Transcriptomic and Proteomic Approach

for Understanding the Molecular Basis of

Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA

Adaptation of Saccharomyces cerevisiae to
Wine Fermentation
Aurora Zuzuarregui, Lucía Monteoliva, Concha Gil and
Marcel·lí del Olmo
Appl. Environ. Microbiol. 2006, 72(1):836. DOI:
10.1128/AEM.72.1.836-847.2006.

Updated information and services can be found at:

http://aem.asm.org/content/72/1/836

These include:
REFERENCES This article cites 53 articles, 17 of which can be accessed free
at: http://aem.asm.org/content/72/1/836#ref-list-1

CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new
articles cite this article), more»

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml

To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2006, p. 836–847 Vol. 72, No. 1
0099-2240/06/$08.00⫹0 doi:10.1128/AEM.72.1.836–847.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Transcriptomic and Proteomic Approach for Understanding the

Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA

Molecular Basis of Adaptation of Saccharomyces cerevisiae
to Wine Fermentation
Aurora Zuzuarregui,1† Lucı́a Monteoliva,2 Concha Gil,2 and Marcel·lı́ del Olmo1*
Departament de Bioquı́mica i Biologia Molecular, Facultat de Ciències Biològiques, Universitat de València, Valencia, Spain,1
and Departamento de Microbiologı́a II, Facultad de Farmacia, Universidad Complutense, Madrid, Spain2
Received 27 May 2005/Accepted 1 November 2005

Throughout alcoholic fermentation, Saccharomyces cerevisiae cells have to cope with several stress conditions
that could affect their growth and viability. In addition, the metabolic activity of yeast cells during this process
leads to the production of secondary compounds that contribute to the organoleptic properties of the resulting
wine. Commercial strains have been selected during the last decades for inoculation into the must to carry out
the alcoholic fermentation on the basis of physiological traits, but little is known about the molecular basis of
the fermentative behavior of these strains. In this work, we present the first transcriptomic and proteomic
comparison between two commercial strains with different fermentative behaviors. Our results indicate that
some physiological differences between the fermentative behaviors of these two strains could be related to
differences in the mRNA and protein profiles. In this sense, at the level of gene expression, we have found
differences related to carbohydrate metabolism, nitrogen catabolite repression, and response to stimuli, among
other factors. In addition, we have detected a relative increase in the abundance of proteins involved in stress
responses (the heat shock protein Hsp26p, for instance) and in fermentation (in particular, the major cytosolic
aldehyde dehydrogenase Ald6p) in the strain with better behavior during vinification. Moreover, in the case of
the other strain, higher levels of enzymes required for sulfur metabolism (Cys4p, Hom6p, and Met22p) are
observed, which could be related to the production of particular organoleptic compounds or to detoxification
processes.

Wine fermentation is a complex microbiological and bio-
chemical process in which the yeast Saccharomyces cerevisiae
plays a central role. Nowadays, the usual strategy to carry out
wine production involves the inoculation of selected yeast cells
into the wine must. This method affords a decrease in the lag
phase, a quick and complete fermentation of the must, and an
important degree of reproducibility in the final product (6, 20).
Of the criteria proposed for the selection of the yeast strain to
be inoculated (12, 13, 56, 57), the ability to conduct vigorous
fermentation, the production of desirable flavors, and the re-
sistance to stress conditions are among the most important.
Wine flavors result from a complex system of interactions
among hundreds of compounds (30), many of them produced
by yeast and bacteria in various biosynthetic pathways that are
active during alcoholic and malolactic fermentations. The lev-
els and activity of enzymes involved in these metabolic path-
ways therefore play a crucial role in determining the organo-
leptic properties of the final product.
Throughout wine production, yeast cells are affected by a
plethora of stress conditions (3, 6). To properly carry out the
whole process, they must detect and respond to these unfavor-
able growth conditions without significant viability loss (6). For
* Corresponding author. Mailing address: Departament de Bio-
quı́mica i Biologia Molecular, Facultat de Ciències Biològiques, Uni-
versitat de València, Dr. Moliner, 50, E-46100 Burjassot (Valencia),
Spain. Phone: 34 96 3544868. Fax: 34 96 3544635. E-mail: m.del.olmo
@uv.es.
† Present address: Dept. of Biochemistry and Molecular Cell Biol-
ogy, University of Vienna, Vienna, Austria.
this purpose, yeast cells have sensor systems to detect varia-
tions in the environmental conditions (osmolarity, tempera-
ture, pH, nitrogen and carbon starvation, chemical and physi-
cal agents, etc.). This sensing step is followed by the activation
of signal transduction pathways, which results in changes in
gene expression, synthesis of protective molecules, and/or
modulation of the protein activity by posttranslational modifi-
cations or subcellular localization (16, 25, 40). Ultimately,
modifications in the level or activity of yeast proteins will play
an important role in the adaptation of the cell to different
external conditions.
During the last few years, an important effort has been made
to characterize gene expression profiles during vinification. For
this purpose, analyses of particular subsets of genes (mainly
related to stress response and carbohydrate metabolism) have
been carried out (33, 36, 37, 39). The development of global
analysis methodologies (DNA microarrays and two-dimen-
sional electrophoresis combined with subsequent identification
and characterization by mass spectrometry) has allowed a de-
tailed analysis of changes in gene expression and protein levels
at various time points during vinification (4, 31, 42, 50, 51).
These studies have been carried out with a particular industrial
strain adapted to vinification conditions, able to complete the
process without any defect.
In our laboratory, we have been characterizing wine yeast
strains from the physiological and molecular points of view.
Recently, we demonstrated that some stress response genes in
these strains show differential expression patterns depending
on the behavior of the strains during vinification (58). In this

836
VOL. 72, 2006 mRNA AND PROTEIN PROFILES OF YEAST DURING VINIFICATION
paper, we present a comparison between the mRNA and pro-
tein profiles of two yeast strains with different fermentative
behaviors at the time point corresponding to the entry into
stationary phase, which correlates with the divergence in the
fermentation profiles. Our results indicate changes in the
mRNA and protein levels and, probably, posttranslational
modifications of several proteins, some of them involved in
stress response and metabolism. This information is important
for a better understanding of the physiological differences be-
tween these strains during vinification and for identification of
features that could contribute to the adequate adaptation of
yeast cells to fermentation conditions.
MATERIALS AND METHODS
Yeast strains and growth conditions. Experiments have been carried out with
S. cerevisiae strains ICV 16 (Fermicru primeur; DSM) and ICV 27 (UCLM
S-377; Springer Oenologie).
Microvinification experiments were carried out using synthetic must at 22°C
following the experimental details described by Zuzuarregui and del Olmo (58).
This synthetic must contains 200 g/liter of an equimolecular mixture of glucose
and fructose and 300 mg/liter of assimilable nitrogen. Cells from overnight
cultures were inoculated into the must at 5 ⫻ 106 cells/ml. Three independent
vinifications were carried out with each strain.
Microvinifications were also carried out with natural musts of Bobal and
Sauvignon blanc varieties supplied by the wineries Torre Oria and Carrascal
(Requena, Valencia, Spain). Bobal must contained approximately 500 mg/liter of
assimilable nitrogen, while in the case of Sauvignon must the amount was 200
mg/liter. In some experiments Sauvignon blanc must was supplemented with 300
mg/liter of nitrogen in the form of diammonium phosphate. For microvinifica-
tions with natural musts, active dry yeast cells were rehydrated at a 10% (wt/vol)
concentration in 5% (wt/vol) glucose for 20 min at 37°C and were inoculated in
a 1:50 proportion in the must, according to the instructions of the yeast manu-
facturer. This corresponds approximately to 2 ⫻ 108 viable cells/ml.
The evolution of the microvinification was determined by measurements of
viability, sugar and nitrogen consumption (58), and ethanol production (11).
RNA analysis. RNA was isolated and quantified as described previously (58).
For microarray analyses, cDNA preparation, labeling, and hybridization were
carried out as described by Fazzio et al. (18). For hybridization the Cy3-Cy5
combinations were 16A-27A, 16C-27B, 27B-16B, 27B-16C, and 27C-16A, with A,
B, and C representing three independent cultures of each strain. The intensity
obtained in each channel for each pair of microarrays was normalized by the
Lowess method (10), and the ratios of the five experiments were evaluated by a
t test using the statistic package ArrayStat with a significance level of 95% and at
least four replicates. The overrepresentation of categories containing function-
ally related genes in each strain was statistically analyzed using the “Function
Associate” tool (http://llama.med.harvard.edu/cgi/func/funcassociate).
The expression of some genes was also analyzed by semiquantitative reverse
transcription-PCR (RT-PCR). For cDNA preparation, 5 ␮g of RNA was incu-
bated with 1 unit of DNase I in a total volume of 8.8 ␮l at 37°C for 30 min.
Afterward, the instructions of the manufacturer of Superscript II were followed.
For the amplification of the resulting cDNA, it was 20-fold diluted and 5 ␮l was
used for a PCR carried out in a final volume of 15 to 25 ␮l containing primers
(0.5 mM each), deoxynucleoside triphosphates (0.2 mM each), MgCl2 (3 mM),
buffer, and 1 unit of DNA polymerase Biotaq (Bioline) from Thermus aquaticus
YT-1. The reaction conditions were as follows: 1 cycle of 3 min at 94°C, 20 to 45
cycles of 1 min at 94°C, 1 min at the optimal primer hybridization temperature
in each case, and 1 min at 72°C, and, finally, a 10 min cycle at 72°C. For ACT1,
FBA1, ERG10, and AUS1, 20 amplification cycles were used; for SNQ2 and
AGP1, 35 cycles were used; and in the case of MUP1 and ADR1, 40 and 45 cycles
were used instead. Table 1 includes the sequences of the oligonucleotides used
in these amplification reactions.
Protein analysis. Samples were prepared as described by Hernández et al.
(24). Analytical and micropreparative two-dimensional polyacrylamide gel elec-
trophoresis was carried out as reported by Hernández et al. (24) with the
following modifications. Volumes of 80 ␮g of protein for analytical gels and 1 mg
for micropreparative gels were loaded. For the first dimension, the program
values used were 500 V for 1 h, 500 to 2,000 V for 1 h, and 8,000 V for 6.2 h for
analytical gels and 500 V for 1 h, 1,000 V for 1 h, 2,000 V for 1 h, 2,000 to 5,000
837
TABLE 1. Oligonucleotides used for the RT-PCR analyses
Oligonucleotide Sequence
ACT1-1 .................................. GGATCTTCTACTACATCAGC
ACT1-2 .................................. CACATACCAGAACCGTTATC
Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA
FBA1-1 .................................. TAAAGAGAAAGACCGGTGTCAT
FBA1-2 .................................. GGGAGGAGAATAATGGTTCA
ADR1-1 ................................. TCCCGTTGTTGACTTG
ADR1-2 ................................. ACTTGACTGAGGATGC
MUP1-1 ................................. CGAAAACGCTCCAAGA
MUP1-2 ................................. CCTCACCAAAGACAGA
AGP1-1.................................. GTCTCTATACGAACTG
AGP1-2.................................. TCTAGTTCTTGAGCC
ERG10-1 ............................... TATCGACTGCCAGAAC
ERG10-2 ............................... CATTACAAATGGCGGC
AUS1-1 .................................. TTCCTTGCTCACCTGCAA
AUS1-2 .................................. CCCATTAAGGCGGTCAAA
SNQ2-1 .................................. ACTGTGTACCCAACGT
SNQ2-2 .................................. CATTGATCGCCTCTGA
V for 2 h, and 8,000 V for 9 h for micropreparative gels. Preparative gels were
silver stained according to the protocol described by Mann (45).
Silver-stained gels were digitalized using a computing densitometer (GS-690
imaging densitometer; Bio-Rad) and analyzed with MELANIE 3.0 software
(Bio-Rad). By use of MELANIE 3.0 tools, protein spots were enumerated,
quantified, and compared between different gels. Nine gels corresponding to
three independent cultures of each strain were analyzed to perform the statistical
analysis.
Mass spectrometry of protein spots was carried out as previously described
(24). Monoisotopic peptide mass fingerprinting data obtained from matrix-as-
sisted laser desorption ionization–time of flight (mass spectrometry) MALDI-
TOF (MS) and MS/MS sequence analysis carried out using a MALDI-TOF–
TOF mass spectrometer 4700 proteomics analyzer (Applied Biosystems,
Framingham, MA) were used to search for protein candidates by use of the
programs Mascot and ProFound (prowl.rockefeller.edu) and the SWISS-PROT/
TrEMBL nonredundant protein database (www.expasy.ch/sprot).
Ergosterol determination. Samples were obtained from vinifications carried
out in synthetic and Sauvignon blanc musts. A volume of cells representing an
optical density at 600 nm of 50 (approximately 5 ⫻ 108 cells) was used for each
ergosterol extraction, which was carried out according to the method of Quail
and Steven (38). For the quantification of the ergosterol present in the extracts,
the spectrophotometric measurement at 282 nm was used (38) (the ε1% of
ergosterol at 282 nm is 290).
RESULTS
Strain selection and behavior during vinification. Two com-
mercial wine yeast strains were selected for these experiments:
ICV 16 and ICV 27. Electrophoretic karyotype, MET2 gene
restriction fragment length polymorphism, and mitochondrial
DNA analyses have indicated that these strains are different
and correspond to S. cerevisiae (data not shown).
Selected parameters of the vinifications carried out with these
strains in synthetic must are shown in Table 2. According to
previous studies (57, 58), the behaviors of these strains in vinifi-
cation are quite similar in terms of growth, numbers of viable
cells, nitrogen consumption, ethanol production, and glucose con-
sumption up to 6 days after inoculation of the cells into the must.
In addition, the expression profiles of their stress response genes
during this time are quite similar (58). For these reasons, these
strains are very useful for comparisons of gene and protein ex-
pression. The most relevant difference between them is related to
sugar consumption: after 6 days, an important decrease in the
consumption rate was observed in strain ICV 27, which was un-
able to complete the vinification, leaving approximately 15 g/liter
of residual sugar at the end of the process. Sluggish or stuck
838 ZUZUARREGUI ET AL. APPL. ENVIRON. MICROBIOL.

TABLE 2. Selected parameters of the vinifications carried out with
ICV 16 and ICV 27 strains in synthetic must
Value for indicated strain and time pointa
Parameter
TABLE 3. Distribution of genes differentially expressed more than
twofold in functional categories statistically overrepresented
in each strain according to the function associate tool
No. of genes

Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA

ICV 16 ICV 27 ICV 16 ICV 27
expressed Total no. of
(day 6) (day 6) (day 30) (day 30) Strain and functional
more than genes in the Pa
gene category
Sugar (g/liter) 89–94 89–92 2–3 12–15 twofold in category
Assimilable nitrogen (mg/liter) 168–175 158–188 162–168 153–158 the category
Ethanol (% [vol/vol]) 5.7–6.3 5.7–6 9.3–10.3 9.3–9.6
CFU · 106/ml 28–38 38–42 12–17 15–17.9 ICV 16
Alcohol metabolism 29 148 2.8e-16
a
Values shown correspond to the interval found in at least three independent Glycolysis 10 18 1.9e-11
vinifications carried out with each one of the strains. A more detailed description Telomerase-independent 7 13 3.1e-08
of the variation of these parameters during the process can be found in the work telomere maintenance
by Zuzuarregui and del Olmo (58). Cell wall 15 109 8.1e-07
Sterol metabolism 8 34 5.7e-06

fermentations represent an important problem in wine produc- ICV 27

tion. Nowadays, some sweet wines (sparkling wines, for instance)
are produced, but in these cases sweetening is achieved by the
addition of sugar or, in most cases, partially fermented or unfer-
mented grape juice (27).
The transcriptomic and proteomic analyses were carried out
using samples obtained in three independent experiments at 6
days after beginning the vinification. This time was selected
because of the reduction in the rate of sugar consumption in
strain ICV 27 at this point. Moreover, this time is coincident
with entry into the stationary phase, which involves significant
changes in gene expression. mRNA and protein expression
profiles can help us to understand the reasons for or conse-
quences of these changes.
Overall description of genes with differential expression in
strains ICV 16 and ICV 27. The microarray used in these
experiments contained DNA fragments corresponding to 6,251
yeast open reading frames. The statistical analysis of the results
was carried out using the Array Stat package; the analysis
showed that 2,073 genes present statistically significant differ-
ences between the strains. Of these, 1,018 showed higher ex-
pression in ICV 16 than in ICV 27 and 1,055 were more
expressed in ICV 27 than in ICV 16. Of those with levels of
expression increased at least twofold, 196 genes were overex-
pressed in ICV 16 relative to ICV 27 and 227 in ICV 27 relative
to ICV 16. This indicates that about 6.8% of the yeast genes
show changes higher than twofold in the expression levels
among strains.
The application of the “Function Associate” tool to the genes
differentially expressed more than twofold for which the biologi-
cal process is known (Table 3) shows that genes related to alcohol
(in particular, carbohydrate) metabolism, telomere maintenance,
and cell wall and sterol metabolism appear to be selectively more
expressed in the ICV 16 strain. In contrast, a higher number of
genes involved in drug response and transport processes was
observed to be overexpressed in the ICV 27 strain.
A detailed description of the genes with differential expres-
sion is shown in Table 4, in which more-specific categories are
considered. For the remainder of the present study we chose to
focus on a subset of interesting categories shown in this table:
carbohydrate metabolism, nitrogen metabolism and transport,
sterol metabolism and transport, and stimulus response.
Comparison of the expression of genes involved in carbohy-
drate metabolism between strains ICV 16 and ICV 27. Accord-
ing to the information shown in Table 4, a large proportion of
genes related to alcohol and carbohydrate metabolism are
ATPase activity coupled 12 58 5.5e-07
to ion transmembrane
movement
Sodium transport 3 3 4.3e-05
Drug response 7 29 4.8e-05
Amine transport 8 42 8.5e-05
a
Single hypothesis one-sided P value of the association between the total
number of genes and the genes expressed more than twofold in each category.
more expressed in strain ICV 16, whereas the opposite occurs
in the case of some genes that participate in the oxidation of
organic compounds and in gluconeogenesis (Fig. 1).
Almost all genes involved in the glycolytic pathway that
appear in our analysis are more highly expressed in ICV 16.
Among them, we find genes encoding fructose bisphosphate
aldolase, enolase, gliceraldehyde-3-phosphate dehydrogenase,
phosphoglycerate mutase, phosphoglucose isomerase, the ␤
subunit of phosphofructokinase, and 6-phosphofructo-2-ki-
nase, with differential severalfold expression levels ranging be-
tween 2.1 and 4.9. Although some of these enzymes catalyze
reversible steps in glycolysis, the detection of activators of this
pathway and the genes ADH1, ADH2, and ADH6, involved in
fermentation, could indicate a better disposition for a fermen-
tative metabolism in strain ICV 16, at least in terms of gene
expression.
In the case of ICV 27, higher mRNA levels of genes that act
as transcription activators of the gluconeogenic pathway
(CAT8, SIP4, and ADR1) were observed. In addition, the ex-
pression of the genes encoding the enzymes that catalyze the
two irreversible steps in this pathway (PCK1 and FBP1) shows
levels respectively 2.1 and 1.4 times higher in this strain (data
not shown). On the other hand, several genes related to the
tricarboxylic acid cycle are more highly expressed in this strain.
Interestingly, genes YJL045W (similar to succinate dehydroge-
nase gene SDH1) and SDH2 show respective expression levels
7.5 and 1.7 times higher than those seen with ICV 16. It has
been reported that during fermentation this cycle is not active,
but two branches are functional (one oxidative from pyruvate
to at least ␣-cetoglutarate and one reductive in the opposite
sense), and there is a complete inhibition of the succinate dehy-
drogenase complex (8). Moreover, in ICV 27 there are higher
mRNA levels of genes involved in the mechanisms for direct-
ing cytosolic NADH to the mitochondrial respiratory chain
(NDE2 and GUT2) and, although to a lesser extent, in acetyl-
coenzyme A (CoA) metabolism and transport, ␤ oxidation,
VOL. 72, 2006 mRNA AND PROTEIN PROFILES OF YEAST DURING VINIFICATION 839

TABLE 4. Distribution detailed in categories of the genes differentially expressed more than twofold in strains ICV 16 and ICV 27
Gene (fold expression increase)a
Functional category
ICV 16 ICV 27

Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA

Carbohydrate metabolism
Transport HXT3 (7.1), HXT4 (2.4) HXT5 (3.4)
Fermentation, glycolysis, and PFK27 (4.9), ENO1 (3), ENO2 (3), FBA1 (2.8), ADR1 (3.6), SIP4 (3.3), GUT2 (3.2), CAT8 (2.8),
gluconeogenesis ADH1 (2.8), TDH3 (2.5), ADH2 (2.5), GPM3 (2.2), PCK1 (2.1)
TDH2 (2.4), TDH1 (2.3), GPM1 (2.3),
PGI1 (2.3), PFK2 (2.1), ADH6 (2)
Organic compound oxidation and
respiration
Krebs cycle LSC2 (2.6), CIT1 (2.5) YJL045W (7.5)
Acetyl-CoA metabolism and ADR1 (3.6), ACS1 (3.1), CRC1 (3), PEX10 (2.6),
␤ oxidation CTA1 (2.5), AGP2 (2.1)
ATP synthase NCA3 (2.6), NCA2 (2.1)
NADH oxidation NDE2 (3.7), GUT2 (3.2)
Others ISF1 (2.6), BCS1 (2.1), HAP1 (2)
Pentose phosphate pathway TKL1 (3.2)
Others GRE3 (2.1), DOG2 (2.1), PGM2 (2.1)

Nitrogen
Transport TPO2 (3.5), PTR2 (3.1) MEP1 (14.7), AGP1 (9.8), MUP1 (4.1), SAM3 (3.6),
GAT1 (3.3), GNP1 (3.3), PTK1 (2.7), DUR3 (2.3),
AGP2 (2.1), AVT6 (2)
Metabolism SFA1 (13), YMR226C (2.3), SAH1 (2), BAT1 (2), GAT1 (3.3), GLT1 (3.1), DUR1,2 (2.3)
LEU2 (2)

Esterols
Transport AUS1 (3.1), DAN1 (2.4), PDR11 (2)
Metabolism CYB5 (6.2), IDI1 (2.5), ERG10 (2.5), ERG13 (2.3),
ERG20 (2.3), ERG26 (2.3), ARE2 (2.2)

Genes related to oxygen presence/absence ANB1 (3.9), HYP2 (3.6), ROX1 (3.5), AHP1 (2.8), SRX1 (7.8), CTA1 (4.2), SNQ2 (4.1), YAP1 (2.1),
TSA1 (2) HAP1 (2)

Ion transport and cellular homeostasis FTR1 (3.4), PMA1 (3.2), VCX1 (2.9), AHP1 (2.8), ENA2 (6.9), ENA5 (6.3), ENA1 (6.2)
CUP9 (2.7), TSA1 (2)

Stimulus response
Drugs RDS1 (4.1), PDR16 (2.2) PDR10 (8.5), SNQ2 (4.1), PDR5 (3), PDR15 (2.7),
YOR1 (2.5), SNG1 (2.5), PDR1 (2.1)
Stress SSA4 (3.9), UBC4 (2.8), YHB1 (2.1), MSN4 (2.4), XBP1 (4.5), SIP18 (3.8), SSA3 (3.3), RDH54 (2.9),
RVS161 (2.3), HSP26 (2.3) RAD55 (2.5)
Temperature SPL2 (3)
Pheromone HBT1 (5.1), CSN9 (3.2), FUS3 (3.2)
Cellular signalling FUS3 (3.2), TPK1 (2.7), IRA2 (3.3)
Oxidation SRX1 (7.8), CTA1 (4.2), SNQ2 (4.1), OYE3 (2.7),
GSH1 (2.3), YAP1 (2.1)

DNA metabolism and changes YCL074W (4.8), YER138C (2.5), YML039W (2.4),
YFL002W-A (2.4), YRF1 (2.4–2.5), YMR050C (2.2)

Meiosis, mitosis, and cell wall organization
and biogenesis
MUC1 (6.1), PIR3 (2.8), GAS1 (2.7), PIR2 (2.5), FMP45 (6.8), FLO9 (5.9), FLO5 (5.1), ZIP2 (4.5),
TIP1 (2.5) ECM12 (4.1), MPS2 (3.9), MCM16 (3.7),
FLO1 (3.4), SPS22 (3.3), ECM5 (3.1), RDH54 (2.9),
SPC24 (2.9), CSM2 (2.6), RAD55 (2.5),
KTR7 (2.5), NRG2 (2.5), ECM8 (2.4), SPO22 (2.2),
YBL009W (2.2), CTF19 (2.2), SMK1 (2.2),
RCK2 (2.1), DST1 (2)

Others
Proteolysis, autophagy, and YPS1 (3), UBC4 (2.8) ATG15 (2.7), CVT17 (2.7), MON1 (2.6)
vacuolar processes
Nucleic acid biosynthesis SRL1 (2.5), AAH1 (2.4), NPT1 (2.3), BNA6 (2.3), URA2 (3.9)
URA10 (2.2)
RNA processing and modification REX3 (3.2) TAD2 (2.8), PTA1 (2.6)
Fatty acid metabolism and transport SAC1 (2.6), ELO1 (2.5), DPL1 (2.5), SCS7 (2.3), ADR1 (3.6), SFH5 (3.1), CRC1 (3), PEX10 (2.6),
YPC1 (2.1) PEX10 (2.6), CTA1 (2.5), PXA1 (2.4), AGP2 (2.1)
Protein modification SDS3 (3.4), MNN5 (2.8), KNS1 (2.5), SMK1 (2.2),
RCK2 (2.1)
Others PRM7 (6), SCM4 (3.2), CLN3 (2.5) SLY41 (3.6)
a
The average level obtained from at least four different experiments is shown in parentheses.

regulation of ATP synthase activity, and cytochrome organi- was carried out for the FBA1 (glycolytic) gene and ADR1 gene
zation. (involved in regulation of gluconeogenesis and respiration). In
To confirm the results obtained with microarray analysis by this experiment we also included other time points during
an alternative molecular approach, semiquantitative RT-PCR vinification to understand the changes in the expression of
840 ZUZUARREGUI ET AL.
FIG. 1. Overall scheme of the metabolism with indication of the genes with differential severalfold expression levels higher than 2 in strains ICV
16 and ICV 27 (underlined).
these genes throughout the process. The results (Fig. 2) are
consistent with the microarray data obtained at day 6. More-
over, the expression profiles throughout vinification shown in
Fig. 2 indicate that the expression of the FBA1 gene is lower in
FIG. 2. Semiquantitative RT-PCR. The experiment was carried out
by amplification of the cDNA obtained at the time points during
vinification indicated in the figure with the specific oligonucleotides for
each gene listed in Table 1. ACT1 was used as control. Experimental
details are described in Materials and Methods.
APPL. ENVIRON. MICROBIOL.
Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA
strain ICV 27 at about 6 days of vinification, when cells enter
into stationary phase, than at 2 days. In the case of ADR1, the
mRNA levels slightly increase at 6 days in strain ICV 27 and
this is followed by a stronger change on the following days,
whereas in ICV 16, an increase is only detected after 10 days of
vinification.
Differential expression of genes involved in transport and
metabolism of nitrogen compounds. A statistically significant
category overexpressed in ICV 27 corresponds to genes in-
volved in amine, polyamine, and amino acid transport. We
detected higher expression levels in this strain at the point of
vinification considered for the genes encoding Agp1p (a wide-
range permease), Mup1p (a high-affinity methionine per-
mease), Gnp1p (a high-affinity glutamine permease), Sam3p
(an S-adenosyl-methionine permease), Mep1p (an ammonia
permease), and Gat1p, a regulator that controls the transcrip-
tional activity of genes regulated by nitrogen catabolite repres-
sion. In fact, many of the genes of this category are controlled
by this regulatory mechanism.
In the case of ICV 16, only a few genes involved in particular
steps of the metabolism of several amino acids appear to be
upregulated compared to strain ICV 27 results.
Semiquantitative PCR with MUP1 and AGP1 (Fig. 2), two
genes more highly expressed in strain ICV 27, confirms the
VOL. 72, 2006 mRNA AND PROTEIN PROFILES OF YEAST DURING VINIFICATION
FIG. 3. Vinifications were carried out in natural musts (Bobal,
Sauvignon blanc [SB], and Sauvignon blanc supplemented with 300 mg
N/liter as diammonium phosphate [SB ⫹ DP]) inoculated with rehy-
drated dry active yeast cells according to manufacturer’s instructions.
Vinifications were carried out at 22°C as described in Materials and
Methods. Bobal must contained 500 mg/liter of assimilable nitrogen
and Sauvignon must 200 mg/liter.
results from the microarray analysis. Besides, expression anal-
ysis of MUP1 throughout the vinification indicates that mRNA
levels of this gene in both strains are similar at the beginning of
vinification (day 2) but decrease in strain ICV 16 as the fer-
mentation progresses. In the case of AGP1, the mRNA levels
decrease in both strains during vinification, but this effect is
stronger in ICV 16.
The higher expression of genes involved in nitrogen trans-
port regulated by nitrogen catabolite repression in ICV 27
suggests that this strain is sensing nitrogen limitation at this
point. However, according to the evolution of nitrogen con-
sumption during the vinification, nitrogen is not completely
consumed (Table 1) and 6 days after inoculation the amount of
total nitrogen is still about 168 mg/liter. In fact, experiments
carried out with natural musts containing different amounts of
nitrogen (Fig. 3) indicate that when the available nitrogen
amounts are similar to those found in the synthetic must used
in our experiments (Sauvignon blanc must), strains ICV 16 and
ICV 27 show the differences in fermentative behavior de-
scribed so far. In spite of this, when musts with significantly
higher nitrogen amounts are used (Bobal must or supple-
mented Sauvignon must) both strains behave in the same way
and are capable of completing the vinification without signifi-
cant differences.
Differential expression of genes involved in sterol transport
and metabolism. Many of the genes encoding enzymes that
participate in ergosterol biosynthesis show higher mRNA lev-
els in strain ICV 16. Some of them (ERG10 and IDI1) appear
in Table 4 because the differences in levels between strains
841
exceed twofold, but some others (ERG13, ERG20, ERG26,
ERG9, and ERG4) show severalfold variations ranging be-
tween 1.4 and 2. Ergosterol is the main sterol in the S. cerevi-
siae plasma membrane. It has been shown that fermentative
Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA
efficiency and ethanol resistance are usually related to the
increase in the ratio of ergosterol to phospholipids and to the
decrease in the fatty acid saturation index (9, 44). Previous
results obtained with these strains indicate that, at least under
some growth conditions, ICV 16 displays higher ethanol resis-
tance than ICV 27 (57).
In strain ICV 27, however, a few genes related to sterol
transport, namely, AUS1, DAN1, and PDR11, are overex-
pressed, with severalfold differences of 3.1, 2.4, and 2 relative
to ICV16 results.
Semiquantitative RT-PCR was carried out with ERG10 (er-
gosterol biosynthesis) and AUS1 (ergosterol transport) and
confirmed the information from the microarray analysis. As
shown in Fig. 2, ICV 27 shows higher ERG10 mRNA levels at
day 2, but the mRNA is almost undetectable at day 6, whereas
in ICV 16 some amounts are still found. Regarding AUS1,
there is also a decrease in the expression level between 2 and
6 days and, especially in ICV16, between days 6 and 10.
Determinations of ergosterol levels in samples obtained from
these vinifications indicate differences among strains that corre-
late with the gene expression data (Table 5). This correlation is
more significant when we consider the results at the beginning of
the vinification, when ergosterol (Table 5; 6 h) and mRNA levels
of genes involved in the metabolism of this lipid (ERG10 in Fig. 2)
are higher. Similar results were obtained in vinifications with
Sauvignon blanc natural must inoculated with active dry yeast
cells at the time point of vinification corresponding to the entry
into stationary phase (data not shown).
Differential expression of genes related to stimulus re-
sponse. An important number of genes involved in stimulus
response show differences in mRNA levels among these
strains, and in most cases the levels are higher in strain ICV 27.
We find, for instance, differential expression of some genes
(PDR10, PDR5, PDR15, SNQ2, YOR1) that participate not
only in multidrug resistance (54) but also in other physiological
functions, such as the transport of weak acids or glutathione-
sulfur compound conjugates (55).
In the subcategory of stress response, higher expression lev-
els are found in strain ICV 27 for some genes involved in DNA
repair (RAD55 and RDH54), desiccation and osmotic stress
(SIP18), transcriptional regulation (XBP1), and temperature
response (SSA3 and SPL2). However some stress response
genes display higher mRNA levels in strain ICV 16; among
them we detect some genes involved in protein degradation
TABLE 5. Ergosterol determination in vinifications carried
out in synthetic must
␮g/OD600 unit at indicated time point a
Strain
6h Day 6 End
ICV 16 1.6 ⫾ 0.26 0.67 ⫾ 0.07 0.5 ⫾ 0.07
ICV 27 1.023 ⫾ 0.05 0.52 ⫾ 0.06 0.55 ⫾ 0.01
a
Values were obtained from at least three independent experiments. Standard
deviation values are included.
842 ZUZUARREGUI ET AL. APPL. ENVIRON. MICROBIOL.

Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA

FIG. 4. Two-dimensional gel (immobilized pH gradient strip [pH 3 to 10], 10% total acrylamide concentration, silver staining) showing the 19
differentially expressed spots in two strains of S. cerevisiae at the entry of stationary phase during vinification. Panel A shows the reference gel of
strain ICV 16 and Panel B the corresponding gel of strain ICV 27. The identified proteins are annotated in the gel by their protein names according
to the Saccharomyces genome database. Nonidentified proteins are indicated solely with an italic number. Spots representing higher expression
levels in one strain are circled. Mr, molecular mass.
VOL. 72, 2006 mRNA AND PROTEIN PROFILES OF YEAST DURING VINIFICATION 843

TABLE 6. List of spots representing differential expression results for strains ICV 16 and ICV 27 at the entry
of stationary phase during vinification
Expt Expt Differential
No. of Posttranslational
ID a Proteinb Mr/Lit pI/Lit % Cov d expression Location g Function
peptidese modification(s)h

Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA

Mr (kDa)c pIc (fold) f

1 Ald6 60/54 5.2/5.3 22 10 ⫹16 C, N, M, V Ac Cytosolic aldehyde dehydrogenase

2 Pdc1 54/61 6.2/6 MS/MS ⫹16 C, N Ac⫹, Carb⫹ Pyruvate carboxylase
3 Cys4 54/56 6.6/6.5 15 8 ⫹⫹27 C, M Cystathionine-␤-synthase
4 Cys4 54 6.7 23 13 16 C, M Cystathionine-␤-synthase
5 NI 54 6.6 16
6 NI 47 6.8 27
7 Met22 37/39 6.1/6 37 14 27 C, N Ac 3⬘-(2⬘),5⬘-Bisphosphate nucleosidase
8 Psa1 37/40 6.3/6.1 34 11 16 C Carb⫹ Mannose-1-phosphate guanilyl
transferase
9 Qcr2 36/39 6.2/6.2 26 10 ⫹27 M Carb⫹ Ubiquinol-cytochrome c reductase
10 NI 34 6.0 16
11 Hom6 33/38 7.1/7.2 18 7 27 C, N, M Ac Homoserine dehydrogenase
12 YPR127w 32/38 5.8/5.8 44 19 16 C, N Ac Similar to S. pombe piridoxal
reductase
13 NI 30 5.6 16
14 NI 25 5.0 16
15 Hsp26 25/24 5.1/5.4 42 8 ⫹⫹16 C, N Ac⫹, P⫹ Molecular chaperone involved
in stress response
16 Hsp26 25 5.2 42 7 ⫹27 C, N Ac⫹, P⫹ Molecular chaperone involved
in stress response
17 Adk1 23/24* 5.9/6* 55 14 16 C, M Ac⫹ Adenylate kinase
18 Adk1 23/24 6.2/6.2 MS/MS 27 C, M Ac⫹ Adenylate kinase
19 NI 21 5.9 ⫹16
a
ID, identification number of the spots in two-dimensional gel.
b
Protein name according to the Saccharomyces genome database (www.yeastgenome.org). NI, protein not identified.
c
Mr, molecular mass; Expt, value obtained experimentally (melanie 3.0); Lit, value obtained from the literature (Proteome package). An asterisk (ⴱ) indicates the
values of the mature form (after the N-terminal methionine excision, if it occurs). In the case of Adk1p, the values corresponding to both immature and mature form
(after Met-Ser excision and N-terminal acetylation) are shown.
d
Percentage of the amino acid sequence coverage for the identified proteins. MS/MS, proteins were analyzed by tandem mass spectrometry using MALDI-TOF/TOF
MS.
e
Numbers of peptide masses matching the top hit from MS-Fit protein motive force are shown.
f
Differential severalfold expression of the spots in the strains. Relative values from the comparison of five different gels are indicated by ⫹ and ⫹⫹ (⫹ indicates
levels of protein approximately between two- and fivefold greater in one strain than in the other. ⫹⫹ indicates differential severalfold expression levels approximately
higher than 5). When no symbol is shown the spot only appears in the strain indicated.
g
Subcellular location. M, mitochondria; C, cytoplasm; N, nucleus; V, vacuol. Data obtained from the Proteome package.
h
Posttranslational modifications. Ac, N-terminal acetylation; Carb, carbonylation; P, phosphorylation. A superscript plus indicates that the modifications were
reported in the literature. Data obtained from the Proteome package.

(UBC4) and others encoding heat shock proteins (SSA4 and
HSP26).
One interesting subcategory of genes overexpressed in strain
ICV 27 contains a large number of oxidative stress response
genes (SRX1, CTA1, SNQ2, OYE3, and YAP1 with differential
severalfold expression levels higher than 2 but many others—
including SKN7, the other main regulator of the response to
this form of stress—with values ranging between 1.5 and 2).
Besides, HAP1 and HAP2 genes, the principal regulators of the
yeast response to oxygen, show levels 2- and 1.9-fold higher
(data not shown), respectively, in ICV 27. It is difficult to
understand the variations in the expression of these genes
under vinification conditions, but this result may have a link
with the higher expression in ICV 27 of genes that participate
in organic compound oxidation and respiration.
Taken together, our data suggest that, at this point of vinifica-
tion, strain ICV 27 may be developing mechanisms of detoxifica-
tion, such as the multidrug response or the destruction of reactive
oxygen species. Semiquantitative PCR experiments with the
SNQ2 gene (involved in response to oxidative stress and in mul-
tidrug resistance) confirm the results obtained in the microarray
analysis (Fig. 2) and indicate that in ICV 27, the maximal expres-
sion is detected at day 6. In the case of strain ICV 16, the expres-
sion levels of this gene are lower at days 6 and 10.
Proteomic analysis reveals that some proteins related to
carbohydrate and sulfur metabolism and stress response dis-
play differential levels in strains ICV 16 and ICV 27. In order
to investigate whether the differences observed between these
strains regarding gene expression are reflected in protein lev-
els, whole-cell protein extracts were prepared from the same
samples and analyzed by two-dimensional gel electrophoresis,
as described in the Materials and Methods section. Fig. 4
shows the reference two-dimensional gel and the protein pro-
file for each of the strains. Each protein sample was analyzed
in at least three independent gels. Spots for which differential
expression was detected in at least eight gels are indicated with
a number.
A total of 19 spots with consistent differential expression
levels between strains were found. Of these spots, 13 were
identified by MALDI-TOF–TOF (MS) and correspond to 10
different proteins. This number represents about 4% of the
total number of spots found in the gels (approximately 450).
Table 6 contains information about the spots with differential
expression among strains.
844 ZUZUARREGUI ET AL.
FIG. 5. Schematic diagram of the sulfur fixation and sulfur amino acids metabolism in S. cerevisiae showing the involvement of several proteins
with differential expression in the strains studied in this work. Data were obtained from the Kegg pathway database (www.genome.ad.jp/kegg
/pathway.html).
Several proteins involved in carbohydrate metabolism are dif-
ferentially expressed in the strains ICV 16 and ICV 27: Ald6p (the
major cytosolic aldehyde dehydrogenase enzyme, largely respon-
sible for acetate formation from glucose during alcoholic fermen-
tation) (53), Pdc1p (involved in the alcoholic fermentation and
cytosolic acetyl-CoA generation), and Qcr2p (ubiquinol-cyto-
chrome c reductase core protein 2, component of the cytochrome
bc1 complex in the mitochondrial respiratory chain). In the case
of Ald6p and Pdc1p the levels are higher in strain ICV 16, sug-
gesting a more active fermentation in this strain. As described
above, at 6 days, this strain continues metabolizing glucose ac-
tively, while in the case of strain ICV 27 the rate of glucose
consumption decreases at this time point. In the case of Pdc1p,
the relevance of this finding is not clear, as the isoform detected
corresponds to a minor form of this protein, probably due to
vacuolar degradation (50). In the case of Qcr2p, the higher levels
found in strain ICV 27 could be indicative of a more active
respiratory metabolism in this strain.
In this work, we have found three protein species related to
sulfur amino acid metabolism (49) that appear more abundant
in strain ICV 27. The first one is Cys4p, cystathionine-␤-syn-
thase, which catalyzes an intermediate step in the synthesis of
cysteine and the conversion of serine and homocysteine in
cystathionine. The second one is Met22p (Hal2p), involved in
methionine biosynthesis, whose activity with respect to nucle-
otide phosphatase [3⬘-(2⬘),5⬘-bisphosphate nucleosidase] al-
lows fine tuning of 3⬘-phospho-5⬘-adenylylsulfate (PAPS), an
extremely toxic intermediate in the formation of sulfite from
sulfate (43). Finally, Hom6p encodes homoserine dehydroge-
nase, an enzyme involved in the biosynthesis of homoserine, a
precursor of homocysteine. It is worth mentioning that Cys4p
requires pyridoxal phosphate for its activity, and another pro-
tein identified in our studies, YPR127w, shows similarity to the
Schizosaccharomyces pombe pyridoxal reductase, thus estab-
lishing a possible link between these two proteins. In the case
of Cys4p, two isoforms have been detected in this work, one
more abundant in strain ICV 27 and the other present only in
strain ICV 16 (Table 6). As this protein is located in both the
mitochondria and cytosol, these two isoforms could be related
to the different subcellular locations of the protein species.
Taken together, these results suggest that the pathway of sulfur
APPL. ENVIRON. MICROBIOL.
Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA
assimilation into homoserine, homocysteine, cysteine, and me-
thionine (Fig. 5) is more active in strain ICV 27.
Two stress-related proteins (Hsp26p and the product of the
gene YPR127w) were identified as differentially expressed in
strains ICV 16 and ICV 27. Hsp26p is a molecular chaperone
(23) induced under many sets of stress conditions (7, 14, 22, 34,
37, 46). In our experiments, two protein species of Hsp26p with
different isoelectric points appear differentially expressed and
each is more abundant in a different strain. Several posttrans-
lational modifications that may affect protein activity deter-
mine changes in the isoelectric point of proteins. As phosphor-
ylation sites have been previously detected in Hsp26p (19) and
as phosphorylation is predicted to lower the isoelectric point,
the isoform more abundant in ICV 16 could correspond to a
protein species with a higher degree of phosphorylation. This
difference could be important in the regulation of signal trans-
duction pathways (26). Considering together the two isoforms
differentially expressed, higher levels of this protein are de-
tected in strain ICV 16, which is in accordance with the dif-
ferences previously reported between these strains (58) in the
steady-state mRNA levels observed for this gene at the time
point of the vinification considered. The YPR127w gene en-
codes an uncharacterized protein sharing a certain similarity
(approximately 25% identity) with the products of YPL088w
(putative aryl-alcohol dehydrogenase) and YJR096w (similar to
aldo-keto reductases). Global expression analyses have indi-
cated an induction in the expression of this gene by nitrogen
starvation and entry into stationary phase (21), although no
further evidence about the relevance of this protein in stress
responses is available.
Finally, two other proteins with differential levels among
strains have been detected. One of them is Psa1p (mannose-
1-phosphate guanilyl transferase), involved in glycosylation
and cell wall biogenesis, which is only detected in strain ICV
16. The other one is Adk1p. Each strain contains one isoform
of this protein, which acts as an adenylate kinase (GTP-AMP
phosphotransferase). This enzyme performs the important
function of catalyzing the rapid return of the adenine nucleo-
tide pool to equilibrium, by the reutilization of AMP for the
synthesis of ADP, and mutants lacking the ADK1 gene product
are considerably impaired in growth (5, 29). The two protein
VOL. 72, 2006 mRNA AND PROTEIN PROFILES OF YEAST DURING VINIFICATION
species detected could correspond to allelic variations, as
shown previously for various strains (1), to different subcellular
location, or to the presence or absence of N-terminal acetyla-
tion, a modification that has been described for this protein
and may be important for the activity or stability of some
proteins under particular conditions (32, 35, 47, 48).
DISCUSSION
Global analyses of gene expression and protein profiles have
become a powerful tool in understanding how cells respond to
changing environments. Wine fermentation is clearly one ex-
ample of a process in which yeast cells have to adapt to signif-
icant variations throughout the whole process.
In this work, global gene expression and protein profiles of
two wine yeast strains fermenting synthetic must have been
considered. These two strains were selected because of their
similarities but also for the different fermentative behaviors
that they display from the time of entry into stationary phase (6
days after inoculation). For this reason this time point of the
vinification was considered. Up to now, only one proteomic
analysis with wine yeast cells under conditions that try to mimic
vinification has been carried out (50). Although some tran-
scriptomic studies with different purposes have been published
(4, 31, 42, 51), our study is the first one in which strains that do
not behave in the same way during vinification are considered
in an integrated transcriptomic-proteomic analysis.
The comparison of the gene expression data obtained from
this study and a previous analysis of stress response genes (58)
with the protein profiles indicates agreement in some cases
(for instance, for HSP26). For other genes, however, the rela-
tionship is not so straightforward, and several aspects contrib-
ute to this. First of all, it is important to consider that the
protein levels are affected not only by gene expression but also
by translation regulation. On the other hand, several isoforms
of proteins are present and with the approach followed in this
work only the spots with different levels of abundance were
characterized (other electrophoretic forms of the proteins may
be present in similar amounts).
Strain ICV 16, but not ICV 27, is able to complete the
fermentation. Our gene expression and protein data indicate
that aspects related to carbohydrate and sulfur metabolism,
nitrogen transport, stimulus response, and sterol biosynthesis
and transport may explain some of the differences in fermen-
tative behavior among these strains and could help to identify
desirable traits of wine yeast cells.
Regarding carbohydrate metabolism, several genes that en-
code enzymes involved in glycolysis and fermentation (FBA1,
ENO1, ENO2, PFK27, TDH1, TDH2, TDH3, GPM1, PGI1,
PFK2, ADH1, ADH2, ADH6) are more expressed in strain
ICV16. In addition, this strain shows higher protein levels of
the aldehyde dehydrogenase Ald6p. In ICV 27, higher gene
expression of gluconeogenic regulators and enzymes involved
in the tricarboxylic acid cycle and ATP synthase and NADH
oxidation was found (genes CAT8, SIP4, PCK1, FBP1, ADR1,
GUT2, YJL045W, SDH2, NCA3, NCA2, NDE3). Besides,
higher levels of the chain-respiratory protein Qcr2p are also
detected in this strain. These results and the data obtained by
semiquantitative PCR during the vinification favor the possi-
bility that strain ICV 27 could show—at the time of entry into
845
stationary phase—a decrease in the fermentation-respiration
balance, while in ICV 16 this metabolic change would take
place later on. The possibility of higher respiratory activity (or
lower fermentative metabolism) in strain ICV 27 does not
Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA
seem very appropriate for an accurate process and could ex-
plain lower glucose consumption later on.
Analyzing the results obtained regarding carbohydrate and
nitrogen metabolism—in particular, the expression profiles
during fermentation of some genes involved in these processes,
such FBA1 and ADR1—it seems that the changes in gene
expression detected in strain ICV 27 at early stationary phase
correspond to those found for strain ICV 16 and for other
commercial yeast strains with appropriate fermentative behav-
ior (42, 51) in late stationary phase. Interestingly, nitrogen
limitation is known to induce entry into the stationary phase,
and in this strain, despite the nitrogen available at this point,
we find higher mRNA levels of genes regulated by nitrogen
catabolite repression (many of them involved in the transport
of nitrogen compounds) and of the transcription factor Gat1p.
These data also suggest that the nitrogen transport capacity of
ICV 27 is somehow affected, and this could be one of the
reasons for the fermentative problems detected in some musts.
Another aspect relevant during wine fermentation is stress
response. Within the category of stimulus (and in particular
stress) response, we find two aspects of great interest. First,
HSP26 mRNA and protein levels are higher in strain ICV 16.
Another protein induced by stress (encoded by YPR127w)
shows similar differences, and the expression of other stress
genes (SSA4, UBC4, MSN4) also displays this kind of behavior.
Recent data indicate that the expression of Hsp26p is probably
important for maintaining the viability of cells during fermen-
tative conditions. In this sense, proteomic analysis of a wild-
type wine yeast strain has revealed an important increase in the
level of this protein when glucose is exhausted and yeast cells
enter into stationary phase (50). Moreover, the levels of this
and other stress proteins are up-regulated during the first gen-
eration in fermentations carried out by brewing yeast strains,
and these levels are maintained during subsequent generations
(28). According to the points stated in the introduction, the
higher abundance of those proteins involved in stress response
in strain ICV 16, especially Hsp26p, may be indicative of a
better adaptation or response to the stationary-phase condi-
tions and, hence, an improvement of the capability of this
strain of fully completing the vinification process.
On the other hand, in strain ICV 27 some indications of
oxidative stress are found; in fact, higher levels of expression of
genes involved in the metabolism of reactive oxygen species
(SRX7, CTA1, OYE3, GSH1, SKN7, and YAP1 among others)
have been detected. Taking these results and those related to
carbohydrate metabolism together, it is possible that in ICV 27
the relative deviation of metabolism with respect to processes
such as gluconeogenesis, organic compound oxidation, and
respiration would require a more active metabolism of reactive
oxygen species.
In strain ICV 27, some proteins involved in the sulfur as-
similation pathway (Cys4p, Met22p, and Hom6p) appear to
overaccumulate. As sulfur compounds contribute to the organ-
oleptic properties of the wine (30), the data obtained in this
analysis suggest that differences could exist in the sulfur com-
pound profiles generated in the wine by these two strains. In
846 ZUZUARREGUI ET AL.
fact, the ICV 27 strain is commercially very interesting for the
aromatic profile in the resulting wine (A. Briones, personal
communication). According to other proteomic and transcrip-
tomic data published, it cannot be ruled out that the higher
activity of the sulfur assimilation pathway in strain ICV 27
could be related to other processes, for instance, detoxifica-
tion. A connection between glutathione biosynthesis and cad-
mium detoxification in yeast cells has been shown (15, 52).
Moreover, recent work from our research group (2) has re-
vealed that high concentrations of acetaldehyde also elicit a
transcriptional induction of most genes involved in the path-
ways of sulfur amino acid metabolism and also of Tpo trans-
porters. It is interesting to mention in this sense that our
microarray data indicate higher expression levels in ICV 27 of
PDR10, SNQ2, PDR5, PDR15, YOR1, and PDR1 genes. Inter-
estingly, the mRNA levels of GSH1, a gene involved in gluta-
thione biosynthesis, are also higher in ICV 27.
Other genes with differential expression levels are involved
in ergosterol biosynthesis or transport. Yeast cells cannot pro-
duce ergosterol in the absence of oxygen, but, in agreement
with our data, several reports (42, 51) indicate that many genes
encoding proteins involved in ergosterol biosynthesis are ex-
pressed at midexponential and early stationary phases and are
down-regulated at the end of fermentation. The reported in-
crease in cellular viability and fermentation rate after punctual
additions of oxygen during the stationary phase in vinification
(41) could have a relationship to a change in the proportion of
ergosterol to phospholipids and hence in the protection against
ethanol (9, 44). The lower ergosterol content observed for
strain ICV 27 could explain, at least partially, lower ethanol
resistance and hence a greater effect of this compound on the
transport of glucose and nitrogen across the membrane.
The information obtained in this work validates the poten-
tial application of not only transcriptomic—as suggested for
other authors (17)—but also proteomic approaches for the
identification of the molecular bases of traits that can be used
for the prediction of environmental phenotypic variation. In
particular, these approaches can be useful for the understand-
ing of the process of wine fermentation and the physiological
differences between strains. Importantly, our results indicate
that these techniques can be applied to industrial S. cerevisiae
strains, which differ in many genetic and physiological aspects
from the laboratory strains previously characterized.
ACKNOWLEDGMENTS
We thank Lola Guitérrez and M. Luisa Hernaez from the “Centro
de Genómica y Proteómica” of the “Universidad Complutense” for
excellent technical support and Lynne Yenush for critically reading the
manuscript and revision of the English text. We are indebted to Jeffrey
Dellrow for his collaboration on the microarray analysis.
This work was supported by grants AGL2002-01109 from the
“Ministerio de Ciencia y Tecnologı́a” and GRUPOS03/012 from the
“Generalitat Valenciana.” A.Z. was a fellow of the “Generalitat
Valenciana.”
REFERENCES
1. Andlid, T., L. Blomberg, L. Gustafsson, and A. Blomberg. 1999. Character-
ization of Saccharomyces cerevisiae CBS 7764 isolated from rainbow trout
intestine. Syst. Appl. Microbiol. 22:145–155.
2. Aranda, A., and M. del Olmo. 2004. Exposure of Saccharomyces cerevisiae to
acetaldehyde induces sulfur amino acid metabolism and polyamine trans-
porter genes, which depend on Met4p and Haa1p transcription factors,
respectively. Appl. Environ. Microbiol. 70:1913–1922.
APPL. ENVIRON. MICROBIOL.
3. Attfield, P. V. 1997. Stress tolerance: the key to effective strains of industrial
baker’s yeast. Nat. Biotech. 15:1351–1357.
4. Backhus, L. E., J. DeRisi, P. O. Brown, and L. F. Bisson. 2001. Functional
genomic analysis of a commercial wine strain of Saccharomyces cerevisiae
under differing nitrogen conditions. FEMS Yeast Res. 1:111–125.
Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA
5. Bandlow, W., G. Strobel, C. Zoglowek, U. Oechsner, and V. Magdolen. 1988.
Yeast adenylate kinase is active simultaneously in mitochondria and cyto-
plasm and is required for non-fermentative growth. Eur. J. Biochem. 178:
451–457.
6. Bauer, F. F., and I. S. Pretorius. 2000. Yeast stress response and fermenta-
tion efficiency: how to survive the making of wine. S. Afr. J. Enol. Vitic.
21:27–51.
7. Blomberg, A. 1997. Osmoresponsive proteins and functional assessment
strategies in Saccharomyces cerevisiae. Electrophoresis 18:1429–1440.
8. Camarasa, C., J. P. Grivet, and S. Dequin. 2003. Investigation by 13C-NMR
and tricarboxylic acid (TCA) deletion mutant analysis of pathways for suc-
cinate formation in Saccharomyces cerevisiae during anaerobic fermentation.
Microbiology 149:2669–2678.
9. Chi, Z., and N. Arneborg. 1999. Relationship between lipid composition,
frequency of ethanol-induced respiratory deficient mutants, and ethanol
tolerance in Saccharomyces cerevisiae. J. Appl. Microbiol. 86:1047–1052.
10. Cleveland, W. S. 1979. Robust locally weighted regression and smoothing
scatterplots. J. Am. Stat. Assoc. 74:829–836.
11. Cornell, N. W., and R. L. Veech. 1983. Enzymatic measurement of ethanol or
NAD in acid extracts of biological samples. Anal. Biochem. 132:418–423.
12. Darriet, P., T. Tominaga, V. Lavigne, J. N. Boidron, and D. Dubourdieu.
1995. Identification of a powerful aromatic component of Vitis vinifera L. var.
Sauvignon wines: 4-mercapto-4-methylpentan-2-one. Flavour Fragr. J. 10:
385–392.
13. Degré, R. 1993. Selection and commercial cultivation of wine yeast and
bacteria, p. 421–447. In G. H. Fleet (ed.), Wine microbiology and biotech-
nology. Harwood Academic Publishers, Chur, Switzerland.
14. de Nobel, H., L. Lawrie, S. Brul, F. Klis, M. Davis, H. Alloush, and P. Coote.
2001. Parallel and comparative analysis of the proteome and transcriptome
of sorbic acid-stressed Saccharomyces cerevisiae. Yeast 18:1413–1428.
15. Dormer, U. H., J. Westwater, N. F. McLaren, N. A. Kent, J. Mellor, and D. J.
Jamieson. 2000. Cadmium-inducible expression of the yeast GSH1 gene
requires a functional sulfur-amino acid regulatory network. J. Biol. Chem.
275:32611–32616.
16. Estruch, F. 2000. Stress-controlled transcription factors, stress-induced
genes and stress tolerance in budding yeast. FEMS Microbiol. Rev. 24:469–
486.
17. Fay, J., H. McCullough, P. Sniegowski, and M. Eisen. 2004. Population
genetic variation in gene expression is associated with phenotypic variation
in Saccharomyces cerevisiae. Genome Biol. 5:R26.
18. Fazzio, T. G., C. Kooperberg, J. P. Goldmark, C. Neal, R. Basom, J. Delrow,
and T. Tsukiyama. 2001. Widespread collaboration of Isw2 and Sin3-Rpd3
chromatin remodeling complexes in transcriptional repression. Mol. Cell.
Biol. 21:6450–6460.
19. Ficarro, S. B., M. L. McCleland, P. T. Stukenberg, D. J. Burke, M. M. Ross,
J. Shabanowitz, D. F. Hunt, and F. M. White. 2002. Phosphoproteome
analysis by mass spectrometry and its application to Saccharomyces cerevi-
siae. Nat. Biotechnol. 20:301–305.
20. Fleet, G. H., and G. M. Heard. 1993. Yeasts—growth during fermentation,
p. 42–43. In G. H. Fleet (ed.), Wine microbiology and biotechnology. Har-
wood Academic Publishers, Chur, Switzerland.
21. Gasch, A. P., P. T. Spellman, C. M. Kao, O. Carmel-Harel, M. B. Eisen, G.
Storz, D. Botstein, and P. O. Brown. 2000. Genomic expression programs in
the response of yeast cells to environmental changes. Mol. Biol. Cell 11:
4241–4257.
22. Godon, C., G. Lagniel, J. Lee, J. M. Buhler, S. Kieffer, M. Perrot, H.
Boucherie, M. B. Toledano, and J. Labarre. 1998. The H2O2 stimulon in
Saccharomyces cerevisiae. J. Biol. Chem. 273:22480–22489.
23. Haslbeck, M., S. Walke, T. Stromer, M. Ehrnsperger, H. E. White, S. Chen,
H. R. Saibil, and J. Buchner. 1999. Hsp26: a temperature-regulated chap-
erone. EMBO J. 18:6744–6751.
24. Hernández, R., C. Nombela, R. Diez-Orejas, and C. Gil. 2004. Two-dimen-
sional reference map of Candida albicans hyphal forms. Proteomics 4:374–
382.
25. Hohmann, S., and W. H. Mager. 2003. Yeast stress responses. Springer-
Verlag, Berlin, Germany.
26. Hubbard, M. J., and P. Cohen. 1993. On target with a new mechanism for the
regulation of protein phosphorylation. Trends Biochem. Sci. 18:172–177.
27. Jackson, R. S. 1994. Wine science. Principles and applications. Academic
Press, San Diego, Calif.
28. Kobi, D., S. Zugmeyer, S. Potier, and L. Jaquet-Gutfreund. 2004. Two-
dimensional protein map of an “ale”-brewing yeast strain: proteome dynam-
ics during fermentation. FEMS Yeast Res. 5:213–230.
29. Konrad, M. 1988. Analysis and in vivo disruption of the gene coding for
adenylate kinase (ADK1) in the yeast Saccharomyces cerevisiae. J. Biol.
Chem. 263:19468–19474.
VOL. 72, 2006 mRNA AND PROTEIN PROFILES OF YEAST DURING VINIFICATION
30. Lambrechts, M. G., and I. S. Pretorius. 2000. Yeast and its importance to
wine aroma—a review. S. Afr. J. Enol. Vitic. 21:97–129.
31. Marks, V. D., G. K. van der Merwe, and H. J. J. van Vuuren. 2003. Tran-
scriptional profiling of wine yeast in fermenting grape juice: regulatory effect
of diammonium phosphate. FEMS Yeast Res. 3:269–287.
32. Mullen, J. R., P. S. Kayne, R. P. Moerschell, S. Tsunasawa, M. Gribskov, M.
Colavito-Shepanski, M. Grunstein, F. Sherman, and R. Sternglanz. 1989.
Identification and characterization of genes and mutants for an N-terminal
acetyltransferase from yeast. EMBO J. 8:2067–2075.
33. Perez-Torrado, R., P. Carrasco, A. Aranda, J. Gimeno-Alcaniz, J. E. Perez-
Ortin, E. Matallana, and M. L. del Olmo. 2002. Study of the first hours of
microvinification by the use of osmotic stress-response genes as probes. Syst.
Appl. Microbiol. 25:153–161.
34. Piper, P. W., K. Talreja, B. Panaretou, P. Moradas-Ferreira, K. Byrne, U. M.
Praekelt, P. Meacock, M. Recnacq, and H. Boucherie. 1994. Induction of
major heat-shock proteins of Saccharomyces cerevisiae, including plasma
membrane Hsp30, by ethanol levels above a critical threshold. Microbiology
140:3031–3038.
35. Polevoda, B., J. Norbeck, H. Takakura, A. Blomberg, and F. Sherman. 1999.
Identification and specificities of N-terminal acetyltransferases from Saccha-
romyces cerevisiae. EMBO J. 18:6155–6168.
36. Puig, S., and J. E. Pérez-Ortı́n. 2000. Expression levels and patterns of glycolytic
yeast genes during wine fermentation. Syst. Appl. Microbiol. 23:300–303.
37. Puig, S., and J. E. Pérez-Ortı́n. 2000. Stress response and expression patterns
in wine fermentations of yeast genes induced at the diauxic shift. Yeast
16:139–148.
38. Quail, M. A., and L. K. Steven. 1993. The extraction and analysis of sterols
from yeasts, p. 123–131. In I. Evans (ed.), Methods in molecular biology:
yeast protocols, vol. 53. Humana Press Inc., Totowa, N.J.
39. Riou, C., J. M. Nicaud, P. Barre, and C. Gaillardin. 1997. Stationary-phase
gene expression in Saccharomyces cerevisiae during wine fermentation. Yeast
13:903–915.
40. Rodrigues-Pousada, C. A., T. Nevitt, R. Menezes, D. Azevedo, J. Pereira, and
C. Amaral. 2004. Yeast activator proteins and stress response: an overview.
FEBS Lett. 567:80–85.
41. Rosenfeld, E., B. Beauvoit, B. Blondin, and J. M. Salmon. 2003. Oxygen
consumption by anaerobic Saccharomyces cerevisiae under enological condi-
tions: effect on fermentation kinetics. Appl. Environ. Microbiol. 69:113–121.
42. Rossignol, T., L. Dulau, A. Julien, and B. Blondin. 2003. Genome-wide
monitoring of wine yeast gene expression during alcoholic fermentation.
Yeast 20:1369–1385.
43. Russel, M., P. Model, and A. Holmgren. 1990. Thioredoxin or glutaredoxin
in Escherichia coli is essential for sulfate reduction but not for deoxyribo-
nucleotide synthesis. J. Bacteriol. 172:1923–1929.
44. Sajbidor, J., Z. Ciesarova, and D. Smogrovicova. 1995. Influence of ethanol
on the lipid content and fatty acid composition of Saccharomyces cerevisiae.
Folia Microbiol. (Prague) 40:508–510. (In Czech.)
847
45. Shevchenko, A., M. Wilm, O. Vorm, and M. Mann. 1996. Mass spectrometric
sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68:
850–858.
46. Susek, R. E., and S. Lindquist. 1990. Transcriptional derepression of the
Saccharomyces cerevisiae HSP26 gene during heat shock. Mol. Cell. Biol.
Downloaded from http://aem.asm.org/ on August 14, 2013 by UNIVERSIDADE CATÓLICA DE BRAS�LIA
10:6362–6373.
47. Tercero, J. C., J. D. Dinman, and R. B. Wickner. 1993. Yeast MAK3 N-
acetyltransferase recognizes the N-terminal four amino acids of the major
coat protein (gag) of the L-A double-stranded RNA virus. J. Bacteriol.
175:3192–3194.
48. Tercero, J. C., L. E. Riles, and R. B. Wickner. 1992. Localized mutagenesis
and evidence for post-transcriptional regulation of MAK3. A putative N-
acetyltransferase required for double-stranded RNA virus propagation in
Saccharomyces cerevisiae. J. Biol. Chem. 267:20270–20276.
49. Thomas, D., and Y. Surdin-Kerjan. 1997. Metabolism of sulfur amino acids
in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 61:503–532.
50. Trabalzini, L., A. Paffetti, A. Scaloni, F. Talamo, E. Ferro, G. Coratza, L.
Bovalini, P. Lusini, P. Martelli, and A. Santucci. 2003. Proteomic response
to physiological fermentation stresses in a wild-type wine strain of Saccha-
romyces cerevisiae. Biochem. J. 370:35–46.
51. Varela, C., J. Cárdenas, F. Melo, and E. Agosin. 2005. Quantitative analysis
of wine yeast gene expression profiles under winemaking conditions. Yeast
22:369–383.
52. Vido, K., D. Spector, G. Lagniel, S. Lopez, M. B. Toledano, and J. Labarre.
2001. A proteome analysis of the cadmium response in Saccharomyces cere-
visiae. J. Biol. Chem. 276:8469–8474.
53. Wang, X. P., C. J. Mann, Y. L. Bai, L. Ni, and H. Weiner. 1998. Molecular
cloning, characterization, and potential roles of cytosolic and mitochondrial
aldehyde dehydrogenases in ethanol metabolism in Saccharomyces cerevisiae.
J. Bacteriol. 180:822–830.
54. Wilcox, L. J., D. A. Balderes, B. Wharton, A. H. Tinkelenberg, G. Rao, and
S. L. Sturley. 2002. Transcriptional profiling identifies two members of the
ATP-binding cassette transporter superfamily required for sterol uptake in
yeast. J. Biol. Chem. 277:32466–32472.
55. Wolfger, H., Y. M. Mamnun, and K. Kuchler. 2001. Fungal ABC proteins:
pleiotropic drug resistance, stress response and cellular detoxification. Res.
Microbiol. 152:375–389.
56. Zaworsky, P. G., and R. C. Heimsch. 1987. The isolation and characteriza-
tion of flocculent yeast. In G. G. Hiebsch (ed.), Biological research on
industrial yeast III. CRC Press Inc., Boca Raton, Fla.
57. Zuzuarregui, A., and M. del Olmo. 2004. Analyses of stress resistance under
laboratory conditions constitute a suitable criterion for wine yeast selection.
Antonie Leewenhoek 85:271–280.
58. Zuzuarregui, A., and M. del Olmo. 2004. Expression of stress response genes
in wine strains with different fermentative behavior. FEMS Yeast Res.
4:699–710.