International Biodeterioration & Biodegradation 130 (2018) 23–31

Contents lists available at ScienceDirect

International Biodeterioration & Biodegradation

journal homepage: www.elsevier.com/locate/ibiod

Biodeterioration of mortars exposed to sewers in relation to microbial T

diversity of biofilms formed on the mortars surface
Christine Lorsa,∗, Johanne Aubeb, Rémy Guyoneaudb, Franck Vandenbulckec, Denis Damidota
a
IMT Lille Douai, Université Lille 1, Laboratoire de Génie Civil et géo-Environnement, LGCgE EA4515, Département Génie Civil & Environnemental, 941 rue Charles-
Bourseul, 59508 Douai, France
b
Université de Pau et des Pays de l'Adour, IPREM UMR CNRS 5254, IBEAS, Equipe Environnement et Microbiologie, BP 1155, 64013 Pau Cedex, France
c
Université Lille 1, Laboratoire de Génie Civil et géo-Environnement, LGCgE EA4515, Environmental Axis, Bât. SN3, 59655 Villeneuve d´Ascq, France

A R T I C LE I N FO A B S T R A C T

Keywords: Strong deterioration of concrete in sewer systems is mainly due to microorganisms and especially to sulfur-
Sewer oxidizing bacteria. Mortars made either with ordinary Portland cement (OPC) or calcium aluminate cement
Mortar (CAC) were exposed in a waste water collector for five years. Mortar microstructure observed by microscopy
Biodeterioration reported a larger thickness of the degraded zone for OPC mortar. Taxonomic identification of bacterial com-
Sulfur-oxidizing bacteria
munities performed on biofilms collected at the mortar surface reported similar bacterial diversities, but strong
Biodiversity
differences of relative abundance. A greater neutrophilic sulfur-oxidizing bacterial (NSOB) activity was observed
Microstructure
for OPC mortar certainly in conjunction with its larger acid neutralization capacity. Thus, CAC mortar was less
biodeteriorated than OPC mortar as less NSOB were able to settle on its surface in relation with its specific
microstructure. The results of the reported field experiments have been compared with bioleaching laboratory
experiments performed on identical mortars in the presence of Halothiobacillus neapolitanus as NSOB. As the
deterioration mechanisms involved were similar, an acceleration factor with respect to the rate of in situ bio-
deterioration was determined for laboratory experiment.

1. Introduction
Concrete deterioration is one of the most serious problems affecting
sewer infrastructure which has an enormous economic impact when the
replacement or rehabilitation of sewer system is required. The dete-
rioration rate of the concrete can reach up to several millimeters per
year for sewer pipes (De Belie et al., 2004).
In sewer systems, concrete deterioration is mainly due to sulfuric
acid generated by microbial sulfur oxidation because high concentra-
tions of hydrogen sulfide (H2S), oxygen (O2) and moisture are present
in the confined atmosphere of sewer network. Hydrogen sulfide (H2S) is
produced under anaerobic conditions by sulfate-reducing bacteria
(SRB) from sulfate and other oxidized sulfur compounds present in
water and sediments. H2S volatilizes and dissolves in the moist concrete
surface. Thus, it is mainly chemically oxidized to thiosulfate (S2O32−)
and elemental sulfur (S0). In addition of H2S, CO2 and other gases
abiotically decrease the pH at the surface of concrete passing from a pH
value of 12 to 9 (Jiang et al., 2015), enabling the colonization by mi-
croorganisms, such as neutrophilic sulfur-oxidizing bacteria (NSOB)
(Mori et al., 1992; Jiang et al., 2014). These bacterial populations, such
as Thiobacillus sp., Thiomonas sp., Halothiobacillus sp., oxidize H2S and
other reduced sulfur compounds to sulfuric acid (H2SO4) and poly-
thionic acids (H2SxO6) that induce the dissolution of some minerals at
the surface of the concrete leading to a drop of pH more or less rapidly
depending on their acid neutralization capacity and the secondary
minerals that may precipitate (Bielefeldt et al., 2009). At pH around
4.5, acidophilic sulfur-oxidizing bacteria (ASOB), such as Acid-
ithiobacillus thiooxidans and Thiomonas intermedia, start to grow using
sulfur compounds as donor electrons. ASOB can survive at pH as low as
1 and produce a high amount of sulfuric acid (Soleimani et al., 2013).
As a consequence, the surface pH of concrete decrease to pH values
between 1 and 3 depending on concrete composition (Parker, 1945).
This promotes the further dissolution of minerals contained in concrete
increasing the porosity of concrete and consequently reducing the
mechanical strength of concrete that may fail. Moreover, these acidic
conditions eventually inhibit neutrophilic sulfur-oxidizing populations
in favor of more acid-tolerant sulfur-oxidizing populations (Islander
et al., 1991). Additionally to the dissolution of the minerals that are not
stable under acidic conditions, some secondary minerals can be pre-
cipitated and thus may participate to the biodeterioration of concrete.

∗
Corresponding author. IMT Lille Douai, Université Lille 1, Laboratoire de Génie Civil et géo-Environnement, LGCgE EA4515, Département Génie Civil & Environnemental, 941 Rue
Charles Bourseul, 59500 Douai, France.
E-mail address: christine.lors@imt-lille-douai.fr (C. Lors).

https://doi.org/10.1016/j.ibiod.2018.03.012
Received 2 December 2017; Received in revised form 19 March 2018; Accepted 22 March 2018
Available online 31 March 2018
0964-8305/ © 2018 Published by Elsevier Ltd.
C. Lors et al.
For example, in the case of concrete made with ordinary Portland ce-
ment (OPC), gypsum (CaSO4, 2 H2O) can be formed by the reaction
between H2SO4 and Portlandite or calcium carbonate and lead to ex-
pansion and cracking (O'Connell et al., 2010; Montery et al., 2000).
Segments of ductile cast iron coated with cementitious linings made
with blast furnace slag cement (BFSC) reported abundant cracking
caused by precipitation of secondary ettringite while no cracking was
observed in the calcium aluminate cement (CAC) lining (Peyre Lavigne
et al., 2016). Thus, the composition of concrete and especially of its
cement paste is crucial to design concretes having a good resistance to
biodeterioration. Amongst the different possibilities, concrete made
with calcium aluminate cement is often reported to be more resistant
than similar concrete made with OPC (Alexander and Fourie, 2011;
Herisson et al., 2013). The different mineralogy and microstructure of
the cement paste in CAC concrete are certainly some major parameters
to explain the observed better performance. However, the possible in-
teraction between sulfur-oxidizing bacteria (SOB) and the concrete
especially at its surface on which biofilm is formed cannot be ruled out
(Peyre Lavigne et al., 2015). Thus, it is necessary to finely characterize
the microbial diversity of sulfur-oxidizing bacteria to better understand
the concrete biodeterioration process. This can assessed using mole-
cular based techniques, such as PCR-DGGE (Huber al., 2016), fluores-
cence hybridization (FISH) (Hernandez et al., 2002) and 16S rRNA
sequencing (Dong et al., 2017). These latter techniques allow the
identification of uncultured microbial communities contrarily to con-
ventional culture dependent techniques which detect only a fraction of
the total microbial population (Harisson, 1984; Islander et al., 1991;
Keller and Zengler, 2004). Molecular microbiological methods (MMMs)
are used to improve our understanding of the effect of microorganisms
in biodeterioration. But, a multidisciplinary approach is required to
establish the significance of molecular microbiological data in respect
to biodeterioration mechanisms involved (Eckert and Skovhus, 2018).
The main objective of this study was to further explain the better
performance of CAC concrete relative to OPC concrete by linking the
biodiversity of the bacterial communities, especially SOB, developed on
biofilm at the concrete surface and the intensity of the biodeterioration.
Mortars, that are smaller and easier to manipulate than concrete sam-
ples, were placed during 5 years in a waste water collector. Then,
bacterial communities were characterized by using 16S rRNA sequen-
cing while the characterization of the microstructure of mortar was
performed in order to estimate the intensity of biodeterioration. A
second objective was to assess the relevance of laboratory bioleaching
experiments using SOB, in order to estimate the performance of mor-
tars. This was possible as identical mortars had already been studied
after being subjected to bioleaching experiments in the presence of
Halothiobacillus neapolitanus (Lors et al., 2017).
2. Materials and methods
2.1. Mortar specimens
Mortars were prepared by mixing cement, sand and water at a
weight ratio of 2:6:1, according to NF EN-196-1 standard (2006). Two
different cements were used to prepare the mortars named OPC and
CAC mortars respectively: ordinary Portland cement (CEM I 52.5)
supplied by HOLCIM (France) and calcium aluminate cement supplied
by KERNEOS (France). The chemical composition of both cements was
determined by X-ray fluorescence spectroscopy (Bruker, Pioneer S4,
Table 1
Content (as atom %) of chemical elements containing in ordinary Portland cement (OPC) and calcium aluminate cement (CAC).
O Ca Si Fe Al S K
OPC 41.1 41.9 7.5 2.9 2.6 1.8
CAC 42.7 26 25.9 2.1 1.2 1.1
24
International Biodeterioration & Biodegradation 130 (2018) 23–31
USA) (Table 1). The sand used was standard siliceous sand that is ex-
pected to be inert in the presence of sulfuric acid. The mortar was
casted into PVC cylindrical moulds, in order to obtain cylindrical
mortar samples (diameter 2.9 cm, height 6.3 cm, surface 70.6 cm2 and
volume 41.6 cm3). Before the setting of the cement, a steel hook was
inserted in the upper face of the mortar sample. The mortars were de-
moulded after 1 day and were cured in pure water at 20 °C during 28
days. After curing, the surface pH measured with pH surface electrode
(SentixSur, WTW) was around 13. A specific device, named mortar
collar, was designed, in order to suspend several mortar samples and to
prevent the interactions between the samples. A mortar collar was
made of four mortar samples that were attached by their steel hook to a
steel cable protected by a Teflon sheath. Additionally, pieces of larger
Teflon tube were used between the mortar samples to avoid any contact
and cross contamination between them. Two mortar collars were made,
each one with either mortars OPC or mortars CAC and then installed in
the emerged part of the collector of waste waters of Urban Community
of Lille (France) in august 2008. This collector was chosen due to easy
access and because it was subjected to H2S contents with average of
7 mg m−3. It has to be noticed that sometimes the collector may be
almost completely filled by waste water and consequently that the
samples may be sometimes in direct contact with the waste water.
2.2. Mortars sampling
After 5 years of exposure (August 2014), one sample of each type of
mortar was removed from mortar collar in order to be analyzed.
The biofilm was collected from the entire mortar surface of each
mortar sample by scraping with a clean metal spatula, and then
transferred in sterile 50 mL centrifuge tube. Moreover, a biofilm sample
was collected on the concrete wall of the collector of waste waters
(sample named C). For total bacterial counts, biofilm samples were
directly used by mixing 0.5 g of biofilm with 10 mL of sterile Ringer
solution (Ramsay, 1984). For molecular analysis, the biofilm samples
were stored at −80 °C.
2.3. Microstructural and mineralogical analysis of mortars
Mortars were dried at 40 °C during 7 days. The mortar cylinder was
impregnated in epoxy resin to avoid any damage during further pre-
paration especially at the surface of the sample. The sample was then
cut perpendicularly to the spherical sections in two equivalent pieces.
The cut section enables us to observe the degraded areas located on its
edges. Then, one of these two pieces was polished to produce a flat
section. After hardening of the epoxy resin, the surface was pre-po-
lished under water using several diamond-covered polishing discs
having a decreasing particle size: 151, 75, 46 and 16 μm. To obtain a
flat surface prior to fine polishing steps, samples were polished using a
silicon carbide grinding wheel (particle size: 8 μm). The fine polishing
steps were performed using diamond pastes of decreasing particle size
(9, 6, 3, 1, ½, and ¼ μm). Observation corresponded to the bottom of
the mortar cylinder and the two first cm of the sample.
Samples were gold coated before observation under a scanning
electron microscopy (SEM) (Hitachi S-4300SE/N, Japan). Backscattered
electron (BSE) imaging was performed (20 KeV and 2 KA) and com-
plemented by energy-dispersive X-ray spectroscopy (EDS) analyses with
a Thermoscientific Ultradry EDX detector running at 15 kV. BSE ima-
ging gave some indications on the intensity of the deterioration of the
Na Mg P Ti C Sr
0.6 0.4 0.4 0.2 0.2 0.13 0.1
0.3 0.3 42.7 26 25.9 2.1 1.2
C. Lors et al.
cement paste that is related to modifications of its mineralogical com-
position often associated to a variation of the mean atomic weight that
induces a different grey level on micrographs. Additionally, dissolution
of some minerals of the cement paste results in an increase of porosity
that is easily observed by its black color. EDS spot analysis was used to
determine the gradient of concentration in Ca, Si, Al, Fe and S elements
from the unaltered portion located at the center of the mortar cylinder
to the altered surface. Spots were made at different positions from the
center to the surface following a straight line but their positions were
chosen by the operator. Thus, EDS spot analysis was always performed
on cement paste. Only the most relevant spots were reported. This
procedure was repeated several times on different locations. Major
changes in the chemical composition were used to estimate the
boundaries between unaltered and degraded areas. However, due to the
presence of sand grains in mortar, these boundaries were not as well
defined than in the case of pure cement paste. This scatter was ac-
counted in the presentation of the results: spot N°2 represents the dis-
tance from the surface of the sample for which all EDS analyses per-
formed were always different from the unaltered paste. On the other
hand, at the distance of spot N°1, all EDS analyses corresponded to
unaltered paste. It is acknowledged that the mean boundary position
lies between spots N°2 and N°1.
2.4. Counts of total bacterial communities
Total bacterial populations were counted on microplates of 96 wells
(Nunc, Nunclon Delta, Germany) on which each well contained 225 μL
of specific medium. The Nutrient Broth (NB, Difco, USA) medium was
used. Inoculation of each well was carried out with 25 μL of suspension
sample diluted to 100–10−8 with Ringer solution (Ramsay, 1984).
Three wells were inoculated by dilution. The inoculated microplates
were incubated at 30 °C during 30 days. Bacterial growth was indicated
by the change in turbidity of the medium. Enumeration of bacteria was
carried out using the Most Probable Numbers (MPN) method (Man,
1977).
2.5. Molecular analysis
2.5.1. DNA extraction, PCR amplification and MiSeq sequencing
Total DNA was extracted directly from each mortar biofilm sample
with a PowerSoil DNA Isolation kit (Mobio 12888-100, Ozyme, France)
according to manufacturer's instructions.
PCR amplifications were performed with the universal eubacterial
16S rRNA gene primers 334F (5′ ACGGRAGGCAGCAG 3′) and 801R (5′
CTTACCAGGGTATCTAATCCT 3’) (Liu et al., 2007; Andersson et al.,
2008). Forwards and reverse primers contained the adapter sequences
(CTTTCCCTACACGACGCTCTTCCGATCT) and (GGAGTTCAGACGTGT
GCTCTTCCGAT) respectively used in Illumina sequencing technology.
PCR reactions included different steps: a short denaturation for
5 min at 95 °C, followed by 35 cycles of denaturation for 45 s at 95 °C,
annealing for 45 s at 58 °C and elongation for 1 min at 72 °C. The last
step consisted of extension for 10 min at 72 °C.
16S rRNA genes fragments were amplified from the extracted total
DNA (0.5 μL) with 0.625U of Taq DNA polymerase (Eurobio) in pre-
sence of 0.2 μM of primers, 0.2 μM of dNTP, 0.6 mM of MgCl2 and 1X
PCR buffer in a final volume of 25 μL. Sequencing were performed on
the GeT-PlaGe platform of Toulouse (France) using MiSeq 250 paired
technology (Illumina). Raw sequences were submitted to the National
Center for Biotechnology Information (NCBI) Sequence Read Archive
(SRA) under BioProject number PRJNA397517.
2.5.2. 16S rRNA gene analysis
16SrRNA sequences analysis was carried using Mothur software
(Schloss et al., 2009) with a modified version of the Illumina MiSeq SOP
pipeline (Kozich et al., 2013). Briefly, paired sequences were joined into
contig and sequences were filtered based on homopolymer (less than 9),
25
International Biodeterioration & Biodegradation 130 (2018) 23–31
ambiguous base calls (none allowed) and size (between 430 and 490
nucleotides). Chimeric sequences were detected with Uchime and re-
moved (Edgar et al., 2011). Resulting sequences were aligned to the
Silva SEED database from release v119 and trimmed to the primer-
targeted region of the 16S rRNA. Alignments were subsequently as-
signed to taxa using the naïve Bayesian classifier. OTUs were generated
based on a 97% sequence similarity threshold with the average
neighbor algorithm. Singletons were removed and data set was sub-
sampled to the lowest read count (n = 22437). Using the ARB software
(Ludwig et al., 2004) representative sequences of the 50 most abundant
OTU were aligned on the 16S rRNA-based LTP release 123 (Yarza et al.,
2008). Resulting phylogenetic trees were exported and used to cluster
the OTU on the heatmap. Diversity index, heatmap and histogram were
obtained using R statistical platform with the vegan, gplots and ggplot2
packages.
3. Results
3.1. Microstructural analysis of mortars
For mortar prepared with OPC, it clearly appeared that the micro-
structure at the surface is very different than the microstructure ob-
served deeper in the sample (Fig. 1). The cement paste that engulfed the
large sand grains, having a homogeneous medium grey, looked to be
less dense at the surface and presented some micro-cracks appearing in
black. Indeed, it has to be noticed that the different levels of grey on the
micrographs resulted from the interactions of backscattered electrons
with sample atoms. These levels of grey are linked to the mean atomic
weight that interacts with electrons, i.e., darker grey levels corre-
sponded to areas with lighter mean atomic weights. Black areas cor-
responded to the resin intruded into the sample before the preparation
of the polished section that contained almost only carbon. Thus, the
porosity inside the sample or areas out of the sample appeared in black
in the micrograph. Additionally, it was noticed that three zones parallel
to the surface exhibited different grey levels. The first zone had a dark
grey and corresponded to the more porous area located at the surface of
the sample. This strongly degraded zone in which the sand grains are
sometimes loosely bound to the cement paste, had an average thickness
of 950 μm. Additionally, some sand aggregates appeared directly at the
surface indicating that the fine coating by the cement paste (mean
thickness of 50 μm) had disappeared. Thus, the overall thickness of the
strongly degraded zone was 1000 μm in average. Then, deeper, the
cement paste appeared to be denser with a light grey. This zone was
called degraded zone. Finally, the remaining cement paste had a
medium grey level similar over the bulk part of the sample and corre-
sponded to the unaltered zone. It was difficult to define the limit be-
tween the degraded zone and the unaltered one just considering the
variation of grey levels as small variations of chemical composition are
occurring. Thus, EDS spot analyses were used to get some additional
data relative to the evolution of the mean atomic concentration of the
three reported zones (Table 2). Accordingly to the cement chemical
composition of OPC and omitting O, Ca was the most abundant che-
mical element followed by Si, Al and Fe in the bulk cement paste (spots
N°0 and 1 in Table 2). Passing from the bulk to the surface, calcium
content decreased progressively to low contents in the strongly de-
graded zone while the opposite trend was observed for Si and Fe. The
Ca/Si molar dropped markedly at 4000 μm (spot N°2 in Table 2).
Consequently, the limit between the degraded zone and the unaltered
one was ranging between 4000 and 6500 μm (spots N°1 and 2 in
Table 2).
The gradient in calcium content in the degraded zone of the cement
paste is consistent with the higher solubility of the minerals that mostly
contain calcium and especially Portlandite (Ca(OH)2). Thus, Ca was
preferentially leached out compared to Si and Fe but also Al at a lesser
extent. The mineral phases containing the chemical elements in the
strongly degraded zone were likely to be badly crystalized metal
C. Lors et al. International Biodeterioration & Biodegradation 130 (2018) 23–31

Fig. 1. Observation of OPC mortar (surface on the left and bulk on the right) by SEM.

Table 2 Al(OH)3 is expected to be the major mineral in this strongly degraded

Spot EDS analysis on the paste of OPC mortar at several distance from surface zone. Additionally, Ca was almost depleted apart in some areas where it
(only the major elements are presented and given as atom %). was associated to Ti certainly in the form of calcium titanate that is
Zone Spot N° distance O Ca Si Al Fe S Ti insoluble. This is consistent with the higher solubility of calcium con-
from surface taining minerals similarly to OPC paste. On the other hand, Si and Fe
(μm) contents increased slightly. Important amounts of S were also detected
in the strongly degraded zone (spots N° 4 to 7 in Table 3). As S is not
Unaltered 0 12000 61.9 24.2 6.4 2.3 1.8 1.4 0.0
1 6500 62.7 24.1 6.5 2.4 2.1 0.3 0.1 contained in CAC (Table 1 and spots N° 0 and 1 in Table 3), its presence
is a direct proof of the sulfur-oxidizing microorganisms activity leading
Degraded 2 4000 60.0 21.9 10.9 1.6 3.0 1.2 0.0 to the formation of sulfates that diffuse into the mortar during the
3 1500 62.6 18.1 11.6 1.7 3.9 0.6 0.0
biodeterioration process. In acidic conditions, sulfates reacted with Al
Strongly 4 900 60.7 1.7 14.2 1.2 17.5 0.6 0.0
to form Al2(SO4)3.xH2O phases in the strongly degraded zone. Indeed,
degraded 5 600 62.6 2.1 19.6 1.9 9.8 0.6 0.1 sulfates are not expected to be associated with Ca to form gypsum as Ca
6 300 60.3 1.7 16.1 1.1 18.3 0.3 0.0 present in this zone is contained in insoluble calcium titanate. Conse-
7 100 45.6 2.6 29.4 4.8 14.2 1.1 0.3 quently, the thickness of the strongly degraded zone that is completely
depleted in Ca, was considered to be equal to the thickness of the darker
area at the edge of the mortar and thus was equal to 800 μm. Then, the
hydroxides, such as reported during leaching experiments in acidic degraded zone displayed a gradient in Ca content such as for OPC
conditions (Lors and Damidot, 2015) or bioleaching experiments by mortar. In the case of CAC mortar that does not contain S, this chemical
NSOB or ASOB (Hondjuila Miokono, 2013). Nevertheless, the small element is a perfect tracer to determine the depth of the diffusion front
enrichment of Al observed at the sample surface (spot 7 in Table 2) is and thus of the limit between the degraded and unaltered zones. S was
consistent with the presence of Al(OH)3. Thus, the pH value at the detected at 3500 μm (spot N° 2 in Table 3) contrarily to 5000 μm where
mortar surface was not expected to be lower than 3 that is the minimum S was no longer detected (spot N°1 in Table 3). Thus, the limit between
pH value at which Al(OH)3 remains stable. The presence of Al(OH)3 is the degraded and unaltered zones ranged between 3500 and 5000 μm.
an important tracer, in order to estimate the advancement of the bio- In summary, the strongly degraded zone that mostly contained Al(OH)3,
deterioration process. Indeed, if the last stage of biodeterioration that was less degraded and thus denser than in the case of OPC sample. A
involves ASOB, is reached, Al(OH)3 should not be longer observed as denser microstructure is impacting the rate of diffusion as diffusion
pH drops below 3. Thus, in the present case, the NSOB were expected to coefficient increases when the amount of porosity increases con-
be the main SOB involved in the biodeterioration. comitantly with the dissolution of mineral in response to the leaching.
The surface of sample made with CAC appeared to be less deterio- Consequently, the thickness of the degraded zone of CAC sample was
rated than OPC sample (Fig. 2). Indeed, it was still possible to observe, lower than the one for OPC sample. Moreover, the presence of large
on most of the edges, the fine coating of cement paste covering the sand amounts of Al(OH)3 in the strongly degraded zone is also in agreement
grains. The grey levels also demonstrated the presence of a darker area with leaching performed at constant pH of 4 (Lors and Damidot, 2015).
at the edge having an average thickness of 800 μm. Grey levels were not On the other hand, similar leaching experiment performed at pH 2,
varying sufficiently deeper in the sample, in order to depict different indicated that most of Al(OH)3 was dissolved in the strongly degraded
zones that could have been altered. EDS spot analyses gave a more zone that consequently was very porous (Lors and Damidot, 2015). This
precise differentiation of the modifications of the chemical composition confirms that the pH at the mortar surface remained greater than 3.
Consequently, it is postulated that the biodeterioration process mostly
induced by leaching as a function of the depth into sample. First, the
initial zone that appeared darker and more strongly degraded was involved NSOB that are not able to survive to pH lower than 3
composed mainly of Al if O is omitted (spots N° 4 to 7 in Table 3). Thus, (Hondjuila Miokono et al., 2011). If large amounts of ASOB had been

26
C. Lors et al. International Biodeterioration & Biodegradation 130 (2018) 23–31

Fig. 2. Observation of CAC mortar (surface on the right and bulk on the left) by SEM.

Table 3 development of the bacteria are less favorable.

Spot EDS analysis on the paste of CAC mortar at several distance from surface Bacterial community analyses were conducted using sequencing of
(only the major elements are presented and given as atom %). the 16S rRNA V3V4 region amplicons. A total of 2.675 different OTUs
Zone Spot N° distance O Ca Si Al Fe S Ti were obtained at the 3% dissimilarity clustering level. The number of
from surface OTUs per samples ranged between 793 and 1477 (Table 5). Alpha di-
(μm) versity indexes indicated a lower observed and estimated species rich-
ness on C sample (Table 5). Reduced community evenness was also
Unaltered 0 12000 60.1 14.9 1.5 21.6 0.6 0.0 0.1
1 5000 59.5 14.7 1.7 22.3 0.7 0.0 0.1 observed on C sample indicating an uneven distribution of the popu-
lation as compared to the OPC and CAC mortars. Prevalent class were
Degraded 2 3500 60.4 10.1 1.7 24.3 0.7 0.4 0.1 the Alphaproteobacteria (29.8%), the Sphingobacteria (25.0%) and the
3 1100 59.7 4.2 1.8 30.6 0.5 1.7 0.3 Gammaproteobacteria (21.1%) (Fig. 3A). For OPC mortar, Alphaproteo-
Strongly 4 700 67.5 0.2 0.6 28.8 0.3 2.5 0.0
bacteria was the most represented class with 19.5%, following by Be-
degraded 5 400 61.5 0.8 2.3 27.6 0.5 5.8 0.4 taproteobacteria and Sphingobacteria (17.2% and 16.5% respectively).
6 200 56.4 2.4 3.7 26.1 1.3 7.2 1.8 The OPC mortar presented a dominance of Chitinophagaceae with the
7 50 63.8 0.4 1.0 29.6 0.7 4.0 0.2 OTU15 (4.7%) belonging to Sphingobacteria class. High relative abun-
dance was also observed for OTU19 related to the Nitrosospira genus
(2.9%) within the Betaproteobacteria group. For CAC mortar, Gamma-
proteobacteria was the most abundant (36.6%), following to Alphapro-
present, pH would have drop below 3 leading to a very different mi-
teobacteria (18.1%) and Actinobacteria (17.6%). CAC mortar exhibited
crostructure for the strongly degraded zone (Hondjuila Miokono,
high relative abundances of OTU5 (8.2%) and OTU2 (3.9%) related to
2013).
unclassified Enterobacteriaceae (Gammaproteobacteria) and Pseudono-
Mortars made with CAC were less biodeteriorated than those con-
cardia (Actinobacteria). The most abundant phylotypes in C sample
taining OPC as expected (Alexander and Fourie, 2011; Herisson et al.,
(OTU1 and OTU4) were members of the genera Sphingomonas (Alpha-
2013). The origin of the better performance of CAC mortar can ob-
proteobacteria) and Chitinophaga (Sphingobacteria) accounting for 15.4%
viously be related to the different mineralogy of CAC paste as demon-
and 7.7% of the sequences respectively (Fig. 3B).
strated by leaching experiments in acidic conditions (Lors and Damidot,
The most prevalent phylotype among sulfur-oxidizing bacteria
2015), but the bacterial populations of biofilm present at the surface of
known to be involved in concrete biodeterioration (Gu et al., 2011; Li
mortars may also impact the performance. Thus, bacterial communities
et al., 2017; Okabe et al., 2007; Vincke et al., 2001; Wei et al., 2014)
were characterized at the surface of both CAC and OPC mortars.
were represented by a member of the Thiobacillus genus (OTU31) ac-
counting for 1.3% of the sequences on the OPC mortar. This phylotype
3.2. Microbiological characteristics of mortars had 100% identity with the Thiobacillus thioparus type strain (Starkey;
NR_117817; Boden et al., 2012). This OTU accounted for less than 0.1%
The sizes of total bacterial populations of biofilm present at the of the sequences in the other mortars. Dominant OTU related to sulfur-
surface of mortars were different (Table 4). OPC Mortar contained a oxidizing bacteria in C sample (1.1%) was also related to Thiobacillus
total bacterial population that was about 30 times larger than CAC genus (OTU46). Blast alignment showed 99% of identity with Thioba-
mortar: 6.2 107 and 1.9 106 bacteria /g of biofilm respectively. On the cillus plumbophilus strain Gro7 (accession number NR_114805, Drobner
other hand, the biofilm collected on the wall of the collector (C sample) et al., 1992). This name has never been validated and a reclassification
contained a weaker total bacterial population of 1.7 105 bacteria /g of as Sulfuriferrula plumbophilus has been proposed (Watanabe et al.,
biofilm. Indeed, the wall of the collector is less subjected to periods 2015). This OTU accounted for 0.4% of the sequences to OPC mortar
during which it is in contact with waste water and thus conditions of and less than 0.01% to CAC mortar. Halothiobacillus neapolitanus were

27
C. Lors et al. International Biodeterioration & Biodegradation 130 (2018) 23–31

Table 4
Total bacterial (TB) and neutrophilic sulfur-oxidizing bacterial (TNSOB) populations at the surface of OPC, CAC and C samples. Proportions (%) of Thiobacillus
thioparus, Sulfuriferrula plumbophilus, Halothiobacillus neapolitanus are obtained by molecular analysis. NSOB (%) corresponds to the sum of these OTUs. TNSOB
(bacteria g−1 of biofilm) = TB X NSOB (%) /100.
Samples TB Thiobacillus thioparus Sulfuriferrula plumbophilus Halothiobacillus neapolitanus NSOB TNSOB

−1
(bacteria g of biofilm) (% of TB) (% of TB) (% of TB) (% of TB) (bacteria g−1 of biofilm)

OPC 6.2 E+07 1.3 0.4 0.05 1.7 1.1 E+06

CAC 1.9 E+06 0.1 0.01 0.01 0.1 2.3 E+03
C 1.7 E+05 0.1 1.1 0.1 1.30 2.2 E+03

Table 5 observed among rare OTU: they represented 0.1% of the sequences in C
Richness and diversity indices for the bacterial communities in OPC, CAC and C sample, 0.05% in OPC mortar and less than 0.01% in CAC mortar. Thus,
samples. OPC mortar was more than 400 times richer in NSOB compared to CAC
Samples OTU richness 16SrRNA Pielou's evenness mortar and the concrete wall of the collector (sample C). Additionally,
ASOB were not detected in any sample. This is in accordance with the
Chao1 hypotheses made in the previous paragraph related to the analysis of
the microstructure of mortars.
OPC 1394 1421.39 0.78
CAC 1477 1550.18 0.73
C 793 902.98 0.62
4. Discussion

Using microstructural and genomic approaches, it has been shown

Fig. 3. A. Relative abundances of bacterial classes observed on mortars by V3V4 rRNA amplicons. B. Heatmap displaying the 50 most abundant OTUs in the mortar
communities. Maximum parsimony phylogenetic tree displayed to the left of the heatmap was obtained with SILVA rDNA database and the ARB software. The bar on
the right side of the tree corresponds to class designations in Fig. 3A. Taxonomic classifications of the OTUs at the genus level are displayed on the right of the
heatmap.

28
C. Lors et al.
Table 6
Estimation of acceleration factor of laboratory experiments versus in situ ex-
periments.
A (μm) B (μm) C (μm) B /C D (μm)
Time (d) 81 1826 1826
OPC thickness degraded 3000 14245 between 4000 6010
zone and 6500
OPC thickness strongly 500 2374 1000 2.37
degraded zone
CAC thickness degraded 1500 7122 between 3500 4001
zone and 5000
CAC thickness strongly 300 1424 800 1.78
degraded zone
A: Thickness measured by SEM for laboratory experiments.
B: Calculated thickness after 5 years for laboratory experiments using Fick's
law.
C: Thickness measured by SEM for in situ experiments.
B /C: Acceleration factor = ratio of thicknesses of the strongly degraded zones
between laboratory experiments calculated at 5 years (B) and in situ experi-
ments after 5 years (C).
D: Calculated thickness of the degraded zone for in situ experiments that can be
compared to estimated thickness by SEM (C).
Remark: the strongly degraded zone is part of the degraded zone.
Results of laboratory experiments were obtained from another study (Lors et al.,
2017).
that CAC mortar was less deteriorated than OPC mortar when exposed
in a collector of waste water for five years. The strongly degraded zone
of OPC mortar was much more degraded than the similar zone of CAC
mortar and the thickness of the degraded zones ranged between 4000
and 6500 μm for OPC mortar compared to 3500–5000 μm for CAC
mortar. The intensity of biodeterioration was based on differences both
in the microstructure of the cement paste and in the relative abun-
dances of the bacterial communities. Both mortars exhibited micro-
structural characteristics of acidic attacks with pH higher than 3. OPC
mortar presented at the surface a strongly degraded zone richer in Si
whereas CAC mortar had an Al enriched surface leading to the forma-
tion of layers mostly composed by Al(OH)3. Similar bacterial diversities
were observed for OPC and CAC samples, but strong differences of re-
lative abundance were evidenced. A greater NSOB activity was ob-
served for OPC sample: SOB represented 1.7% of the total bacterial
populations for OPC mortar compared to 0.1% for CAC mortar. Thus,
sulfur-oxidizing bacterial population was more than 400 times larger
for OPC mortar relative to CAC mortar. Full length sequences of
16SrRNA provide better resolution of taxonomical identification than a
500 bp short 16SrRNA sequence notably for close related species.
Taxonomic classifications of short reads should be treated critically
(Martínez-Porchas et al., 2016; Soergel et al., 2012). A high relative
abundance (1.3%) of OTU related to Thiobacillus thioparus was evi-
denced in OPC mortar. Indeed, this bacterial strain but also other
bacterial strains, such as Thiothrix sp., Thiobacillus phumbophilus, Thio-
monas intermedia, Starkeya novella and Halothiobacillus neapolitanus, are
dominant in the bacterial population during the earlier stages of bio-
deterioration process on concrete walls of the Hamburg sewer system
(Milde et al., 1983; Islander et al., 1991). Sulfuriferruela plumbophilus
whose related OTU has been abundantly (0.4%) found in the biofilm at
OPC mortar surface, have also been shown to be involved in the first
steps of biodeterioration of concrete in sewer systems by Okabe et al.
(2007). Conversely, ASOB were not detected. This result indicated that
the conditions of waste waters collector in which the mortar samples
were introduced, has not reached the final stage of biodeterioration
process that has been observed in the case of other in situ studies
(Pagaling et al., 2014). The degree of biodeterioration of samples is
specific of the sewer collector and their environmental conditions. This
is in agreement with the observation of the microstructure of both
29
International Biodeterioration & Biodegradation 130 (2018) 23–31
mortars, that reported the presence of Al(OH)3 indicating that the pH at
the mortar surface was not lower than 3. Nitrosospira genus has been
shown to be more abundant on OPC sample. Although sulfur oxidation
is the major process involved in deterioration of sewer system, ni-
trifying bacteria can be involved in concrete deterioration resulting of
nitric acid production during the nitrifying process (Gu et al., 2011).
Nevertheless, most of the biodeterioration was expected to be due to
NSOB. NSOB can oxidize sulfur compounds into thiosulfate or sulfate
depending on the pH conditions: a greater the pH with respect to the
minimum pH of survival is expected to induce a stronger bacterial ac-
tivity. As the pH at the surface of a mortar is higher than the minimum
pH of survival for all NSOB (Parker and Prisk, 1953; Roberts et al.,
2002; Lors et al., 2009; Hondjuila Miokono et al., 2011), mortar will
tend to oppose to the drop of pH induced by the oxidation of sulfur
compound by NSOB. Consequently, NSOB activity will be greater and
mortar more deteriorated. This phenomenon will be stronger for mor-
tars having a greater acid neutralization capacity, such as OPC mortars
compared to CAC ones. Bioleaching experiments performed with Ha-
lothiobacillus neapolitanus demonstrated this general mechanism of in-
teraction between NSOB and cementitious materials (Lors et al., 2017)
that is expected to occur in the present case mostly due to OTU related
to Thiobacillus thioparus. Thus, the greater abundance of NSOB on OPC
mortar leading to a stronger biodeterioration, is expected to be mostly
related to the difference of mineralogy between OPC and CAC paste.
Additional secondary effects may also take place as the total bacterial
population is smaller for CAC mortar compared to OPC mortar. Indeed,
heterotrophic bacteria can be involved to biodeterioration process of
concrete: some heterotrophic bacteria use thiosulfate only in the pre-
sence of other organisms (Nica et al., 2000). Pai et al. (2017) also ob-
served that biodeterioration process is dominated by the activity of
heterotrophic microorganisms in biofilm.
The reported in situ experiments are also very valuable, in order to
assess the pertinence of laboratory assays to estimate the performance
of mortars in sewers. Indeed, the same mortars were also subjected
previously to bioleaching experiments performed using a suspension of
Halothiobacillus neapolitanus (Lors et al., 2017). These laboratory scale
experiments were carried out in order to study the biodeterioration of
mortars in simplified but well controlled conditions. The microstructure
of the degraded zone reported for bioleaching experiments was very
similar to the reported in situ experiments for which NSOB were mostly
responsible of the biodeterioration. However, the thicknesses of the
strongly degraded zone were different between laboratory and in situ
experiments: 500 μm instead of 1000 μm for OPC mortar and 300 μm
instead of 800 μm for CAC mortar (Table 6). Indeed, duration of the
laboratory experiments was 81 days compared to 5 years in situ. As
diffusion governs the thicknesses of the degraded zones, the longer is
the experiment duration, the larger are the thicknesses. In order to
estimate the acceleration factor of laboratory experiments; the thick-
ness of the strongly degraded zone was calculated for the laboratory
experiment after 5 years (1826 days) considering Fick's law. The cal-
culated thicknesses are 2374 μm and 1424 μm for OPC and CAC mortars
respectively (Table 6). These thicknesses are respectively 2.37 and 1.78
times greater than the measured thicknesses for OPC and CAC samples
exposed in situ. Thus, biodeterioration was more intense during the
laboratory experiments compared to in situ experiments with an ac-
celeration factor of 2.37 and 1.78 for OPC and CAC mortars respec-
tively. This is not surprising as the growth conditions of Halothiobacillus
neapolitanus are optimized in laboratory experiments by a renewal of
the bacterial suspensions each 21 days. Thus, the bacterial population
of 109 bacteria mL−1 of NSOB reached before each renewal, is larger
than for in situ experiments. Moreover, the mortar is always immerged
in the bacterial suspension during laboratory experiments whereas a
succession of drying and wetting periods occurred in situ. Knowing the
acceleration factor is very helpful, in order to estimate the field per-
formance of different mix designs from short term laboratory made
experiments. Additionally, the thickness of the degraded zone for the in
C. Lors et al.
situ samples could also be estimated by an alternative method to the
reported microscopic observations. Indeed, the ratio between the
thickness of the strongly degraded zone calculated by bioleaching in the
laboratory (B) and the thickness of the strongly degraded zone mea-
sured in situ (C) (2.37 and 1.78 for OPC and CAC mortars respectively)
is the same in all the parts of the degraded zone. Thus, dividing the
calculated thickness of the degraded zone for the laboratory experiment
at 5 years (B) by this ratio (B/C), gives us an estimated thickness of the
degraded zone for in situ experiment at 5 years (D): 6010 μm and
4001 μm for OPC and CAC mortars respectively. These estimated
thicknesses are in agreement with the reported microscopic observa-
tions: the boundary between unaltered and degraded zones was ranging
between 4000 and 6500 μm for OPC mortar and between 3500 and
5000 μm for CAC mortar.
5. Conclusion
The better performance of mortar made with CAC is mainly due to
lower abundances at its surface of sulfur-oxidizing bacteria community
that could be linked to its lower acid neutralization capacity.
Bioleaching experiment performed with NSOB can reproduce the bio-
deterioration patterns observed in situ for similar pH conditions. The
increase of deterioration rate for bioleaching experiments compared to
in situ assays can be assessed by comparing results obtained with similar
mortars subjected to similar pH conditions and thus similar SOB, thanks
to an acceleration factor. However, the value of the acceleration factor
is not unique as it depends on the in situ environmental conditions
leading to the prevalent development of NSOB or ASOB and especially
H2S concentration.
References
Alexander, M.C., Fourie, C., 2011. Performance of sewer pipe concrete mixtures with
Portland ad calcium cements subject to mineral and biogenic acid attack. Mat. Struct.
44, 313–330.
Andersson, A.F., Lindberg, M., Jakobsson, H., Bäckhed, F., Nyrén, P., Engstrand, L., 2008.
Comparative analysis of human gut microbiota by barcoded pyrosequencing. PLoS
One 3 e2836.
Bielefeldt, A., Gutierrez-Padilla, M.G.D., Ovtchinnikov, S., Silverstein, J., Hernandez, M.,
2009. Bacterial kinetics of sulfur oxidizing bacteria and their biodeterioration rates of
concrete sewer pipe samples. J. Environ. Eng. 136 (7), 731–738.
Boden, R., Cleland, D., Green, P.N., Katayama, Y., Uchino, Y., Murrell, J.C., Kelly, D.P.,
2012. Phylogenetic assessment of culture collection strains of Thiobacillus thioparus,
and definitive 16S rRNA gene sequences for T. thioparus, T. denitrificans, and
Halothiobacillus neapolitanus. Arch. Microbiol. 194, 187–195.
De Belie, N., Montery, J., Beeldens, A., Vincke, E., Gemert, D.V., Verstraete, W., 2004.
Experimental research and prediction of the effect of chemical and biogenic sulfuric
acid on different types of commercially produced concrete sewer pipes. Cem. Concr.
Res. 34, 2223–2236.
Dong, Q., Shi, H., Liu, Y., 2017. Microbial character related sulfur cycle under dynamic
environmental factors based on the microbial population analysis in sewerage
system. Frontiers in Microbiol. 8, 64.
Drobner, E., Huber, H., Rachel, R., Stetter, K.O., 1992. Thiobacillus plumbophilus spec.
nov., a novel galena and hydrogen oxidizer. Arch. Microbiol. 157, 213–217.
Eckert, R.B., Skovhus, T.L., 2018. Advances in the application of molecular micro-
biological methods in the oil and gas industry and links to microbiologically influ-
enced corrosion. Int. Biodeterior. Biodegr. 126, 169–176.
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011. UCHIME improves
sensitivity and speed of chimera detection. Bioinformatics 27, 2194–2200.
Gu, J.-D., Ford, T.E., Mitchell, R., 2011. Microbiological corrosion of concrete. In: Uhlig's
Corrosion Handbook, third ed. John Wiley & Sons, Inc., pp. 451–460.
Harisson, A.P., 1984. The acidophilic thiobacilli and other acidophilic bacteria that share
their habitat. Annu. Rev. Microbiol. 38, 265–292.
Herisson, J., van Hullebusch, E.D., Moletta-Denat, M., Taquet, P., Chaussadent, T., 2013.
Toward an accelerated biodeterioration test to understand the behavior of Portland
and calcium aluminate cementitious materials in sewer setworks. Int. Biodeterior.
Biodegr. 84, 236–243.
Hernandez, M., Marchand, E.A., Roberts, D., Peccia, J., 2002. In situ assessment of active
Thiobacillus species in corroding concrete sewers using fluorescent RNA probes. Int.
Biodeterior. Biodegrad. 49, 271–276.
Hondjuila Miokono, E.D., Lors, C., Lamberet, S., Damidot, D., 2011. Mise au point d’un
test accéléré de mortiers mettant en jeu une succession de bactéries sulfo-oxydantes.
Mat. Tech. 99, 555–563.
Hondjuila Miokono, E.D., 2013. Biodétérioration des mortiers avec une succession de
bactéries sulfo-oxydantes neutrophiles et acidophiles. Thèse de Doctorat de
l'Université de Lille 1, Mines de Douai, France.
30
International Biodeterioration & Biodegradation 130 (2018) 23–31
Huber, B., Herzog, B., Drewes, J.E., Koch, K., Müller, E., 2016. Characterization of sulfur
oxidizing bacteria related to biogenic sulfuric acid corrosion in sludge digesters. BMC
Microbiol. 16, 153.
Islander, R.L., Devinny, J.S., Mansfeld, F., Postyn, A., Shih, H., 1991. Microbial ecology of
crown corrosion in sewers. J. Environ. Eng. 117, 751–770.
Jiang, G., Keller, J., Bond, P.L., 2014. Determining the long-term effects of H2S con-
centration, relative humidity and air temperature on concrete sewer corrosion. Water
Res. 65, 157–169.
Jiang, G., Sun, X., Keller, J., Bond, P.L., 2015. Identification of controlling factors for the
initiation of corrosion of fresh concrete sewers. Water Res. 80, 30–40.
Keller, M., Zengler, K., 2004. Tapping into microbial diversity. Nat. Rev. Microbiol. 2,
141–150.
Kozich, J.J., Westcott, S.L., Baxter, N.T., Highlander, S.K., Schloss, P.D., 2013.
Development of a dual-index sequencing strategy and curation pipeline for analyzing
amplicon sequence data on the MiSeq Illumina sequencing platform. Appl. Environ.
Microbiol. 79, 5112–5120.
Li, X., Kappler, U., Jiang, G., Bond, P.L., 2017. The ecology of acidophilic microorganisms
in the corroding concrete sewer environment. Front. Microbiol. 8.
Liu, Z., Lozupone, C., Hamady, M., Bushman, F.D., Knight, R., 2007. Short pyrosequen-
cing reads suffice for accurate microbial community analysis. Nucleic Acids Res. 35,
e120.
Lors, C., Hajj Chehade, M., Damidot, D., 2009. pH variations during growth of
Acidithiobacillus thiooxidans in buffered media designed for an assay to evaluate
concrete biodeterioration. Int. Biodeterior. Biodegr. 63 (7), 880–883.
Lors, C., Damidot, D., 2015. Long term leaching experiments of OPC mortars at constant
pH in acidic conditions. In: Proceedings of the 14th International Congress on the
Chemistry of Cement, Beijing (Chine).
Lors, C., Hondjuila Miokono, E., Damidot, D., 2017. Interactions between Halothiobacillus
neapolitanus and cementitious materials: comparison of the biodeterioration between
Portland and calcium aluminate cement mortars. Inter. Biodeterior. Biodegr. 121,
19–25.
Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H., Yadhukumar, Y., Buchner, A.,
Lai, T., Steppi, S., Jobb, G., Förster, W., Brettske, I., Gerber, S., Ginhart, A.W., Gross,
O., Grumann, S., Hermann, S., Jost, R., König, A., Liss, T., Lüssmann, R., May, M.,
Nonhoff, B., Reichel, B., Strehlow, R., Stamatakis, A., Stuckmann, N., Vilbig, A.,
Lenke, M., Ludwig, T., Bode, A., Schleifer, K.-H., 2004. ARB: a software environment
for sequence data. Nucleic Acids Res. 32, 1363–1371.
Man, J.C., 1977. MPN tables for more than one test. European J. Appl. Microbiol. 4,
307–316.
Martínez-Porchas, M., Villalpando-Canchola, E., Vargas-Albores, F., 2016. Significant
Loss of Sensitivity and Specificity in the Taxonomic Classification Occurs When Short
16S rRNA Gene Sequences are Used.
Milde, K., Sand, W., Wolff, W., Bock, E., 1983. Thiobacilli of the corroded concrete walls
of the Hamburg sewer system. J. Gen. Microbiol. 129, 1327–1333.
Montery, J., Vincke, E., Beeldens, A., De Belie, N., Taerve, L., Van Gemert, D., 2000.
Hemical, microbiological, and in situ test methods for biogenic sulfuric acid corrosion
of concrete. Cem. Concr. Res. 30, 623–634.
Mori, T., Nonaka, T., Tazaki, K., Koga, M., Hikosaka, Y., Noda, S., 1992. Interactions of
nutrients, moisture and pH on microbial corrosion of concrete sewer pipes. Water
Res. 26, 29–37.
NF EN 196–1, 2006. Methodes d’essais des ciments – Partie 1: détermination des
résistances mécaniques. AFNOR.
Nica, D., Davis, J.L., Kirby, L., Zuo, G., Roberts, D.J., 2000. Isolation and characterization
of microorganisms involved in the biodeterioration of concrete in sewers. Int.
Biodeterior. Biodegr 46, 61–68.
O'Connell, M., Mcnally, C., Richardson, M.G., 2010. Biochemical attack on concrete in
wastewater applications: a state of the art review. Cem. Concr. Compos. 32 (7),
479–485.
Okabe, S., Odagiri, M., Ito, T., Satoh, H., 2007. Succession of sulfur-oxidizing bacteria in
the microbial community on corroding concrete in sewer systems. Applied Environ.
Microbiol. 73 (3), 971–980.
Pagaling, E., Yang, K., Yan, T., 2014. Pyrosequencing reveals correlations between ex-
tremely acidophilic bacterial communities with hydrogen sulphilde concentrations,
pH and inert polymer coatings at concrete sewer crown surfaces. J. Applied
Microbiol. 117, 50–64.
Pai, T.-Y., Wang, S.-C., Lo, H.-M., Chen, L., Wan, T.-J., Lin, M.-R., Lin, C.-Y., Yang, P.-Y.,
Lai, W.-Y., Lai, W.-J., Wang, Y.-H., Lu, T.-H., 2017. A simulation of sewer biodeter-
ioration by analysis of different components with a model approach. Int. Biodeterior.
Biodegr. 125, 37–44.
Parker, C.D., 1945. The corrosion of concrete 1. The isolation of a species of bacter-
iumassociated with the corrosion of concrete exposed to atmospheres containing
hydrogen sulphide. Aust. J. Exp. Biol. Med. Sci. 23, 81–90.
Parker, C.D., Prisk, J., 1953. The oxidation of inorganic compounds of sulphur by various
sulphur bacteria. J. Gen. Microbiol. 8, 344–364.
Peyre Lavigne, M., Bertron, A., Botanch, C., Auer, L., Hernandez-Raquet, G., Cockx, A.,
Foussard, J.-N., 2015. An innovative approach to reproduce the biodeterioration of
industrial cementitious products in a sewer environment. Part I: test design. Cem.
Concr. Res. 73, 246–256.
Peyre Lavigne, M., Bertron, A., Botanch, C., Auer, L., Hernandez-Raquet, G., Cockx, A.,
Foussard, J.-N., 2016. Innovative approach to stimulating the biodeterioration of
industrial cementitious products in sewer environment. Part II: validation on CAC
and BFSC linings. Cem. Concr. Res. 79, 409–418.
Ramsay, A.J., 1984. Extraction of bacteria from soil: efficiency of shaking or ultra-
sonication as indicated by direct counts and autoradiography. Soil Biol. Biochem. 16,
475–481.
Roberts, D.J., Nica, D., Zuo, G., Davis, J.L., 2002. Quantifying microbially induced
C. Lors et al.
deterioration of concrete: initial studies. Inter. Biodeterior. Biodegr. 49, 227–234.
Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B.,
Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres, B.,
Thallinger, G.G., Horn, D.J.V., Weber, C.F., 2009. Introducing mothur: open-source,
platform-independent, community-supported software for describing and comparing
microbial communities. Appl. Environ. Microbiol. 75, 7537–7541.
Soergel, D.A.W., Dey, N., Knight, R., Brenner, S.E., 2012. Selection of primers for optimal
taxonomic classification of environmental 16S rRNA gene sequences. ISME J. 6,
1440–1444.
Soleimani, S., Isgor, O.S., Ormeci, B., 2013. Resistance of biofilm-covered mortars to
microbiologically influenced deterioration simulated by sulfuric acid exposure. Cem.
Concr. Res. 53, 229–238.
Vincke, E., Boon, N., Verstraete, W., 2001. Analysis of the microbial communities on
31
International Biodeterioration & Biodegradation 130 (2018) 23–31
corroded concrete sewer pipes–a case study. Appl. Microbiol. Biotechnol. 57,
776–785.
Watanabe, T., Kojima, H., Fukui, M., 2015. Sulfuriferula multivorans gen. nov., sp. nov.,
isolated from a freshwater lake, reclassification of ‘Thiobacillus plumbophilus’ as
Sulfuriferula plumbophilus sp. nov., and description of Sulfuricellaceae fam. nov. and
Sulfuricellales ord. nov. Int. J. System. Evol. Microbiol. 65, 1504–1508.
Wei, S., Jiang, Z., Liu, H., Zhou, D., Sanchez-Silva, M., 2014. Microbiologically induced
deterioration of concrete - a Review. Braz. J. Microbiol. 44, 1001–1007.
Yarza, P., Richter, M., Peplies, J., Euzeby, J., Amann, R., Schleifer, K.-H., Ludwig, W.,
Glöckner, F.O., Rosselló-Móra, R., 2008. The All-Species Living Tree project: a 16S
rRNA-based phylogenetic tree of all sequenced type strains. System. Appl. Microbiol.
31, 241–250.