1

BIOL1018 Lunch box tutorials: Review course content and then attempt all the following questions.

Note that the final exam is designed to test your understanding of the course content, not your ability to
memorize answers to specific questions. It is essential to study the course material thoroughly and
ensure that you understand the concepts and theories and the applications. Prioritize studying the
course content as you prepare for the final exam. While tutorial and past exam paper questions can be
helpful, they should not be relied upon as the sole study strategy.

1. Central dogma of Molecular Biology

Briefly explain the three processes used by all cells to maintain their genetic information and to convert
their genetic information into gene products.

2. Replication
a. Below are the steps of DNA replication. Arrange the steps in the correct sequence. Identify each step
by its letter followed by a comma. That is, X,Y,Z
A. Once elongation of both DNA strands is complete, the strands are checked for errors, repairs are
made and the production of identical helices of DNA from one double-stranded molecule of DNA is
complete.
B. Once primers are formed on both strands, DNA polymerases extend the primers into new DNA
strands. These enzymes catalyse the joining of deoxyribonucleotide triphosphates (dNTPs) to form the
growing DNA chains. Synthesis of new DNA is complementary to both strands of parental DNA.
C. Primers are removed and replaced with DNA nucleotides. This occurs in both the leading strand and in
Okazaki fragments. DNA ligases subsequently join the DNA nucleotides that replaced the primers. The
enzymes also catalyze linkages between Okazaki fragments to generate a continuous lagging strand.
D. Using both strands as a template, short segments called primers, comprising of RNA nucleotides, are
synthesized. Primers are synthesized once on the leading strand template and repeatedly on the lagging
strand template.
E. Helicase unwinds the DNA helix into single strands. Both strands of DNA serve as templates for the
synthesis of new DNA chains.
F. DNA polymerases can add new nucleotides only to the 3′ end of an existing strand, and hence can
synthesize DNA in 5′ to 3′ direction only. The leading strand is made continuously, while the lagging
strand is made in segments called Okazaki fragments. Both leading and lagging strand synthesis are
occurring exclusively in the 5' to 3' direction.

b. Using the sequence below, clearly illustrate each of the aforementioned steps in the correct order.
Assume that (i) the initiation complex forms at the first base pair (underlined), (ii) 5 nucleotide primers
are synthesized in all instances, and (iii) two Okazaki fragments of 13 nucleotides are generated.

5’ TTAACTAGTGGATGAAATTTGGGTAG 3’
3’ AATTGATCACCTACTTTAAACCCATC 5’

c. List the enzymes involved in DNA replication in (i) prokaryotic cells and (ii) eukaryotic cells

3. Transcription
a. What is the purpose of transcription?
b. Briefly describe the three steps in the process of transcription in a eukaryotic cell.
2

c. A partial sequence of a DNA strand is given below. Assuming that the gene is transcribed from left to
right starting at the first base pair, give the sequence of nucleotides of (i) pre mRNA from this region of
the gene and (ii) mature mRNA generated after splicing.

5’ ACCGAAGATGGTGCTGTTAAGCCAAGGCAGATTGCCCATGAG 3’
3’ TGGCTTCTACCACGACAATTCGGTTCCGTCTAACGGGTACTC 5’

d. Transcription involves a complex interplay between regulatory elements, enzymes, and proteins that
control the process of gene expression. Explain.

4. Translation
a. Assuming transcription of the sequence below starts at the 7 th base pair of the sequence below and
transcription is from left to right, which strand serves as template? Give the sequence of transcript
produced.
b. What are the three potential reading frames of the transcript produced? Which of the frames could
be translated into amino acids by ribosomes to produce a polypeptide chain? Explain.
c. Using the genetic code table, give the amino acid sequence of the polypeptide produced from the
mRNA in (b). Clearly indicate the amino acids specified by each mRNA codon in the transcript.

5’ TTAACTAGTGGATGAAATTTGGGTAG 3’
3’ AATTGATCACCTACTTTAAACCCATC 5’

5. Recombinant DNA technology

a. Refer to the diagram below. If lane 6 is DNA from a crime scene, which individual (1-5) should contact
a lawyer? Explain your answer.
2,3 & 5

b. Briefly describe two techniques that were used to generate these data. Name the techniques and
explain the steps involved in setting up both laboratory techniques.
Denaturation
Annealing
3

Extension
-staining of the amplified DNA product with a chemical dye ethidium bromide
-labelling the PCR primers or nucleotides with florescent dyes

c. β thalassemia is a disease that is most often caused by a deletion of all or part of the β globin gene.
Briefly describe a PCR procedure that you would use to determine whether a patient is suffering from β
thalassemia. The beta -globin gene is typically of 1600 bp.
4

6. Mendelian Inheritance and Probability

A gene coded as ‘A’ displays incomplete dominance and is responsible for the colour of the flowers of a
‘Sweet Pea’ plant, while a second gene coded as ‘B’ displays complete dominance and is responsible for
the shape of the pods. The homozygous dominant gene ‘A’ produces a bright red flower, the
heterozygous gene produces a purple flower and the homozygous recessive form produces a yellow
flower. The dominant allele of gene ‘B’ produces an elongated pod, while the recessive allele produces a
short pod. If a plants with the AABb and AaBb genotype codes are crossed, what would be:
a) The different genotypes and phenotypes expected in the F1 generation?
b) What percent of the offspring are expected to be plants with a purple flower and short pods?

7. Epistasis
A gene coded as ‘A’ results in the colour of the grains of a species of maize plants being red or yellow, an
epistatic interaction with a gene coded a ‘B’ results in the production of white grains. A cross between
plants that were heterozygous for both genes resulted in a plants in the F1 generation that produced
plants with White, red and yellow grains in a ratio of 12:3:1. What are the likely genotypes of the white
red and yellow grained plants in the F1 generation?

8. Linkage
Genes ‘A’ and ‘B’ have been determined to code for the colour and texture, respectively of the scales in
a species of lizards. It has also been determined that the genes are trans-linked. If lizards heterozygous
for both genes are crossed what would be the expected genotypes in the F1 generation?

9. Gene Mapping
Three recessive genes on the same chromosome of a fruit fly produce a brown coloured body (b), red
eyes (r) and a striped abdomen (s). A test cross of heterozygous individuals resulted in 19% of the
offspring being as a result of a single crossover between gene ‘b’ and ‘s’, 16% as a result of a single
crossover between gene ‘s’ and ‘r’ and 2% as a result of a double crossover. Using this information,
determine the following.
a) What is the distance between gene ‘b’ and ‘s’ in map units?
b) What is the distance between gene ‘s’ and ‘r’ in map units?
c) What is the Coefficient of Coincidence?

10. Population Genetics

A survey of 800 persons randomly selected from the population of North Caicos Island in the Turks and
Caicos Islands indicated that 680 were considered tone deaf due to the effect of a dominant gene (D).
Determine the number of individuals in the sample that are likely to be homozygous dominant,
heterozygous or homozygous recessive for the gene.