Aquaculture Reports 19 (2021) 100619

Contents lists available at ScienceDirect

Aquaculture Reports
journal homepage: www.elsevier.com/locate/aqrep

Dietary arginine alleviates the oxidative stress, inflammation and

immunosuppression of juvenile Chinese mitten crab Eriocheir sinensis under
high pH stress
Changle Qi a, Xiaodan Wang a, *, Fenglu Han a, Xuefeng Chen c, Erchao Li b, Meiling Zhang a,
Jian G. Qin d, Liqiao Chen a, *
a
Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, Shanghai, 200062, PR China
b
Department of Aquaculture, College of Marine Sciences, Hainan University, Haikou, Hainan, 570228, PR China
c
Agriculture Ministry Key Laboratory of Healthy Freshwater Aquaculture, Key Laboratory of Freshwater Aquaculture Genetics and Breeding of Zhejiang Province,
Zhejiang Institute of Freshwater Fisheries, Huzhou, 313001, PR China
d
College of Science and Engineering, Flinders University, Adelaide, SA, 5001, Australia

A R T I C L E I N F O A B S T R A C T

Keywords: This study investigates the effect of arginine (Arg) on the growth, antioxidant capacity, inflammation and im­
Arginine munity of juvenile Chinese mitten crab Eriocheir sinensis under high pH stress. Three diets containing 23.7 g/kg
High pH stress (control) 31.4 g/kg and 40.1 g/kg Arg were formulated and fed to crabs (3.37 ± 0.01 g) at high pH (pH = 9.5) for
Antioxidant capacity
eight weeks. The weight gain and specific growth rate significantly increased in crabs fed the 31.4 g/kg and 40.1
Inflammation
Immunity
g/kg Arg diets (P < 0.05). Furthermore, Arg improved the antioxidant capacity by increasing the activities of
superoxide dismutase, catalase and glutathione production in the hepatopancreas (P < 0.05). In addition, Arg
significantly downregulated the inflammatory and apoptotic genes including LPS-induced TNF-α factor, p38
mitogen-activated protein kinase, a disintegrin and metalloprotease 17, Bcl-2-associated X and cysteine-aspartic
acid protease 3 (P < 0.05). Arg significantly upregulated the immune genes including crustin, relish and per­
oxinectin (P < 0.05). The respiratory burst of crabs fed the control diet was significantly lower than those fed the
31.4 g/kg Arg and 40.1 g/kg Arg diets after LPS injection of 0 h, 6 h and 12 h (P < 0.05). This study indicates that
dietary Arg can alleviate oxidative stress and inflammation and improve the immunity of juvenile Chinese mitten
crab under high pH stress.

1. Introduction alleviate the adverse effects of high pH stress.

High pH stress is a common environmental stress in aquaculture. It
can increase reactive oxygen species (ROS) production to cause oxida­
tive stress (Han et al., 2018; Wang et al., 2009). Meanwhile, high pH
stress can also suppress growth, inhibit ammonia excretion, decrease
antioxidant enzyme activities, impair gut-barrier function, reduce im­
munity and even lead to mortality in aquatic animals (Furtado et al.,
2015; Allan and Maguire, 1992; Liu et al., 2016; Wang et al., 2018; Chen
and Kou, 1996; Mauro and Moore, 1987; Weihrauch and O’Donnell,
2017; Han et al., 2016; Zhou et al., 2009; Duan et al., 2019; Yu et al.,
2011). Thus, high pH stress can adversely affect aquatic animals, and it
is necessary to direct future research to explore methods that can
To date, a few studies has been reported that the diet supplemented
with antioxidants such as astaxanthin, L-glutamine, selenium, vitamin C
and vitamin E can alleviate the oxidative damage of aquatic animals
induced by chronic high pH stress (Wang et al., 2018, Huang, 2018;
Shen, 2017; Xie et al., 2006). In addition to using functional feed ad­
ditives to alleviate high pH stress, a higher protein diet can also coun­
teract the negative effect of high pH by regulating antioxidant capacity
and inflammatory response (Qi et al., 2020). However, the role of crude
protein in feed especially the amount of specific amino acids in allevi­
ating high pH stress has not been reported.
Arginine (Arg) is a critical amino acid in aquatic animals and per­
forms a wide range of biological functions (Mai, 2011; Halver and

* Corresponding authors at: Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, Shanghai,
200241, PR China.
E-mail addresses: xdwang@bio.ecnu.edu.cn (X. Wang), lqchen@bio.ecnu.edu.cn (L. Chen).

https://doi.org/10.1016/j.aqrep.2021.100619
Received 28 September 2020; Received in revised form 20 January 2021; Accepted 21 January 2021
Available online 29 January 2021
2352-5134/© 2021 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
C. Qi et al. Aquaculture Reports 19 (2021) 100619

Hardy, 2002; NRC, 2011). Arg not only serves as a potent stimulant of 2. Material and methods
insulin and growth hormone to regulate the growth of aquatic animals
(Uretsky and Chang, 2000; Plisetskaya et al., 1991; Cheng et al., 2012; 2.1. Experimental diets
Zhou et al., 2012; Lin et al., 2015), but also can improve antioxidant
capacity by increasing antioxidant enzymes such as superoxide dis­ The formulation and proximate composition of experimental diets
mutase, catalase, glutathione peroxidase, glutathione reductase and are shown in Table 1. Three isonitrogenous and isolipidic diets (control
glutathione S-transferase via the Keap1/Nrf2 signaling pathway or diet, 31.4 g/kg Arg diet and 40.1 g/kg Arg diet) were formulated to
AMPK-NO signaling pathway (Wang et al., 2016a; Liang et al., 2018; contain 23.7 g/kg, 31.4 g/kg and 40.1 g/kg Arg (measured level) by
Petrović et al., 2008). Besides, Arg is closely related to the immune adding crystalline L-arginine at the expense of crystalline glycine. The
function (Vincenzo and Paola, 2005). In fish, Arg can improve immunity actually measured amino acid composition of experimental diets is
by regulating the inflammatory response and TOR pathway (Wang et al., shown in Table 2.
2016a; Chen et al., 2015). Arg can also enhance specific and non-specific All ingredients were ground into a powder and sieved through a 60-
immunity of fish by regulating cytokines of plasma, such as C3 and IgM mesh strainer, and then mixed all ingredients thoroughly with an elec­
(Liang et al., 2018; Chen et al., 2015). In crustaceans, Arg can the ability tric mixer. Subsequently, oil and distilled water were added to make a
to enhance the immunity through the dough and then pelleted with a screw-press pelletizer (F-26, South China
peroxinectin-relish-crustin/lysozyme pathway (Qi et al., 2019). Never­ University of Technology, Guangzhou, China) using a 2.0-mm die. Pel­
theless, most previous studies have focused on the physiological func­ lets were air-dried at room temperature for approximately 48 h to a
tions of Arg in a non-stressed environmental condition. A few studies moisture content <100 g/kg. After drying, all diets were packed in bags
also reported that Arg can suppress stocking density stress and repeated and stored at − 20 ◦ C until use.
handling stress in aquatic animals, that might augment growth (Hoseini
et al., 2019a; Costas et al., 2007, 2013). We do not have adequate 2.2. Feeding trial, sampling and growth evaluation
knowledge of whether Arg can alleviate the oxidative stress of aquatic
animals under high pH stress. In a recent review paper, Hoseini et al. Juvenile crabs used in this experiment were obtained from a local
(2020) pointed out that arginine plays a vital role in fish immunity and farm in Shanghai, China. Prior to the trial, all crabs were stocked in 300
ammonia detoxification (Chen et al., 2016; Hoseini et al., 2019b), but L tanks (100 × 80 × 60 cm) and fed with a commercial diet for one week
the functional role of arginine in the diet may depend on the environ­ to acclimatize at the Experimental Base of Zhejiang Freshwater Fisheries
mental condition and species involved. As ammonia toxicity to fish de­ Research Institute (Huzhou, China). The experimental water was filtered
pends on ambient pH, our present paper addresses the grade-dependent
role of arginine in the diet of crab at under high pH stress.
Table 1
Chinese mitten crab (Eriocheir sinensis) is an important crustacean in Formulation and proximate composition of experimental diets (Dry matter, g/
freshwater aquaculture (Wang et al., 2016b), and its production was kg).
over 756,800 tons in 2018 (Ministry of Agriculture and Rural Affairs and
Ingredients 23.7 g/kg Arg 31.4 g/kg 40.1 g/kg
China Society of Fisheries, 2019). In the current farming model, aquatic (Control) Arg Arg
plants are used in ponds to provide shelters for crabs, and almost 60 % of
Caseina 364 364 364
the pond area is covered by hydrophytes (Gong et al., 2015). The
Gelatinb 91 91 91
downside is that the photosynthesis of aquatic plants can enhance water Corn starchc 250 250 250
pH during daytime and the pH value in crab ponds can occasionally Cholesterold 5 5 5
exceed 10.5 (Boyd, 1990; Wang et al., 2018). Thus, high pH stress could Soybean lecithind 10 10 10
be an environmental stress factor in crab farming. Fish oil 30 30 30
Soybean oile 30 30 30
Therefore, this study aims to explore the role of Arg on the allevia­ Sodium 20 20 20
tion of high pH stress in Chinese mitten crab. Our previous study has carboxymethylcellulose
found that the negative effect of the high pH at 9.5 could be counter­ Cellulose 74 74 74
acted by the high protein content in the diet compared with that at pH Choline chlorided 5 5 5
Vitamin premixf 40 40 40
7.8 (Qi et al., 2020). Specifically, when the dietary protein increased
Mineral premixg 30 30 30
from 30 % to 40 %, the weight gain of Chinese mitten crab at pH 9.5 was Butylated hydroxytoluened 1 1 1
significantly improved compared with that at pH 7.8. The pH stress Betained 30 30 30
could suppress growth of crabs when the pH is high in the environment. Glycined 20 10 0
As Arg supplementation can improve growth, antioxidant capacity and Arginined 0 10 20
Proximate analysis
immunity in fish (Wang et al., 2016a), it is unclear whether Arg sup­ Moisture 91.5 92.0 91.7
plement in the diet can alleviate high pH stress in the Chinese mitten Crude protein 421.2 420.5 420.9
crab. Based on the results of our previous study on the growth reduction Crude lipid 75.4 76.2 76.0
of Chinese mitten crab at pH 9.5 at the low level (30 %) of dietary a
Casein: Gansu hualing dairy Co., Ltd, Gansu, China.
protein (Qi et al., 2020), we further tested if the supplementation of b
Gelatin: Baotou Dongbao Bio-Tech Co., Ltd, Baotou, China.
dietary Arg would alleviate the stress of high pH at 9.5 on crab. c
Corn starch: Beijing gusong food Co., Ltd, Beijing, China.
Therefore, this study was conducted based on our previous study, the d
Sangon Biotech (Shanghai) Co., Ltd, Shanghai, China.
400 g/kg protein level of basic diet was supplemented with 10 g/kg and e
Soybean oil: Cofco food marketing Co. Ltd, Beijing, China.
f
20 g/kg Arg, respectively. Crabs were cultured in 9.5 pH water. The Vitamin premix (per 100 g premix): retinol acetate, 0.043 g; thiamin hy­
experiment lasted eight weeks to determine the growth, antioxidant drochloride, 0.15 g; riboflavin, 0.0625 g; Ca pantothenate, 0.3 g; niacin, 0.3 g;
capacity, inflammation and immunity. After the feeding trial, some pyridoxine hydrochloride, 0.225 g; para-aminobenzoic acid, 0.1 g; ascorbic acid,
crabs were injected with lipopolysaccharide (LPS) to assess the respi­ 0.5 g; biotin, 0.005 g; folic acid, 0.025 g; cholecalciferol, 0.0075 g; α-tocopherol
acetate, 0.5 g; menadione, 0.05 g; inositol, 1 g. All ingredients are filled with
ratory burst. This study has provided evidence on the alleviation of high
α-cellulose to 100 g.
pH stress by manipulating a dietary amino acid in aquaculture. g
Mineral premix (per 100 g premix): KH2PO4, 21.5 g; NaH2PO4, 10.0 g; Ca
(H2PO4)2, 26.5 g; CaCO3, 10.5 g; KCl, 2.8 g; MgSO4⋅7H2O, 10.0 g; AlCl3⋅6H2O,
0.024 g; ZnSO4⋅7H2O, 0.476 g; MnSO4⋅6H2O, 0.143 g; KI, 0.023 g; CuCl2⋅2H2O,
0.015 g; CoCl2⋅6H2O, 0.14 g Calcium lactate, 16.50 g; Fe-citrate, 1 g. All in­
gredients are diluted with α-cellulose to 100 g.

2
C. Qi et al. Aquaculture Reports 19 (2021) 100619

Table 2 anticoagulant and hemolymph mixture (1:1) was deposited in a 5 mL

Amino acid composition of experimental diets (Dry matter, g/kg). centrifuge tube, and then 100 μl nitroblue tetrazolium (NBT; 0.2 %) was
Amino acid 23.7 g/kg Arg(Control) 31.4 g/kg Arg 40.1 g/kg Arg added to react for 30 min at 37.5 ◦ C. Subsequently, 4 mL N, N-dime­
thylformamide (DMF) was added and well mixed. The mixed solution
Arginine 23.7 31.4 40.1
Glycine 49.6 39.0 27.8 was centrifuged at 2000 r/min for 5 min. Finally, 3 mL supernatant was
Asparagine 9.8 10.8 10.7 drawn out and measured using a spectrophotometer (UV765, Shanghai
Histidine 10.7 13.5 9.4 Precision & Scientific Instrument Co., LTD) at 540 nm. DMF was used as
Serine 18.2 15.7 16.2 the blank. Respiratory burst activity was expressed as OD540.
Glutamic acid 27.8 30.2 29.6
Alanine 9.1 9.6 10.5
Threonine 9.7 8.5 8.8 2.4. Sample analysis
Lysine 5.6 5.0 14.9
Tyrosine 26.2 28.9 16.8 2.4.1. Chemical composition analysis
Methionine 10.2 9.9 9.6
Chemical compositions of the experimental diets and crab were
Valine 17.8 16.9 19.2
Isoleucine 18.2 18.7 21.0 determined by standard procedures using proximate composition anal­
Leucine 26.3 26.9 30.1 ysis (AOAC, 2005). Four duplicate samples were measured in each
Phenylalanine 35.9 32.4 27.4 treatment (n = 4). Samples were dried to a constant weight at 105 ◦ C to
determine moisture content. Crude protein was determined by the
Kjeldahl method (N × 6.25) using Kjeltec™ 8200 (Foss, Hoganas,
using a quartz sand filter (Xinyi Water Treatment Equipment Factory,
Sweden). Crude lipid was quantified by the Soxhlet extraction method
Huzhou, China) and aerated before use. The experimental water pH was
using a 1000-mL Soxhlet extraction tube (Fujian Minbo Toughened
set at 9.5 by gradually adding 1 M NaOH solution. During the experi­
Glass Co. Ltd., Fujian, China). For ash content analysis, samples were
mental period, the water pH was double-checked and adjusted every 8 h
burned in a carbonization furnace (Zhejiang lichen instrument tech­
using a portable pH meter (SIN-PH-100, Hangzhou) and pH test strips. A
nology Co., Ltd) at 300 ◦ C and then placed in a muffle furnace
total of 420 crabs (3.37 ± 0.01 g, mean ± S.D.) with intact appendages
(PCD-E3000 Serials, Peaks, Japan) at 550 ◦ C for 6 h. For total amino acid
were randomly distributed into 12 tanks in four replicates. Four bundles
content analysis, the diet was freeze-dried overnight, and then the
of corrugated plastic pipes and arched tiles were placed in each tank as
amino acid composition of the diet was measured in a commercial
shelters to reduce attacking behavior. Diets with a daily ration of 3 %
testing center using the method of high-performance liquid chroma­
body weight were hand-fed to crabs three times at 07:00, 16:00 and
tography (HPLC).
24:00, with 20 %, 20 % and 60 % of the full daily ration, respectively.
Feces were removed in the morning (09:00), and the water of 30 % tank
2.4.2. Antioxidant capacity and immune enzyme activity assay
volume was exchanged daily. Any dead crabs were immediately
The enzyme activities in the hepatopancreas were measured using
removed from the tank, weighed and recorded. Feed intake of each tank
commercial assay kits (Nanjing Jiancheng Bioengineering Institute,
was recorded accurately throughout the trial period. During the exper­
Nanjing, China) in accordance with the manufacturer instructions.
imental period, the daily water temperature varied from 23 ◦ C to 25 ◦ C.
Malondialdehyde (MDA; Cat. No. A003-1), superoxide dismutase (SOD;
Dissolved oxygen was above 7 mg L− 1 and total ammonia below 0.05 mg
Cat. No. A001-1), catalase (CAT; Cat. No. A007-1-1), glutathione (GSH;
L− 1 .
Cat. No. A006-2-1), γ-glutamyl cysteine synthetase (GCS; Cat. No. A091-
When the feeding trial was ended, the crabs from each tank were
1-1), glutamate-cysteine ligase (GCL; Cat. No. A120-1-1) and total pro­
anesthetized with crushed pieces of ice, followed by counting and group-
tein (TP; Cat. No. A045-2) were determined in the hepatopancreas.
weighing of crabs by tank after fasting for 24 h. Five crabs from each
tank were euthanized and stored at − 20 ◦ C for whole-body proximate
2.4.3. Analysis of gene expression
analysis. Another 10 crabs per tank were euthanized and then the
Total RNA was extracted from the hepatopancreas using Trizol
hepatopancreas samples were collected and put into liquid nitrogen
(RN0101, Aidlab, China) according to the manufacturer’s protocol. The
immediately and then stored at − 80 ◦ C for the analyses of enzyme ac­
total RNA concentration and quality were estimated using the Nano
tivity and gene expression.
Drop 2000 spectrophotometer (Thermo, USA). If the ratio of A260/A280
Weight gain, specific growth rate, hepatopancreas index and survival
was between 1.8–2.0, the sample was used for reverse transcription
were calculated according to the following formulas:
using a Reverse Transcription Kit (CWBIO Co. Ltd., China). The specific
Weight gain (WG, %) = (final weight - initial weight) × 100/initial weight; primers for the genes of E. sinensis were designed based on the tran­
scriptome sequencing results and NCBI database using NCBI Primer
Specific growth rate (SGR, %/day) = 100 × (Ln final weight - Ln initial BLAST (Table 3). The RT-PCR amplification reactions were performed in
weight)/days; a volume of 10 μL, containing 5 μL 2 × SYBR Premix Ex TaqTM, 0.25 μL
Hepatopancreas index (HPI, %) = 100 × hepatopancreas weight/body weight; of 10 mM forward primer, 0.25 μL of 10 mM reverse primer and 4.5 μL of
diluted cDNA, using CFX96 Real-Time PCR system (Bio-rad, Richmond,
Survival (%) = 100 × final number of crabs/initial number of crabs. CA). PCR conditions were as follows: 94 ◦ C for 3 min, and following 40
cycles at 94 ◦ C for 15 s and 60 ◦ C for 50 s, and 72 ◦ C for 20 s. The gene
expression levels were normalized with the control gene β-actin and
calculated by the 2–ΔΔCT comparative CT method (Livak and Schmittgen,
2.3. LPS stimulation 2001).

For LPS injection, four crabs from each tank (16 crabs per treatment)
were randomly selected and injected with 10 μg/g LPS (Sigma-Aldrich,
L2630). Three crabs were randomly collected from each treatment at 0,
6, 12 and 24 h post-injection (n = 3). The hemolymph with anticoagu­
lant (sodium citrate 30 mmol/L, sodium chloride 338 mmol/L, glucose
115 mmol/L, ethylene diamine tetraacetic acid 10 mmol/L) was
collected and immediately used for respiratory burst quantification ac­
cording to the method modified by Liao et al. (2014). 100 μl
2.5. Statistical analysis
Statistical analysis was performed using the SPSS 25.0 for Windows
(SPSS, Michigan Avenue, Chicago, IL, USA). The data were represented
as the mean ± standard error (S.E.). All data were subject to normality
test and homogeneity of variance by using Shapiro-Wilk and Levene’s
equal variance tests, respectively. If the data conform to the normal
distribution, one-way analysis of variance (ANOVA) was used, and when

3
C. Qi et al. Aquaculture Reports 19 (2021) 100619

Table 3 3.2. Whole-body proximate composition

Primer sequences used for real-time PCR.
Primers Sequences (5’-3’) Length Product Reference The crude protein, crude lipid, ash and moisture of Chinese mitten
name size crab were not significantly affected by dietary Arg levels (P > 0.05;
P38- CACTCATGGGTGCTGACCTC 20 Table 4). However, the crude protein was slightly higher in crabs fed the
MAPK 31.4 g/kg Arg diet and 40.1 g/kg Arg diet than those fed the control diet
F
100 bp KF582665.1
(P > 0.05). The ash content was significantly higher in crabs fed the
P38- control diet than those fed the 31.4 g/kg Arg diet and 40.1 g/kg Arg diet
MAPK TACTTGAGGCCTCGCAACAC 20
R
(P < 0.05).
LITAF F ATCAGCTCCCCCACCCTATG 20
102 bp KF892539.1
LITAF R GTTGTTGGAGCAGCACCTTG 20 3.3. Antioxidant capacity
ADAM
GATGTCCGCAACCTGCTAGA 20
17 F
102 bp KC007532.1 The malondialdehyde (MDA) content was significantly higher in
ADAM
CAGGATGCCCCCTTCAAACT 20
17 R crabs fed the control diet than those fed the 31.4 g/kg Arg diet and 40.1
Bcl-2 F CATCATCTCCCTCTTCGCGG 20 g/kg Arg diet (P < 0.05, Table 5). The activity of superoxide dismutase
100 bp c141679_g4
Bcl-2 R CAGTCCCATCACGTCGATCA 20
(SOD) was significantly higher in crabs fed the 40.1 g/kg Arg diet than
Bax F AGAGATGAAGCAGACCACGC 20
Bax R TTCTACGGTGGGTGAGTCCA 20
106 bp c143681_g1 those fed the control diet (P < 0.05). The catalase (CAT) and glutathione
Caspase 3 (GSH) were significantly higher in crabs fed the 31.4 g/kg Arg and 40.1
AGGAAAAGTTCACGCCGCTA 20
F
103 bp MH183147.1
g/kg Arg diets than those fed the control diet (P < 0.05). There were no
Caspase 3 significant differences in γ-glutamyl cysteine synthetase (GCS) and
GGCTGCCTTCTGTCAGGATT 20
R
Relish F TCAGGATTCGGTGGCAACTC 20
glutamate-cysteine ligase (GCL) among diets (P > 0.05). However, the
105 bp GQ871279.1 slightly higher activities of GCS and GCL were found in crabs fed the
Relish R ATCTGCACTTGGACCGATGG 20
ProPO F GGAACACTCGGGACTTCGAG 20 31.4 g/kg Arg and 40.1 g/kg Arg diets than those fed the control diet (P
102 bp EF493829.1
ProPO R TATACCTGAAGGGGCGGTGA 20 > 0.05).
Crustin F GGCTTCTTCGAACCACCCAA 20
100 bp FJ974138.1
Crustin R GCTTGCAGACATGTTCACCG 20
β-actin F TGGGTATGGAATCCGTTGGC 20
101 bp KM244725.1
3.4. Inflammatory response and apoptotic factors
β-actin R AGACAGAACGTTGTTGGCGA 20

Notes: P38-MAPK: P38 mitogen-activated protein kinase; LITAF: The expression of LPS-induced TNF-α factor (LITAF), p38 mitogen-
Lipopolysaccharide-induced tumor necrosis factor-alpha factor; ADAM 17: A activated protein kinase (p38-MAPK) in crabs fed the 31.4 g/kg Arg
Disintegrin and metalloproteinase 17; Bcl 2: B-cell lymphoma 2; Bax: Bcl-2- and 40.1 g/kg Arg diets were significantly lower than those fed the
associated X; Caspase 3: Cysteine-aspartic acid protease 3; ProPO: control diet (P < 0.05; Fig. 1). However, the expression of a disintegrin
Prophenoloxidase. and metalloprotease 17 (ADAM 17) was only significantly down­
regulated in crabs fed the 40.1 g/kg Arg diet (P < 0.05). The expression
the means of each treatment were significantly different, Duncan’s of B-cell lymphoma (Bcl-2) was significantly upregulated in crabs fed the
multiple range test was used to compare means among the treatments. 31.4 g/kg Arg diet compared with those fed the control diet (P < 0.05).
Significance was set at P < .05. There were no significant differences in Bcl-2 gene expression between
crabs fed the control diet and those fed the 40.1 g/kg Arg diet (P > 0.05).
3. Results The mRNA levels of Bcl-2-associated X (Bax) and cysteine-aspartic acid
protease 3 (Caspase 3) were significantly downregulated in crabs fed the
3.1. Growth performance 31.4 g/kg Arg and 40.1 g/kg Arg diets than those fed the control diet (P
< 0.05).
Crabs fed the 31.4 g/kg Arg diet and 40.1 g/kg Arg diet gained
significantly more weight and specific growth rate than those fed the 3.5. Immunity
control diet (P < 0.05; Table 4). No significant differences were observed
in the hepatopancreas index and survival of crabs (P > 0.05). The expressions of prophenoloxidase (proPO) and lysozyme (LZM)
were not significantly affected by dietary Arg level (P > 0.05, Fig. 2).
However, the mRNA level of LZM was slightly increased with the
Table 4 increasing level of Arg (P > 0.05). The expression of crustin in crabs fed
Effects of arginine on the growth performance and whole-body proximate
composition of Chinese mitten crab. Table 5
　 23.7 g/kg Arg 31.4 g/kg 40.1 g/kg Effects of arginine on the antioxidant capacity of Chinese mitten crab.
(Control) Arg Arg
　 23.7 g/kg Arg 31.4 g/kg Arg 40.1 g/kg Arg
Weight gain (%) 48.18 ± 1.72a 63.71 ± 63.04 ± (Control)
1.25b 2.13b
MDA (nmol/ 0.55 ± 0.01b 0.36 ± 0.02a 0.40 ± 0.01a
Specific growth rate 0.70 ± 0.02a 0.88 ± 0.01b 0.87 ± 0.02b
mgprot)
(%/day)
SOD (U/mgprot) 0.33 ± 0.05a 0.48 ± 0.06ab 0.58 ± 0.04b
Hepatopancreas index 8.91 ± 0.12 9.22 ± 0.15 9.10 ± 0.15
CAT (U/mgprot) 1.00 ± 0.01a 1.28 ± 0.10b 1.23 ± 0.05b
(%)
GSH (μmol/gprot) 387.00 ± 29.27a 571.71 ± 555.76 ±
Survival (%) 78.75 ± 3.40 80.00 ± 3.65 82.75 ± 3.40
30.45b 36.64b
Crude protein (g/kg) 141.24 ± 3.84 150.26 ± 145.03 ±
GCS (U/gprot) 8.27 ± 0.27 9.57 ± 0.65 9.04 ± 0.40
4.52 3.62
GCL (U/gprot) 2.38 ± 0.16 2.65 ± 0.35 2.83 ± 0.27
Crude lipid (g/kg) 64.41 ± 0.90 63.58 ± 3.47 64.28 ± 2.69
Ash (g/kg) 145.00 ± 3.19b 132.85 ± 130.95 ± Notes: MDA: Malondialdehyde in the hepatopancreas; SOD: Superoxide dis­
3.32a 3.21a mutase in the hepatopancreas; CAT: Catalase in the hepatopancreas; GSH:
Moisture (g/kg) 617.43 ± 8.16 628.48 ± 631.00 ±
Glutathione in the hepatopancreas; GCS: γ-glutamyl cysteine synthetase in the
6.64 3.11
hepatopancreas; GCL: glutamate-cysteine ligase in the hepatopancreas. Different
Notes: Different lowercase letters show significant differences (P < 0.05). lowercase letters show significant differences (P < 0.05).

4
C. Qi et al. Aquaculture Reports 19 (2021) 100619

Fig. 1. Effects of arginine on the inflammation and apoptosis of Chinese mitten crab. (A) Relative expression of LPS-induced TNF-α factor (LITAF) in the hepato­
pancreas, (B) Relative expression of a disintegrin and metalloprotease 17 (ADAM 17) in the hepatopancreas, (C) Relative expression of P38 mitogen-activated protein
kinase (P38-MAPK) in the hepatopancreas, (D) Relative expression of B-cell lymphoma (Bcl-2) in the hepatopancreas, (E) Relative expression of Bcl-2-associated X
(Bax) in the hepatopancreas, (F) Relative expression of cysteine-aspartic acid protease 3 (Caspase 3) in the hepatopancreas. Different lowercase letters show sig­
nificant differences (P < 0.05).

As showed in Fig. 3, the respiratory burst of crabs fed the control diet
was significantly lower than those fed the 31.4 g/kg Arg and 40.1 g/kg
Arg diets (P < 0.05), and there were no significant differences between
the 31.4 g/kg Arg diet and the 40.1 g/kg Arg diet (P > 0.05) post LPS
injection of 0 h, 6 h and 12 h.

4. Discussion

Arg is an essential amino acid for the growth of crustacean (NRC,

Fig. 2. Effects of arginine on the immunity of Chinese mitten crab. ProPO:
Prophenoloxidase; LZM: Lysozyme (*P < 0.05).
the 40.1 g/kg Arg diet was significantly higher than those fed the control
diet (P < 0.05). Crabs fed the 31.4 g/kg Arg diet also obtained a higher
crustin expression but no significant differences were found in crabs fed
the control diet and 31.4 g/kg Arg diet (P > 0.05). The mRNA levels of
relish and peroxinectin were significantly upregulated in crabs fed the
31.4 g/kg Arg and 40.1 g/kg Arg diets than those fed the control diet (P
< 0.05).
Fig. 3. Effects of arginine on the respiratory burst of crabs after LPS stimula­
tion. Different lowercase letters show significant differences (P < 0.05).
2011). Previous studies reported that dietary supplementation with Arg
improved the growth of Chinese mitten crab (E. sinensis), Pacific white
shrimp (L. vannamei), Atlantic ditch shrimp (Palaemonetes varians) and
Kuruma shrimp (Marsupenaeus japonicus) (Palma et al., 2015; Zhou
et al., 2012; Ye et al., 2010; Alam et al., 2004). Our study was conducted
at a high pH condition, which is different from those in previous studies.
However, the results showed that Arg supplementation in diets signifi­
cantly increased the weight gain, which indicates that Arg also is able to
improve the growth of Chinese mitten crab under high pH stress. One
possible reason is Arg involved in ammonia detoxification, so that it
improved the growth of aquatic animal (Chen et al., 2016). Besides, Arg
deficiency not only can result in growth retardation but also lead to high
mortality of crab (Qi et al., 2019). Moreover, Arg deficiency combined
with high pH stress may cause poor survival. Nevertheless, the survival
was not significantly lower in crabs fed the control diet in this study. It
can be speculated that the Arg level used in this study was enough to
satisfy the need for the survival of Chinese mitten crab under the high
pH stress, although it could not meet the need for maximal growth.
In the present study, dietary Arg level did not significantly affect the
protein content. This result is similar to the results reported in Pacific
white shrimp (L. vannamei) and Kuruma shrimp (M. japonicus) (Zhou
et al., 2012; Alam et al., 2004). However, these results are different from
those in other studies in juvenile cobia (Rachycentron canadum) and
juvenile hybrid sturgeon (Acipenser schrenckii♀× A. baerii♂) (Ren et al.,
2014; Wang et al., 2017). This discrepancy may be due to a

5
C. Qi et al.
species-specific reason, or it may be caused by the difference of the
experimental environment. And this speculation warrants further study.
Environmental stress can diminish the antioxidant capacity and
result in oxidative stress (Lushchak, 2011; Winston, 1991). A previous
study reported that high pH stress decreased the content of GSH in
Chinese mitten crab (Qi et al., 2020). GSH is an important antioxidant to
cope with oxidative stress (Dar and Barzilai, 2009). Dietary Arg has been
reported to be able to increase the GSH content in fish (Wang et al.,
2016a). In the present study, dietary Arg increased the GSH content and
the activities of GCS and GCL, which are the key enzymes for GSH
synthesis (Lu, 2013). It indicates that Arg can increase synthesis GSH
under high pH stress. In addition, the antioxidant enzyme system is the
second line of defense to cope with oxidative stress (Dar and Barzilai,
2009). In the defense system, SOD is an important enzyme to dismutase
the superoxide anion (Dar and Barzilai, 2009; Canesi, 2015), following
the end product of the dismutation reaction, H2O2 can be removed by
the catalase (Canesi, 2015). The Arg can increase the activities of anti­
oxidant enzymes through the Keap1 / Nrf2 signaling pathway or
AMPK-NO signaling pathway in other aquatic animals (Liang et al.,
2018; Wang et al., 2016a). In the present study, dietary Arg increased
the activities of SOD and CAT, which are similar to the studies in juve­
nile blunt snout bream (Megalobrama amblycephala) and Jian carp
(C. carpio var. Jian) (Liang et al., 2018; Wang et al., 2016a). In
conclusion, Arg can alleviate the oxidative stress caused by high pH
stress via increasing the GSH content and antioxidative enzymes such as
SOD and CAT in Chinese mitten crab.
Oxidative stress can induce an inflammatory response which would
affect the health status of aquatic animals (Feng et al., 2015). The
p38-MAPK is an important factor to regulate environmental stress and
inflammatory response (Sanjay et al., 2003). It can elevate the mRNA
levels of cytokines such as TNFα, IL-1 beta and IL-6 activation by acti­
vating ADAM 17 (Xu and Derynck, 2010; Scheller et al., 2011; Schieven,
2005). In the Chinese mitten crab, high pH stress upregulated the mRNA
levels of p38-MAPK, ADAM 17 and LITAF and lead to the inflammatory
response (Qi et al., 2020). In the present study, the gene expressions of
p38-MAPK, ADAM 17 and LITAF (a pivotal transcription factor with
activity on TNF-alpha transcriptional regulation (Merrill et al., 2011))
were significantly downregulated in crabs fed diets supplementation
with Arg. It indicates that dietary Arg decreased the inflammatory
response by downregulating the pro-inflammatory genes such as
p38-MAPK, ADAM 17 and LITAF. Moreover, p38-MAPK can stimulate
the activities of pro-apoptotic proteins (e.g. Bax, Bak) and inhibit the
anti-apoptotic proteins (e.g. Bcl-2, Bcl-XL) to regulate the release of
cytochrome c and caspases (Owens et al., 2009; Bragado et al., 2007).
Thus, inflammatory responses are often accompanied by apoptosis (Ma
et al., 2014). In the present study, the gene expression of Bcl-2 was
significantly upregulated in crabs fed the 31.4 g/kg Arg diet, and Bax
was downregulated in crabs fed the 31.4 g/kg Arg and 40.1 g/kg Arg
diets. The expression of caspase 3 was significantly downregulated in the
Arg supplementation diets, suggesting that Arg can decrease the
apoptotic response in Chinese mitten crab under the high pH stress by
regulating the genes of P38-MAPK, Bcl-2, Bax and caspase 3.
The health status including antioxidant capacity and anti-
inflammatory capacity, are closely related to the immune system in
aquatic animals (Limbu et al., 2018). Crabs have no adaptive immunity
and largely rely on innate immunity to defend against pathogen infec­
tion (Mu et al., 2011; Divya et al., 2018; Kim et al., 2000). A previous
study reported that Arg could upregulate the expression of peroxinectin,
which is one of the cell adhesion factors in the innate immunity system,
to enhance the immunity of Chinese mitten crab (Lv et al., 2015; Qi
et al., 2019). In the present study, the expression of peroxinectin was
upregulated in Arg supplementation groups, suggesting that Arg may
also enhance the immunity of Chinese mitten crab by upregulating the
gene expression of peroxinectin under the high pH stress. In addition,
peroxinectin can improve the production of antibacterial peptides by
enhancing the nuclear translocation of the nuclear factor NF-kB in
6
Aquaculture Reports 19 (2021) 100619
invertebrates (Denise et al., 2005; Hoffmann, 2003). Our results showed
that the expressions of relish (a NF-κB-like transcription factor (Li et al.,
2010)), crustin and lysozyme were upregulated in the Arg supplemen­
tation groups. Therefore, Arg can improve the expressions of immune
genes such as peroxinectin, relish, crustin and lysozyme to regulate the
immunity of Chinese mitten crab under pH stress.
Besides, phagocytic cells in the hemolymph of crustaceans play an
important role in pathogen elimination (Jiravanichpaisal et al., 2006;
Xian et al., 2011). The intra-membrane bound NADPH oxidase in this
kind of cells can convert the molecular oxygen to superoxide anions, and
this process is called respiratory burst (Babior et al., 1973). The active
oxygen has a strong lethality to the pathogens, and thus respiratory burst
is an indicator to reflect the bactericidal ability of phagocytes (Grant and
Loake, 2000). In the present study, the respiratory burst of crabs fed the
control diet was significantly lower than those fed the Arg supplemen­
tation diets after LPS injection of 0 h, 6 h and 12 h. The similar result was
found in juvenile blunt snout bream (M. amblycephala) (Liao et al.,
2014). It indicates that Arg can increase respiratory burst to regulate the
antibacterial ability in Chinese mitten crab under the high pH stress.
5. Conclusion
Dietary supplementation with Arg could improve the growth of
Chinese mitten crab under high pH stress. Furthermore, dietary Arg also
increased the antioxidant capacity and reduced inflammation and
apoptosis caused by high pH stress via increasing the antioxidant en­
zymes and downregulating the genes involved in an inflammatory
response and pro-apoptotic in Chinese mitten crab. Meanwhile, Arg
enhanced the immunity of Chinese mitten crab under the high pH stress
by increasing the respiratory burst and upregulating the genes involved
in the non-specific immunity.
Data availability statement
The data that support the findings of this study are available on
request from the corresponding author.
CRediT authorship contribution statement
Changle Qi: Conceptualization, Methodology, Software, Investiga­
tion, Formal analysis, Writing - original draft. Xiaodan Wang: Project
administration, Formal analysis, Writing - review & editing. Fenglu
Han: Methodology, Resources, Formal analysis. Xuefeng Chen: Re­
sources, Project administration. Erchao Li: Writing - review & editing,
Methodology. Meiling Zhang: Data curation, Formal analysis. Jian G.
Qin: Writing - review & editing. Liqiao Chen: Conceptualization, Su­
pervision, Investigation, Methodology, Writing - review & editing,
Funding acquisition.
Declaration of Competing Interest
The authors report no declarations of interest.
Acknowledgments
This research was supported by grants from the Research and
Development Project in Key Areas of Guangdong Province
(2020B0202010001), China Agriculture Research System-48 (CARS-
48), the National Natural Science Foundation of China (No. 32072986),
the National Natural Science Foundation of China (No. 31572629) and
Agriculture Research System of Shanghai, China (Grant No. 201904).
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.aqrep.2021.100619.
C. Qi et al. Aquaculture Reports 19 (2021) 100619

References Jiravanichpaisal, P., Lee, B.L., Soderhall, K., 2006. Cell-mediated immunity in
arthropods: hematopoiesis, coagulation, melanization and opsonization.
Immunobiology 211, 230–236.
Alam, M.S., Teshima, S.I., Ishikawa, M., Hasegawa, D., Koshio, S., 2004. Dietary arginine
Kim, Y.S., Ryu, J.H., Han, S.J., Choi, K.H., Nam, K.B., Jang, I.H., Lemaitre, B., Brey, P.T.,
requirement of juvenile kuruma shrimp Marsupenaeus japonicus (Bate). Aquacult.
Lee, W.J., 2000. Gram-negative bacteria-binding protein, a pattern recognition
Res. 35, 842–849.
receptor for lipopolysaccharide and beta-1,3-glucan that mediates the signaling for
Allan, G.L., Maguire, G.B., 1992. Effects of pH and salinity on survival, growth and
the induction of innate immune genes in Drosophila melanogaster cells. J. Biol. Chem.
osmoregulation in Penaeus monodon Fabricius. Aquaculture 107, 33–47.
275, 32721–32727.
AOAC, 2005. Official Methods of Analysis of AOAC International, 18th ed. Association of
Li, F., Wang, L., Zhang, H., Zheng, P., Zhao, J., Qiu, L., Zhang, Y., Song, L., 2010.
Official Analytical Chemists, Washington DC, USA.
Molecular cloning and expression of a Relish gene in Chinese mitten crab Eriocheir
Babior, B.M., Kipnes, R.S., Curnutte, J.T., 1973. Biological defense mechanisms. The
sinensis. Int. J. Immunogenet. 37, 499–508.
production by leukocytes of superoxide, a potential bactericidal agent. J. Clin.
Liang, H., Ji, K., Ge, X., Ren, M., Liu, B., Xi, B., Pan, L., 2018. Effects of dietary arginine
Invest. 52, 741–744.
on antioxidant status and immunity involved in AMPK-NO signaling pathway in
Boyd, C.E., 1990. Water Quality in Ponds for Aquaculture. Birmingham Publishing Co.,
juvenile blunt snout bream. Fish Shellfish Immunol. 78, 69–78.
Birmingham, Alabama, USA.
Liao, Y., Liu, B., Ren, M., Ge, X., Xie, J., Cui, H., Zhou, Q., Zhao, W., Chen, R., 2014.
Bragado, P., Armesilla, A., Silva, A., Porras, A., 2007. Apoptosis by cisplatin requires p53
Effects of dietary arginine level on growth performance, free essential amino acids,
mediated p38α MAPK activation through ROS generation. Apoptosis 12, 1733–1742.
hematological characteristics and immune response in juvenile blunt snout bream
Canesi, L., 2015. Pro-oxidant and antioxidant processes in aquatic invertebrates. Ann. N.
Megalobrama amblycephala. J. Fish. Sci. China. 21, 549–559.
Y. Acad. Sci. 1340, 1–7.
Limbu, S.M., Zhou, L., Sun, S., Zhang, M., Du, Z., 2018. Chronic exposure to low
Chen, J.C., Kou, C.T., 1996. Nitrogenous excretion in Macrobrachium rosenbergii at
environmental concentrations and legal aquaculture doses of antibiotics cause
different pH levels. Aquaculture 144, 155–164.
systemic adverse effects in Nile tilapia and provoke differential human health risk.
Chen, G., Liu, Y., Jiang, J., Jiang, W., Kuang, S., Tang, L., Tang, W., Zhang, Y., Zhou, X.,
Environ. Int. 115, 205–219.
Feng, L., 2015. Effect of dietary arginine on the immune response and gene
Lin, H., Tan, X., Zhou, C., Niu, J., Xia, D., Huang, Z., Wang, J., Wang, Y., 2015. Effect of
expression in head kidney and spleen following infection of Jian carp with
dietary arginine levels on the growth performance, feed utilization, non-specific
Aeromonas hydrophila. Fish Shellfish Immunol. 44, 195–202.
immune response and disease resistance of juvenile golden pompano Trachinotus
Chen, Q.M., Zhao, H.X., Huang, Y.H., Cao, J.M., Wang, G.X., Sun, Y.P., Li, Y.J., 2016.
ovatus. Aquaculture 437, 382–389.
Effects of dietary arginine levels on growth performance,body composition, serum
Liu, J.S., Wang, J., Yue, W.C., Chen, J., Huang, S., Ci, Y., Wang, C.H., 2016. The effect of
biochemical indices and resistance ability against ammonia-nitrogen stress in
pH on the molting, growth and related gene expression in juvenile mitten crab,
juvenile yellow catfish (Pelteobagrus fulvidraco). Anim. Nutr. 2, 204–210.
Eriocheir sinensis. Freshwat. Fish. 46, 96–100.
Cheng, Z., Iii, D.M.G., Buentello, A., 2012. Dietary supplementation of arginine and/or
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
glutamine influences growth performance, immune responses and intestinal
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408.
morphology of hybrid striped bass (Morone chrysops × Morone saxatilis). Aquaculture
Lu, S.C., 2013. Glutathione synthesis. Biochim. Biophys. Acta 1830, 3143–3153.
362–363, 39–43.
Lushchak, V.I., 2011. Environmentally induced oxidative stress in aquatic animals.
Costas, B., Aragão, C., Mancera, J.M., Dinis, M.T., Conceição, L.E.C., 2007. High stocking
Aquat. Toxicol. 101, 13–30.
density induces crowding stress and affects amino acid metabolism in Senegalese
Lv, S., Lu, B., Xu, J., Xu, H., Zhao, J., Li, S., Li, Y., Chen, Y., 2015. Immune response of
sole Solea senegalensis (Kaup 1858) juveniles. Aquacult. Res. 39, 1–9.
peroxinectin of Chinese mitten crab Eriocheir sinensis to exterior stimulation. Dev.
Costas, B., Rêgo, P.C.N.P., Conceição, L.E.C., Dias, J., Afonso, A., 2013. Dietary arginine
Comp. Immunol. 51, 56–64.
supplementation decreases plasma cortisol levels and modulates immune
Ma, J.Q., Ding, J., Zhang, L., Liu, C.M., 2014. Hepatoprotective properties of sesamin
mechanisms in chronically stressed turbot (Scophthalmus maximus). Aquacult. Nutr.
against CCl4 induced oxidative stress-mediated apoptosis in mice via JNK pathway.
19, 25–38.
Food Chem. Toxicol. 64, 41–48.
Dar, I., Barzilai, A., 2009. Cellular Responses to Oxidative Stress. Springer, Netherlands.
Mai, K., 2011. Aquatic Animal Nutrition and Feed Science. China Agriculture Press,
Denise, L., Hanke, M., Eiserich, J.P., Freeman, B.A., Andreas, D., Gehling, U.M., Jens, B.,
Beijing.
Volker, R., Thomas, M., Thomas, H., 2005. Myeloperoxidase mediates neutrophil
Mauro, N.A., Moore, G.W., 1987. Effects of environmental pH on ammonia excretion,
activation by association with CD11b/CD18 integrins. Proc. Natl. Acad. Sci. U. S. A.
blood pH, and oxygen uptake in fresh water crustaceans. Comp. Biochem. Physiol. C
102, 431–436.
Toxicol. Pharmacol. 87, 1–3.
Divya, M., Vaseeharan, B., Anjugam, M., Iswarya, A., Karthikeyan, S., Velusamy, P.,
Merrill, J.C., Jian, Y., Cara, C., Leeman, S.E., Salomon, A., 2011. Whole-body deletion of
Govindarajan, M., Alharbi, N.S., Kadaikunnan, S., Khaled, J.M., 2018. Phenoloxidase
LPS-induced TNF-α factor (LITAF) markedly improves experimental endotoxic shock
activation, antimicrobial, and antibiofilm properties of β-glucan binding protein
and inflammatory arthritis. Proc. Natl. Acad. Sci. U. S. A. 108, 21247–21252.
from Scylla serrata crab hemolymph. Int. J. Biol. Macromol. 114, 864–873.
Ministry of Agriculture and Rural Affairs, B.o.f.a.f.m, China Society of Fisheries, N.F.T.E.
Duan, Y., Wang, Y., Liu, Q., Zhang, J., Xiong, D., 2019. Changes in the intestine barrier
C, 2019. China Fishery Statistical Yearbook. China Agriculture Press, Beijing, China.
function of Litopenaeus vannamei in response to pH stress. Fish Shellfish Immunol. 88,
Mu, C., Zheng, P., Zhao, J., Wang, L., Qiu, L., Zhang, H., Gai, Y., Song, L., 2011. A novel
142–149.
type III crustin (CrusEs2) identified from Chinese mitten crab Eriocheir sinensis. Fish
Feng, L., Luo, J., Jiang, W., Liu, Y., Wu, P., Jiang, J., Kuang, S., Tang, L., Zhang, Y.,
Shellfish Immunol. 31, 142–147.
Zhou, X., 2015. Changes in barrier health status of the gill for grass carp
NRC, 2011. Nutrient Requirements of Fish and Shrimp. National academies press,
(Ctenopharyngodon idella) during valine deficiency: regulation of tight junction
Washington.
protein transcript, antioxidant status and apoptosis-related gene expression. Fish
Owens, T.W., Valentijn, A.J., J-P, U, Keeble, J., Zhang, L., Lindsay, J., Zouq, N.K.,
Shellfish Immunol. 45, 239–249.
Gilmore, A.P., 2009. Apoptosis commitment and activation of mitochondrial Bax
Furtado, P.S., Fugimura, M.M.S., Monserrat, J.M., Souza, D.M., Garcia, L.D.O.,
during anoikis is regulated by p38MAPK. Cell Death Differ. 16, 1551–1562.
Wasielesky, W., 2015. Acute effects of extreme pH and its influences on the survival
Palma, J., Andrade, J.P., Lemme, A., Bureau, D.P., 2015. Quantitative dietary
and biochemical biomarkers of juvenile White Shrimp, Litopenaeus vannamei. Mar.
requirement of juvenile Atlantic ditch shrimp Palaemonetes varians for lysine,
Freshwat. Behav. Physiol. 48, 417–429.
methionine and arginine. Aquacult. Res. 46, 1822–1830.
Gong, Z., Cai, C., Zhu, J., Yi, S., Ye, Y., Shen, J., Zhang, W., Zhang, Q., 2015. Effects of
Petrović, V., Buzadžić, B., Korać, A., Vasilijević, A., Janković, A., Mićunović, K.,
high pH on antioxidant capacity and astaxanthin content in Eriocheir sinensis.
Korać, B., 2008. Antioxidative defence alterations in skeletal muscle during
Freshwat. Fish. 45, 20–24.
prolonged acclimation to cold: role of L-arginine/NO-producing pathway. J. Exp.
Grant, J.J., Loake, G.J., 2000. Role of reactive oxygen intermediates and cognate redox
Biol. 211, 114–120.
signaling in disease resistance. Plant Physiol. Biochem. 124, 21–29.
Plisetskaya, E.M., Buchelli-Narvaez, L.I., Hardy, R.W., Dickhoff, W.W., 1991. Effects of
Halver, J.E., Hardy, R.W., 2002. Fish Nutrition. Academic press, California, USA.
injected and dietary arginine on plasma insulin levels and growth of pacific salmon
Han, C., Zheng, Q., Sun, Z., 2016. Gene expression and activities of antioxidant enzymes
and rainbow trout. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 98, 165–170.
in liver of Hybrid Tilapia, Oreochromis niloticus × Oreochromis aureus, under acute pH
Qi, C., Wang, X., Han, F., Jia, Y., Lin, Z., Wang, C., Lu, J., Yang, L., Wang, X., Li, E.,
stress. J. World Aquacult. Soc. 47, 260–267.
Qin, J.G., Chen, L., 2019. Arginine supplementation improves growth, antioxidant
Han, S.Y., Wang, M.Q., Wang, B.J., Liu, M., Jiang, K.Y., Wang, L., 2018. A comparative
capacity, immunity and disease resistance of juvenile Chinese mitten crab, Eriocheir
study on oxidative stress response in the hepatopancreas and midgut of the white
sinensis. Fish Shellfish Immunol. 93, 463–473.
shrimp Litopenaeus vannamei under gradual changes to low or high pH environment.
Qi, C., Han, F., Wang, X., Xu, C., Huang, Z., Li, E., Qin, J.G., Chen, L., 2020. High protein
Fish Shellfish Immunol. 76, 27–34.
diet alleviates the high pH stress in Chinese mitten crab Eriocheir sinensis.
Hoffmann, J.A., 2003. The immune response of Drosophila. Nature 426, 33–38.
Aquaculture 516.
Hoseini, S.M., Yousefi, M., Hoseinifar, S.H., Doan, H.V., 2019a. Effects of dietary arginine
Ren, M., Ai, Q., Mai, K., 2014. Dietary arginine requirement of juvenile cobia
supplementation on growth, biochemical, and immunological responses of common
(Rachycentron canadum). Aquacult. Res. 45, 225–233.
carp (Cyprinus carpio L.), stressed by stocking density. Aquaculture 503, 452–459.
Sanjay, K., Jeffrey, B., Lee, J.C., 2003. p38 MAP kinases: key signalling molecules as
Hoseini, S.M., Vatnikov, Y.A., Kulikov, E.V., Petrov, A.K., Hoseinifar, S.H., Doan, H.V.,
therapeutic targets for inflammatory diseases. Nat. Rev. Drug Discov. 2, 717–726.
2019b. Effects of dietary arginine supplementation on ureagenesis and amino acid
Scheller, J., Chalaris, A., Garbers, C., Rose-John, S., 2011. ADAM17: a molecular switch
metabolism in common carp (Cyprinus carpio) exposed to ambient ammonia.
to control inflammation and tissue regeneration. Trends Immunol. 32, 380–387.
Aquaculture 511, 734209.
Schieven, G.L., 2005. The biology of p38 kinase: a central role in inflammation. Curr.
Hoseini, S.M., Khan, M.A., Yousefi, M., Costas, B., 2020. Roles of arginine in fish
Top. Med. Chem. 5, 921–928.
nutrition and health: insights for future researches. Rev. Aquac. 12, 2091–2108.
Shen, Z., 2017. The effects of dietary magnesium, selenium and astaxanthin in juvenile
Huang, Z., 2018. The Effects of pH on the Growth and Its Intervention with Nutritional
Chinese mitten crab Eriocheir sinensis exposed to ambient stress. East China Normal
Methods in Juvenile Chinese Mitten Crab Eriocheir sinensis. East China Normal
University, Shanghai.
University, Shanghai.

7
C. Qi et al.
Uretsky, A.D., Chang, J.P., 2000. Evidence that nitric oxide is involved in the regulation
of growth hormone secretion in goldfish. Gen. Comp. Endocrinol. 118, 461–470.
Vincenzo, B., Paola, Z., 2005. Regulation of immune responses by L-arginine metabolism.
Nat. Rev. Immunol. 5, 641–654.
Wang, W.N., Zhou, J., Wang, P., Tian, T.T., Zheng, Y., Liu, Y., Mai, W.J., Wang, A.L.,
2009. Oxidative stress, DNA damage and antioxidant enzyme gene expression in the
Pacific white shrimp, Litopenaeus vannamei when exposed to acute pH stress. Comp.
Biochem. Physiol. C Toxicol. Pharmacol. 150, 428–435.
Wang, B., Feng, L., Chen, G., Jiang, W., Liu, Y., Kuang, S., Jiang, J., Tang, L., Wu, P.,
Tang, W., Zhang, Y., Zhao, J., Zhou, X., 2016a. Jian carp (Cyprinus carpio var. Jian)
intestinal immune responses, antioxidant status and tight junction protein mRNA
expression are modulated via Nrf2 and PKC in response to dietary arginine
deficiency. Fish Shellfish Immunol. 51, 116–124.
Wang, S., He, Y., Wang, Y., Tao, N., Wu, X., Wang, X., Qiu, W., Ma, M., 2016b.
Comparison of flavour qualities of three sourced Eriocheir sinensis. Food Chem. 200,
24–31.
Wang, L., Wu, J., Wang, C.a., Li, J., Zhao, Z., Luo, L., Du, X., Xu, Q., 2017. Dietary
arginine requirement of juvenile hybrid sturgeon (Acipenser schrenckii♀ × Acipenser
baerii♂). Aquacult. Res. 48, 5193–5201.
Wang, Z., Cai, C.F., Cao, X.M., Zhu, J.M., He, J., Wu, P., Ye, Y.T., 2018. Supplementation
of dietary astaxanthin alleviated oxidative damage induced by chronic high pH
stress, and enhanced carapace astaxanthin concentration of Chinese mitten crab
Eriocheir sinensis. Aquaculture 483, 230–237.
Weihrauch, D., O’Donnell, M., 2017. Acid-Base Balance and Nitrogen Excretion in
Invertebrates. Springer International Publishing, Switzerland.
Aquaculture Reports 19 (2021) 100619
Winston, G.W., 1991. Oxidants and antioxidants in aquatic animals. Comp. Biochem.
Physiol. C Toxicol. Pharmacol. 100, 173–176.
Xian, J., Wang, A., Chen, X., Gou, N., Miao, Y., Liao, S., Ye, C., 2011. Cytotoxicity of
nitrite on haemocytes of the tiger shrimp, Penaeus monodon, using flow cytometric
analysis. Aquaculture 317, 240–244.
Xie, Y., Wu, R., Xie, J., Wang, G., Guan, S., Yu, D., 2006. Effects of vitamin C on non-
specific immunity of largemouth bass under high pH stress. Feed Ind. 25–27.
Xu, P., Derynck, R., 2010. Direct activation of TACE-mediated ectodomain shedding by
p38 MAP Kinase regulates EGF receptor-dependent cell proliferation. Mol. Cell 37,
551–566.
Ye, J., Wang, Y.H., Guo, J.L., Chen, J.M., Pan, Q., Shen, B.Q., 2010. Lysine,methionine
and arginine requirements of juvenile Chinese mitten crab (Eriocheir sinensis). J. Fish.
China/Shuichan Xuebao 34, 1541–1548.
Yu, Y.Q., Guo, M., Wang, Y., Yi, L., Sun, H., 2011. Effects of pH stress on five non-specific
immune parameters of Chinese mitten crab (Eriocheir sinensis). Freshwat. Fish. 41,
70–74.
Zhou, J., Wang, W.N., Wang, A.L., He, W.Y., Zhou, Q.T., Liu, Y., Xu, J., 2009. Glutathione
S-transferase in the white shrimp Litopenaeus vannamei: characterization and
regulation under pH stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 150,
224–230.
Zhou, Q.C., Zeng, W.P., Wang, H.L., Wang, T., Wang, Y.L., Xie, F.J., 2012. Dietary
arginine requirement of juvenile Pacific white shrimp, Litopenaeus vannamei.
Aquaculture 364–365, 252–258.