PRINCIPLES OF GENETICS

Maximum Marks: 150

Time: 6 Hrs
SECTION-A
ANSWER ALL THE QUESTIONS (20 * 1 = 20)

FILL IN THE BLANKS

1._____  In double-stranded RNA regions, the bonds that hold complementary
nucleotides together are described as
                    A. ionic      B. covalent     C. hydrophobic     D. hydrogen     E. hydrophilic

2.______  The teritary structure of protein is determined by

                    A. beta sheets     B. hydrogen bonds     C. disulfide bonds     D. alpha helices
E. subunit arrangement

3.______ The active site of an enzyme is most likely to be composed of amino acids with
the following characteristics:
                    A. Polar & Hydrophobic  B. Polar & Hydrophilic  C. Non-polar &
Hydrophobic  D. Non-polar & Hydrophilic

4.______ Semi-conservative DNA replication was demonstrated by

                    A. Watson & Crick    B. Meselson & Stahl    C. Hershey & Chase    D. Luria
& Delbruck    E. Penn & Teller

   5. ______ If the template strand of a piece of DNA reads 3' - AAAAAATTT - 5', its
protein product will read:
                       A. H3N - F  F  K - COOH        B. HOOC - F  K  K - NH3    C. H3N - K  F  F
- COOH        D. HOOC - K  K  F - NH3

  6. ______  If a sequence in an anticodon is 5'-CUA-3' , the sequence of the

corresponding template strand is
                       A.  5'-ATC-3'    B.  5'-GAT-3'    C.  5'-GAU-3'     D.  5'-CTA-3'     E. 5'-
TAG-3'      F. 5'-UAG-3'

 7.  In not more than three grammatically complete sentences, identify and correct the
error. Do NOT draw diagrams.

       Ex.: "DNA probes anneal to particular SNPs and are responsible for genetic
diseases."

       Ex.: "Met- mutants are caused by a defect of methionine that block its synthesis."

       Ex.: "Most  people do not have Cystic Fibrosis because they do not have the gene for
Cystic Fibrosis."
II. MENDELIAN GENETICS. For each question, indicate in the space provided the
LETTER of the ONE response that best answers the question.

       Ex: "Brown eyes (B) are dominant to blue eyes (b). Both of my parents have brown
eyes, but I have blue eyes. Since eye colour is genetic, I must be adopted."
                Sample answer: If eye colour were a simple Mendelian trait, your parents
might both be Bb heterozygotes for brown eyes, and you could be a blue-eyed bb
homozygote with blue eyes.

  8.  ______ A woman is heterozygous for an X-linked recessive allele that causes night-
blindness. If she marries a man with night-blindness, what proportions of her female &
male offspring will carry the night-blindness allele?
                        A) all, none      B) all, half      C) half, half      D) half, none    E) none,
half      F) none, all

   9. ______ In Trufula trees, the locus for leaf colour has three alleles: R (red), G
(green), and B (brown). R is dominant to G,  G is dominant to B. In the progeny of the
cross BR x BG, what fraction will be brown ?
                        A) All        B) 3/4        C) 1/2        D) 1/4        E) 0

    10. ______ Two individuals heterozygous for semi-dominant traits at four loci are
crossed: how many F2 genotypes are expected?
                        A) 4    B) 9    C) 16        D) 27     E) 32        F) 64        G) 81

.11._______Which of the following could be Type-II restriction endonuclease

recognition sites?
                    A. CGCGCG        B. AGCCGA         C. AUGCAU         D. GGAAGG    E.
None of the them      F. All of them

12._______ Oligonucleotides are described as "sticky." What makes them "sticky" ?

                    A. They bind to polynucleotides    B. They bind to mRNA    C. They bind to
ddNTPs    D. They bind to hnRNA    E. They bind to DNA    F. Two of these

13._______ Southern Blots are used to detect rare genes. In a Southern blot analysis:
                    A. DNA probes bind to a base-complementary DNA          B. DNA probes
bind to an immobilized mRNA
                    C. RNA probes bind to corresponding cDNA                      D. RNA probes
bind to mRNA
                    E. Protein binds to corresponding mRNA                            F. Protein binds
to corresponding DNA

14._______ A bioinformatic search for open reading frames will most use which of the
following data base tools?
                    A. GenBank    B. HuGO    C. ExPASy    D. CanLit    E. ENSEMBL    F.
ORFAnn

IV. GENETIC STRUCTURES: The numbers in the left-hand column refer to

structures on the right. For each numbered structure, write the letter of the correct
term.
V. DNA TRANSCRIPTION & TRANSLATION [Use the Genetic Code table attached
to the test] 

The following DNA is part of a gene that codes for a polypeptide of at least seven amino
acids:

    3' caattgattagtcagtcaattgat 5'

    5' gttaactaatcagtcagttaacta 3'

    i. Which strand includes an Open Reading Frame? Top (T) or Bottom (B) 
    ii. Which DNA strand is the sense strand? Top (T) or Bottom (B)              
   iii. Give the mRNA sequence that would be transcribed from this gene; label the 5' &
3' ends.
   iv. Give the seven amino acids that would be translated from the correct message;
label the C & N ends.

VI. PEDIGREE ANALYSIS: Given the pedigree shown, which of the six modes of
inheritance are possible? Which is most likely? What observations would change this?

VII. TRI-HYBRID THREE-POINT TEST CROSS: From the following recombination

data, draw a physical map to indicate the correct order and distances between loci.

VIII. RESTRICTION MAPPING: From the following fragment size data, draw a
restriction map. Label the sites, provide a scale in Kbp.

Types of questions I would not ask.  

15. Watson & Crick received the Nobel Prize in what year? (a) 1953  (b) 1962 (c) 1973
(d) 1984

16. Transcription proceeds in which of the following directions (a) 3'  1'  (b)  2'
4'  (c)  3' 5'    (d)  4' 6'     (e) 5' 3'

17. Which of the following amino acids is/are non-polar? (a) Ala   (b) Gly   (c) Arg   (d)
Asp   (e) Two of these   (f) All of them
 
Draw the structure of Deoxyadenosine monophosphate.

18. Outline the process of DNA replication.

19. What are the clues for sex-linked inheritance?

20. How many introns are present in the chicken ovalbumin gene?   (a) 4  (b) 5  (c) 6  (d)
7  (e) more than 7
 
 SECTION-B
ANSWER ALL THE QUESTIONS (15 * 4 = 60)

1. Definition, significance and historical development in genetics.

2. Mendel's Law's of heredity and exceptions to the laws.
3. Chromosomal theory of inheritance, meiosis and mitosis.
4. Linkage and crossing over - types, mechanism and significance,
5. Nucleic acid as genetic material - structure, replication, genetic code, transcription
and translation.
6. Mutation - spontaneous and induced.
7. Chromosomal changes - molecular, structural and numerical.
8. Multiple factor inheritance and multiple alleles, blood groups in man and body coat
colour in rabbits.
9. Sex chromosomes and its determination in man and drosophila, sex linked
characters.
10. Cytoplasmic inheritance - plasma and nuclear, gene interaction.
11. The DNA molecule and inheritance.
12. The factors which modulate allele frequencies in natural populations.
13. The genetic basis of phenotypic variation; genetic analysis in eukaryotes, viruses and
bacteria.
14. The nature of the genetic material.
15. Gene structure and function.
SECTION-C
ANSWER ALL THE QUESTIONS (7 * 10 = 70)
16. Define quantitative and qualitative inheritance. Describe inheritance of quantitative
traits in nicotiana and zea mays.
17. Explain how ordered and unordered data is used for gene mapping in neurospora.
18. Give an account of:
a) Complementary factors.
b) Multiple factor hypothesis.
19. What are chromosomal aberrations?
20.Describe different types of chromosomal aberrations.
21.Give characteristics of mutation and describe gene mutations.
22. Comment on:
a) Pre and post mendelian development.
b) Importance of genetic diversity in crop improvement.
23. Write short notes on:
a) Heterosis.
b) Types of incompatability.
c) Role of polyploidy in crop improvement.
Practical
1. Preparation of temporary cytological slides (mitosis and meiosis)
2. Genetical problems on mono and dihybrid ratios with their modifications.
3. Chi-square test and goodness of fit of Mendelian modified ratios.
4. Practical record
5. Viva-voce