993. Tourette’s syndrome and homozygosity for the
dopamine D3 receptor gene. Lancet 341:1483.
Hebebrand J, Klug B, Fimmers R, Seuchter SA, Wettke-Schäfer R, Deget
F, Camps A, Lisch S, Hebebrand K, von Gontard A, Lehmkuhl G,
Poustka F, Schmidt M, Baur MP, Remschmidt H. 1997a. Rates for tic
disorders and obsessive compulsive symptomatology in families of chil-
dren and adolescents with Gilles de la Tourette syndrome. J Psychiatr
Res 31:519–530.
Hebebrand J, Nöthen MM, Ziegler A, Klug B, Neidt H, Eggermann K,
Lehmkuhl G, Poustka F, Schmidt MH, Propping P, Remschmidt H.
1997b. Nonreplication of linkage disequilibrium between the dopamine
D4 receptor locus and Tourette syndrome. Am J Hum Genet 61:238–
239.
Kurlan R, Eapen V, Stern J, McDermott MP, Robertson MM. 1994. Bilineal
transmission in Tourette’s syndrome families. Neurology 44:2336–
2342.
Leckman JF, Hardin MT, Riddle MA, Stevenson J, Ort SI, Cohen DJ. 1991.
Clonidine treatment of Gilles de la Tourette’s syndrome. Arch Gen
Psychiatry 48:324–328.
Leckman JF, Pauls DC, Cohen DJ. 1995. Tic disorders. In Bloom FE,
Kupfer DJ (eds): Psychopharmacology: The Fourth Generation of Prog-
ress. New York: Raven Press, Ltd. p 1665–1674.
Lichter DG, Jackson LA. 1996. Predictors of clonidine response in Tourette
syndrome: Implications and inferences. J Child Neurol 11:93–97.
McMahon WM, van de Wetering BJ, Filloux F, Petit K, Coon H, Leppert M.
1996. Bilineal transmission and phenotypic variation of Tourette’s dis-
order in a large pedigree. J Am Acad Child Adolesc Psychiatry 35:672–
680.
Miller SA, Dykes DD, Polesky HF. 1988. A simple salting out procedure for
extracting DNA from human nucleated cells. Nucleic Acids Res 16:
1215.
Müller N. 1992. Exacerbation of tics following antidepressant therapy in a
163
case of Gilles-de-la-Tourette syndrom. Pharmacopsychiatry 25:243–
244.
Müller N, Putz A, Klages U, Hofschuster E, Straube A, Ackenheil M. 1994.
Blunted growth hormone response to clonidine in Gilles de la Tourette
syndrome. Psychoneuroendocrinology 19:335–341.
Nöthen MM, Propping P, Fimmers R. 1993. Association versus linkage
studies in psychosis genetics. J Med Genet 30:634–637.
Nöthen MM, Hebebrand J, Knapp M, Hebebrand K, Camps A, von Gontard
A, Wettke-Schäfer R, Lisch S, Cichon S, Poustka F, Schmidt M,
Lehmkuhl G, Remschmidt H, Propping P. 1994. Association analysis of
the dopamine D2 receptor gene in Tourette’s syndrome using the hap-
lotype relative risk method. Am J Med Genet 54:249–252.
Pacholczyk T, Blakely RD, Amara SG. 1991. Expression cloning of a co-
caine- and antidepressant-sensitive human noradrenaline transporter.
Nature 350:350–354.
Patel PI. 1996. Quest for the elusive genetic basis of Tourette syndrome.
Am J Hum Genet 59:980–982.
Pauls DL, Leckman JF. 1986. The inheritance of Gilles de la Tourette
syndrome and associated behaviors: Evidence for autosomal dominant
transmission. N Engl J Med 315:993–997.
Pörzgen P, Bönisch H, Brüss M. 1995. Molecular cloning and organization
of the coding region of the human norepinephrine transporter gene.
Biochem Biophys Res Commun 215:1145–1150.
Pörzgen P, Bönisch H, Brüss M. 1996. Molecular cloning and organization
of the coding region of the human norepinephrine transporter gene
(published erratum). Biochem Biophys Res Commun 227:642–643.
Robertson MM, Stern JS. 1997. The Gilles de la Tourette syndrome. Crit
Rev Neurobiol 11:1–19.
Shapiro M, Senapathy P. 1987. RNA splice junctions of different classes of
eukaryontes: Sequence statistics and fundamental implication in gene
expression. Nucleic Acids Res 15:7155–7174.
Stöber G, Nöthen MM, Pörzgen P, Brüss M, Bönisch H, Knapp M, Beck-
mann H, Propping P. 1996. Systematic search for vatiation in the hu-
man norepinephrine transporter gene: Identification of five naturally
occurring missense mutations and study of association with major psy-
chiatric disorders. Am J Med Genet 67:523–532.
Walkup JT, LaBuda MC, Singer HS, Brown J, Riddle MA, Hurko O. 1996.
Family study and segregation analysis of Tourette syndrome: Evidence
for a mixed model of inheritance. Am J Hum Genet 59:684–693.