SCIENTIFIC METHOD

Second Law of thermodynamics: entropy ( = chaos) can only increase over time.
There is no order or organization in the universe

Living organisms don’t follow this law, thanks to a flow of energy in their body, called chemical energy
that makes them able to maintain an organization and reproduce themselves

Living organisms can be divided into: - autotrophic organisms: plants

- heterotrophic organisms: humans or animals

Autotrophic organisms are able to create their food by converting some chemicals using solar energy
Heterotrophic organisms are not able to create their own food. They get energy from outside the system
and it’s called

Humans get the energy through food carbohydrates are broken into glucose that produces energy

Food can sometimes be a way to manage the emotions in this case, some eating disorders occur
Eating disorders are the manifestations of fear and insecurities
Psychologists investigate the reasons of these disorders

Science = form of human knowledge characterized by a method that has rigor and objectivity

Science can be divided into mathematical, physical, and human sciences.

Mathematic and Physical sciences use the techniques to build scientific knowledge
Human sciences use the scientific method

The scientific method has some characteristics: - all researchers should be able to get the same outcome
- it should have procedures
- results must proven
6 basic steps:
1. Observation
2. definition of the problem
3. hypothesis of solution
4. verification or refutation
5. conclusion or theory they can be absolute (= no further discussion) or immutable (=can be reviewed)
6. communication

EXAMPLE:
Griffith made an experiment about the morphology of Pneumococci colonies to find the vaccine
He used two bacteria: Strain R (non-virulent) and Strain S (virulent)
His experiment was divided into 4 steps:
1. He injected living S strain into some mice, that died he proved that the Strain was the cause of death
2. He injected living R strain into some mice, that survived the immune system destroyed them
3. Hecan
Living organisms injected the dead
be divided into:S- strain into some
autotrophic mice, that
organisms: survived
plants
 - heterotrophic organisms: humans or animals

Autotrophic organisms are able to create their food by converting some chemicals using solar energy
Heterotrophic organisms are not able to create their own food. They get energy from outside the system
and it’s called

Humans get the energy through food carbohydrates are broken into glucose that produces energy

Food can sometimes be a way to manage the emotions in this case, some eating disorders occur
Eating disorders are the manifestations of fear and insecurities
Psychologists investigate the reasons of these disorders

Science = form of human knowledge characterized by a method that has rigor and objectivity

Science can be divided into mathematical, physical, and human sciences.

Mathematic and Physical sciences use the techniques to build scientific knowledge
Human sciences use the scientific method

The scientific method has some characteristics: - all researchers should be able to get the same outcome
- it should have procedures
- results must proven
6 basic steps:
1. Observation
2. definition of the problem
3. hypothesis of solution
4. verification or refutation
5. conclusion or theory they can be absolute (= no further discussion) or immutable (=can be reviewed)
6. communication

EXAMPLE:
Griffith made an experiment about the morphology of Pneumococci colonies to find the vaccine
He used two bacteria: Strain R (non-virulent) and Strain S (virulent)
His experiment was divided into 4 steps:
1. He injected living S strain into some mice, that died he proved that the Strain was the cause of death
2. He injected living R strain into some mice, that survived the immune system destroyed them
3. He injected the dead S strain into some mice, that survived
4. He injected both dead S stain and living R strain into some mice, that died bacterial infection

1943: Avery, MacLeod and McCarthy found out that the molecule responsible for genetic transmission was
the DNA, and not proteins, like others thought

Proteins were made up of 20 ammino acids, both in the nucleus and the cytoplasm.
Proteins have several functions

DNA is only in the nucleus of the cell and it’s made up of 4 Nitrogenous bases that repeat themselves
throughout the sequence
Avery and colleagues made an experiment to demonstrate the genetic transmission through DNA.
They did a cellular extraction and put RNA, proteins, and DNA into different tubes with the extracted cells
and with S strain bacteria.
After 24 hours, they saw that only in the tube with DNA, the S stain bacteria became an R stain bacteria

NUCLEIC ACIDS
= polymers specialized for storage, transmission and use of genetic information between generations

DNA and RNA are nucleic acids, and they are capable of coding and transmitting biological information

The genetic information is the genotype of the organism

Phenotype= genotype + environment it is the sum of the genetic characteristics and the interactions that
an individual has with the environment (es. emotions, experiences…)
Es. skin color it depends on my genotype but also on the sunlight

The environment influences the phenotype starting from the conception nutritional factors for example

DNA and RNA are wo nucleic acids, and they are polymers. Their monomers are called nucleotides
Nucleotides are composed by a nitrogenous base (purine/pyrimidine) + a molecule of
sugar (ribose/deoxyribose) + phosphate group it has a negative charge
Since the phosphate group has a negative charge, the nucleotides are negatively charged
Deoxyribose contains only a hydroxyl group, while ribose has two of them

Nucleotides are all connected to each other through the connection between the hydroxyl group of sugar
and the phosphate group. The connection is possible thanks to a phosphodiester bond, which is a covalent
linkage
The nitrogenous baes are connected to the sugar

RIBONUCLEIC ACID (RNA):

- it’s one of the macromolecules of life
- it’s just in some virus (es. corona virus)
- it has a negative charge because the phosphate group is negatively charged

Monomers= nucleotides: Ribonucleotides

Sugar: ribose two hydroxyl groups
Nitrogenous bases Purines: Adenine and Guanine
Pyrimidines: Cytosine and Uracil
RNA is produced in the nucleus, by transcription, but then it’s transferred in the cytoplasm, where the
translation happens

FUNCTIONS:
Translation / protein synthesis the genetic info in RNA is transferred to proteins

There are 3 types of RNA: - mRna (messenger-RNA) = copy of one strand of DNA
-tRna (transfer-RNA) transportation of amino acids
small non-coding RNAs
- rRna (ribosomal RNA) costitute the ribosoma

Only mRNA contains the info for the synthesis of proteins

All 3 RNAs are used during translation
Francis Crick formulated a theory, called “The central Dogma of molecular biology”, which describes the
process by which the information in genes flows into proteins.

DNA is transcribed RNA is produced and translated  proteins are produced

Proteins are the result of the abstraction of a gene

Cells transcript and translate only some genes. Not all of them
The flow of information is irreversible (= it can’t go the opposite direction)

Some viruses, called retroviruses, that contain RNA, can actually do the opposite process.
When these viruses get into the cells, they transfer the information contained into RNA in DNA, using a
process called Reverse-transcription this is also described in “The central Dogma”

DEOXYRIBONUCLEIC ACID (DNA):

- it’s one of the macromolecules of life (DNA, RNA and proteins)
- it’s in most of living organisms
- it has a negative charge because the phosphate group is negatively charged

Monomers = nucleotides: Deoxyribonucleotides

Sugar: deoxyribose one hydroxyl group PRINCIPLE OF COMPLEMENTARY BASES:
Nitrogenous bases Purines: Adenine and Guanine Adenine pairs up with Thymine. Cytosine with Guanine,
Pyrimidines: Cytosine and Thymine through hydrogen bonds. Cytosine and Guanine’s bonds
are stronger than Adenine and Thymine’s
Adenine and Thymine are connected by 2 Hydrogen bonds,
Guanine and Cytosine are connected by 3 Hydrogen bonds they are stronger
In 1940, scientists didn’t think that DNA contained the general information, because they thought that it
was made by only 4 nucleotides arranged randomly. In fact, they thought that proteins had the genetic
information
After a lot of studies, they found out that the nucleotides are arranged in a specific way and with a precise
meaning and function

Each DNA molecule is compacted into a chromosome

The entire set of chromosomes constitutes the genome (= complete set of genetic info)
The human genome is made of 46 chromosomes that contains about 3 billion nucleotides per cell
 The amount of DNA is not related to the complexity of the organism

FUNCTIONS:
DNA has 2 functions:
- Replication mechanism that duplicates DNA, so that when the cell divides, the amount of
DNA in the cells stays the same

Mitosis = Meiosis =
cellular division mechanism of cellular division mechanism of
somatic cells germinal/sexual cells. It produces gametes
- Transcription process to produce RNA. The genetic info is transferred to it ( vd. Pagine dopo)

Genes are the part of DNA that produce proteins, but all the other parts of DNA don’t do it. For example,
the ending part of chromosomes preserves the genetic information

STRUCTURE:
DNA has a double helix structure formed by 2 wrapped antiparallel strands one strand goes from 3 prime
to 5 prime, while the other
one goes from 5 prime to 3
The backbone (= structure made by the 2 strands) is made of deoxyribose and phosphate.
The segments in the middle of the double helix are made of nitrogenous bases
The two strands are called chromatids during mitosis/meiosis, they compose a chromosome
because they pair up and assume the shape of an X
chromatid
The diameter of DNA is about 20 armstrong
centromere Chromosome
One filament of DNA is about 2m
chromatid

In the cells, there is Nuclear DNA, which is the one contained by the nucleus, but a small molecule of DNA is
also contained by the Mitochondrial, and it’s called Mitochondrial DNA

In the nucleus, DNA takes the form of chromatin, that is made by Nucleosomes, connected by Linker DNA
Nucleosomes = structure made of a core which contains 4 different histones (=positive proteins) (H2A, H2B,
H3, H4). Around this core there is a helix of DNA that is surrounded by another histone (H1)

histones and DNA interact with each other because they have opposite charges

During the replication, chromatin becomes more tightly coiled and it assumes the form of metaphasic
chromosomes, that contain two strands of DNA and so double genetic information

In the nucleus, DNA takes the form of chromatin, while, during DNA replication, it
takes the form of chromosomes, because chromatin condenses into chromosomes

In the Karyokinesis, Mitosis generates two nuclei that contain the same genetic information. The same
number of chromosomes as the mother is produced.
Before mitosis, the DNA molecules have the form of chromatin with two sister chromatids
In mitosis, the two sister chromatids split up and each one binds with another chromatid, and two
homologous chromosomes are formed.
At the end, there are 46 chromosomes and 92 pairs of sister chromatids

Human genome consists of 22 pairs of homologous chromosomes and 2 sex chromosomes (XY in male and
XX in female). One of the chromosomes of the homologous pair is derived from the father and the other
from the mother.
Homologous chromosomes contain the same genes and in the same position, but the shape of the genes
can be different

Replication/ synthesis of DNA:

= process in which the genetic info of DNA is copied and two strands, identical to the parent strands, are
created
DNA needs to be copied before the cell division, so that each new cell receives a full set of extraction. It’s
important that, when a cell divides, the genetic info is duplicated, because the genetic info is then
transformed into proteins. Proteins are important because they are responsible for the synthesis and the
transportation of all the other molecules in our body and they regulate the metabolism

Synthesis/ S phase = DNA replication phase  it comes before mitosis/meiosis, during the Interphase

Scientists proposed 3 models to describe molecular mechanisms of DNA replication

1. Semi conservative replication the two original DNA strands are complementary and so have the same
genetic info. When they separate, each strand is used as template for a
new DNA strand. After replication, the 2 double helixes contain one
parent strand (= the original one) and one Neo-synthesis DNA strand,
that are identical to the initial double helix
2. Conservative replication
3. Dispersive replication
DNA takes the form of chromatin, but, before DNA replication, chromatin condenses into chromosomes.
Each chromosome is made up of a single DNA molecule, containing millions of nucleotide pairs, which need
to be replicated.

HOW:
The DNA replication starts in the Replication Origin. Here, the DNA helix is opened up by an enzyme and
the Replication Forks are formed
There are multiple forks, since replication can occur simultaneously in different places
DNA Helicase in the enzyme that breaks the Hydrogen Bond between the Nitrogenous bases and so the
one that divides the two strands
Single Strand Binding Protein is the enzyme that prevents the two strands from coming back together

Topoisomerase (ex. DNA Lingase) is the enzyme that prevents the DNA from getting too stressed

Primase is the enzyme that produces Primers = short nucleic acid sequence

DNA Polymerase is the enzyme that adds the primers to the new DNA strand it can only make DNA from
5 Prime to 3 Prime direction

Since the helix is antiparallel, two different strands are made:

- Leading Strand: made continuously and it’s extended by one primer
- Lagging Strand: made of Okazaki fragments and it needs a new primer for each fragment

DNA Lingase is the enzyme that creates Phosphodiester Linkages, which link the Okazaki fragments

DNA gyrase is an enzyme that prevents the DNA’s double helix from getting too stressed

When the replication is completed, the primer is removed

DNA is able to check the new DNA strand and remove the possible mistakes the new strand must be the
exact copy
It’s important that DNA replication is accurate because it leads to the production of proteins and they
compose the majority of cellular structure
When there are mistakes in the replication of DNA, genetic diseases occur

GENETIC DISEASES
= mutation in genetic material
Mutations can be point mutation: change of one nucleotide
 point mutation: change of the sequence of a gene
 chromosome mutation: change of entire chromosome segments

These DNA diseases happen during the replication  they are rare tho
These diseases can be inherited
Neutral lipids are stored in the lipid droplets. They have a core made of neutral lipids, surrounded by a
phospholipid monolayer, to which some proteins bind.
Cells store lipids during starvation, to produce energyTriglycerides are the main resource of energy
When the cells need energy, the triglycerides (3 fatty acid + 1 glycerol) are broken down by the proteins.
Neutral lipid storage diseases= genetic diseases in which one or more proteins are mutated and so there
is an abnormal storage of neutral lipids that leads to an increase of
lipid droplets

In the patient’s cell there is an

abnormal amount of lipid droplets.
It can lead to diabetes

The study of rare genetic disorders can help researchers to understand the functions of proteins

Psychologists help the family of people affected by rare genetic diseases to accept life and move on.

GENES:
= linear sequence of nucleotides along the DNA that carry the phenotype and codes proteins
Human genome has around 20000 genes

Genes are made of fragments that have different functions.

1. Promoter = the site where the transcription starts
To code= to go from genetic
2. Coding region: it contains the info necessary for the synthesis of proteins material to proteins

The segment is divided into:

1. Start codon/triplet code = sequence of 3 nucleotides: ATG in DNA and AUG in RNA
2. Exons and Introns Exons = DNA sequences which contain the info for the proteins’ synthesis
Introns = DNA sequences which separate exons.
Not used for translation (=protein coding)
When the translation begins, the introns are eliminated from the RNA
3. Stop codon = sequence of 3 nucleotides. TGA in DNA and UGA in RNA

The genetic code allows us to write 20 amino acids with an alphabet of only 4 letters (AGTU)
TGA in DNA and UGA in RNA
GENE’S EXPRESSION:
= process by which DNA is converted into a protein

DNA’s decoding happens through 2 processes:

- Transcription= DNA RNA = from a nucleotide sequence to another nucleotide sequence. The info is the
same and the nature of info doesn't change either

- Translation = RNAProtein = from the nucleotide sequence to amino acids sequence. The info is the
same, but the nature of info changes, because RNA is composed of
nucleotides, while proteins contain amino acids sequences

Transcription:
= process in which DNA is transcribed into RNA
Three different types of RNAs are produced: rRNA, tRNA and mRNA (mRNA is the only one with the genetic info)
It takes place inside the cell’s nucleus

HOW:
RNA polymerase is the enzyme that recognizes the promoter of the gene and knows when to start the
transcription and how many mRNAs have to be produced.
The RNA polymerase copies the info in the DNA to the RNA
ONLY ONE of the two strands in transcribed. The strand transcribed is called “sense strand”.

As soon as the first transcription ends, the second one starts, and so on.

After transcription, mRNA contains the entire sequence of the gene (exons and in introns)
Before transferring the mRNA from the nucleus to the cytoplasm, the introns, that are useless for the
protein coding, are removed by a process called “Splicing”.
Translation/ protein synthesis:
= process in which proteins are created
After the introns are removed, the mRNA and all the others RNAs are transported to the cytoplasm, where
the protein synthesis starts. Only mRNA contains the info for the synthesis of proteins

The main components of the Protein synthesis are mRNA, Ribosomes and tRNA:

 mRNA:
The mRNA transforms the nucleotide sequence into an amino acid sequence, called polypeptide. This
process is called Genetic code

The genetic code has 3 main characteristics:

- it’s universal  = the codons code the same amino acids in all organisms
  expect for the mitochondria
- it’s redundant = some amino acids can be coded by more than one codon
- it’s continuous = each nucleotide belongs to a triplet, which follow each other without interruption

There are 20 different amino acids in the cytoplasm of our cell and there are 64 possible codons

61 different codons code 20 amino acids, while 3 triplets (UGA, UAA and UGA) are stop codons and they
don’t correspond to any amino acid

There is just 1 start codon (AUG), but there are 3 stop codons (UAA, UAG, UGA) they only signal the
end of translation
The 64 codons:

The human body uses amino acids to make proteins in order to perform a lot of body functions. So, amino
acids can be used as a source of energy by the body

Amino acids are classified into 2 groups: - essentials they must come from food
- nonessential our body produces them even if we don’t get
them from the food

Tryptophan is an example of essential amino acid it’s found in food with a lot of proteins
 it’s important for the production of serotonin

= neurotransmitter for cognitive functions (ex. Learning, mood…)

Reduction of Tryptophan leads to a worsening of the mood and social skills
 Ribosomes:
= molecules made of rRNA and ribosomal proteins they are contained in the nucleus
They consist of 2 subunits large: it contains 3 different rRNAs & 49 ribosomal proteins
It has a site in which tRNAs bind
 small (40s): it contains 1 rRNA & 33 ribosomal proteins
It has a site in which mRNAs bind
Each subunit contains different types of rRNA and ribosomal proteins
rRNA are transcribed in the nucleus, in the site called nucleolus. After the transcription, rRNA is
brought to the cytoplasm, where it assembles with the proteins and create the two unites of the
ribosomes. These two units join when the translation begins
 tRNA:
it’s contained in the nucleus
It connects the mRNA codon with the corresponding amino acid for each amino acid, there is at
 least one tRNA molecule
It carries a particular amino acid and it interacts with ribosomes
They have a 5-prime end and a 3-prime end if they are loaded, they have attached a specific
amino acid at the 3-prime end
The 3-prime end is called “Amino acid attachment site”
They have a trinucleotide sequence, called Anticodon, that recognizes a specific codon of the mRNA
molecule
The anticodon decides which nucleotide will be attached to the 3-prime end
tRNA is constituted by 80 nucleotides the anticodon allows to distinguish different tRNAs

tRNA

HOW:
Translation occurs in three steps:
1. Initiation a ribosome, mRNA and an initiator tRNA bind together single phase
2. Elongation amino acids are added, and polypeptides are created it is repeated more times
3. Termination one of the stop codons of mRNA interrupts the process single phase

INITIATION:
It occurs in the cytoplasm
Phases:
1. The ribosome’s small subunit binds to the mRNA’s binding site
2. The anticodon (UAC) of the initiatior tRNA binds to the start codon of the mRNA (AUG), also called start
codon of translation. The tRNA is loaded with the amino acid Methionine (all proteins start with this amino acid)
3. The large ribosome’s subunit binds and, with the samll one, it forms the “Functional ribosome”
This phase requires a lot of energy that comes from a molecule called GTP

The ribosome’s large subunit has an E site, A site and P site the tRNA is in the P site, while mRNA is in the A site
ELONGATION:
All the other amino acids are added to the polypeptide the process is repeated until all the amino acids
are added to the polypeptide
It’s divided into 3 steps:
1. codon recognition the anticodon of tRNA binds with the mRNA codon in the A site
2. formation of peptide bonds among all the amino acids 2 GTP molecules are used for energy
After the bonds are created the polypeptide is transferred from the tRNA in the P site to the one in the A
3. translocation the ribosome translocates the tRNA from the A site to the P site, then, the empty tRNA in
the P site is transferred to the E site, before being released by the ribosome. A new
mRNA codon is exposed to the A site and a new elongation phase starts

TERMINATION:
It starts after the stop codons (UAA, UAG or UGA) enter the A site and stop the translation.
The ribosome binds a protein called “release factor” it doesn’t carry any amino acids
 it promotes hydrolysis of the bond between the
tRNA and the polypeptide chain

In this way, polypeptide is released to the cytoplasm, while the two subunits of the ribosome, RNA, the
release factor and the last tRNA separate from each other
EXERCISE ON THE PRINCIPLE OF COMPLEMENTARY BASIS:
One strand of genomic DNA contains the following sequence reading from 5’ end to 3’:
5’ CGGTAGTGGTGAAACCGTGACGGTAGGGTAGCTTA 3’

1. What is the sequence of basis in the complementary strand of DNA?

3’ GCCATCACCACTTTGGCACTGCCATCCCATCGAAT 5’
(because Cytosine pairs with Guanine and Tamine pairs with Thymine)

2. What is the sequence of basis in the mRNA transcripted from strand b of DNA from 5’ to 3’?
5’ CGGUAGUGGUGAAACCGUGACGGUAGGGUAGCUUA 3’
(because RNA has Uracil instead of Thymine)

3. There is a start codon in the above mRNA? NO What is the amino sequence coded by this mRNA?
5’ CGG UAG UGG UGA AAC CGU GAC GGU AGG GUA GCU UA 3’
Arg Stop  the rest is not coded, because UAG is a sop codon
(firstly, we divide RNA in triplets and then wee see which amino acid they code, using the table below)

PROTEINS
= macromolecules that are the product of gene expression
They are polymers and their monomers are the amino acids there are 20 amino acids
Proteins participate in almost all processes inside and outside cells different proteins have different
functions
Their functions made them the most important macromolecules of the cells

They result in the phenotype of the individual that’s why it’s important for psychologists to know them
In humans, there are thousands of different proteins
Each protein has its own function and structure, but all proteins are composed by the same 20 amino acids

The difference among proteins is due to the fact that amino acids are arranged differently in each protein

Some proteins are made of thousands amino acids, while others are simpler and are made of less of them

Amino acids are made of: - 1 Amino group

- 1 Side group it’s different in each amino acid
- 1 Carboxyl group it forms the backbone of the protein
The side group characterizes the amino acids

The side group defines the chemical characteristics of the amino acids ex. The reaction to water

Leucine and Serine are two

different amino acids. It can
be seen through their side
groups, that are different

Amino acids are connected through a condensation reaction, that happens during the Elongation phase of
the translation. Through this reaction, Peptide bonds are created

= bond between the Carboxyl group of the first amino acid and the Amine group of the second one

After the condensation reaction, a molecule of H2O is released

Each protein has its own amino acid sequence. The difference sequences of amino acids are not random,
but they follow a specific design, that is written in the DNA.
Therefore, our genes define the sequence of amino acids in our proteins

Primary structure = sequence of amino acids in a polypeptide chain held together by the peptide bond
The change of just one amino acid can modify the function and the structure of an entire protein and it can
lead to some diseases.

Ex. Sickle-cell anemia is the result of the replacement of only one amino acid with another one in the
hemoglobin molecule.

Proteins have a primary, secondary, tertiary, and quaternary structure

There are 2 types of secondary structure alpha helix: involved with the reception
 beta pleated sheet: involved in the interaction with other
Molecules or protein

When these two secondary structures interact, they form the tertiary structure, that is the most important
one, because it determines the function of a protein

The mutation of a single amino acid in the primary structure CAN determine the change of tertiary
structures. It doesn’t always happen, but only when certain amino acids are changed.

Proteins are made of domains, that are involved in specific activities

Some domains contain the catalytic site, that is where the function of the protein takes place. If one amino
acid in the catalytic site changes, then the function changes too.

Only some proteins have a quaternary structure = spatial relationship between two or more
polypeptides

A polypeptide chain spontaneously arranges itself into a three-dimensional shape. The structure is
stabilized by interactions among the R group of the amino acids

Denaturation= alteration of a protein’s physiological characteristics (ex. pH, temperature…)

The structure of the proteins determines their functions and, for this reason, scientists try to generate the
three-dimensional structure of the proteins, in order to study their functions. To generate it, they use the X-
ray crystallography
 28 Ottobre 2020
THE CELL
The cell is the fundamental unit of structure, function, and reproduction of all living organisms

The term “cell” was first used by Hooke in the 1700, when, thanks to the primitive microscope, he was able
to see the cell walls

In the 19th century, new compound microscopes were invented, with advanced optical design.
Thanks to this microscope, scientists discovered that cells are composed by a nucleus and the cytoplasm

Plants have cells walls and so it easier to see that they are made of cells. Whereas animals don’t have cell
walls and so it took a while before scientists understood that they are made of cells too

Schleiden and Schwann studied both cells and animals and formulated the theory that cells are the basic
unit of both plants and animals.
Schleiden thought that cells are created by the nucleus
Schwann thought that cells crystallized from the material between other cells

Virchow stated that all cells are generated by pre-existing cells. Therefore, cells are unable to rise without
other cells the cells is therefore the fundamental unit of the reproduction of organisms
His idea helped to establish the idea of “cellular pathology” = changes of normal cells cause diseases

All these studies heled to formulate the cell theory

CELL THEORY 1st principle: all organisms are made of one or more cells
 2nd principle: all live functions of organism occur within cells
 3rd principle: cells come from other pre-existing cells

A cell must have all the characteristics of a living system = it must live and generate other organisms with
the same genetic characteristics
Viruses are unable to reproduce themselves they need the molecular mechanism of other cells

Cellular studies are due to several inventions that happened in the end of the 19 th century

- Microtome: it studies small slices of tissue

- Histological staining techniques: it highlights important features of the tissue and cells
- Electron microscope: it identifies cellular structures invisible under the optical microscope
Thanks to it, cellular ultrastructure were identified

The electron microscope helped discover that Eukaryotic cells have

a much more complex structure than the Procaryotic ones

Today, several microscopes are available The phase contrast microscope is able to show living cells
 The immunofluorescence microscope shows the fibroblasts

Cell’s dimension is measured through: - the micrometer (1mm= 1000 µ)

- the nanometer (1 µm = 1nm)
- the angstrom (1 millimicron = 1 Å)

All cells are organized in tissues organs and systems

Cells that are close communicate with each other through junction systems Tight junctions
 Desmosomes
 Gap junctions
Tight junctions:
- They prevent the dehydration, avoiding the loss of substances
- The plasma membranes of adjacent cells are fused together

Desmosomes:
- They provide strong adhesion between neighboring cells
- They are made of intermediate filaments, that are composed by keratin the filaments provide strong
adhesion

Gap Junctions:
- They allow communication between cells and enable the trade of substances
- They are made of channel proteins
There are 2 types of cells:
- Prokaryotic cells simple structure
 less organized
 they contain DNA but not in the nucleus
 they don’t have the nucleus

- Eukaryotic cells complex cells

 they have a nucleus that contains DNA and other cellular organelles
 they have a cytoplasm that divided in two, where two different processes take place

TREE OF LIFE

These species have the same common ancestor but then they evolved in different ways

BACTERIA:
- it goes from a few hundred milli micrometers to a few micrometers
- they have a high variety of shape their shape is what classify them
- all bacteria have the same basic structure
STRUCTURE:
Cell wall: it supports the cell and determines its shape
Plasma membrane: it separates the interiors from the external
environment and it regulates the trade
of materials
Cytoplasm: contains the material. It has a region, called Nucleoid,
in which the DNA is contained
Mesosomes: they break down food to produce energy

Some bacteria also have:

Capsulse: it avoids that other cells attack the bacteria
Flagella: contributes to the movement of cells
Pili: used to identify food or dangerous changes
EUKARYOTIC CELLS:
Each structure has a fundamental role in the life of the cell Structure:
- ECM - Nucleus
Structure: - Plasma Membrane - Cytoplasm
Extracellular Cellular Matrix (ECM): - Cytoskeleton
It consists of proteins produced by the cell itself
It can influence the activity of the genes and vice versa
3 main proteins: 1. Collagen it is a fibrous protein that forms fibers outside the cell
2. Fibronectin it binds to collagen and to integrins
3. Integrin they perform receptor activities. They are partially inserted into Glycoproteins
the cell membrane. A part binds to the cytoskeleton, while
another one binds to the fibronectin
They communicate the changes in the ECM to the Cytoskeleton

Plasma Membrane
It separates the cytoplasm from the extracellular environment

Functions it provides mechanical support to the cell

 it regulates what can enter or exit the cell
 it allows the interaction between cells
 it generates and distributes signals

It contains receptors, that pick up external signals and allow the cell to change its behavior in response to them

Ex. neurotransmitter receptors in neurons they regulate a lot of functions

In order to transmit signals, neurons communicate with one another, thanks to the synaptic cleft.
The neurotransmitters cross this synaptic cleft and go from one neuron to the other.
When they arrive in a neuron, they bind with a specific receptor and an excitatory signal is produced

Fluid mosaic model:  because the membrane is fluid

The membrane is mainly composed by lipids, proteins are carbohydrates

Lipids:
There are 2 types of lipids Phospholipids: they form a bilayer in which the heads face
outwards and the tail face inward
 Cholesterol: it is located in the internal layer and it determines
the fluidity of the membrane
Proteins:
There are 2 types of proteins Integral membrane proteins: they are placed in the phospholipidic layer
 extrinsic membrane proteins: they are exposed out of the membrane
They allow the membrane to receive/ send messages and to transport substances in and out. In ther words,
they allow the membrane to do its job
They determine to which substances the membrane is permeable
Carbohydrates:
They are on the outside surface of the cell
They can bind both to proteins and to lipids
They are made of monosaccharides chains, that can be straight or branched
They have important roles: 1. Recognize specific substances and allow cells to receive messages
2. Recognize other cells
3. Detect chemical changes in the environment

Alzheimer is a progressive disease caused by a disorder of the plasma membrane.

People who suffer from Alzheimer have an accumulation in the plasma membrane of some specific
proteins, called beta-amyloid. An unknown process causes the division of these proteins into small
fragments. When these fragments come together, they have toxic effect of neurons, that interrupt the
communication among cells, that then die.
It causes progressive memory loss, since the cells that die are the ones in the section of the brain that
controls memory.
It is caused by genetic, environmental and lifestyle factors.

Nucleus
It’s surrounded by cytoplasmic organelles

Functions it is responsible for storage and transfer of genetic materials

 it helps in the process of transcription
 it controls the activity of all cell organelles

It is constituted by Nuclear envelope: it consists in an inner and an outer membrane

 Nuclear Pores: = protein complex that regulate the transportation of molecules
between the nucleus and outside
 Nucleoplasm it includes Heterochromatin (where RNA is transcripted), Euchromatin
(where DNA is replicated) and the nucleus
 Nucleolus it transcripts rRNA

Cytoplasm
The main components are organelles and or Cytosol
Organelles:
- Mitochondria they have an outer and inner membrane which contain mitochondrial that
has some enzymes, DNA and RNA
 their main function is to do the “cellular respiration” (= to produce ATP).
If there is a problem with it, some diseases occur
 we inherit it only from our mother
 they are generated after the fusion of a crista

- Endoplasmic reticulum here are 2 types: Rough (RER) and Smooth (SER)
RER: it has ribosomes and it’s involved in the synthesis of proteins
 SER doesn’t have ribosomes is the site for the production of some
lipids and for the modification of exogenous molecules. It’s involved in the
lipid synthesis and detoxification reaction
- Golgi apparatus it’s a flat membranous sac (cisternae), surrounded by tubules and vesicles
 it involved in the reception and distribution of proteins and lipids

- Lysosomes They do the process of autophagy, that recycles cellular constituents and allows
the cell to regenerate
 Primary Lysosomes: - they are surrounded by a single membrane
- they contain a lot of enzymes
- when it fuses with the membrane, it forms the secondary
 Secondary Lysosomes: - site where the cellular digestion of particles occurs
- Peroxisomes they have a single membrane containing lytic enzymes and two specialized
enzymes called Peroxidase and Catalase
 they are responsible for the Oxidation reaction, that produce Hydrogen
Peroxide. It is then decomposed by the Peroxidase and Catalase by using it
to oxidase another organic compound
 Functions: - they use the oxygen to break down fatty acids
- they detoxify the alcohol and other harmful compounds

- Lipids droplets they are made by a layer of phospholipids that surround an interior, in which
neutral lipids are contained (ex. triglycerides)
 they also contain proteins that perform several functions
 they are generated in the smooth endoplasmic reticulum

When the body needs a lot of energy, the fatty acids are esterified with the glycerol and the
triglycerides are formed (they are the main source of energy).
When the amount of neutral lipids increases, the reticulum swells and forms lipid droplets
Cytoskeleton
Functions: - it provides mechanical support to the cell, preserving its shape
- it holds he cell organelles in position
- it is involved in the movements of many cells
It can be quickly dismantled and reassembled in a new assembly, to allow cells ‘movements
In muscles cells, in consists in filaments. When they interact, the muscle contracts
It contracts to allow the vesicles to move thy transport neurotransmitters
It also allows the transportation of damaged components from neurons to cell

It has 3 main components:

- Microtubules and centrioles
- Microfilaments They all contain proteins
- Intermediate filaments

Microtubules Functions: - they support the cell and determine its shape
- they allow the vesicles to move
- they form the mitotic spindle, that allows the division of the chromosome
during the cell division
Centrioles they consist in 9 Microtubules’ triplets
 they organize the mitotic spindle

Microfilaments Functions: - they support the cell and determine its shape
- they help the cells to move
 There are 2 types: 1. Myosin filaments
2. Actin filaments

Intermediate filaments There are various types of them, that are made up of different proteins
 They support the shape of the cell and anchor some organelles in the right place
CELLS’ CYCLE:
Each cell has a cell cycle divided into two phases:
1. Interphase
2. Cell Division mitosis (somatic cells)
 meiosis (sexual cells)

INTERPHASE:
It has 3 subphases :
1. Gap 1 (G1) the cell produces cytoplasmic structures and starts the synthesizes some proteins
2. DNA synthesis/ S phase DNA is replicated, and histones and other proteins are synthesized
3. GAP 2 (G2) other structural proteins, needed for cellular division, are synthesized

CELLULAR DIVISION:
It’s divided in two steps:
1. Karyokinesis (nucleus division): the daughter cell receives the same genetic material of the mother
2. Cytokinesis (cytoplasm division): the daughter cell receives cytosol and organelles

The cells are called Diploid Cells because, in the nucleus, the chromosomes are in pairs of homologous
In humans, the number of chromosomes is 23, and we have 2 sets of them. One from the father, and one
from the mother they are homologous (=similar, not identical)
In humans, 44 chromosomes (divided into two sets of homologous) are the non-sexual chromosomes and
they are called Autosomes. The, there are 2 sex chromosomes, called Heterosomes
Therefore, there are 2 genes that synthesize only one protein, but they do it in a different way

MITOSIS:
When a spermatozoon fertilizes an egg, a zygote is formed and it goes through mitosis, in which the chromosomes
are duplicated before the zygote is divided. The zygote repeats the process of mitosis for 5/10 days, creating an
embryo, that contains a few hundred cells. These cells are called Embryonic Stem Cells
Types of Embryonic Stem Cells : - totipotent they produce all types of cells, including placenta
and the embryo
- pluripotent they generate all cells that compose our body.
They don’t produce the placenta or the embryo
- multipotent they develop specific types of cells and generate
somatic cells. They contain the same genetic material of
all our cells
Mitosis occurs around every 30 hours it depends on the length of the G1 phase, that changes all the
time. The other subphases have the same constant length

Different cells have different division rates vs. Cell cycle control
In humans, there are 3 categories of cells:
- Liable they often proliferate (= mitosis happens frequently)
- Stable they rarely undergo through mitosis
- Permanent they don’t proliferate and are unable to divide if some cells get damaged, they can’t
substitute them

It’s in the G1 where the cells decide between proliferation or quiescence. If they choose to quiescence, they
enter the phase called G0.
Some cells can exit the G0 phase and enter the G2 phase
Permanent cells (ex. neurons) remain in G0 forever= if neurons get damaged, they will never be replaced

In the Karyokinesis, Mitosis generates two nuclei that contain the same genetic information. The same
number of chromosomes as the mother is produced.
Before mitosis, the DNA molecules have the form of chromatin with two sister chromatids
In mitosis, the two sister chromatids split up and each one binds with another chromatid, and two
homologous chromosomes are formed.
At the end, there are 46 chromosomes and 92 pairs of sister chromatids

Mitosis is composed of 4 phases:

1. Prophase The chromatin condenses and forms the chromosomes
The two pairs of centrioles separate and move to opposite ends of the nucleus, while
the microtubules form the fibers of the mitotic spindle
2. Metaphase chromosomes arrange in the mitotic spindle, lining up through the centromeres
in the metaphase plate. Proteins in the centromere constitute a structure called
“kinetochore” and they act as a molecular motor.
3. Anaphase The kinetochore hydrolysis the ATP, releasing energy that is used to separate the
chromatids and move them toward opposite poles of the cell. This happens for pair
of homologous chromosomes.
Since the two chromatids are identical and have the same genetic info, when the cell
divides, the two parts will contain the same info
4. Telophase chromatids are now less compacted and there is the formation of chromatin in the two
opposite poles. Nucleoli appear at opposite sides of the pole, while the spindle disappears.
The microtubules that formed the spindle are used to obtain tubulin monomers, that will
constitute the cytoskeleton of the daughter cells
Cytokinesis= process in which the cell divides into two daughter cells

In animals, it occurs through a process called Cleavage

A ring of filaments, made of actin and myosin, contracts and it

pinches the cell until two separated daughter cells are formed

When mitosis is finished, each somatic cell has the same amount of genetic material, contained in the 46
chromosomes. The cells, tho, have some differences, due to different gene’s expressions.

CELL CYCLE CONTROL:

Different cells have different division rates
The differences in the cell cycle are due to some proteins that are involved in the control of the cycle

There are specific points, called “Restriction points”, in which some proteins send signals of starting or
stopping the cell cycle
These Control points are located in the phase G1, G2 and Mitosis

The Restriction Point of the G1 phase is the most important one.

If a cell receives the starting signals at this point, it will most likely complete the cycle ad divide.
If the cell doesn’t receive the starting signal, it will enter the G0 phase, or quiescence phase, and it’s not
gonna go through cell division

Liver regeneration if the liver is damaged, its cells are pushed to divide and grow

G1 RESTRICTION PHASE:
Cells enter the G1 phase when specific proteins, called Cyclins (CD), bind with some enzymes, called
Kinases (CDK) and perform phosphorylation reactions
When Cyclins are produced, they send an activation signal. Then, they bind with Kinases, and activate these
enzymes.
At the end of this phase, Cyclins decline, and they deactivate the Kinases and send a stopping signal

G2 RESTRICTION PHASE:
The cell goes from G1 to G2 when Cyclin B and a Kinase form a Mitosis-Promoting factor (MPF).
First, The MPF performs the phosphorylation of the nuclear proteins that determines the fragmentation of
the nuclear envelope and the beginning of mitosis.
Then, At the end of this phase, Cyclin B degrades, while Kinases is disactivated, leading the cell to exit
mitosis

M CONTROL PHASE:(This Control point is essential because it makes sure that chromosomes are equally distributed)
At the control point of the M phase the cell can decide whether to terminate mitosis and go through the
process of programmed cell death, called Apoptosis.
This restriction point regulates the passage from Metaphase to Anaphase.
First, the Kinetochores, not yet attached to the spindle fibers, send some slowing signals, that end the
metaphase. Then, when Kinetochores attach to the spindle fibers, the slowing signal stops and the
Anaphase-Promoting Complex (APC) is activated. This complex inactivates the proteins that hold the
chromatids together.
Conditions that regulate the cells’ division/proliferation:
- Grow factors= proteins released by some cells in the body that stimulates the division of other cells

- Contact inhibition: cells divide until they fill up all the available surface. When cell come in contact with
each other, they stop dividing

- Anchorage dependence: most cells can divide only when they are anchored to the extra cellular matrix of
the tissue. Therefore, the anchorage to a surface indicated that cells are active
and ready to divide.
Cells that can’t anchor can’t either proliferate

Tumor cells= cells that don’t respond normally to cell cycle control mechanisms. They divide excessively,
meaning that they don’t present contact inhibition and they invade other tissues, because they
don’t have anchorage dependance
They are due to an alteration of genes that influence the cell cycle control system

Certain genes produce proteins that normally regulate cell growth and division.
When these are mutated in somatic cells, they lead to cancer

Tumors form when there is a transformation = process that convert a single cell to a tumor one

Our body immune system should be able to recognize tumor cells, because they produce different proteins
than the normal cells.
Sometimes, tho, tumor cells produce similar proteins to the normal ones, and our immune system is not
able to recognize the difference.
When tumor cells escape the immune system, the tumor is formed
Primary tumor= tumor made up by cells that are unable to invade other tissues
If tumor cells acquire the ability to invade other tissues, the tumor becomes a secondary tumor, and it gets
malignant. For this reason, it’s also called Cancer

Certain genes produce proteins that normally regulate cell growth and division. When there is a mutation
of these genes in somatic cells, they lead to cancer.

Genes that regulate the cell’s cycle: - Proto-Oncogenes they code proteins responsible
- Tumor suppressor genes for the cell division

Proto-oncogenes:
- they code proteins responsible for growth factors
- their variation can lead to the production of proteins that have a high resistance to degradation. This leads
to continuous cellular division and transforms normal cells to tumor cells
- they code Cyclin and, when these genes are mutated, they produce a mutated Cyclin, that doesn’t
degrade when the cell division is completed, and therefore, the cell division continues

Tumor Suppressor Genes:

- they code proteins that are responsible for the interruption of the cell division
- if these genes mutate, they produce proteins that are not able to interrupt the proliferation, and,
therefore, they continue to divide, invading other tissues.
Tumor cells proliferate and grow continuously all of them are the same as the first mutated cell
These cells absorb all the nutrient in order to grow and divide, and, therefore, they steal energy from the
normal cells of the tissues.
The mutation of these cells lead to the mutation of other cells, and this leads the tumor to get worse

Colorectal cancer is the third most frequent tumor because the cells in the codon develop really fast

Cells proliferate but remain anchored to the tissue and there is the formation of a polyp. Over the years,
this polyp gets bigger and, at first, it becomes a benign tumor (adenoma), but then it can grow more, and it
can become a malignant tumor (carcinoma), forming a metastasis (=cancer that invades other organs).
Before a tumor becomes a carcinoma, it takes around 7 years

Some researchers (Allison and Honjo) discovered a new cancer Immunotherapy to stimulate the immune
system to kill the tumor cells

MEIOSIS:
- Living organisms can reproduce through sexual or non-sexual reproduction
- Meiosis is a karyokinetic phenomenon and it occurs during Gametogenesis (= formation of gametes,
specialized for sexual reproduction)
- it involves only some specific cells, that are able to create gametes after fertilization

- During Gametogenesis, through the process of Reductional division, 4 gametes (Haploid cells) with the
same genetic info 2 somatic cells (Diploid cells) are formed. Though, they are not the same, because,
even if they have the same genetic info, the sequence of chromosomes is different.

After meiosis, there is the Syngamy= fusion of two gametes, that form a zygote (Diploid cell)

Sexual reproduction:
Gametogenesis reduction in the number of chromosomes in the nucleus of gametes through meiosis
Fertilization reconstitution of the number of chromosomes in the nucleus of the zygotes

The two original parent cells are part of generation X, while the zygote is the Generation X+1

Diploid cell= cell with 46 chromosomes

Haploid cell= cell with 23 chromosomes

Meiosis has 2 characteristics  Karyotype invariance: the number of chromosomes remain unchanged
 over the generations, except for errors
 Genotype variability: genetic variability increases due to two phenomena:

- Crossing- over process: new combination of genes in the chromosomes

- Independent segregation of homologous chromosomes: they separate independently, creating
several possible combinations of
chromosomes in the haploid nuclei

In humans, there are more than 8 million possible combination of chromosomes for each mitosis. In
zygotes, the total number of chromosomal combinations is infinite

Meiosis is made of two phases Meiosis I and Meiosis II

The DNA synthesis phase (= Interphase) takes place only before Meiosis I

MEIOSIS I:
1. Prophase I homologous chromosomes pair and exchange segments
 it is composed by 5 subphases:
- Leptotene: each chromosome appears as a single filament
- Zygotene: the homologous chromosomes get arranged, forming Synaptonemal complex .
Each chromosome is made of chromatids, that overlap each other, forming a Tetrad
- Pachytene: crossing-over takes place and the chromosomes intertwined with each other
- Diplotene: homologous chromosomes separate, but the Chiasmata remains (it is the point
where the homologous chromosomes cross)
- Diakinesis: the spindle fibers forms

2. Metaphase I: chromosomes are arranged on the spindle fiber

3. Anaphase I: homologous chromosomes split up
4. Telophase I: two haploid cells are generated

MEIOSIS II:
The two chromatids of the homolog chromosome are separated and there is the formation of 4 haploid
cells, with a single chromatid

GENETICS
It studies how genes are transmitted through generations and genetic diseases

Genes code for fundamental proteins in our body. When mutations of genes arise, proteins change and
present a partial or total loss of their function and this leads to genetic diseases

Modern genetics was born by the union of two theories:

1. Theory of inheritance (by Mendel)
2. Chromosome theory of inheritance (by Sutton and Boveri)

THEORY OF INHERITANCE:
- Mendel studied the characteristics and laws of the hereditary transmission of characters over generations
- For his experiments, he used peas plants, but the discoveries apply to all living organisms
- His experiment is considered an excellent example of the application of the scientific method, because he
provided both a qualitative and quantitative interpretation of the results

Experimental plan:
Conditions
1. He decided to study one character (=gene/ phenotype) at the time
2. The character chosen can be found in only two alternative forms (=alleles), without intermediate
manifestations (ex. the seed color which can be either yellow or green. Not an intermediate color between them)
3. The alternative forms of the characters are identifiable in a large number of individuals
4. He selected and crossed true-breeding plants, in which a selected character manifests itself with no
variation over the generations (ex. he crossed plants that always gave yellow seeds over generations)
5. He chose organisms that reproduce sexually, with a brief cycle. In this way, he was able to observe
several characters in a short interval
6. He repeated the same crosses with several single characters, to check the validity of the results
7. He repeated the crossings considering more characters each time, to study the hereditary transmission
of more characters, independent from each other.
The two alternative forms of each character can manifest themselves independently of the forms of the
other characters

All 7 characters are single and independent = able to be transmitted independently

of each other
=able to be transmitted over generations and to
influence a single characteristic of the plant

First experiment Seed shape

1. He crossed two true-breeding lines, also called Parental lines (P). One with spherical seeds, and the other
one with wrinkled seeds. (he repeated this step multiple times)
2. As a result of this crossing, in the first generation (F1), he obtained a plant with Spherical seeds
3. He then crossed together two plants of the first generation (they have spherical seeds)
4. As a result of this crossing, in the second generation (F2), he obtained a plant with both spherical an
wrinkled seeds

Evaluation:
In F2, most plants (5774) have the
form of the character in F1, while a
few of them (1850) have the form of
one of the characters present is P

Bolt number= number of seeds

Mendel repeated the same experiment but studying the characters and he obtained the same results.
In F2, most of the plants presented the same form of the character of F1. Just a few of them presented the
form of one of the characters of the generation P

Explanation:
- In each plant, there are hereditary factors (=chromosomes), represented by the two alternative forms.
These two forms control the manifestation of the character and its transmission over the generations
- The two alternative forms derive one from the mother and one from the father, through the gametes
- The two alternative forms separate independently from each other, when the gametes are formed
- The two alternative forms can be identical or different. The two Parental lines carry two identical alleles,
while the individuals in the other generations carry different alleles
- If the two forms are different, one of them is dominant, while the other one is recessive

Dominant form = form that appears in P and F1 and that is the most frequent in F2
Recessive form = form that appears in P but not in F1 and that is the less frequent in F2

In humans:
Dominant Homozygous individual= individual in which the alleles are the same and both dominant.
It creates a gamete with a dominant allele
Recessive Homozygous individual= individual in which the alleles are the same and both recessive

Possible combinations between a Dominant homozygote and a Recessive homozygote (AA x aa):
 Punnet Square

The crossing generates all heterozygous individuals (Aa), who show the dominant character

Heterozygous individual= individual that has both a dominant allele and a recessive one.

When a heterozygote forms two gametes, one of them has a dominant allele, while the other one has a
recessive allele

Possible combination between two Heterozygotes individuals (Aa x Aa):

Punnet Square

The crossing can generate dominant homozygous individuals (AA), recessive homozygous
individuals (aa) or heterozygous individuals (Aa).
Dominant homozygotes and Heterozygotes show the dominant character, while the recessive homozygote
shows the recessive character

Mendel performed a Test Cross to understand if the dominant character is due to a Dominant Homozygous
genotype or to a Heterozygous genotype.
This allows to understand if an individual is homozygous or heterozygous

Test Cross:
The observable character is crossed with a recessive homozygote
If all the individual generated from the cross has a Dominant character, it means that the observable
character was a Dominant Homozygous Individual
If some individual generated from the cross have the Dominant Character and other have the Recessive
one, it means that the observable character was a Heterozygote individual

After the first series of experiments, Mendel started the second series, considering the transmission of two
characters at the time
Experiment:
1. He crossed two true-breeding lines (P). One plant with Spherical and yellow seeds, and the other one
with Wrinkled and green seeds
2. As a result of this crossing (F1), he obtained a plant with Spherical and Yellow seeds
3. He crossed two identical F1 plants
4. Aa a result of this crossing (F2), he obtained new phenotypic combinations. Some (315) plants with
Spherical and yellow seeds, some (108) with Spherical and green seeds, some (108) with Wrinkled and
yellow seeds and some (32) with Wrinkled and green seeds.
Therefore, he obtained some plants that were not present in P or F1

Possible combination between Dominant homozygotes (AABB) and Recessive homozygotes (aabb) for both
characters:
Punnet Square

The crossing generates Heterozygotes individuals (AaBb), which

manifest the dominant character

Heterozygotes individuals (AaBb) can generate 4 different types of gametes AB, ab, Ab and aB
Possible combination between two Heterozygotes individuals (AaBb) for both characters:

Punnet Square

The crossing generates Dominant Homozygous individuals (AABB), Recessive Homozygous

Individuals (aabb), Homozygous mixed individuals (AAbb and aaBB) and Heterozygous
individuals (AABb, aaBb, AaBB and bBb)

The three Laws/Principles of Mendelian genetics:

1. Principle of Dominance it refers to the transmission of one hereditary character
2. Principle of Segregation it refers to the transmission of one hereditary character
3. Principle of Independent Assortment it refers to the transmission of two hereditary characters

PRINCPLE OF DOMINANCE
“In heterozygotes, only the dominant allele is going to be expressed”
He formulated this law after seeing that each allele has a dominant and a recessive form

PRINCIPLE OF SEGREGATION
“When an individual produces gametes, the two copies of each character separate, so that each gamete
receives only one of them”
He noticed that, when crossing two true-breeding lines, one dominant and the other one recessive,
phenotypically identical individuals were obtained. This happens because the Dominant true-breeding line
produces gametes with dominant alleles, while the recessive True-breeding line produces gametes with
recessive alleles.
The fusion of these gametes generates Heterozygous individuals, that show the dominant character
By crossing the F1 plants with each other, an individual with the recessive character was obtained.
This happens because the two alleles of each character segregate independently and, therefore, there is
the 25% probability that two Recessive alleles will bind together in one individual

PRINCIPLE OF INDEPENDENT ASSORTMENT

“The alleles of two or more different genes assort independently of one another during gametes’ formation
He noticed that by crossing Heterozygous individuals for two different characters, phenotypically different
individuals were obtained in F2.
Some of them have all the dominant or recessive alleles for both characters, identical to the P lines, while
others have different combination of the alleles.
This indicates that the alleles separate independently, producing 4 different possible combination

Today, we know that this is due to the independent segregation of

homologous chromosomes during meiosis

CHROMOSOME THEORY OF INHERITANCE:

Thanks to the new tools, Sutton was able to analyze the movements of chromosomes during meiosis and
he noticed that the genetic material consists of 11 pairs of homologous chromosomes (=22 chromosomes,
diploid state) and that the gametes, formed during meiosis, always receive only one chromosome of each
pair of homologous (11 chromosomes, haploid state)
The non-sex chromosomes are called Autosomes they are 44 in each diploid cell

This mechanism was coherent with Mendel’s hereditary factors’ segregation. The chromosomes represent
what Mendel called “factors”

Meanwhile, Boveri studied the development of sea urchin (it has 36 chromosomes). He tried to create
individuals with a different number of chromosomes, but, at the end of the experiments, he noticed that
only the ones with a normal set of chromosomes developed normally.
Therefore, he discovered that a specific assortment of chromosomes is responsible for the normal
development of living organisms. This means that the chromosomes have different qualities

Sutton and Boveri’s observation formed the Chromosome theory of Inheritance, which states that:
1. During meiosis, homologous chromosomes pairs migrate indecently from each other
2. The assortment of chromosomes from each homologous pairs into gametes is random
3. Each parent produced gametes which contain only half of their chromosomal set
4. Males and Females have the same number of chromosomes, but their morphology is different
5. The gametes combine during fertilization, to produce an offspring with the same chromosome number
as their parents

This theory was proposed long before there was evidence that chromosomes carry the genetic info

SEX DETERMINATION
Stevens and Wilson provided the first direct evidence supporting the Chromosome theory of Inheritance
They studied male and female characteristics and discovered that the difference in these two is in the
presence of two different chromosomes, called X and Y  the sex chromosomes are called Heterosomes

Females carry two X chromosomes, while males carry one X chromosome and one Y

They noticed that, in females, meiosis produced only one type of sex chromosome (X), while in males, 50%
of the gametes carry the X chromosome and the other 50% carry the Y chromosome

The sex of the individual is defined during fertilization.

It depends on which male gamete binds which the female gamete. If the female gamete binds with the
male gamete with the X chromosome, it’ll a girl, but if it binds with the gamete with the Y chromosome, it’ll
be a boy.
It’s the spermatozoa that determines the sex of the offspring

The study of a family’s tree is called Analysis of pedigree it consists of the study of the phenotypic data
 of all the generation of the family
To analyze the Family, a set of symbols is used:

GENETIC DISEASES:
Cystic fibrosis due to a deficit in the 7th pair of autosomes.
 it’s characterized by an abnormal thick secretion of the mucous gland
 autosomal recessive disease

Huntington’s chorea disease of the central nervous system, due to the expansion of a repeated triplet
(CAG) in the first exon of the 4 th chromosome
 it’s characterized by rapid and involuntary movements affecting all muscles
 autosomal dominant disease

Familial hypercholesterolemia characterized by high level of cholesterol in the blood, which can lead to
cardiovascular pathologies
 autosomal dominant disease

Duchenne muscular dystrophy due to a deficit in the X chromosome

  it usually hits males
 characterized by a reduction of mental retardation
 Heterosomal recessive (X-linked) disease

Tay-Sachs disease due to a mutation in the gene with codes for the hexosaminidase A enzyme, in
chromosome 5. This leads to an abnormal accumulation of GM2 ganglioside in neurons
 characterized by psychomotor retardation, progressive loss of vision, progressive
muscle weakness…
 autosomal recessive disease

Rett syndrome neurological developmental disease due to a mutation of the X chromosome

 characterized by severe cognitive impairment, loss of motor skills, loss of ability to
interact and socialize…
 Heterosomal dominant (X-linked) disease

Mendel’s laws are useful for calculating the outcome of crosses between organism carrying single
hereditary characters.
However, there are a lot of extensions to Mendel’s laws which show that there can be some complicated
situations, that can’t be explained only thought the segregation and assortment of one or more pairs of
independent genes and through dominance or recessively ratio between two alleles of a gene

EXTENSIONS:
Incomplete dominance when one allele is not completely dominant over another. In this case, a
heterozygote (Aa) shows a phenotype that is intermediate between those of a
dominant homozygote (AA) and the recessive homozygote (aa)
 in humans, this incomplete dominance can lead to some diseases
Ex. the incomplete dominance of the gene which codes the β chain of
hemoglobin (= protein) causes the sickle cell anemia
Codominance when the alleles are neither dominant nor recessive. In this case, two alleles produce the
 two different phenotypes that both appear in heterozygotes individuals.
 in humans, an example is represented by the genes that determine the type M-N blood
group. People can have three different phenotypes (M, N and MN), given by three
different genotypes. Homozygous individuals are phenotypically M or N, while
heterozygous individuals are phenotypical MN (because none of the alleles is dominant)

Multiple alleles presence of more than two alleles of the same gene (vs Mendel’s experiments that
hypothesized only two alleles per gene) They can generate different genotypes, which will give
rise to various phenotypes
 In humans, an example of multiple alleles is represented by the gene with encodes the
AB0 system of the blood group. Pairs of three different alleles can be found in the human
genome, and they can combine and form more than three genotypes. They can have
different antigens (proteins). The antigens determine the blood group (that is the phenotype).

BLOOD GROUPS
There are 35 different blood groups the most important ones are AB0 and Rh system
Each phenotype (=blood group) is determined by the antigen found on the surface of the plasma and by the
production of an antibodies in the plasma
RH: individuals might or might not have the antigens on the surface of the plasma
If they havethem, they are Ph positive, if they don’t, they are Ph negative
When the mother is Rh negative and the baby is Rh positive, this is a problem for the baby. The mother
Must do a sensitization to Rh positive, in order to produce the antibodies for Rh positive.

AB0:

Polygenetic characters many characters of more complex living organisms are not regulated by only one
 gene, but by multiple ones, located in different regions of the genome
 the result of the interaction between gene shows qualitative and also
quantitative differences between them
 Ex. humans’ skin pigmentation is determined by 8 different genes

Pleiotropy when a single gene influences different characters. These genes are called “pleiotropies”
 Ex. Albinism is determined by a lack of melanin, which influences the eyes’ color, the skin
color, the hair color…

MUTATIONS:
Mutations of genes can be divided according to the amount of genes that mutate
Gene mutations:
- Replacements: - when a nucleotide is replaced with another nitrogenous base. This causes a mutation of
the triplet.
- There are 3 cases Sense mutation: when the triplet is converted into a different
triplet, which codes for another amino acid
 Silent mutation: when the triplet is converted into a similar triplet,
which codes for the same amino acid
 Non-sense mutation: when the triplet is converted into a triplet that
acts as a termination signal
- Insertion and deletion: - Frame-shirt mutation= insertion or removal of some nucleotides from a
nucleotide sequence (codon), that modifies the info of
the gene
- the reading of the nitrogenous bases gets altered
- Duplication

Chromosomal mutations:
- Structural anomalies Inversion: the fragment of a chromosome is reversed
 Deletion: the fragment of a chromosomes is broken, and the two pieces get loss
- Translocation: - when two chromosomes switch non identical and non-corresponding fragments
of DNA (= crossing over)
- If the genetic info is not damaged, the person is clinically normal, but they carry a
recessive disease that can be transmitted to the children
- The person can generate 4 different gametes and then 4 possible embryos. One normal,
one with 45 chromosomes, due to a translocation error, one with 3 copies of chromosome
21 (down syndrome) and one with only a chromosome 21 (this is lethal)

CHROMOSOMAL ANOMALIES
Genetic diseases are different from chromosomal diseases
- Gene mutations can generate positive outcomes. In fact, they can increase the generation of proteins and
it leads to evolution
- Chromosomal anomalies always lead to negative outcomes

Each chromosome contains multiple genes The Chromosomic Map indicates the allocation of the genes

Each chromosome pair has its own barcode (white, black and gray lines) and, by observing it, we can
discover if there are some structural anomalies

The international convention, invented during the Paris Conference, is used to number the chromosomes
Human control female karyotype 46, XX
Human control male karyotype 46, XY
Human female karyotype with an extra autosome 47, XX (we can then add which autosome is extra)
Human female karyotype with an extra heterosome 46, XXX
Human male karyotype with two extra heterosomes 48, XY

Chromosomal anomalies can be classified into Numerical Anomalies and Structural Anomalies

STRUCTURAL ANOMALIES:
- Due to a modification in the structure of one or more chromosomes of the normal karyotype
- Most common ones Deletions= anomaly in which a region of a chromosome is lost
 Inversion= anomaly in which there is the inversion of 2 regions of a chromosome
 Translocation= anomaly in which a region of a chromosome moves to another one

Syndromes cause by chromosomal deletions

- Cri-du-Chat syndrome
- Williams Syndrome
- Prader-Willy syndrome
- Angelman syndrome

CRI-DU-CHAT SYNDROME
Due to the fact that one homologous chromosome has a deletion

Clinical features: - small size of the skull

- psychomotor problems
- fusions of some fingers and toes
- cardiac and renal malformation pretty high mortality

Genetic causes  the parents of children affected by this syndrome usually have only a translocation of the
chromosomes. This translocation can lead to the creation of 4 possible gametes:
- gametes with a translocation
- gametes with a deletion
- gametes with an inversion
- gametes
X-FRAGILE SYNDROME with a normal karyotype
(FraX) (CGG)
Due to a modification of the terminal region of the Chromosome X this terminal region contains an
important gene (FMR1)

this gene regulates the synapsis formation

Males tend to me more affected by this syndrome, because they only have one Chromosome X and when
this chromosome is damaged, it doesn’t work at all
Females have 2 chromosomes X and when one of them doesn’t work, the other one can function for two

Pre-mutation condition: CGG between 56 and 200 the person is a healthy carrier of the disease
Complete mutation: > 200 CGG the disease develops and is evident

A high number of CGG is a signal to the cell to stop the transcription of the FMR1 gene and therefore, it is
not produced, and it leads to the X Fragile syndrome

Genetic causes subjects with a repetition of CGG between 56 and 200, are healthy carrier of this disease
(Pre-Mutation). These subjects can produce gametes with a greater number of CGG
sequences, which leads to the development of the syndrome (complete mutation)

The higher is the number of CGG sequences, the more sever is the
manifestation of the syndrome

Features narrow and elongated face with prominent forehead

 enlarged testicles in males
 poor muscles tone
 attentional deficits, hyperactivity, difficulty in learning, discomfort in being touch and looked at..

NUMERICAL ANOMALIES:
- Due to a variation in the number of chromosomes in the karyotype
- Syndromes can be discovered during the pregnancy, through the analysis of the amniotic liquid, because
it contains some cells that are released by the fetus
- They can be:
 Polyploidia= increase in the number of complete sets of chromosomes
- 2 kinds:  Triploidy: 3n (the normality is 2n, which means that
Tetraploidy: 4n we have 2 sets of 23 chromosomes)

 Aneuploidy= variation in the number of single chromosomes

- 3 kinds:  Monosomy: there is only one homologous chromosome
 Trisomy: there are 3 homologous chromosomes
 Tetrasomy: there are 4 homologous chromosomes
- It can be Autosomal aneuploidy: variation of an autosome
 Monosomy: it can happen only to chromosome 21
 Trisomy: only to 13, 18 and 21
 Heterosomic aneuploidy: variation of a heterosome
 Monosomy: Turner syndrome (45, X OR 45, X0)
 Trisomy: 47,XXX ; 47,XXY ; 47,XYY

Syndromes associated with Autosomal Trisomies:

- Patau Syndrome (Trisomy 13)
- Edwards Syndrome (Trisomy 18)
- Down Syndrome (Trisomy 21)

These syndromes are very different from each other, also in terms of severity. This is due to the different
amount of genes that chromosomes contain. Longer chromosomes contain more genes and therefore, and
therefore, when there is an excessive long chromosomes, the syndrome is more severe than when there is
an excessive short chromosome
Chromosome 13 and 18 are longer than the 21, therefore Down Syndrome is less severe

DOWN SYNDROME
Langdon Down was the first one to notice some forms of mental retardation and it called it “mongolism”.
Lejeune then discovered that this syndrome is due to an excess of chromosome 21

The excess of chromosome 21 is due to a non-disjunction of the 2 homologous during meiosis (usually
during meiosis 1), which then leads to the formation of a gamete with 2 chromosomes 21. Then, when this
gamete is fertilized, it leads to the formation of an infant with Down syndrome

Clinical features: - delay in physical and mental development

- cardiac malformations
- predisposition to develop leukemia
- they are hypotonic (= with weak muscles)

When the mother is more than 35 years old, the risk of carrying a baby with Down syndrome is high (1 out of 50)

EDWARDS SYNDROME
It is due to an excess of Chromosome 18

Clinical features: - cardiac malformations 90% of babies die within the first month due to it
- low birth weight

PATAU SYNDROME
Due to an excess of chromosome 13

Clinical features: - Microcephaly

- Heart malformations and others
- Mental delay
- Average life span is 1 y and 8 months

Syndromes associated with Heterosomal Aneuploidies:

- Turner Syndrome (45,X OR 45,X0) females
- Klinefelter Syndrome (47,XXY) males

TURNER SYNDROME only women are affected

Due to an anomalous karyotype (45, X)  there is the lack of one chromosome X
The symptoms becomes manifest in pre-adolescence this causes psychological trauma

Clinical features: - short stature, large chest, and small hip/waist

- they are infertile ovaries are not developed enough. This is chronic
- the intelligence is usually normal

There is no cure but there are some useful treatments ex. injections of growth hormones in order to
increase the stature
ex. injection of estrogens in order to increase
breast and hips
KLINEFELTER SYNDROME only men are affected
Due to an anomalous karyotype (47, XXY or 48, XXXY) there is one or two extra chromosomes X
These men have some female features
The symptoms arise in puberty

Clinical features: - tall stature, large chest and large hips

- they are infertile testicular atrophy (they are small)
- mild mental retardation

There is no cure, but there are some treatments ex. use of testosterone in order to decrease the chest,
to improve the muscle development, to deepen the
voice and to avoid osteoporosis in adulthood

GENES AND BEHAVIOR

The behavior is not inherited, but DNA is, and it influences the behavior of people
Some mental illnesses (ex. schizophrenia, bipolar disorders, depression..) are due to genetic predispositions

Some studies have been conducted on identical homozygous twins (= with the same genome) that were
separated when they were born and grew up in different families and contexts.

Some similarities were noted and, therefore, they were attributed to the fact that twins have
same genetic heritage, and not to the context in which they grew up in.

These studies show that the genetic heritage plays an important role on human behavior, but they can’t tell
us which genes influence the behavior the most
Though, a single gene can’t encode a behavior a behavior is originated by nervous circuits
that involve a lot of genes

Most of the behavioral traits are polygenic (= due to multiple genes)

Most common similarities fingerprints

 personality
 religious interests

The Church refuses these results they don’t believe that religious interests depend on genes

Mutations in genes can generate motor and cognitive deficits

HUNGTINGTON’S DISEASE first genetic disease that was analyzed

- Characteristics inheritance is 50%
Chorea (=rapid and incessant movements)
 Dementia
 Death around 50 years old
- In most patients, this disease arises after 30 years of life

- due to a mutation in the gene IT-15 on Chromosome 4 (autosomal gene) this gene produces a protein
called Huntingtin

We have 2 copies of this genes, and subjects affected by this disease have one normal IT-15
gene and one that is mutate though, this disease is dominant, therefore, it is evident even with
the modification of only one gene

- Pre-mutation: the CAG triplet is repeated 35 times the disease is not dominant, but people with pre-
mutation can generate gametes with the disease
- Mutation: the CAG triplet is repeated too many times (36-40 times), and this causes the Huntington
disease= these is an expansion of the gene and of the protein produced by it (Huntingtin)

The amount of Huntingtin is related to the amount of Brain-derived neurotrophic factor, which allows the
survival of neurons
A low amount of Huntingtin leads to the death of neurons and to the Huntington disease
Two main problems: - the mutated proteins tend to form Fibrils which are dangerous for the neurons
- the non-mutated protein produced by the non-mutate gene are not enough
The therapy consists in increasing the amount of non-mutated proteins and to decrease the amount of the
mutated ones

Chorea is due to the damage of the Striatum Neurons (in the basal ganglia)
Dementia is due to the damage of Cortical Neurons

SCHIZOPHRENIA
= disorder characterized by a deterioration in the ability to function in everyday life
- Symptoms: lack of motivation, hallucinations, delusions, disorganized speech…

- Schizophrenia in Greek means “Divided mind” it refers to the dissociation between the emotional
and intellectual aspects of the person
Ex. people may cry without any reason

Positive symptoms= behaviors that should be absent, but they are actually present
Ex. sadness for no reason
Negative symptoms= behaviors that are absent, but should be present more difficult to treat
Ex. no reaction to a bad news

Schizophrenia can be Acute: sudden appearance, but good prospect of recovery
 Chronic: gradual appearance but prolonged course

In Italy, 1% of the population is affected by schizophrenia it’s very high

It arises around 20yo for men and 30yo for women

GENETIC INFLUENCE:
Many genes are involved with the appearance of schizophrenia
The closest we are to someone with schizophrenia, the more likely we re to get it
In Monozygotic twins, if one twin has schizophrenia, the other one has a 50% probability to have it too

This proves that genes influence it, but there are other factors
that influence the onset of this disease

Studies show that children with a schizophrenic mother are 15% likely to contract the disease. Though,
this happens even in adopted children, with non-schizophrenic natural parents but with a schizophrenic
foster mother

This proves that, at the basis of schizophrenia, there is the genetic component,
but the context has a huge influence too

Pregnant women tend to have bad habits (ex. drinking, smoking…) and they influence the fetus

Researchers have identified the genes responsible for it, but the degree of association is never 100%, but
it’s usually 70%
Why it’s hard to determine the genes involved:
- It’s difficult to diagnose schizophrenia clinicians sometimes mistakenly diagnose it
- Schizophrenia depends on a combination of genes the greater is the number of genes involved,
the worse the schizophrenia is
- The arise of schizophrenia is not always due to genetic reasons

Genes involved:
Around 100 different gene’s variants are associated with schizophrenia

Mutation = Variation = genes produce proteins that work a little more or a little less

= genes lose their functions and produce proteins that don’t work

Each variant gives a contribution to the onset of the disease a single variant can’t generate the disease
The higher is the number of variants that a person has, the higher is the possibility to develop schizophrenia

Most of the variations are related to the Dopamine System and to the Glutamate System (IMPO!!)
Usually, there is an excess in Dopamine
In both cases, there is an unbalance in neurotransmitters

Example:
COMT = gene which creates a protein responsible for the degradation of dopamine (=neurotransmitter)
 positive symptoms in schizophrenia are due to a variation of the dopamine

PHARMACOLOGY:
There are some drugs, called Antipsychotic drugs, that are able to reduce the amount of dopamine in the
system and, by doing so, they reduce the positive symptoms of schizophrenia.
This is the proof that schizophrenia is caused by an excess of dopamine in the system

Genetic studies correspond with the Pharmacological studies

NEUROANATOMY:
People with schizophrenia might have anomalies in the brain anatomy
Most affected area: - grey area neurons are disorganized
- hippocampus
- ventriculi

These brain abnormalities don’t increase over time it is not a degenerative disorder

When people have auditory hallucinations, there is an activation of the neurons responsible for the
perception of external speech sounds, even if the external sound is not present.
The same thing happens when they have visual hallucinations. The visual cortex activates, even if no visual
stimulus is presented
This causes the patients not to be able to distinguish between hallucinations and real stimuli
TREATMENTS:
Therapy must begin immediately after the diagnosis and it must continue
- Drug treatment antipsychotic drugs
- Cognitive-behavioral treatment the patient and the family need to understand what is going on
in the patient’s mind
 there are several approaches

Patients need to be aware that their hallucinations are not real

BIPOLAR DISORDER
- also called “manic depressive disorder”
- Symptoms: mood swings people go from Depression to Mania (euphoria, constant laughter…).
The cycle can last for days or even for weeks
- Manic people are sometimes aggressive and can be dangerous to themselves and to others
- During the manic phase, there is a big neural activation

- There are two types: - Type I strong manic episodes and some depressive episodes
 more severe
- Type II depressive episodes and hypomanic episodes (= less severe manic episodes)
 less severe

- Bipolar disorder is usually diagnosed around adolescence

- Patients have brain abnormalities the amygdala is larger than normal

GENETIC INFLUENCE:
When, in monozygotic twins, one of the twins has bipolar disorder, the other twin has a 50% possibility to
get it.
Instead, dizygotic twins, sibling or children of a patient with bipolar disorder, usually have a 10% possibility

There are several gene variants they are more common in male patients

Each variant gives a contribution to the onset of the disease a single variant can’t generate the disease
The higher is the number of variants that a person has, the higher is the possibility to develop the disorder

Most of the variations are associated with the Dopamine System and the Serotonin System

TREATMENTS:
Patients usually neglect their disorder, and they refuse to be treated especially Type I
Drugs and psychological therapy are needed

- Lithium and Quetiapine are able to stabilize the mood swings, by reducing the amount of
dopamine and serotonin in the system
- Valproic acids and Carbamazepine are able to reduce the manic symptoms
THE AUTISTIC SPECTRUM
AUTISM
= generalized developmental disorder
Symptoms: 4 behavioral areas are hit impairment in communicative and non-communicative behaviors
(Ex. Echolalia  continuous repetition of the same word)
 impairment in social emotional reciprocity and interactions
 repertoire of interests (the same behaviors are repeated and
people may show excessive interest in some objects)
 resistance to change (difficulties with transitions and use of rituals)

- There are several degrees of autism it usually improves with age

- Some autistic people have extraordinary talents

Boy are 4 times more likely to get this disorder scientists believe that some genes localized on the
Chromosome X are responsible for it. Since boys have
only one Chromosome X, when it’s damaged, it causes
autism

The causes of autisms are still not known the origin is multifactorial: - genetic factors
- environmental factors
- epigenetic factors

Theories about the causes of autism:

Psychodynamics Theory of the “refrigerator mother”: autism is a defense mechanism against cold and
(now abandoned) detached mothers and it’s also the result of a
non-stimulating environment
Neuroscience Theory of mirror neurons
Immunology vaccines could be the cause
Observation an accumulation of heavy metals could be the cause
Genetics there is a genetic predisposition which influences the onset

Autism often affects entire families this is the reason why scientists believe that autism is due to multiple
genetic variants, and not only to a single mutation (in the latter case,
every member would have it, recessively or dominantly)
Different gene variants contribute to the onset of autism

There are around 154 different genes responsible for autism

Most of these genes regulate the survival of synaptic functions

ASPERGER’S SYNDROME
= developmental disorder related to autism it’s a high functioning form of autism
Symptoms: higher intelligence, impaired social skills, and obsessive patterns of interests
It’s considered as related to autism because they have in common the fact that people have struggle to
create social relationships, make eye contacts and stay in social situations and they also have a tendency to
be distracted easily and have a strong attachment to habits

Although, people with Asperger’s syndrome have a normal intelligence and normal language skills
It often considered as a high functioning form of autism (=symptoms are less severe than autism)

The exact cause of this syndrome is unknown, but it’s a multifactorial disorder

Genetics, epigenetics and environmental factors (ex. mother with an infection during
pregnancy, mother who smokes during pregnancy…)

Genetics many genetic variances are associated with a risk to develop the syndrome
 some genetic variances are in common with autism
 males are more likely to have it than females because most genetic variances are
localized on chromosome X
 people with Asperger’s syndrome have an impairment in the mirror system

THERAPY:
Types of therapy: Behavioral therapies, support in school, mental health counseling…

The treatments depend on the age and on the symptoms of the patient some suffer from depression
There are some strategies that people can use to manage their symptoms

The administration of Oxytocin can help to improve the social skills

RETT SYNDROME
= neurovegetative disease of progressive evolution it’s a form of autism
Only girls can be affected they have around 18 months of normal development, and then they
start having mental retardation problems

It’s considered to be a form of autism because some clinical features resemble the autistic spectrum

Different types of Rett syndrome

- The variant with preserved language
- The variant with Early-onset seizures
- The “Whip forms” no major clinical signs
- The congenital variant psychomotor retardation is evident since the first months of life
- The late regression variant

4 stages of Rett syndrome:

1. Phase 1 (6-18 months) no symptoms or vague symptoms
 reduced interest in tors, delayed development of motor skills…
2. Phase 2 (18m-3yo) rapid regression of development the diagnosis takes place in this phase
 insomnia, autistic manifestation, irritability, loss of language, reduced use of
hands, impaired movements…
3. Phase 3 (2-10yo) called “Pseudo stationary stage”
 motor problems, seizures
 less irritability and improvement in movements
 most girls remain in this phase
4. Phase 4 (10yo-death) emotional contact improves, and seizures get controllable
 atrophy, scoliosis it makes it impossible to walk

It’s due to Genetic causes it’s a Monogenic disease (= the mutation of a gene leads to the onset)
 the MeCP2 gene is usually the one responsible, but the CDKL5 gene and
FOXG1 gene can be responsible (mutations in these latter two generate the
most severe phenotype)

It’s called “syndrome” because it hits several organs, despite the fact that it is a genetic disease

MeCP2 gene:
- it produces a protein (MeCP2) that condenses DNA when this protein is mutated, the DNA sequences
don’t bind together
- it regulates the brain-derived neurotrophic factors (BDNF) it is responsible for the brain development
and for the synaptic connections

- A mutation in the MeCP2 gene leads to an excessive production of BDNF. This excess causes the
establishment of the wrong nerve connections

it’ the opposite of the Huntington disease, in which there was a low level of BDNF

EPIGENETICS:
= study of the changes in the gene function that can be transmitted, but that are not due to alteration
of the DNA sequence

These changes comprehend: - DNA modifications ex. addition of Adenine or Adenine to the promoter
of the gene
 they lead to the lower expression of the gene
- Chromatin modifications histone’s modifications that lead to a
modification in the chromatin structure
- non-coding RNAs modifications
- RNA modifications they are chemical modifications

Epigenetics can be responsible for the onset of autism

NEURONS
Neurons= most important basic working unit of the brain. They are specialized cell designed to transmit
 information to other nerve cells, muscles of gland cells

The main function of our brain is to process, codify and integrate information

Neurons sense changes in the environment, communicate these changes to other

neurons and command the body’s responses to these sensations

Neurons are localized in different Neuron anatomic structures

Golgi was the first one to analyze neurons he developed a method with silver chromate solution

This method colors only 1% f the neurons, therefore, we are able to see only a few neurons, separately
from the surrounding ones thanks to this, we can clearly see the morphology of the neurons

He was able to show that neurons have 2 parts: - Central region with the nucleus
- Thin tubes  called Neurites

Cajal formulated the Neuron Doctrine the brain is composed by distinct neurons, which are independent.
The info is transmitted through neurons thanks to the Synapsis,
which are small conjunctions

Cajal also formulated 2 laws:

- Laws of Dynamic Polarization nervous messages can only go in one direction. from the reception area,
to the triggering zone, and from the triggering zone to the presynaptic
termination

- The law of connection specificity each nerve cell establishes specific connections with particular post-
synaptic cells

Neurons can be divided based on their shape:

- Unipolar/Pseudo-unipolar neurons they have a single branching which extends in two directions
 in humans, they from the Ganglia
- Bipolar neurons they have an entry area, which carries info from the periphery to the cell body, and
then there is an Axon, which brings the info from the body to the central nervous
system
 found in the retina and olfactory system
- Multipolar neurons they have many ramifications at the entry, and a single axon
 most neurons are multipolar

Neurons can be divided based on their function:

- Sensory/Afferent neurons they take info from the periphery to the central nervous system
- Interneurons they receive the info from the sensory neurons, codify the info and transmit it to the
 motor neurons
 Can be: - Relay Interneurons they connect circuits of neurons between different regions
- Local Interneurons they form circuits between nearby neurons to analyze
small pieces of info
- Motor/Efferent neurons they transmit the info to the muscles and the glands

NEURAL TRASMISION
Synapsis are formed by:
- Pre-synaptic membrane it comprehends synaptic vesicles, which contains a neurotransmitter
- Synaptic cleft= little space between the two membranes
 the neurotransmitter is released by the pre-synaptic membrane to the synaptic cleft, and
then it is taken by the receptor which is in the post synaptic membrane
- Post synaptic membrane it comprehends special receptors, which interact with neurotransmitters

All neurons have common structural elements, and they employ the same mechanism to receive and send
messages

Structural elements:
1. Entry area/Receptive Zone it is formed by the post synaptic membrane
 here, they neurons receive signals from other neurons
 composed by the soma (=cell body) and by the dendrites
2. Integrative area the central soma is part of it
 the signals are processed
3. Conduction area the signals are conducted
 the axon hillock (=origin of the axon) and all the axons are part of it
4. Exit area the messages are transferred to other neurons
 it is composed by the terminal axon

ENTRY AREA AND INTEGRATIVE AREA:

1. When neurons are at rest and don’t receive signals from other neurons, there is a membrane potential
Membrane potential= difference of the electric change between the inside and the outside of
 the cell, when the neuron is at rest -60mV

- This difference is due to an unequal distribution of electrically charged ions. In particular, Potassium
ions (positively charged) inside the membrane, and Proteins (negatively charged) outside the membrane
- When the neuron is at rest, the Sodium channels are closed, and the Potassium channels are open.
Therefore, the Potassium ions tend to go outside, and a cloud of negative charges forms inside the cell.
- The unequal distribution of positive ions between the two membranes sides is maintained by a membrane
protein which pumps ions of Sodium outside the cell, and Ions of Potassium inside the cell

2. When neurons start interacting with other neurons, there is a synaptic potential
Synaptic potential= partial depolarization of the membrane -40mV

- When Dendrites receive signals, due to a neurotransmitter binding with a receptor, some Sodium
channels open and Sodium ions (positively charged) enter our neurons, while the Potassium channels
close. This causes a partial depolarization of the membrane potential
- it is only a partial depolarization because the signals don’t go beyond the initial segment of the axon
- The synaptic potential depends on the amount of neurotransmitter released only a certain number is
released

3. When the signals arrive to neurons and are transmitted, there is an action potential
Action potential= complete depolarization of the membrane +50mV

- It starts in the Axon hillock it is known as the Trigger Zone, because the nerve impulses start here
 here, there are some Sodium channels that are voltage dependent
In fact, if the internal charge reaches a threshold of excitation (= if the
voltage is too high), the Sodium channels open
- When all Sodium channels open, a lot of Sodium ions enter the neuron, and this causes a strong
depolarization of the membrane
- it is a complete depolarization because the signals are transported along all the axons

4. After the depolarization of the membrane, the Sodium channels close and the Potassium channels open,
so that the membrane potential is repolarized

5. Then, some of the Potassium channels close and the membrane goes back to an initial state

CONDUCTION AREA:
Nerve impulse= modification of the membrane potential which is regenerated in consecutive positions
along the axon
The conduction of signals depends on:
- Number of action potential the duration of the signal depends on the total number of action potentials
- Frequency of action potential the intensity of the signal depends on the frequency of the action
potentials

The nerve impulses propagate along the axons the intensity of the signal doesn’t decrease, because the
action potential continues to regenerate (high frequency)

Axon can conduct impulses only in one direction, because the Axon Hillock is the only part able to start the
action potential, by opening the Sodium channels. Therefore, the impulses can only start here

The velocity of conduction of the nerve impulses varies according to the diameter of the axon
Small-diameter axons are slow-running they are called Unmyelinated axons
Large axons, instead, are surrounded by a Myelin Sheath, which makes the propagation very fast

- Myelination= process of creation of the myelin sheath around the axons

- In the brain and the spinal cord, the axons are myelinated by the Oligodendrocytes
- Myelin sheath is arranged in repeated lipid biomolecular layers it is made by 70% of lipids and 30% of
Proteins
- In the Peripheral Nervous System, the myelin sheath is substituted by the Schwann cells
- Myelin alterations can create catastrophic consequences Multiple sclerosis
 Guillain-Barre syndrome

MULTIPLE SCLEROSIS
- it’s an inflammatory disorder that affects the central nervous system
- it is an autoimmune disease the autoimmune system reacts against the myelin sheaths
- it is due to a myelin degeneration process, which causes blocking or slowing down of impulses
- Plaques= areas in which myelin sheaths are damaged

- Symptoms Vision: blurring, double vision…

 Coordination: partial or complete loss of balance
 Strength: weakness
 Sensitivity: loss of increased of sensitivity of touch
 Language: loss of speech
 Cognitive functions: disorders or character or personality, loss of memory…
EXIT AREA:  Some patients have a Lhermitte sing = sensation of an electric shock when people bend
In the axons, there is an Axoplasmic Transport = transportation of chemical vesicles and cell organelles
 Anterograde axonal transport vesicles are full, and they go from the cell body to the
nerve terminals (very fast)
Retrograde Axonal Transport vesicles are empty, and they go from the nerve terminals
to the cell body

For the neuronal transmission, ATP is required it is obtained through the degradation od carbohydrates

Axonal transport occurs thanks to some structures that make up the cytoskeleton and some proteins:
- Microtubules composed by the protein “tubulin”
- Neurofilaments composed by the protein “cytokeratin”
- Microfilaments composed by the protein “actin”
- Kinesin and Dynein (=proteins) they bind with vesicles and enable the transportation

When the action potential reaches the Axon termination/Exit area, it determines the release of the
neurotransmitters, which are contained in the synaptic vesicles

The release of the neurotransmitter is a complex and highly regulated event

1. The action potential propagates until the exit area
2. The Calcium channels are voltage dependent, therefore, when the action potential reaches the exit area,
they open and the Calcium ions enter into the synaptic termination
3. Calcium ions cause the vesicles to bind with the pre-synaptic membrane
4. The fusion of the vesicles with the membrane causes the neurotransmitters to exit the cell and to be
released into the synaptic cleft the amount of neurotransmitter released depends on the
amount of Calcium ions that enters
5. Neurotransmitters bind with specific receptors in the post-synaptic membrane
6. The bond between neurotransmitters and receptors determines the opening of ion channels of the
post-synaptic membrane
7. The neurotransmitters are inactivated and quickly removed from the synaptic cleft

There are different kinds of neurons, but they all go through similar mechanisms.
Main differences between neurons:
- diversity of ion channels
- diversity of neurotransmitters employed to transmit a message to the neurons
- diversity in the receptors that receive the info

The Nervous system has a large number of cell types For this reason, it can undergo different cell
modification and it susceptible to a high number
of neurological and psychiatric diseases

NEUROTRANSMITTERS
In order to be classifies as a neurotransmitter, a chemical messenger must have 4 characteristics:
1. It is synthesized by the neuron
2. It is present in the pre-synaptic termination and it performs the action in the post-synaptic neuron
3. When it is produced from the outside (ex. drug), it is able to reproduce the action of the
neurotransmitter released endogenously
4. There is a specific mechanism for its disposal

2 main classes of neurotransmitters Small molecules neurotransmitters: made of amino acids and
amines
 Neuroactive Peptides: made of small chains of peptides

 DA SAPERE A MEMORIA

Specific enzymes are involved in the synthesis of the

neurotransmitters.
Enzymes are codified by genes, and some of these genes are
associated with the onset of schizophrenia and other mental diseases

SMALL MOLECULES NEUROTRANSMITTERS

ACETYLCHOLINE
- Used by motor neurons in the spinal cords
- they are present at the level of neuromuscular junctions and at the level of brain synapsis mainly in the
basal ganglia

BIOGENIC AMINES
- Serotonin, Dopamine and Norepinephrine play an important role in the onset of some mental diseases
- Parkinson’s disease is due to a decrease in the dopamine synthesis

DOPAMINE
- Dopamine is originated from 4 possible Dopaminergic Pathways:
1. Nigrostriatal Pathway it originates from neurons in the substantia nigra, and they are important for
Midbrain
the movement control. They are impaired in mental disorders
2. Mesolimbic Pathway it plays a key role in affective and emotional manifestations
3. Mesocortical Pathway it plays an important role in attention and motivation
4. Tuberoinfundibular Pathway it originates from neurons present in the hypothalamus and it
regulates the secretion of various hormones

- An unbalanced production of Dopamine can generate hallucinations

- it is responsible for the onset of Depression
NORADRENALINE
- It is the neurotransmitter of the neurons present in the “Locus Coeruleus” (= nucleus of the brain stem),
which have functions in the regulation of sleep the number of neurons in the Locus Coeruleus is limited,
however, they project to the entire cerebral Cortex,
which allows the regulation of pain perception
- It is also the neurotransmitter for the neurons in the Sympathetic Nervous System

ADRENALINE
- it is the neurotransmitter of the neurons in the Sympathetic Nervous System
- it is also the neurotransmitters of the neurons in the Central Nervous System
- it is rapidly activated in situation that generate stress and fear
- an increase of adrenaline causes an increase in systolic pressure and a decrease in diastolic pressure

SEROTONINE
- it is the neurotransmitter of Serotonergic Neurons, which are localized in the Nuclei of the Raphe (in the
midline of the Brain stem), which are involved in the control of attention and other cognitive functions
- together with Dopamine, it is responsible for the onset of Schizophrenia
- Serotonine, Dopamine and Noradrenaline are responsible for the onset of Depression

- Some Antidepressant drugs are able to block the transportation of Serotonine, Dopamine and
Noradrenaline, which allows more neurotransmitters to bind with the receptor. This helps to reduce
the Depression’s symptoms

HISTAMINE
- when Histidine (= an amino acid) goes through the process of Decarboxylation, it becomes a
neurotransmitter, called Histamine
- in humans, it is produced by Hypothalamic neurons, which control the main hormonal functions
AMINO ACIDS
- Glycine and Glutamate are two amino acids that function as neurotransmitters
- Glycine and GABA are inhibitory neurotransmitter
- Glutamate is an excitatory neurotransmitter

GLUTAMATE
- it is an amino acid that functions as a neurotransmitter
- most common excitatory neurotransmitter
- it is fundamental for the regulation of sleep and attention

GABA
- the most common inhibitory neurotransmitter
- present in our spinal cord and cortex

GLYCINE
- it is an amino acid that functions as a neurotransmitter
- primary neurotransmitter of inhibitory neurons in the spinal cord
- responsible for the formation of memory

NEUROACTIVE PEPTIDES
- they are short-chains of peptides
- they can be inhibitory or excitatory
- they can be both neurotransmitters and hormones If they are in the brain, they are neurotransmitters.
If they are in other organs, they are hormones
- There are 10 families of Peptides:

Main Families Main Peptides

The disposal of Neurotransmitters takes place immediately after their release

If a neurotransmitter remains in the synaptic cleft for a long time, the signal can’t be transmitted
3 mechanisms for the removal of neurotransmitter:
Diffusion spontaneous mechanism of neurotransmitters
Degradation enzymes degrade the neurotransmitter
Reuptake receptors transport again the neurotransmitter in the presynaptic space
There are several diseases that alter the transmission of impulses between neurons and their target cells

MYASTHENIA GRAVIS
- it is a rare autoimmune disease that hits skeletal muscles
- it is characterized by the presence of specific antibodies that block the Nicotinic Receptor, which are the
receptors for Acetylcholine =neurotransmitter responsible for muscle contraction

- the presence of these antibodies doesn’t allow Acetylcholine to bind with nicotinic Receptor.
This leads to a problem in the transmission of info from Motor neurons to muscles

- This diseases is characterized by crises sometimes the autoimmune system works properly. Then
it suddenly produces antibodies and then it stops for a while

- Clinical features it mainly affects facial muscles

 muscle weakness
 rapid and sudden onset
 First signs: nasal voice, difficulty in swallowing and double vision

- if this disease is not discovered at an early stage, there is the risk of paralysis there can be a paralysis of
the most important organs

- Therapies Administration of Acetylcholinesterase drug it allows the Acetylcholine to remain in the

synaptic cleft for a longer time, so they are
more likely to bind to the receptors
Corticosteroids and Immunosuppressive drugs they decrease the function of immune system
 In acute crisis: Sessions of plasmapheresis = removal of antibodies from the blood
 In severe cases: removal of thymus

- Prognosis most patients can live without significant problems

 2 types of remission: - Drug remission: symptoms disappear with the continuous use of drugs
- Complete remission: symptoms totally disappear and the patient can
stop using drugs

- There are still some unanswered questions about this disease

Ex. What triggers the production of antibodies against the receptor? We don’t know

Hypothesis: some viruses and bacteria may contain Epitopes (= portions of a protein), which have
antigenic properties and that are similar to Nicotinic Receptors
When a person contracts these viruses or bacteria, the body produces some antibodies to fight
them. Although, our body can’t distinguish the Nicotinic receptors from the Epitopes.
Therefore, even when the viruses/bacteria are defeated, our body continues to produce the
antibodies, that now attacks the Nicotinic receptors
 10. NEUROANATOMY
The nervous system is a vast and continually active set of connections, which changes throughout the life
There are billions of connections between neurons they are fundamental for the transmission of info

Neuroanatomical studies focus on the brain

NERVOUS SYSTEM
It’s divided in peripheral nervous system and central nervous system

Peripheral nervous system:

it is formed by 2 division:
- Afferent division formed by afferent neurons
 it captures sensory info from the environment
 it sends info to the central nervous system
 it is the input of info
 ex. eyes
 Divided in: - Sensing external environment (organs)
- Sensing Internal environment (world)

- Efferent division formed by efferent neurons

 it allows our body to perform some actions
 it is the output of info
 ex. muscles
Divided in: - Somatic nervous system voluntary actions
- Automatic nervous system involuntary act

Divided in Parasympathetic division: it is responsible for rest. It maintains the heart rate,
respiratory activity and metabolic activity to remain normal
 Sympathetic division: it intervenes in emergency situations, by increasing the signals
to the heart

Formed by: - Cranial nerves they originate from the brain

- Spinal nerves they originate from the spinal cord
- Spinal ganglia it is in the spinal nerves
Central nervous system:
1. It receives info from the Afferent division
2. It integrates some past information with the info coming from the Afferent division
3. It sends commands to the Effector division, in order to enable the performance of some actions

Formed by: - Medulla

- Spinal cord
- Pons Brain stem
- Mid brain
- Cerebellum
- Cerebral hemisphere
- Diencephalon thalamus and hypothalamus

It contains the Meninges they surround the central nervous system

 they are 3 membranes: Dura mater, Arachnoid and Pia mater
 they are formed by connective tissues
 there is a space between the dura and the arachnoid, called epidural space
 between the pia and the arachnoid there is a Subarachnoid space

SPINAL CORD
- it is the simplest functional unit of the central nervous system
- it goes from the cranial base to the first lumbar vertebra
- it controls the sensations and motor control of the trunk and limbs
- 2 divisions: - Afferent division it receives sensory info, and it transmits them to the upper centers
of the brain
- Efferent division it receives info from the upper centers, and it transmits them to the
muscles, for voluntary motor movements

- it is inside the vertebral canal and it’s surrounded by Meninges (= membranes)

- there is an Epidural Space between Dura mater (= external area of the meninges) and the vertebral wall

- it contains the grey matter, surrounded by a white substance

it contains the soma of our neurons it contains the axons of neurons

- the gray matter is divided in: - Dorsal Horn with sensory neurons, that activate the efferent division
- Ventral Horn with motor neurons, that activate 65hthe efferent division
BRAIN STEM
= trunk of the encephalon
- it’s formed by medulla, pons, and midbrain
- it is the continuation of the spinal cord
- it contains Sensory nerves: it contains the somatic sensory fibers
 Motor nerves: it contains somatic motor fibers
 Mixed somatic nerve: it contains somatic motor fibers and somatic sensory fibers

- 5 main functions analysis an sensation of the head, neck and facial and motor control of these regions
 it is the place of entry of info from some special senses (ex. hearing, taste…)
 specific neurons mediate parasympathetic reflexes, such as decreased heart rate…
 it contains ascending and descending pathways that retransmit sensory and motor
pathways to and from other regions of the central nervous system
 there is a reticular formation which constitutes a sort of summary of most of the
sensorial info of the alter and vigilance level

MEDULLA
- it is situated above the spinal cord and within the skull
- it is formed by different nuclei (= group of neurons)
- functions of nuclei some regulate the blood pressure and respirations
 some regulate taste, hearing and in maintaining balance
 some control the muscles of the neck and face

- from medulla, some nerves originate: - Spinal accessory nerve they supply the large muscles of the neck
- Vagus nerve it supplies the organs of thorax and abdomen
- Hypoglossal nerve it supplies the muscles in the tongue
- Glossopharyngeal nerve it supplies the muscles of pharynx and
larynx

- in the medulla, there is the decussation of the Cortico-Spinal Tract

This tract goes from the cerebral cortex to the spinal cord. But, in the medulla, it decussates.
This is way the left part of the brain controls the right part of the body, and vice versa
PONS
- it is above the medulla, below the midbrain and behind the cerebellum
- since it’s inside the brain, it can’t be affected by traumas
- there are a lot of nuclei Pontine nuclei transmit motor info to the cerebellum
 some of them control breathing, taste and sleeping

- from the pons, some nerves originate: - Trigeminal nerve it supplies masticatory muscles
- Abducens nerve it supplies the extraocular muscle
- Facial nerve it supplies the muscles for facial expressions
- Vestibulocochlear nerve responsible for hearing and balance
MIDBRAIN
- it’s above the pons
- the neurons in the midbrain establish important connections between components of motor systems
and the cerebral hemispheres
- it contains 2 special nuclei: - Substantia Nigra an alteration of substantial nigra is responsible for
Parkinson
- Red nucleus responsible for motor coordination

- it contains info belonging to the auditory and visual system several regions are connected to the eye
muscles

CEREBELLUM
- situated inside the skull, behind the brainstem it has strong connections with the brainstem
- the central portion is called “Vermis”
- it contains a lot of neurons it contains 50% of the neurons of our brain
 tho, it contains only a few types of neurons
- it is involved in the language and other cognitive functions, and also in the coordination of motor
movements

- Lesions can cause alteration of special precision and temporal coordination of movements, deficit
of balance, reduction of muscle tone and also deficits in cognitive functions

DIENCEPHALON
- situated in the center of the brain
- divided in Thalamus and Hypothalamus
- Thalamus all sensory info (except for the olfactory ones) and motor info arrive to the thalamus.
It selects them and then retransmits the selected into to some cortex areas, for the
codification of info
 composed by several nuclei, each of which projects to a different part of the cerebral cortex
 it consists of 2 thalami, that are connected by a masa intermedia

- Hypothalamus Functions: - it controls the neuroendocrine system

- it organized the activity of the autonomic nervous system
- it releases hormones which target the Pituitary Gland, which then
synthesizes hormones, related to important functions of our body
(ex. homeostasis, reproduction, metabolism…)
- it regulates the light-dark cycle because the pineal gland, which is part of
the diencephalon, produces melatonin
 it has a lot of afferent and efferent connections with the central nervous system
CEREBRAL HEMISPHERES
- they re the largest part of the whole central nervous system
- there are the Right Hemisphere and the Left Hemisphere
- they include:
 Cerebral cortex impo for all actions related to the functioning of sensory and motor systems,
consciousness, memory, emotions, learning and language, thinking
 Corpus Callosum = large bundle of fibers underlying the cerebral cortex
 it connects the 2 hemispheres
 Basal ganglia involved in control, initiation, and organization of voluntary movements
 Limbic system it is made up of brain structures
 it provide an anatomical basis for emotions and affectivity

The brain is surrounded by a Cerebrospinal fluid

- it surrounds the brain and the spinal cord

- there is always a circulation and replacement of it
- it can transport products from the blood to the brain, and from the brain to the
blood, to be expelled
- it is absorbed by some blood vessels
- it fills up the 4 Ventricles (= networks of cavities) in our brain 2 Lateral ventricles
 Third ventricle
 Cerebral aqueduct
 Fourth ventricle

In the depth of the hemisphere, there is a White matter, in which some axons create some bundles that
connect the hemispheres of the brain:
- Commissural bundles they connect the cortical areas in the hemispheres
- Associative bundles they connect different cortical areas on the same side
- Projection bundles they connect the cerebral cortex with the subcortical structures (basal ganglia, brain
stem and spinal cord)
BASAL GANGLIA:
- positioned in the telencephalon
- Function: selection, initiation, and organization of voluntary movements
- Core structures Putamen they form the striatum
 Caudate nucleus
 Globus pallidus

- Other structures Subthalamic nucleus

 Nucleus of ventral thalamus: it controls movements
 Substantia nigra: it is in the midbrain, but it is connected to the basal ganglia

- lesions in the basal ganglia lead to a dyskinesia (=motor dysfunction)

- Parkinson’s disease is one of the most famous diseases which affect basal ganglia

CORPUS CALLOSUM
- it is in the depths of the fissure
- it is composed by myelinated fibers

LIMBIC SYSTEM:
- it is also called “emotional brain”
- Function: regulation of emotional responses

they involve: - Behaviors related to survival ex. feeding, responses to emergency situations…
- Physiological changesex. thirst
- Alteration of mental state ex. depression
- memorization of events and emotions

Structure:
- Cortical structures Core structures: - Hippocampal formation (core structure)
- Para hippocampal gyrus
- Cingulate gyrus
 Extended structures: - Limbic forebrain

- Non cortical structures Core structures:- Amygdala

- Septal region
- Ventral portion of basal ganglia
 Extended structures: - Olfactory system
- Some parts of the midbrain
AMYGDALA localized in the temporal lobe
 it receives all the sensory info from the thalamus, and also the olfactory info
 the sensory info that it receives are the basis for the expression of emotions
 it has an important role in emotional behavior
 it is connected to the Septal nuclei they create positive emotions
 it can project the emotions to the hippocampus, that then memorizes them
HIPPOCAMPAL FORMATION localized in the temporal lobe
 Function: formation of new memory (not involved in the storage and retrieval)
 it can form emotional and episodic memories
 it receives messages from the amygdala
 it is very delicate
 lesions in the hippocampus or in the amygdala lead to an impossibility to
form new memories (anterograde amnesia)
 people with dementia have a loss of neurons in hippocampus

CEREBRAL CORTEX
- it is the outer layer of the cerebral hemisphere
- the Pia mater is attached to the cerebral cortex
- composed by 6 layers
- due to its dimension, the cerebral cortex is the dominant controller of the Central Nervous System

- It is responsible for almost all interpretations and actions related to the functioning of the sensory and
motor system, for consciousness, language, thinking, emotions…

- it is divided into right and left portion the left portion controls the right part of our body, and vice versa
- it has some associative areas (=areas that receive info from other part s of the brain)

they allow complex learning behaviors and processes

- The cerebral cortex is divided into 4 lobes Frontal Lobe

 Parietal lobe
 Temporal lobe
 Occipital lobe

- There is a Lateral Fissure which separates the Frontal and Temporal lobe, and a Central Fissure which
separates the Frontal lobe and the Parietal Lobe

- In the center of the cerebral cortex there is a cortex area, called Insula

- it is fundamental for the reception of external information and internal sensations, from our organs
- it’s between the Temporal lobe and the Parietal lobe

- Broadman defined the “52 Areas of Broadman”

- he identifies 52 areas in the cerebral cortex, which all have a different function
- he distinguished 4 types of cortex Primary sensory areas: they receive signals from the senses
 Secondary sensory: they receive signals from the primary
Around 20 areas can be sensory areas, and they elaborate them
assigned to these categories  Motor areas: they control voluntary movements
 Association areas: they interpret the sensory info and create
a motor action or mental process

Unimodal association areas they associate info of the same modality

 Heteromodal association areas they associate different kinds of info
11. MIRROR NEURONS
Discovered in 1990, by some Italian researchers, that observed some moneys’ brains

They noticed that these neurons activated when the monkeys performed an action,
and also when they looked at other monkeys performing an action

Mirror neurons= neurons that are activated when a subject performs a certain task and when he
observes another individuals performing the same task

when they are activated, they emit electrical signals

ACTIONS
Before this experiment, researchers believed that when we perform an action, the only brain part activated
is the only the Primary Cortex Area now, researchers know that there is the activation of other areas

How mirror neurons work:

1. Activation of the Primary Visual Cortex when we observe
2. Activation of the Supplementary Motor Cortex it creates a potential motor representation of the
action, that allows us to learn by imitating
 Mirror neurons are in the Supplementary motor cortex

After the discovery of mirror neurons, some researchers discovered the Audiovisual Mirror Neurons

These neurons are able to code the action performed by another person, even with
only the presence of an auditory stimulus, without any visual one

They activate the Primary motor cortex, the Auditory motor cortex and
then the Supplementary Motor Cortex, which creates a potential action

Thanks to the use of fMRI Marco Iacoboni discovered which are the cortex areas involved in the mirror
neurons system in humans without fMRI, researchers weren’t able to carefully analyze
which are the areas activated

He asked some students to observe some movements performed by other students, and to reproduce
them
Areas activated area 40: parietal lobe
 area 44: frontal lobe Broadman’s areas
 area 45: frontal lobe
 sometimes, also area 6

The primary function of mirror neurons is connected to the understanding of the meaning of the actions of
other people
Mirror neurons create a potential act, thanks to the encoding of sensory information in motor terms

For example, if I’m looking at someone writing, some areas of the brain are
 creating a potential act of writing, even though I am not writing
EMOTIONS
Besides being able to understand other people’s actions, we are also able to understand their emotions

Emotions allow us to interpret the sensory information and to automatically trigger appropriate responses

The interpretation of other’s emotions is fundamental in order for us to protect ourselves from danger, and
also to establish initial bonds with other people

After 2 or 3 days of life, newborns are already able to recognize other’s emotions due to mirror neurons

Primary emotions pain and disgust

 they are strong emotions

Disgust Wicker used fMRI to study the perception of disgust in students. At first, he made students smell
disgusting cents. Then, he made these student look at other people smelling these disgusting cents
 he noticed that, when students directly smelt the cent and experienced disgust, some parts of
the brain activated. When they observed other people smelling the same cent, a partial
activation of the same areas took place

Pain Hutchinson electrodes to record the activity of neurons in patients that had a partial ablation of the
cingulate Cortex. He pinched these patients with a needle, and he noticed that, since they felt pain,
some areas of the brain activated. Then, when these patients observed other people getting
pinched with a needle, the same areas of the brain activated

INTENTIONS
Mirror neurons allow us to understand simple and clear intentions of other people

Some experiments, tho, show that mirror neurons can’t understand complicated intentions

It is therefore shown that mirror neurons are responsible for the understand of actions, emotions and
intentions of others.
They allow us to learn by imitation, and also to empathize with others

The neuro-mirror system has implications on some pathologies, like Strokes and Autism

In patients affected by these pathologies, there is not an activation of mirror neurons, and
this doesn’t allow people to be empathic and o understand others’ actions and intentions