NeuroResource

Neuron-Specific Genome Modification in the Adult

Rat Brain Using CRISPR-Cas9 Transgenic Rats
Graphical Abstract Authors
Susanne Ba €ck, Julie Necarsulmer,
Leslie R. Whitaker, ..., F. Kent Hamra,
Christopher T. Richie,
Brandon K. Harvey

Correspondence
bharvey@mail.nih.gov

In Brief
Limited availability of transgenic rats has
hindered their utility in modeling human
behavior and cognition. Ba €ck,
Necarsulmer, et al. describe new
transgenic rats and viral vectors that
enable neuron- and region-specific gene
modifications within the adult rat brain.

Highlights
d Methods are described for cell-specific genome modification
in the adult rat brain

d Transgenic rats were engineered to express Cre-dependent

Cas9 or Cas9 nickase

d A Cre driver rat for dopaminergic neurons and an mCherry

Cre reporter rat were made

d The first transgenic rat made by CRISPR and spermatogonial

stem cells is described

€ck et al., 2019, Neuron 102, 105–119

Ba
April 3, 2019 Published by Elsevier Inc.
https://doi.org/10.1016/j.neuron.2019.01.035
Neuron

NeuroResource

Neuron-Specific Genome Modification

in the Adult Rat Brain
Using CRISPR-Cas9 Transgenic Rats
Susanne Ba €ck,1,11 Julie Necarsulmer,2,11 Leslie R. Whitaker,3 Lamarque M. Coke,1 Pyry Koivula,1 Emily J. Heathward,2
Lowella V. Fortuno,2 Yajun Zhang,2 C. Grace Yeh,3 Heather A. Baldwin,1 Morgan D. Spencer,1 Carlos A. Mejias-Aponte,4
James Pickel,6 Alexander F. Hoffman,5 Charles E. Spivak,5 Carl R. Lupica,5 Suzanne M. Underhill,7 Susan G. Amara,7
Andrii Domanskyi,8 Jenni E. Anttila,8 Mikko Airavaara,8 Bruce T. Hope,3 F. Kent Hamra,9,10 Christopher T. Richie,2,12
and Brandon K. Harvey1,2,12,13,*
1Molecular Mechanisms of Cellular Stress and Inflammation Section, Intramural Research Program, National Institute on Drug Abuse,

National Institutes of Health, Baltimore, MD 21224, USA

2Optogenetics and Transgenic Technology Core/Genetic Engineering and Viral Vector Core, Intramural Research Program, National Institute

on Drug Abuse, National Institutes of Health, Baltimore, MD 21224, USA

3Neuronal Ensembles in Drug Addiction Section, National Institute on Drug Abuse, Intramural Research Program, National Institutes of Health,

Baltimore, MD 21224, USA

4Histology Core, Intramural Research Program, National Institute on Drug Abuse, National Institutes of Health, Baltimore, MD 21224, USA
5Electrophysiology Research Section, Intramural Research Program, National Institute on Drug Abuse, National Institutes of Health,

Baltimore, MD 21224, USA

6Transgenic Technology Core, Intramural Research Program, National Institute of Mental Health, Bethesda, MD 20892, USA
7Laboratory of Molecular and Cellular Neurobiology, Intramural Research Program, National Institute of Mental Health, Bethesda, MD

20892, USA
8Institute of Biotechnology, HiLIFE, University of Helsinki, 00014 Helsinki, Finland
9Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA
10Cecil H. and Ida Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA
11These authors contributed equally
12These authors contributed equally
13Lead Contact

*Correspondence: bharvey@mail.nih.gov
https://doi.org/10.1016/j.neuron.2019.01.035

SUMMARY INTRODUCTION

Historically, the rat has been the preferred animal
model for behavioral studies. Limitations in genome
modification have, however, caused a lag in their
use compared to the bevy of available transgenic
mice. Here, we have developed several transgenic
tools, including viral vectors and transgenic rats,
for targeted genome modification in specific adult
rat neurons using CRISPR-Cas9 technology. Start-
ing from wild-type rats, knockout of tyrosine hy-
droxylase was achieved with adeno-associated
viral (AAV) vectors expressing Cas9 or guide RNAs
(gRNAs). We subsequently created an AAV vector
for Cre-dependent gRNA expression as well as
three new transgenic rat lines to specifically target
CRISPR-Cas9 components to dopaminergic neu-
rons. One rat represents the first knockin rat model
made by germline gene targeting in spermatogonial
stem cells. The rats described herein serve as a
versatile platform for making cell-specific and
sequence-specific genome modifications in the
adult brain and potentially other Cre-expressing tis-
sues of the rat.
Since its debut in the mid-2000s, the application of CRISPR-
Cas9 technology has revolutionized the field of genome editing.
Originally identified as an adaptive defense mechanism in bacte-
ria (Barrangou et al., 2007; Gasiunas et al., 2012; Jinek et al.,
2012) and subsequently engineered for the modification of genes
in eukaryotes (Mali et al., 2013; Cong et al., 2013; Jinek et al.,
2013; Hou et al., 2013; Cho et al., 2013), the Cas9 nuclease iden-
tifies target DNA molecules for cleavage using complimentary
short guide RNAs (gRNA) (Zhang et al., 2014; Sander and Joung,
2014). Crucial for target DNA recognition and nuclease activity is
a protospacer adjacent motif (PAM) on the nontarget strand at
the 30 end of the target sequence. Once recognized, the DNA
is cleaved 3 nucleotides (nt) upstream of the PAM sequence by
the endonuclease domains of Cas9 (Jinek et al., 2012), creating
a sequence-specific double-strand break that is subsequently
resolved by host-cell processes for nonhomologous end joining
(NHEJ) or homology-directed repair (reviewed by Doudna and
Charpentier, 2014; Sander and Joung, 2014). The typical result
of a CRISPR-mediated lesion is a mutated DNA sequence con-
taining an insertion or deletion (indel) mutation.
The components of the CRISPR-Cas9 system have been
delivered to rodent embryos by transfection or direct injection
to facilitate the creation of novel loss-of-function alleles and
transgenic knockins for both mice (Yang et al., 2013; Wang

Neuron 102, 105–119, April 3, 2019 Published by Elsevier Inc. 105

et al., 2013; Shen et al., 2013; Li et al., 2013a) and rats (Ma et al.,
2014; Chapman et al., 2015; Li et al., 2013a, 2013b). Importantly,
these components can be packaged into lipid nanoparticles
(Finn et al., 2018) or genetically encoded into viral vectors (Suzuki
et al., 2016; Shao et al., 2018; Swiech et al., 2015), allowing for
the introduction of sequence-specific modifications into the
genome of early postnatal and adult rodents using systemic or
local injection. The ability to temporally control genome modifi-
cation of somatic cells circumvents developmental adaptations
or diminished survival caused by some germline mutations. Us-
ing CRISPR-Cas9 technology, it is now possible to alter the
genome by sequence-specific knockout, knockin, or correction
of one or several target genes at any time during the lifespan of
an animal.
The ability of CRISPR-Cas9 to introduce genetic modifications
in neurons of adult mice has previously been demonstrated (Su-
zuki et al., 2016; Nishiyama et al., 2017; Swiech et al., 2015; Platt
et al., 2014). Although CRISPR-Cas9 has been used to make
germline mutations in rats (Ma et al., 2014; Chapman et al.,
2015; Li et al., 2013b; Pradhan and Majumdar, 2016; Remy
et al., 2017), manipulations of the genome of specific neurons
in the rat brain have not been described. Rats are the animal
model of choice for behavioral research for historical, technical,
and developmental reasons (larger size, more elaborate cogni-
tive and social behavior, etc.; reviewed by Ellenbroek and
Youn, 2016; Homberg et al., 2017). The use of rats is particularly
prominent within the field of substance abuse disorders and
addiction research, where complex drug-abuse-related operant
behaviors have been successfully modeled (Parker et al., 2014).
Another field that has heavily relied upon rat models for preclin-
ical testing of therapeutic strategies is Parkinson’s disease, a
disorder characterized by degeneration of the nigrostriatal dopa-
minergic pathway leading to motor disabilities (Duty and Jenner,
2011; Creed and Goldberg, 2018). Both Parkinson’s disease and
substance abuse disorders are linked to alterations in the func-
tion of midbrain dopaminergic neurons. In the lateral midbrain,
the dopaminergic neurons of the substantia nigra (SN) send pro-
jections to the dorsal striatum, where they are involved in control
of movements, whereas more medially located dopaminergic
neurons of the ventral tegmental area (VTA) innervate the ventral
striatum (nucleus accumbens) and prefrontal cortex to partici-
pate in motivation and reward modalities. Therefore, the ability
to alter the genetic composition of the midbrain dopaminergic
neurons during various stages of disease progression can
shed light on the function of genes in the manifestation of rele-
vant pathologies, which in turn could enable the development
of novel therapies.
Herein, we describe the generation and characterization of
several transgenic rats that can facilitate genomic modification
in adult rat midbrain dopaminergic neurons. We created two
Cre-dependent Cas9 rats, one with ‘‘wild-type’’ Cas9 (LSL-
Cas9 rat) and the other with a Cas9 ‘‘nickase’’ (LSL-nickase
rat). The LSL-nickase rat was generated by CRISPR-Cas9-medi-
ated knockin using spermatogonial stem cells and represents
the first transgenic rat made in this manner. We also created
a Cre-driver rat expressing a mammalian codon-optimized
‘‘improved Cre recombinase’’ or ‘‘iCre’’ (Shimshek et al., 2002)
under control of the rat dopamine transporter promoter (DAT-
106 Neuron 102, 105–119, April 3, 2019
iCre rat). By crossing LSL-Cas9 and DAT-iCre rats and delivering
gRNAs to the rat midbrain via adeno-associated viral (AAV)
vectors, we were able to selectively modify the genome of dopa-
minergic neurons. Using wild-type (WT) rats and our newly
described transgenic lines, we present multiple approaches
with different degrees of targeting precision and specificity that
can be used to induce sequence-specific knockout of target
genes in the adult rat midbrain following viral vector delivery of
CRISPR-Cas9 components (Figure 1).
RESULTS
Genome Modification in Rat Midbrain by
Co-transduction with Cas9 and gRNA or Nickase
and gRNA
To first demonstrate viral-vector-mediated genome modification
in the adult rat brain, we targeted the rat tyrosine hydroxylase
(Th) gene. The Th gene is expressed in the dopaminergic neu-
rons of the midbrain and has a distinct, bilateral pattern of immu-
noreactivity on brain sections. We constructed gRNAs that bind
within the first exon of the Th gene or Rosa26 locus (control) and
validated them by co-transfection with a Cas9 expression
plasmid into rat PC12 cells (Figure S1). These gRNA expression
cassettes were then cloned into an AAV vector (serotype 1) that
expresses an EGFP reporter (‘‘AAV Th gRNAs’’ and ‘‘AAV control
gRNAs’’). We first tested the AAV vectors in rat primary cortical
neurons and found evidence of mutations at the Th locus at
1 week after co-transduction with AAV Th gRNAs and AAV
Cas9. Using tracking of indels by decomposition (TIDE) analysis,
we identified different types of mutations at the Th locus (Fig-
ure S2). We then analyzed WT Long-Evans (LE) rats for tyrosine
hydroxylase (TH) protein knockout following the co-delivery of
AAV Cas9 and AAV Th gRNAs to the midbrain (Table S1).
Compared to the contralateral hemisphere that received AAV
Cas9 and AAV control gRNAs, densitometry analysis revealed
a significant reduction (40%) in TH immunoreactivity in the
SN at 2, 3, and 6 weeks post-transduction with AAV Cas9 and
AAV Th gRNAs (Figure 2A, top, and Figure 2B). The reduction
of TH immunoreactivity was specific to the co-delivery of Cas9
and gRNA, as no decrease in TH immunoreactivity was observed
in WT animals injected with gRNA alone (Figure 2B). While the
reduction in TH immunoreactivity in the midbrain leveled off at
the earliest time point (2 weeks), we observed a time-dependent
decrease in the density of TH-positive fibers in the striatum, pro-
gressing from an 25% to 53% reduction between 2 and
6 weeks post-transduction (Figure 2A, bottom, and Figure 2C).
Modifications within the Cas9 catalytic sites have generated
variants that retain the ability for gRNA-directed DNA binding
but produce a break or ‘‘nick’’ on only one strand of the DNA
double helix (Gasiunas et al., 2012; Ran et al., 2013). Taken on
its own, a nick in the DNA backbone created in this way is not
very mutagenic; however, these nickases (or Cas9n variants)
can still create indels when combined with a mix of two gRNAs
that target proximal sites on opposite strands (Ran et al.,
2013). Since this technique uses two gRNAs, it expands the
target sequence necessary to create an indel to 40 nt and should
therefore lead to fewer off-target effects. To test the capability of
nickase to induce genetic alterations in the adult rat brain, we
A B Figure 1. Experimental Approaches for
Induction of CRISPR-Cas9-Mediated
wildtype Knockout of Genes in the Rat Midbrain
AAV-Cas9

AAV-gRNA
(Th)
} rat
} AAV-Cas9 AAV-Cas9

AAV-gRNA AAV-LSL-gRNA
(control) (Th)
} DAT-iCre Targeted gene disruption in the adult rat midbrain
was achieved using four different approaches.
(A) WT rats received co-injections of AAV vectors
expressing Cas9 or gRNAs specific to rat tyrosine
hydroxylase (Th) gene.
(B) The midbrain of transgenic rats (DAT-iCre)
1

expressing Cre in their dopaminergic (DAT-ex-

pressing) neurons was targeted with Cas9 and
Cre-dependent Th gRNA to modify the Th gene
only in dopaminergic neurons.
(C) Co-injections of AAV iCre and AAV gRNAs for
Th or Manf were performed to modify the Th or
Manf genes in transgenic rats expressing Cre-
Region-specific Contralateral Cell-type-specific Contralateral
control
dependent Cas9 or nickase.
Th editing control Region-specific
Th editing (D) A cross of the DAT-iCre and LSL-Cas9 rats
generated rats with Cas9 expression limited to
C D dopaminergic neurons, allowing for sequence-
specific alterations of the genome in dopaminergic
LSL-Cas9 DAT-iCre
or x neurons with an injection of a single AAV
AAV-Cre

AAV-gRNA
(Th/Manf)
} LSL-nickase
} AAV-Cre

AAV-gRNA
(control)
AAV-gRNA
(Manf) } LSL-Cas9
} AAV-gRNA
(control)
carrying gRNAs.

1 1
Region-specific Contralateral Cell-type-specific
Th/Manf editing control Region-specific
Manf editing
designed an AAV vector expressing nickase under the MeCP2
promoter and delivered it to the rat midbrain by co-injection
with an AAV expressing a pair of ‘‘nickase-compatible’’ gRNAs
targeting the Th gene. The co-injection of AAV nickase and
AAV Th gRNAs resulted in a significant loss of TH immunoreac-
tivity in the ipsilateral midbrain and striatum compared to the
contralateral hemisphere that received AAV nickase and AAV
control gRNAs (Figures 2D–2F). However, using this approach,
the loss of TH appeared to exhibit a slower onset compared to
that achieved by AAV Cas9 delivery. Significant reductions in
TH immunoreactivity were observed 4 and 6 weeks post-trans-
duction, resulting in an average 30% and 47% loss of TH immu-
noreactivity in the SN (Figure 2E) and striatum (Figure 2F),
respectively.
Characterization of DAT-iCre Rats
Although the selection of transgene promoter, viral vector
tropism, and method of vector delivery provide some control
over transgene expression, the intracranial delivery of viral vec-
tors does not generally allow for targeting of specific neuronal
populations. Therefore, to selectively alter the genetic composi-
tion of dopaminergic neurons, we created a transgenic rat line
expressing iCre under the control of the rat Dat (Slc6a3) pro-
moter. A bacterial artificial chromosome (BAC) containing the
Dat gene was recombineered to express
iCre and randomly integrated into the LE
rat genome. Six founder rats were identi-
fied, three of which had germline-trans-
missible transgenes. Analysis by droplet
digital PCR determined that lines 1, 5,
and 6 contained two, eight, and one
Contralateral copies of the transgene per haploid
control genome, respectively. Line 1, which had
two copies per haploid genome, ex-
hibited an occasional loss of a copy
within the litters produced in the first five generations. In situ
RNA hybridization in the SN/VTA of DAT-iCre line 6 transgenic
rats showed nearly complete colocalization of Dat and Cre signal
(Figure 3A), with Dat and Cre colocalized in 96.5% ± 2.1% of the
cells (total of 9 sections from 3 rats, mean ± SD). Dat-reactive
cells that showed no Cre expression represented 1.3% ± 0.8%
of the population counted, and 2.4% ± 2.5% cells were Cre
positive and Dat negative. Expression of Cre in dopaminergic
neurons was also verified with immunohistochemistry using
antibodies for TH and Cre (Figure 3B). The signal from Cre
mRNA and protein was absent in the midbrain of WT animals
(Figures 3A and 3B).
A series of experiments were performed to examine whether
the presence of the transgene affected dopaminergic neuron
properties. Expression of iCre in rat dopaminergic neurons
did not change the midbrain or striatal expression of TH for
all lines tested (Figures 3C and 3D). Also, the protein levels
of striatal DAT from a membrane preparation were constant
across all DAT-iCre transgenic lines and WT rats (Figure 3E).
Moreover, the DAT-iCre rats showed normal internalization of
DAT (Figure 3F) and excitatory amino acid transporter 3
(EAAT3) (Figure 3G) in response to amphetamine treatment.
For DAT protein assays (Figures 3E–3G), line 5 showed the
highest variability but also had the highest number of transgene

Neuron 102, 105–119, April 3, 2019 107

A EGFP TH DAPI Merge
Figure 2. Co-delivery of AAV Th gRNA and
AAV Cas9 or AAV Nickase into WT Rats
L R
Leads to Decreased TH Immunoreactivity
Midbrain

(A and D) Representative images of the midbrain

(MB; top) and striatum (bottom) from WT rats
6 weeks following a co-injection of (A) AAV Cas9
or (D) AAV Cas9 nickase with either AAV control
gRNAs (right side [R]) or AAV Th gRNAs (left side
L R [L]) into the MB. GFP fluorescence, as a marker of
gRNA delivery, and TH immunoreactivity, as a
Striatum

marker of TH knockout efficacy, were assessed.

B Midbrain
TH immunofluorescence
(B and E) Quantification of TH immunoreactivity in
the SN shown as Th gRNA-injected compared to
control gRNA-injected side with or without a co-
C Striatum injection of AAV Cas9. Both datasets were

TH immunofluorescence

125 b 125 c normalized to DAPI following 2-, 4-, or 6-week

(% of contralateral)

(% of contralateral)

100 100
incubations. Each data point represents a coronal
a
a b section (3–4 sections/animal), and each color
a
75 a 75 b
represents a distinct animal (n = 3–5/group). (B)
50 50 One-way ANOVA, F3,10 = 34.8, p < 0.0001; a
25 25
versus b: p < 0.0001, Tukey’s multiple compari-
sons test. (E) One-way ANOVA, F3,33 = 10.59, p <
0 0 0.0001; a versus b: p < 0.01; a versus c: p < 0.05,
2 4 6 6 2 4 6 6
No No
a versus d: p = 0.226, b and c versus d: p < 0.001,
Cas9 Cas9
Cas9 Cas9 Tukey’s multiple comparisons test.
Weeks Weeks (C and F) Quantification of TH immunoreactivity in
D EGFP TH DAPI Merge the striatum, as described for (B and E) (3–4 cor-
L R onal sections/animal from 3-5 animals/group).
(C) One-way ANOVA, F3,10 = 52.72, p < 0.0001;
Midbrain

a versus b: p < 0.05 (4 wk); a versus b: p < 0.01

(6 wk); a versus c: p < 0.001; b versus c: p <
0.0001 (4 wk); b versus c: p < 0.0001 (6 wk),
Tukey’s multiple comparison test. (F) One-way
ANOVA, F3,37 = 31.20, p < 0.0001; a versus b and
c, p < 0.0001; a versus d, p = 0.986; b versus d,
Striatum

p = 0.0001; c versus d, p < 0.0001, Tukey’s mul-

E Midbrain
TH immunofluorescence
tiple comparisons test.
Scale bars, 500 mm. The same group of animals
injected with control gRNA only are used for
reference in the midbrain (B and E) and the stria-
F Striatum
tum (C and F).

125 125 a
THimmunofluorescence

d d
(% of contralateral)

(%ofcontralateral)

100 a
c 100 b
b
75 75 c

50
25
0 0
2 4
Nickase
Weeks
copies. Dopaminergic neurons from DAT-iCre line 6 rats had
electrophysiological properties similar to WT rats, displaying a
tonic firing pattern characteristic if dopaminergic neurons
(Figure 3H), with a firing rate (Figure 3I), input resistance (Fig-
ure 3J), and holding current (Figure 3K) that did not differ
from WT rats. Fast-scan cyclic voltammetry in dorsal striatal
slices obtained from DAT-iCre line 6 rats revealed no signifi-
cant differences in dopamine release or uptake following a
single pulse electrical stimulation relative to WT controls
(Figures 3M and 3N). In addition, cocaine (5 mM), a known
antagonist of DAT, acutely inhibited dopamine uptake to the
same extent in both genotypes (Figures 3L and 3M), further
50
confirming that the presence of the
25
transgene does not alter DAT function.
To test the specificity of Cre-mediated
6 6 2 4 6 6
No Nickase No recombination in DAT-iCre line 6 rats,
Nickase Nickase
both WT and DAT-iCre rats received
Weeks
intranigral injections of a viral vector ex-
pressing a Cre-dependent color-chang-
ing reporter, AAV Nuc-flox-(mCherry)-EGFP (Table S1). This
vector produces nuclear-localized ‘‘Nuc’’ mCherry by default
but switches to producing nuclear-localized GFP in the presence
of Cre recombinase. Two weeks after the injection, DAT-iCre rats
showed expression of EGFP in dopaminergic neurons (TH-reac-
tive cells), indicating that Cre-dependent recombination of the
transgene had resulted in a deletion of the mCherry coding re-
gion (Figure 3O). The signal from EGFP was not detected in
WT rats or in non-dopaminergic cells (TH negative) in DAT-iCre
rats. When we injected the same virus into additional regions
(the prefrontal cortex, hypothalamus, and striatum), we observed
the strongest expression in the midbrain; however, noticeable

108 Neuron 102, 105–119, April 3, 2019

staining was also observed in the hypothalamus (Figure S3).
DAT-iCre line 6 rats were also crossed with LE Dio-mCherry
transgenic rats, and the expression of Cre and mCherry was vali-
dated with immunohistochemistry (Figure S4). Both Cre and
mCherry showed robust expression in the midbrain. Similar to
the Cre-reporter virus results, some GFP-positive cells were de-
tected in the hypothalamus of the rats, although we did not
observe Cre expression in this area as we did in the midbrain
(Figures 3 and S4). The expression of Dat mRNA in the rat hypo-
thalamus has been previously described (Meister and Elde,
1993). Based on our characterization of the different DAT-iCre
lines, we proceeded with line 6 as the ‘‘DAT-iCre’’ line.
Delivery of Cre-Dependent gRNA to DAT-iCre Rats
Causes Disruption of TH
To achieve genome modification that is restricted to dopami-
nergic neurons, we modified a Cre-dependent expression sys-
tem (Tiscornia et al., 2004) for gRNA expression. The foundation
of this system is a modified murine U6 promoter that contains a
loxP element just upstream of the transcription start site. By
coupling this to the U6 gene’s transcription termination
sequence and another loxP element, we created a floxed
(‘‘flanked by loxP’’) transcription terminator referred to as a lox-
stop-lox (LSL), which prevents the transcription of a downstream
gRNA in the absence of Cre activity (Figure S5). To demonstrate
Cre-dependent gRNA expression, rat PC12 cells were co-trans-
fected with a mix of plasmids expressing Cre-independent Th
gRNA, Cre-dependent Th gRNA, Cas9, and either iCre or Flpo,
a recombinase that does not act on lox sites. Using the T7E1
assay, evidence of Th gene mutagenesis was only observed in
the presence of Cre (Figure S5). We produced an AAV vector
with this Cre-dependent gRNA to rat Th (AAV LSL-Th gRNA)
and co-injected it with our AAV Cas9 vector unilaterally into the
midbrain of the DAT-iCre rats (Table S1). Six weeks post-trans-
duction, we observed an 50% decrease of TH immunoreac-
tivity in the SN of the injected hemisphere (Figures 4A and 4B)
and a concomitant 44% reduction of TH staining in the ipsilateral
striatum (Figures 4C and 4D). WT LE rats injected with the same
viral vectors also showed an 20% reduction of TH immunore-
activity in the ipsilateral hemisphere, possibly due to injection-
induced tissue damage or GFP overexpression. However, the
loss of TH immunoreactivity in the nigrostriatal pathway of
DAT-iCre rats was significantly greater than that observed
in WT rats (Figures 4B and 4D). A similar trend in TH protein
loss was observed using western blot analysis of midbrain
tissue punches from AAV-injected WT and DAT-iCre animals
(Figure S6).
Generation of Transgenic LSL-Cas9 Transgenic Rats for
Cre-Dependent Expression of Cas9
We created a transgenic rat to express a FLAG-tagged Cas9 in a
Cre-dependent manner. A CAG promoter-driven LSL-Cas9
construct was targeted to the rat Rosa26 locus. PCR genotyping
and sequencing confirmed appropriate targeting to the Rosa26
locus. To verify that the LSL-Cas9 transgenic rats express
Cas9 following Cre-dependent recombination, rats received
intracranial injections of AAV iRFP-iCre or AAV iRFP-Flpo to ex-
press either Cre recombinase or Flpo recombinase (as control) in
the midbrain (Table S1). Four weeks post-transduction, we
observed FLAG immunoreactivity in the midbrain following
transduction by AAV iRFP-Cre, but not by AAV iRFP-Flpo (Fig-
ure 5A), indicating Cre-dependent recombination and expres-
sion of FLAG-tagged Cas9. Injections of the viral vectors resulted
in comparable levels of iRFP fluorescence, demonstrating
similar viral delivery of both recombinases. No FLAG immunore-
activity was observed when either virus was injected into WT
animals.
Co-delivery of Cre Recombinase and gRNAs Alters Gene
Expression in the Midbrain of LSL-Cas9 Rats
The midbrain of LSL-Cas9 transgenic rats was injected with a
combination of AAV iCre and AAV Th gRNAs or AAV control
gRNAs (Table S1). Four weeks later, the hemisphere that
received Th gRNAs displayed a 45% reduction in nigral TH
immunoreactivity compared to the control gRNAs-injected
hemisphere (Figures 5B and 5D). Similarly, TH immunoreactivity
in the ipsilateral striatum was decreased to 60% of the contra-
lateral side (Figures 5C and 5D). Comparable viral transduction
between the hemispheres was observed based on detection of
EGFP fluorescence that was co-expressed with each gRNA vec-
tor (Figures 5B and 5C).
Mesencephalic astrocyte-derived neurotrophic factor (MANF)
is a protein expressed in the rodent midbrain (Lindholm et al.,
2008) and has been reported to have therapeutic effects on
dopaminergic neurons in rodent models of Parkinson’s disease
(Voutilainen et al., 2009). The ability to modify genes linked to
alterations in disease pathology could provide important insight
into the functions of these genes and reveal new opportunities
for treatment development. We therefore produced an AAV vec-
tor with gRNAs that would specifically target the Manf gene and
allow for downregulation of MANF expression (Figure 6A). This
AAV Manf gRNAs vector was tested in vitro by co-transduction
with AAV Cas9 into rat primary cortical neurons. Resolvase treat-
ment of the Manf PCR product revealed cleaved fragments
(Figure 6B) consistent with the introduction of indel mutations
verified by subsequent cloning and sequencing of the PCR
DNA (Figure 6C). In addition, primary neurons transduced with
AAV Cas9 and AAV Manf gRNA showed a robust decrease in
Manf mRNA (Figure 6D) and protein levels (Figure 6E) 1 week
post-transduction.
Following in vitro validation of the MANF knockout assay, the
LSL-Cas9 transgenic rats received an injection into the SN with a
mix of AAV iCre and AAV Manf gRNA or AAV control gRNA (Table
S1). Four weeks post-transduction, the ipsilateral SN that
received MANF gRNA displayed an average 35% reduction of
MANF immunoreactivity relative to the contralateral region in-
jected with control gRNA (Figures 6F and 6G). Detection of
EGFP fluorescence was used as a reference to ensure similar
viral delivery of EGFP-tagged gRNAs between hemispheres
(Figure 6F).
Genetic Editing of Midbrain Neurons in an LSL-Cas9-
Nickase Rat Created by CRISPR-Cas9 Modifications of
Spermatogonial Stem Cells
CRISPR-Cas9-mediated gene targeting in donor spermatogo-
nial stem cell cultures via the NHEJ DNA repair pathway was
Neuron 102, 105–119, April 3, 2019 109
 A H I

J K

M N

O
C D

E
F G

Figure 3. Characterization of DAT-iCre Rats

(A and B) Representative images of (A) in situ RNA hybridization and (B) immunohistochemical staining of the midbrain in WT and DAT-iCre transgenic rats.
(A) Green, Cre; red, dopamine transporter (Dat); blue, DAPI staining. (B) Green, Cre; red, tyrosine hydroxylase (TH). Scale bars, 20 mm.
(legend continued on next page)

110 Neuron 102, 105–119, April 3, 2019

 A EGFP TH DAPI Merge B
Midbrain
L R

TH immunofluorescence
150 **

(% o f contralateral)
WT

100

L R
50
DAT-iCre

0
WT DAT-iCre
Animal

C EGFP TH DAPI Merge D

L R Striatum

TH immunofluorescence
150 *
WT

(% of contralateral)
100

L R
50
DAT-iCre

0
WT DAT-iCre
Animal

Figure 4. Unilateral Injection of LSL-gRNA in Rats Expressing Cre in Dopaminergic Neurons Enables Region- and Cell-Type-Specific Th
Editing
(A and C) Representative images demonstrate unilateral loss of TH immunoreactivity in the (A) midbrain and (C) striatum of DAT-iCre rats (bottom), but not WT
animals (top), 6 weeks following co-delivery of AAV Cas9 and AAV LSL-Th gRNA to the left (L) SN. GFP fluorescence represents transduction by AAV.
(B) Quantification of optical density of TH immunoreactivity relative to DAPI in the ipsilateral compared to the contralateral SN of animals described in (A). Each
point represents one analyzed coronal section (n = 3–4 sections/animal), and each color represents a distinct animal (n = 5–6/group, unpaired t test, t(9) = 4.166,
**p = 0.0024).
(D) Quantification of optical density of TH immunoreactivity relative to DAPI in the ipsilateral compared to the contralateral striatum of animals described in (C).
Each point represents one analyzed coronal section (n = 3–4 sections/animal), and each color represents a distinct animal (n = 5–6/group, unpaired t test,
t(11) = 2.896, *p = 0.0177).
Scale bars, 500 mm.

previously shown to provide an efficient approach for knockout geted insertion of an 11.9 kb Cre-dependent, LSL-nickase
rat production (Chapman et al., 2015). Here, we demonstrate (SpCas9(D10A)) transgene into the Rosa26 genomic locus (Fig-
highly efficient CRISPR-Cas9-mediated homology-directed ure 7A). The Rosa26 locus is commonly used as a ‘‘safe harbor’’
repair (HDR) in rat spermatogonial stem cell cultures by tar- site to support robust, ubiquitous transgene expression in rats

(C and D) Western blot analysis of TH protein levels in the (C) midbrain and (D) striatum of WT and DAT-iCre rats (lines 1, 5, and 6) (n = 3/line, one-way ANOVA;
E: F3,8 = 0.734, p = 0.5604; D: F3,8 = 0.2735, p = 0.8429; representative blots are shown above the graphs).
(E) Western blot analysis of total DAT membrane protein in the striatum of WT and DAT-iCre rats (n = 5–9, one-way ANOVA, F3,24 = 0.7502, p = 0.2744).
(F and G) DAT (F) and excitatory amino acid transporter 3 (EAAT3) (G) western blot on the biotinylated fraction from hemisected midbrain sections treated with
10 mM amphetamine (AMPH) or vehicle for 30 min. The results are normalized to DAT band density from the vehicle-treated hemisphere (100%). A comparable
effect of amphetamine treatment on DAT and EAAT3 internalization was observed throughout all groups (F: one-way ANOVA, F3,10 = 0.2704, p = 0.8454;
G: Kruskal-Wallis, H = 2.918, p = 0.4404).
(H) Traces from tonically firing dopamine neurons in the SN.
(I) SN dopamine neuron firing rate in WT (n = 5) and DAT-iCre (n = 6) neurons (unpaired t test, t(9) = 0.1273, p = 0.9015).
(J) Input resistance in SN dopaminergic neurons from WT (n = 10) and DAT-iCre (n = 10) cells (unpaired t test, t(18) = 1.488, p = 0.1541).
(K) Dopamine neuron holding current in WT (n = 10) and DAT-iCre (n = 10) cells (unpaired t test, t(18) = 1.621, p = 0.1223).
(L) Representative voltammetry signals from a WT and DAT-iCre rat prior to (control) and 10 min post-cocaine (Coc). Circles represent three averaged responses
obtained under each condition; red traces are fitted curve used to determine uptake constant.
(M) Effects of cocaine on dopamine uptake in WT (16 slices, 4 rats) and DAT-iCre rats (16 slices, 4 rats) (two-way repeated measures [RM]-ANOVA, F1, 30 = 12.75,
p = 0.001, *p < 0.05 cocaine versus control, Holm-Sidak). No significant differences were found between the genotypes (two-way RM-ANOVA, F1, 30 = 0.3417,
p = 0.56).
(N) Mean input-output (stimulus intensity versus peak signal amplitude) for all slices tested (two-way ANOVA, F1,31 = 0.6706, p = 0.4191).
(O) Fluorescence from mCherry (red), EGFP (green), and immunostained TH (white) in midbrain sections 2 weeks after an intranigral injection of AAV Nuc-flox
(mCherry)-EGFP in WT and DAT-iCre rats (scale bar, 50 mm).
All results are presented as mean ± SE.

Neuron 102, 105–119, April 3, 2019 111

 A Nuc-iRFP-2A-iCre
B EGFP TH DAPI Merge
Nuc-iRFP-2A-Flpo

Cre+control gRNA
iRFP

Cre+TH gRNA
Cre

EGFP TH Merge
C
L R
FLAG

D
Merge

TH immunofluorescence

100
(% of contralateral)

80

60
40
20

0
Midbrain Striatum

Figure 5. Characterization and Use of an LSL-Cas9 Transgenic Rat for Cre-Dependent Knockout of TH
(A) Representative confocal images of colocalization of iCre recombinase and the FLAG-tagged Cas9 transgene in LSL-Cas9 rats. FLAG immunoreactivity is not
observed following delivery of Flpo, a non-Cre recombinase. iRFP fluorescence indicates comparable delivery of Flpo- and iCre-encoding viruses.
(B) Representative confocal images of unilateral TH loss in the SN of LSL-Cas9 rats 4 weeks after a midbrain injection of AAV iCre and AAV control gRNAs (right
side, top) or AAV Th gRNAs (left side, bottom). Comparable EGFP fluorescence in control and Th gRNAs-injected hemispheres indicates comparable viral delivery
between conditions.
(C) A TH-immunostained striatal section from a rat injected as in (B) (L, left side; R, right side).
(D) Quantification of optical density of TH immunoreactivity in the SN and striatum of animals described in (B) and (C). Each data point represents one analyzed
coronal section (n = 3–4 sections/animal), and each color represents a different animal (n = 4).
Scale bars represent 50 mm (A), 100 mm (B), and 500 mm (C).

and mice (Kisseberth et al., 1999; Remy et al., 2014; Kobayashi
et al., 2012; Tsuchida et al., 2016). Like in LSL-Cas9 rats, the
LSL-nickase gene targeting construct was designed to mediate
transgene expression upon removal of the floxed transcription
terminator signals by Cre recombinase (Figure 7A). The LSL-
nickase targeting construct also contained an internal Frt-Pgk-
Neo-Frt selection cassette in between the Rosa26 locus
homology arms to facilitate genetic selection for targeted sper-
matogonial stem cells in culture (Figure 7A).
Spermatogonial cultures stably modified with the LSL-nickase
targeting construct were selected in G418-containing medium
following co-transfection with a pX459 plasmid expressing Cas9
and Rosa26_A gRNA (neon electroporation). Selected spermato-
gonia were then transplanted into busulfan-treated, male-sterile
recipient rats (Ivics et al., 2011). Recipient-founder males were
paired with WT female Sprague-Dawley rats at 60 days post-
transplantation for breeding and the first transgenic F1 mutant
progeny were produced d107 post-transplantation. Genomic
PCR analyses identified 20 of 34 total pups (n = 5 litters) as germline
mutants harboring the correctly targeted LSL-nickase construct in
their Rosa26 locus (Figure 7A). Thus, rat spermatogonial lines are
amenable to genetic modification by CRISPR-Cas9-mediated
HDR using relatively large circular plasmids as donor templates.
The resulting LSL-nickase rat was backcrossed with WT LE for
three or four generations, and Cre-dependent nickase activity
was tested by injecting AAV Manf gRNAs or control gRNAs along
with AAV iCre into the midbrain (Table S1). Four weeks later, the
rats showed unilateral loss of MANF immunoreactivity in the
hemisphere injected with AAV Manf gRNAs (Figures 7B–7D),
suggesting that Cre-induced recombination and expression of
rat-derived nickase can be used to drive modifications of endog-
enous genes in rat dopaminergic neurons. Delivery of gRNA and
Cre to the midbrain of WT rats did not affect MANF immunoreac-
tivity of the cells (Figure 7D).

112 Neuron 102, 105–119, April 3, 2019

 A B

D E

F G

Figure 6. Developing an Assay for Knockout of MANF In Vivo

(A) A schematic of the gRNA-binding sites and the PCR assay used to amplify the 893 nt flanking the second exon of rat Manf.
(B–E) Rat primary cortical neurons were transduced with AAV Cas9 and AAV Manf gRNAs or AAV control gRNAs and harvested 1 week later for determination of
mutagenesis and knockout. (B) Co-transduction with AAV Cas9 and AAV Manf gRNAs resulted in resolvase-induced cleavage of the PCR product (arrows). (C) An
alignment of seven independently isolated clones of the PCR fragment shows precise +A insertions among the alleles. Knockout of Manf was verified with (D) real-
time qRT-PCR and (E) Wes analyses of Manf mRNA and protein levels, respectively. (D) Manf mRNA levels were normalized to the geometric mean of reference
genes and presented as 2ddCq ± upper and lower limits (n = 3, unpaired t test using dCq values, t(4) = 20.27, ****p < 0.0001). (E) The MANF protein band density
was normalized to actin and presented as density relative to control gRNA (mean ± SE, n = 3, unpaired t test, t(4) = 4.999, **p = 0.0075). The arrow in the cropped
blot points at the 25-kDa MANF band.
(F) Representative images of unilateral loss of MANF immunoreactivity in the SN of LSL-Cas9 rats four weeks after co-injection of AAV iCre and AAV control
gRNAs or AAV Manf gRNAs. GFP fluorescence represents delivery of gRNA. Scale bar 100 mm.
(G) Quantification of the optical density of MANF immunoreactivity in the SN of LSL-Cas9 or WT animals injected as described in (F). Each data point represents
one analyzed coronal section (n = 3–4/animal), and each color represents data from a distinct animal (n = 4/group, unpaired t test, t(6) = 5.437, **p = 0.0016).

Generation of LSL-Cas9 3 DAT-iCre Double-Transgenic
Rats to Allow for Dopaminergic Neuron-Specific
Modification of Target Genes
Models that require delivery of two or more viral vectors are
dependent on co-transduction of individual cells with all vectors,
which may reduce the overall efficiency of this approach.
To further refine our gene editing model and allow specific
targeting of dopaminergic neurons in the rat midbrain using a sin-
gle AAV vector, we first crossed LSL-Cas9 and DAT-iCre rats
to produce double-transgenic LSL-Cas9 3 DAT-iCre animals.

Neuron 102, 105–119, April 3, 2019 113

 A Figure 7. Production of LSL-Cas9 Nickase
B C
Immunohistochemical validation of the transgene expression in
the rats showed that the FLAG-tagged Cas9 transgene colocal-
ized with TH in the SN of double-positive animals (Figure 8A). Cell
quantification from three animals (two sections per animal) re-
vealed 96% ± 0.02% FLAG+TH+ cells, 4.00% ± 0.02% FLAG-
TH+ cells, and 0.69% ± 0.44% FLAG+TH cells in the SN
(mean ± SE).
Next, we injected the midbrain of the double transgenic LSL-
Cas9 X DAT-iCre rats with either AAV Manf gRNAs or AAV con-
trol gRNAs. The animals were perfused after a 4-week recovery
period, and their brains were sectioned for fluorescence micro-
scopy. Using EGFP fluorescence as a marker for transduction
and TH immunoreactivity as a surrogate marker for dopami-
nergic neurons (GFP+TH+), we observed that the subpopulation
of MANF-immunoreactive cells (Figures 8B and 8C, closed
114 Neuron 102, 105–119, April 3, 2019
Knockin Rats by HDR in Spermatogonial
Stem Cells
(A) Transgenic LSL-nickase rats were produced
using donor rat spermatogonia harboring an
11.9 kb, CAG promoter-driven floxed-stop
FLAG-tagged SpCas9(D10A) transgene that was
precisely targeted to the rat Rosa26 germline lo-
cus by CRISPR-Cas9-mediated HDR. Targeted
spermatogonia were genetically selected for in
G418-containing culture medium and then in-
jected into recipient rat testes (F0, founder males)
to produce spermatozoa that transmitted the tar-
geted transgene to F1 germline mutant progeny
(LSL-nickase hemizygotes). Genotyping of F1
progeny derived from a recipient male trans-
planted with spermatogonia genetically modified
with the LSL-nickase targeting construct demon-
strated the expected 797-bp PCR amplicon using
primers that hybridize to rRosa26 locus and CAG
transgene, respectively;  and + at the bottom of
the gel represent genotyping results from primers
that hybridize to the neomycin (Neo) selection
cassette; F, female F1 pup DNA; M, male F1 pup
D DNA; WT (Ct) and transgenic (+Ct) rat DNA from
F1 progeny were generated from an earlier litter.
(B and C) Representative midbrain images at (B)
23 and (C) 203 magnification indicating unilateral
loss of MANF immunoreactivity in transgenic LSL-
Cas9 nickase rats 4 weeks following co-injection
of AAV iCre and AAV Manf gRNAs or AAV control
gRNAs into the SN. GFP fluorescence indicates
viral transduction.
(D) Quantification of the optical density of MANF
immunoreactivity in the SN of animals described in
(B) and (C). Each data point represents one coro-
nal section (n = 3/animal), and each color repre-
sents data from a distinct animal (n = 3–4/group,
unpaired t test, t(5) = 5.553, **p = 0.0026).
arrowheads) was reduced from 96%
on the side receiving AAV control RNAs
to 3% on the side receiving AAV Manf
gRNA (Figure 8D). Conversely, when
scoring the transduced non-dopami-
nergic cells (GFP+TH) in the same
sections, the subpopulations of MANF-immunoreactive cells
(Figure 8C, open arrowheads) were relatively similar (90% ±
4% versus 79% ± 6%) (Figure 8D). This supports that the reduc-
tion in MANF immunoreactivity is Cre dependent and that in this
model, Cas9 activity is restricted to dopaminergic cell types.
DISCUSSION
The development of the CRISPR-Cas9 system has provided un-
precedented capabilities for genome editing in mammals. Here,
we describe a novel combination of AAV vectors and transgenic
rats that enable the cell-type-specific genome modification of
neurons in the adult rat brain. Our methods include the use of
transgenic rats expressing a Cre-dependent Cas9 (LSL-Cas9)
or Cas9 nickase (LSL-Cas9 nickase) that can be combined
 A

B C

Figure 8. Characterization and Use of the LSL-Cas9 3 DAT-iCre Double-Transgenic Rat for Knockout of MANF in the Midbrain Dopaminergic
Neurons
(A) Representative confocal images of TH and FLAG-tagged Cas9 colocalization in the SN of LSL-Cas9 3 DAT-iCre double-transgenic rats.
(B) Representative midbrain images depicting unilateral loss of MANF immunoreactivity (white arrowheads) in TH+ dopaminergic cells in LSL-Cas9 3 DAT-iCre
rats 4 weeks following injection of AAV control or AAV Manf gRNAs into the SN.
(C) High-magnification confocal images acquired 4 weeks after AAV injection demonstrating selective loss of MANF immunoreactivity in TH+ cells that received
Manf gRNAs (right), but not in those that received control gRNAs (left). GFP fluorescence indicates viral transduction. Open arrowheads signal to GFP+TH cells
in which MANF immunoreactivity is maintained in both control and experimental conditions. Closed arrowheads signal to GFP+TH+ cells in which MANF
immunoreactivity is lost in the hemisphere receiving Manf gRNAs, but not control.

(legend continued on next page)

Neuron 102, 105–119, April 3, 2019 115

with a virally delivered Cre approach or crossed with Cre-driver
rat lines, such as the DAT-iCre rat that we describe here. Once
either of these Cas9 transgenes has been switched ‘‘ON’’ due
to Cre recombinase activity, the subsequent delivery of gRNAs
specific to the user’s gene(s) of interest (e.g., Manf or Th as
shown here) produces a loss of detectable protein expression
where Cas9 is expressed.
While this work is focused on dopaminergic neurons (as spec-
ified by our DAT-iCre driver rat), the Cre-dependent LSL-Cas9
and LSL-nickase rats and the Cre-dependent gRNA viral vectors
represent a versatile set of tools that should be readily applicable
to other neuronal (or non-neuronal) cell types using alternative
methods of Cre delivery to restrict CRISPR activity to the tissue
and cell type of interest. For example, a growing repertoire of
Cre-driver rats specifying, e.g., GABAergic (Sharpe et al.,
2017), D1 receptor, D2 receptor, and parvalbumin (Pvalb)-ex-
pressing neurons is already available at the Rat Resource and
Research Center or commercially. With the recent development
of rAAV2-retro (Tervo et al., 2016), an AAV serotype capable of
retrograde transduction, it is now feasible to apply CRISPR-
based modifications with projection-specific control.
Here, we demonstrate successful CRISPR-Cas9-mediated
gene targeting directly in the rat germline by HDR within cultures
of fully functional spermatogonial stem cells. Direct germline
gene targeting in spermatogonial stem cells streamlines the pro-
duction of custom model organisms, reduces resource expendi-
ture, and eliminates birth of unutilized mosaic and/or chimeric
animals (Chapman et al., 2015). The efficiency of LSL-Cas9 nick-
ase rat production by HDR at the Brown Norway Rosa26 locus
indicated that 50%–100% of genetically selected stem sper-
matogonia harbored monoallelic and/or biallelic targeted inser-
tions (i.e., 59% donor germline transmission of tgLSL-Cas9
nickase). Here, we utilized the inbred Brown Norway rat genome
database (Gibbs et al., 2004) to facilitate production of gene tar-
geting constructs with homology arms and gRNAs compatible
with Brown Norway rat spermatogonial lines. Genetic tractability
of spermatogonial stem cell lines derived from Brown Norway
lines and potentially those from commonly employed inbred
and outbred rat strains will greatly expand the toolbox for
genetically engineering rat models needed to advance research
within a broad spectrum of biomedical fields, particularly the
neurosciences.
When utilizing the Cas9 editing approach, the location of the
double-stranded DNA break caused by Cas9 is predictable
and specific, but the novel sequence that results from cellular
repair mechanisms typically varies among cells (Cong et al.,
2013). It is important that users of this technology keep in mind
that indels may occur on one or both alleles of the target
sequence and the resulting indels in a single cell may differ
from one another and that populations of treated cells may
contain a mosaic of different genotypes even when treated
with identical gRNAs. Our TIDE analysis of mutations from pri-
mary neurons showed that several types of indels were detected
(D) Relative percentage of MANF-immunoreactive cells within the GFP+TH+ and GFP+TH populations after injection with AAV control or AAV Manf gRNAs.
Values represent the average cell counts of three LSL-Cas9 3 DAT-iCre rats (mean ± SE, n = 3, one-way ANOVA, F3,8 = 385.7, p < 0.0001; ****p < 0.0001 [versus all
other groups], **p < 0.01, *p < 0.05 with Tukey’s multiple comparison test).
Scale bars represent 50 mm in (A) and (C) and 500 mm in (B).
116 Neuron 102, 105–119, April 3, 2019
at either the Th or Rosa26 locus. Ideally, two-thirds of these
lesions should result in translational frameshift and cause a
truncation in the encoded polypeptide. However, there is evi-
dence that the frequency and spectrum of indel sequences is
affected by regions of ‘‘microhomology’’ proximal to the break
site, and bioinformatic tools are now available to predict the like-
lihood of frameshifts (Bae et al., 2014). When optimizing the
position of the indel in relation to the start and stop codons of
the gene of interest, it is preferable to be closer to the start
codon, since an early frameshift omits more of the original poly-
peptide than a frameshift that occurs later and therefore is more
likely to result in the loss of enzyme activity and/or antibody
recognition. Ultimately, the conclusion that can be drawn from
experiments employing these tools will be defined by the pheno-
typic and genotypic changes that can be demonstrated with the
available tools and methods for assaying the target gene(s) of in-
terest. The use of a control gRNA (e.g., Rosa26) is highly recom-
mended to help control for phenotypic alterations due to delivery
of the CRISPR-Cas9 system.
In the current study, we used AAV vectors to deliver gRNAs
(singly or as nickase-compatible pairs) to each of the target
genes. We observed effective knockout of the target proteins
by assessing immunoreactivity for TH and MANF in the rat
midbrain. Following injection of AAV iCre with an AAV gRNA to
Th or a control gRNA into the midbrain of LSL-Cas9 rats, we
observed a decrease in TH immunoreactivity only in the hemi-
sphere that received Th gRNA. The loss of TH did not appear
to reflect the loss of dopaminergic neurons, since GFP expres-
sion from the gRNA vectors was comparable in the striatum
and midbrain between the two hemispheres. In LSL-Cas9 rats
crossed with DAT-iCre rats, we used gRNAs to target Manf, a
gene that is expressed in both dopaminergic and non-dopami-
nergic neurons in the midbrain. Using this approach, we
observed a selective loss of MANF only in the midbrain dopami-
nergic neurons and only of the hemisphere that received MANF
gRNAs. An EGFP reporter expressed by the AAV RNAs
confirmed that both dopaminergic and non-dopaminergic neu-
rons were transduced in this paradigm, demonstrating that the
selective knockdown of MANF in TH+ cells is not simply due to
a biased tropism of the virus. Taken together, these data indicate
that cell-specific reduction in MANF protein, or any protein, is
possible using the double-transgenic line and single AAV
gRNA injection.
We examined changes in protein expression for our targeted
genes at 2, 4, and 6 weeks post-delivery of the different compo-
nents of the CRISPR-Cas9 system in WT rats. Although both de-
livery of Cas9 and Cas9 nickase were effective in reducing
expression of the target protein, the duration required to detect
significant knockout varied depending on the method utilized.
When considering an approach to CRISPR-Cas9 genome edit-
ing in the rat brain, numerous factors may contribute to the
time required to produce peak loss of the target. Such factors
include the half-life of the target protein, titer of virus, volume
of virus, and viral promoter and should be evaluated empirically
for novel gene targets. We therefore advise pilot studies to deter-
mine the optimal conditions needed to achieve adequate loss of
target protein immunoreactivity and, more importantly, protein
activity.
In this study, we also describe for the first time a DAT-iCre rat
produced on the LE background. In contrast to a previously
described DAT-Cre rat using an IRES-Cre targeted to the endog-
enous rat Dat locus of Sprague-Dawley background (Liu et al.,
2016), we randomly integrated a BAC expressing iCre from the
rat DAT promoter into the genome of LE embryos. In DAT-Cre
mice, the insertion of an IRES-Cre element has been shown to
affect DAT activity in the striatum (O’Neill et al., 2017). Here, us-
ing a variety of techniques, we show that the expression of iCre in
our DAT-iCre rat is restricted to dopaminergic neurons in the
midbrain and does not impair the electrophysiological properties
of dopamine neurons, evoked-dopamine release and uptake in
striatum, or endogenous TH and DAT protein expression. We
initially obtained six founder lines, three of which did not produce
progeny carrying the transgene (i.e., no germline transmission).
The remaining three lines varied in copy number per haploid
genome (one, two, and eight copies). Of note, line 1 had two
copies and occasionally lost a copy within litters, resulting in
different recombination kinetics. This serves as a cautionary
note when using BAC transgenics with more than one copy
per haploid genome. Because the transgene’s locus of insertion
was random and has not been determined, all results presented
herein were obtained by breeding hemizygous rats to WT rats or
LSL-Cas9 rats.
In conclusion, the viral vectors and transgenic rats described
in the present study can be combined to enable both regional
and cell-specific genomic editing in the adult rat brain. Our re-
sults suggest that these tools can be combined with other exist-
ing Cre-driver rats and viral vectors to study loss of gene function
in cells of the rat nervous system as well as other tissues. With
the described ability to introduce mutations in dopaminergic
neurons, it may also be possible to provide repair templates to
tag or create specific mutations using viral vector delivery (Nish-
iyama et al., 2017; Ishizu et al., 2017), thereby testing gene func-
tion in models of substance abuse or creating disease models of
Parkinson’s disease (e.g., LRKK2, synuclein, PINK, and DJ-1).
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Animals
B Cell culture
d METHOD DETAILS
B Viral vector construction
B Production of AAV vectors
B Intracranial injections
B Immunohistochemistry
B Image analysis and cell counting
B RNA in situ hybridization (RNAscope)
B Heteroduplex digestion and TIDE analysis
B RNA isolation and quantitative reverse transcription
PCR (RT-qPCR)
B Western blot
B Protein analysis using Wes
B Biotinylation and DAT internalization
B Electrophysiology
B Voltammetry
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental Information includes seven figures and three tables and can be
found with this article online at https://doi.org/10.1016/j.neuron.2019.01.035.
ACKNOWLEDGMENTS
This study was supported by the Intramural Programs of the National Institute
on Drug Abuse and National Institute of Mental Health. M.A., A.D., and J.E.A.
were supported by the Academy of Finland. M.A. and A.D. were supported by
3iRegeneration Tekes. J.E.A. was supported by the University of Helsinki
Doctoral Program in Drug Research. Transgenic LSL-Cas9 nickase rat pro-
duction was supported by the UT Southwestern Mutant Rat Resource in Dal-
las. The NIDA Histology Core and Electrophysiology Core (EVEC) provided
technical support. Dr. Francois Vautier oversaw the breeding of the transgenic
rats. Doug Howard produced the AAV vectors. Reinis Svarcbahs assisted with
the molecular biology in generating vectors. Dr. Deon Harvey made comments
on the manuscript. Coronal brain schematics in figures are based on Swan-
son (2018).
AUTHOR CONTRIBUTIONS
B.K.H. and C.T.R. conceived the study and designed the viral vectors and
transgenic rats. B.K.H., S.B., and J.N. wrote the manuscript. C.T.R., C.G.Y.,
and E.J.H. made the DNA constructs. M.A., A.D., and J.E.A. characterized
MANF gRNAs. S.B., C.T.R., and L.V.F. did the in vitro studies. J.N., L.M.C.,
P.K., M.D.S., and H.A.B. performed the in vivo injections and tissue analyses.
F.K.H. developed methods to create LSL-Cas9 nickase rats using spermato-
gonial stem cells. J.P. and the NIMH transgenic core facility contributed to pro-
duction of the DAT-iCre and LSL-Cas9 rats. A.F.H., B.T.H., C.E.S., C.R.L.,
C.G.Y., L.R.W., S.G.A., L.M.C., C.A.M.-A., S.M.U., and Y.Z. participated in
the characterization of the DAT-iCre rats. All authors reviewed and com-
mented on the final manuscript.
DECLARATION OF INTERESTS
F.K.H. serves as a project consultant for GenomeDesigns Laboratory, LLC
(GDL), but GDL had no involvement with this study.
Received: July 12, 2018
Revised: December 13, 2018
Accepted: January 16, 2019
Published: February 18, 2019
REFERENCES
Bae, S., Kweon, J., Kim, H.S., and Kim, J.S. (2014). Microhomology-based
choice of Cas9 nuclease target sites. Nat. Methods 11, 705–706.
Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P., Moineau,
S., Romero, D.A., and Horvath, P. (2007). CRISPR provides acquired resis-
tance against viruses in prokaryotes. Science 315, 1709–1712.
Brinkman, E.K., Chen, T., Amendola, M., and van Steensel, B. (2014). Easy
quantitative assessment of genome editing by sequence trace decomposition.
Nucleic Acids Res. 42, e168.
Neuron 102, 105–119, April 3, 2019 117
Chapman, K.M., Medrano, G.A., Jaichander, P., Chaudhary, J., Waits, A.E.,
Nobrega, M.A., Hotaling, J.M., Ober, C., and Hamra, F.K. (2015). Targeted
germline modifications in rats using CRISPR/Cas9 and spermatogonial stem
cells. Cell Rep. 10, 1828–1835.
Cho, S.W., Kim, S., Kim, J.M., and Kim, J.S. (2013). Targeted genome engi-
neering in human cells with the Cas9 RNA-guided endonuclease. Nat.
Biotechnol. 31, 230–232.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X.,
Jiang, W., Marraffini, L.A., and Zhang, F. (2013). Multiplex genome engineering
using CRISPR/Cas systems. Science 339, 819–823.
Creed, R.B., and Goldberg, M.S. (2018). New developments in genetic rat
models of Parkinson’s disease. Mov. Disord. 33, 717–729.
Doudna, J.A., and Charpentier, E. (2014). Genome editing. The new frontier of
genome engineering with CRISPR-Cas9. Science 346, 1258096.
Duty, S., and Jenner, P. (2011). Animal models of Parkinson’s disease: a
source of novel treatments and clues to the cause of the disease. Br. J.
Pharmacol. 164, 1357–1391.
Ellenbroek, B., and Youn, J. (2016). Rodent models in neuroscience research:
is it a rat race? Dis. Model. Mech. 9, 1079–1087.
Finn, J.D., Smith, A.R., Patel, M.C., Shaw, L., Youniss, M.R., van Heteren, J.,
Dirstine, T., Ciullo, C., Lescarbeau, R., Seitzer, J., et al. (2018). A single admin-
istration of CRISPR/Cas9 lipid nanoparticles achieves robust and persistent
in vivo genome editing. Cell Rep. 22, 2227–2235.
Gasiunas, G., Barrangou, R., Horvath, P., and Siksnys, V. (2012). Cas9-crRNA
ribonucleoprotein complex mediates specific DNA cleavage for adaptive im-
munity in bacteria. Proc. Natl. Acad. Sci. USA 109, E2579–E2586.
Gibbs, R.A., Weinstock, G.M., Metzker, M.L., Muzny, D.M., Sodergren, E.J.,
Scherer, S., Scott, G., Steffen, D., Worley, K.C., Burch, P.E., et al.; Rat
Genome Sequencing Project Consortium (2004). Genome sequence of the
Brown Norway rat yields insights into mammalian evolution. Nature 428,
493–521.
Henderson, M.J., Richie, C.T., Airavaara, M., Wang, Y., and Harvey, B.K.
(2013). Mesencephalic astrocyte-derived neurotrophic factor (MANF) secre-
tion and cell surface binding are modulated by KDEL receptors. J. Biol.
Chem. 288, 4209–4225.
Hoffman, A.F., Spivak, C.E., and Lupica, C.R. (2016). Enhanced dopamine
release by dopamine transport inhibitors described by a restricted diffusion
model and fast-scan cyclic voltammetry. ACS Chem. Neurosci. 7, 700–709.
Homberg, J.R., Wöhr, M., and Alenina, N. (2017). Comeback of the rat in
biomedical research. ACS Chem. Neurosci. 8, 900–903.
Hou, Z., Zhang, Y., Propson, N.E., Howden, S.E., Chu, L.F., Sontheimer, E.J.,
and Thomson, J.A. (2013). Efficient genome engineering in human pluripotent
stem cells using Cas9 from Neisseria meningitidis. Proc. Natl. Acad. Sci. USA
110, 15644–15649.
Howard, D.B., and Harvey, B.K. (2017). Assaying the stability and inactivation
of AAV serotype 1 vectors. Hum. Gene Ther. Methods 28, 39–48.
Howard, D.B., Powers, K., Wang, Y., and Harvey, B.K. (2008). Tropism and
toxicity of adeno-associated viral vector serotypes 1, 2, 5, 6, 7, 8, and 9 in
rat neurons and glia in vitro. Virology 372, 24–34.
Ishizu, T., Higo, S., Masumura, Y., Kohama, Y., Shiba, M., Higo, T., Shibamoto,
M., Nakagawa, A., Morimoto, S., Takashima, S., et al. (2017). Targeted
genome replacement via homology-directed repair in non-dividing cardiomyo-
cytes. Sci. Rep. 7, 9363.
Ivics, Z., Izsvák, Z., Medrano, G., Chapman, K.M., and Hamra, F.K. (2011).
Sleeping Beauty transposon mutagenesis in rat spermatogonial stem cells.
Nat. Protoc. 6, 1521–1535.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier,
E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive
bacterial immunity. Science 337, 816–821.
Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., and Doudna, J. (2013). RNA-pro-
grammed genome editing in human cells. eLife 2, e00471.
118 Neuron 102, 105–119, April 3, 2019
Kabadi, A.M., Ousterout, D.G., Hilton, I.B., and Gersbach, C.A. (2014).
Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral
vector. Nucleic Acids Res. 42, e147.
Kisseberth, W.C., Brettingen, N.T., Lohse, J.K., and Sandgren, E.P. (1999).
Ubiquitous expression of marker transgenes in mice and rats. Dev. Biol.
214, 128–138.
Kobayashi, T., Kato-Itoh, M., Yamaguchi, T., Tamura, C., Sanbo, M.,
Hirabayashi, M., and Nakauchi, H. (2012). Identification of rat Rosa26 locus en-
ables generation of knock-in rat lines ubiquitously expressing tdTomato. Stem
Cells Dev. 21, 2981–2986.
Li, D., Qiu, Z., Shao, Y., Chen, Y., Guan, Y., Liu, M., Li, Y., Gao, N., Wang, L., Lu,
X., et al. (2013a). Heritable gene targeting in the mouse and rat using a
CRISPR-Cas system. Nat. Biotechnol. 31, 681–683.
Li, W., Teng, F., Li, T., and Zhou, Q. (2013b). Simultaneous generation and
germline transmission of multiple gene mutations in rat using CRISPR-Cas
systems. Nat. Biotechnol. 31, 684–686.
Lindholm, P., Pera€nen, J., Andressoo, J.O., Kalkkinen, N., Kokaia, Z., Lindvall,
O., Timmusk, T., and Saarma, M. (2008). MANF is widely expressed in
mammalian tissues and differently regulated after ischemic and epileptic in-
sults in rodent brain. Mol. Cell. Neurosci. 39, 356–371.
Liu, Z., Brown, A., Fisher, D., Wu, Y., Warren, J., and Cui, X. (2016). Tissue spe-
cific expression of Cre in rat tyrosine hydroxylase and dopamine active trans-
porter-positive neurons. PLoS ONE 11, e0149379.
Ma, Y., Shen, B., Zhang, X., Lu, Y., Chen, W., Ma, J., Huang, X., and Zhang, L.
(2014). Heritable multiplex genetic engineering in rats using CRISPR/Cas9.
PLoS ONE 9, e89413.
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E.,
and Church, G.M. (2013). RNA-guided human genome engineering via Cas9.
Science 339, 823–826.
Meister, B., and Elde, R. (1993). Dopamine transporter mRNA in neurons of the
rat hypothalamus. Neuroendocrinology 58, 388–395.
Nishiyama, J., Mikuni, T., and Yasuda, R. (2017). Virus-mediated genome edit-
ing via homology-directed repair in mitotic and postmitotic cells in mammalian
brain. Neuron 96, 755–768.e5.
O’Neill, B., Patel, J.C., and Rice, M.E. (2017). Characterization of optically and
electrically evoked dopamine release in striatal slices from digenic knock-in
mice with DAT-driven expression of channelrhodopsin. ACS Chem.
Neurosci. 8, 310–319.
Parker, C.C., Chen, H., Flagel, S.B., Geurts, A.M., Richards, J.B., Robinson,
T.E., Solberg Woods, L.C., and Palmer, A.A. (2014). Rats are the smart
choice: rationale for a renewed focus on rats in behavioral genetics.
Neuropharmacology 76, 250–258.
Platt, R.J., Chen, S., Zhou, Y., Yim, M.J., Swiech, L., Kempton, H.R., Dahlman,
J.E., Parnas, O., Eisenhaure, T.M., Jovanovic, M., et al. (2014). CRISPR-Cas9
knockin mice for genome editing and cancer modeling. Cell 159, 440–455.
Pradhan, B.S., and Majumdar, S.S. (2016). An efficient method for generation
of transgenic rats avoiding embryo manipulation. Mol. Ther. Nucleic Acids
5, e293.
Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E.,
Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., and Zhang, F. (2013). Double
nicking by RNA-guided CRISPR Cas9 for enhanced genome editing speci-
ficity. Cell 154, 1380–1389.
Remy, S., Tesson, L., Menoret, S., Usal, C., De Cian, A., Thepenier, V., Thinard,
R., Baron, D., Charpentier, M., Renaud, J.B., et al. (2014). Efficient gene target-
ing by homology-directed repair in rat zygotes using TALE nucleases. Genome
Res. 24, 1371–1383.
Remy, S., Chenouard, V., Tesson, L., Usal, C., Ménoret, S., Brusselle, L.,
Heslan, J.M., Nguyen, T.H., Bellien, J., Merot, J., et al. (2017). Generation of
gene-edited rats by delivery of CRISPR/Cas9 protein and donor DNA into
intact zygotes using electroporation. Sci. Rep. 7, 16554.
Richardson, T.E., Chapman, K.M., Tenenhaus Dann, C., Hammer, R.E., and
Hamra, F.K. (2009). Sterile testis complementation with spermatogonial lines
restores fertility to DAZL-deficient rats and maximizes donor germline trans-
mission. PLoS ONE 4, e6308.
Sander, J.D., and Joung, J.K. (2014). CRISPR-Cas systems for editing, regu-
lating and targeting genomes. Nat. Biotechnol. 32, 347–355.
Savolainen, M.H., Richie, C.T., Harvey, B.K., Ma€nnistö, P.T., Maguire-Zeiss,
K.A., and Myöha€nen, T.T. (2014). The beneficial effect of a prolyl oligopepti-
dase inhibitor, KYP-2047, on alpha-synuclein clearance and autophagy in
A30P transgenic mouse. Neurobiol. Dis. 68, 1–15.
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch,
T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an
open-source platform for biological-image analysis. Nat. Methods 9, 676–682.
Shao, Y., Wang, L., Guo, N., Wang, S., Yang, L., Li, Y., Wang, M., Yin, S., Han,
H., Zeng, L., et al. (2018). Cas9-nickase-mediated genome editing corrects he-
reditary tyrosinemia in rats. J. Biol. Chem. 293, 6883–6892.
Sharpe, M.J., Marchant, N.J., Whitaker, L.R., Richie, C.T., Zhang, Y.J.,
Campbell, E.J., Koivula, P.P., Necarsulmer, J.C., Mejias-Aponte, C.,
Morales, M., et al. (2017). Lateral hypothalamic GABAergic neurons encode
reward predictions that are relayed to the ventral tegmental area to regulate
learning. Curr. Biol. 27, 2089–2100.e5.
Shen, B., Zhang, J., Wu, H., Wang, J., Ma, K., Li, Z., Zhang, X., Zhang, P., and
Huang, X. (2013). Generation of gene-modified mice via Cas9/RNA-mediated
gene targeting. Cell Res. 23, 720–723.
€bner, M.R., Spergel, D.J., Buchholz, F., Casanova,
Shimshek, D.R., Kim, J., Hu
E., Stewart, A.F., Seeburg, P.H., and Sprengel, R. (2002). Codon-improved Cre
recombinase (iCre) expression in the mouse. Genesis 32, 19–26.
Suzuki, K., Tsunekawa, Y., Hernandez-Benitez, R., Wu, J., Zhu, J., Kim, E.J.,
Hatanaka, F., Yamamoto, M., Araoka, T., Li, Z., et al. (2016). In vivo genome
editing via CRISPR/Cas9 mediated homology-independent targeted integra-
tion. Nature 540, 144–149.
Swanson, L.W. (2018). Brain maps 4.0-structure of the rat brain: An open ac-
cess atlas with global nervous system nomenclature ontology and flatmaps.
J. Comp. Neurol. 526, 935–943.
Swiech, L., Heidenreich, M., Banerjee, A., Habib, N., Li, Y., Trombetta, J., Sur,
M., and Zhang, F. (2015). In vivo interrogation of gene function in the mamma-
lian brain using CRISPR-Cas9. Nat. Biotechnol. 33, 102–106.
Tervo, D.G., Hwang, B.Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K.D.,
Lindo, S., Michael, S., Kuleshova, E., Ojala, D., et al. (2016). A designer AAV
variant permits efficient retrograde access to projection neurons. Neuron 92,
372–382.
Tiscornia, G., Tergaonkar, V., Galimi, F., and Verma, I.M. (2004). CRE recom-
binase-inducible RNA interference mediated by lentiviral vectors. Proc. Natl.
Acad. Sci. USA 101, 7347–7351.
Tsuchida, J., Matsusaka, T., Ohtsuka, M., Miura, H., Okuno, Y., Asanuma, K.,
Nakagawa, T., Yanagita, M., and Mori, K. (2016). Establishment of nephrin re-
porter mice and use for chemical screening. PLoS ONE 11, e0157497.
€ck, S., Pörsti, E., Toppinen, L., Lindgren, L., Lindholm, P.,
Voutilainen, M.H., Ba
€nen, J., Saarma, M., and Tuominen, R.K. (2009). Mesencephalic astro-
Pera
cyte-derived neurotrophic factor is neurorestorative in rat model of
Parkinson’s disease. J. Neurosci. 29, 9651–9659.
Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F.,
and Jaenisch, R. (2013). One-step generation of mice carrying mutations in
multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153,
910–918.
Warming, S., Costantino, N., Court, D.L., Jenkins, N.A., and Copeland, N.G.
(2005). Simple and highly efficient BAC recombineering using galK selection.
Nucleic Acids Res. 33, e36.
Yang, H., Wang, H., Shivalila, C.S., Cheng, A.W., Shi, L., and Jaenisch, R.
(2013). One-step generation of mice carrying reporter and conditional alleles
by CRISPR/Cas-mediated genome engineering. Cell 154, 1370–1379.
Zhang, F., Wen, Y., and Guo, X. (2014). CRISPR/Cas9 for genome editing:
progress, implications and challenges. Hum. Mol. Genet. 23 (R1), R40–R46.
Neuron 102, 105–119, April 3, 2019 119
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Mouse anti-tyrosine hydroxylase Millipore CAT#MAB318; RRID: AB_2201528
Rabbit anti-MANF YenZym N/A
Rabbit anti-Cre-recombinase BioLegend CAT#908001; RRID: AB_2565079
Mouse anti-FLAG Sigma-Aldrich CAT#F1804; RRID: AB_262044
Rabbit anti-tyrosine hydroxylase Millipore CAT#AB152; RRID: AB_390204
Mouse anti-actin Abcam CAT#ab3280; RRID: AB_303668
Mouse anti-actin Cell Signal Technology CAT#mab3700S; RRID: AB_2242334
Goat anti-mouse secondary Protein Simple CAT#042-205
Goat anti-rabbit Alexa Fluor 568 Invitrogen CAT#A11011; RRID: AB_143157
Goat anti-rabbit Alexa Fluor 568 Invitrogen CAT#A11036; RRID: AB_10563566
Goat anti-mouse Alexa Fluor 568 Invitrogen CAT#A11004; RRID: AB_2534072
Goat anti-mouse Alexa Fluor 488 Invitrogen CAT#A11029; RRID: AB_2534088
Goat anti-mouse Alexa Fluor 680 Invitrogen CAT#A21058; RRID: AB_2535724
Bacterial and Virus Strains
NEB Stable competent cells New England Biolabs CAT#C3040I
Stbl3 competent cells Thermo Fisher Scientific CAT#C737303
AAV-Cas9 This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1077,
Addgene 60957
AAV-TH gRNAs This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1088
AAV-nickase This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1124
AAV-Nuc-flox(mCherry)-eGFP This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1032
AAV-LSL-TH gRNA This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1179
AAV-iRFP-Flpo This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1440
AAV-iRFP-iCre This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1442
AAV-iCre This paper NIDA IRP CORE FACILITY, AAV1, pOTTC556
AAV-MANF gRNAs This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1388
AAV-control gRNAs This paper NIDA IRP CORE FACILITY, AAV1, pOTTC1270
Biological Samples
Rat brain tissue This study N/A
Critical Commercial Assays
Anti-mouse detection module Protein Simple CAT#DM-002
12-230 kDA Separation Module, 25 capillary cartridges Protein Simple CAT#SM-W002
T7 Endonuclease I New England Biolabs CAT#M0302S
Resolvase (Guide-it Mutation Detection Kit) Takara CAT#631448
EZ Standard Pack 1 Protein Simple PS-ST01EZ-8
Experimental Models: Cell Lines
PC-12 cells ATCC ATCC CRL-1721; RRID: CVCL_0481
HEK293 (used for AAV production) Dr. Xiao Xiao (UNC) N/A
Experimental Models: Organisms/Strains
DAT-iCre on Long Evans background This paper LE-Tg(Slc6a3-iCre)1Ottc; RGD ID: 9588572;
RRRC ID: 730
DIO-mCherry on Long Evans background This paper LE-Tg(DIO-mCherry)2Ottc; RGD ID: 8693598;
RRRC ID: R687
(Continued on next page)

e1 Neuron 102, 105–119.e1–e8, April 3, 2019

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
LSL-Cas9 on Long Evans background This paper LE-(ROSA)26 em1(CAG-Cas9)Ottc; RGD ID:
1320822; RRRC ID: 833
LSL-nickase on Long Evans background This paper LE.Cg-(ROSA)26 em1(CAG-Cas9*D10A)Ottc;
RGD ID: 13602097; RRRC ID: 834
Oligonucleotides
Manf for:cggttgtgctactacattgga IDT N/A
rev: gggccagaggcttcgatac
probe: ccacagatgatgccgccaccaag
Polr2a for: tagtcctacctactccccaacttc IDT N/A
rev: agtagccaggagaagtgggag
probe: actcgcccaccagtcccacctact
Ube2i for: gccaccactgtttcatccaaa IDT N/A
rev: gccgccagtccttgtcttc
probe: cgtgtatccttctggcacagtgtgc
TH Fwd: GAGAT GGCTACCACTAGCTCGAG IDT N/A
TH Rev: GAGCCTGAGACAGGGTGATCC IDT N/A
Rosa26 Fwd: GGGATTCCTCCTTGAGTTGTGGC IDT N/A
Rosa26 Rev: GGAGGAGATATTCATCTGTAAACCATT IDT N/A
AACAGG
MANF Fwd: GCACTTAGGGGGTTCAGTGTATTC IDT N/A
MANF Rev: CTACAAAAGCTGATGCTTCACCAGG IDT N/A
TH seq F: CCAAAGGTTATAGTTCTAACATGAGCCCTTAG IDT N/A
Rosa 26 seq R: AGCTACAGCCTCGATTTGTGGTG IDT N/A
DAT-iCre Fwd: CGCACAAGCTGGGAGCTAATGTGAA IDT N/A
DAT-iCre Rev: CTTCCAGGTGTGTTCAGAGAAG IDT N/A
LSL-Cas9 50 junction Fwd: GGCTCCTCAGAGAGCCTCG IDT N/A
LSL-Cas9 50 junction Rev: AGTTATGTAACGCGGAACTC IDT N/A
CATATATGG
LSL-Cas9 30 junction Fwd: CTGTGCCTTCTAGTTGCCAGCC IDT N/A
LSL-Cas9 30 junction Rev: TTCTGCATTCCAGAAGGAACTA IDT N/A
ACTTTTATAGAG
LSL-Nickase 50 junction Fwd: GCTCAGAAAACTGGCCTTTG IDT N/A
LSL-Nickase 30 junction Fwd: GAGGCGCTCACAGGTTCC IDT N/A
Recombinant DNA
PX551 Swiech et al., 2015 Addgene plasmid # 60957
pAAV MeCP2 HA-SpCas9n(D10A) This paper Addgene plasmid # 112719
pAAV TH gRNA A+B pair EF1a EGFP This paper Addgene plasmid # 113155
pAAV Rosa26 gRNA A+B EF1a EGFP This paper Addgene plasmid # 113156
pAAV MANF gRNA A+B EF1a EGFP This paper Addgene plasmid # 113157
pAAV (flox-stop) TH gRNA A EF1a eGFP This paper Addgene plasmid # 113158
pAAV CMV-IE Nuc-iRFP-2A-iCre This paper Addgene plasmid # 112683
pAAV CMV-IE Nuc-iRFP-2A-Flpo This paper Addgene plasmid # 112684
pAAV EF1a iCre This paper Addgene plasmid # 89760
pAAV EF1a Nuc-flox(mCherry)-EGFP This paper Addgene plasmid # 112677
pX458 with rat Rosa26 gRNA A This paper Addgene plasmid # 113161
prRosa26v1 LSL FLAG-SpCas9n NeoR This paper Addgene plasmid # 113162
prRosa26v2 LSL FLAG-SpCas9 This paper Addgene plasmid # 113163
pmU6(loxP-STOP-loxP) BbsI gRNA This paper Addgene plasmid # 113160
(Continued on next page)

Neuron 102, 105–119.e1–e8, April 3, 2019 e2

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Software and Algorithms
TIDE: Tracking of Indels by Decomposition Brinkman et al., 2014 Tide.deskgen.com, version 2.0.1, premium
license
Fiji – distribution of ImageJ Schindelin et al., 2012 FIJI.SC, RRID:SCR_002285

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Brandon
K. Harvey (bharvey@mail.nih.gov).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Animals
All animal experiments were conducted on adult rats (males and females) in accordance with the National Institute of Health (NIH)
guidelines for animal research. All experiments were approved by the Animal Care and Use Committees (ACUC) of the Intramural
Research Programs at the National Institute on Drug Abuse and the National Institute of Mental Health. The rats were group-housed
in a 12 h light-dark cycle with ad libitum access to rodent chow and water. The assignment of animals to experimental groups was
done based on genotyping results, with each animal serving as its own internal control (unilateral intracranial injections of experi-
mental gRNA versus control gRNA).
DAT-iCre transgenic rat
For the DAT-iCre rats, a bacterial artificial chromosome (BAC) containing the rat Dat gene (CH230-275E16) was obtained from the
Children’s Hospital Oakland Research Institute (CHORI), and recombineered to replace the start codon of Dat with cassette contain-
ing iCre (improved Cre recombinase) and the polyadenylation signal from the gene for bovine growth hormone (Warming et al., 2005).
This BAC was injected into the pronuclei of LE rat zygotes. These were transferred to pseudopregnant Sprague-Dawley females as
single cell zygotes on the day of injection or allowed to develop to 2-cell embryos the next day before transfer. The resulting line, LE-
Tg(Slc6a3-iCre)6Ottc, is registered at the Rat Genome Database (RGD: 9588578) and deposited at the Rat Resource and Research
Center (RRRC #758; University of Missouri, Columbia MO, USA). Animals were bred with WT LE rats from Charles River Laboratories
for 10 generations before crossing with LSL-Cas9 rats for experiments. This line has one copy of the transgene per haploid genome
as determined by droplet digital PCR.
LSL-Cas9 transgenic rat
The LSL-Cas9 donor plasmid was constructed using the coding region for FLAG-tagged NLS-tagged SpCas9, which was amplified
from pX458 (Addgene 48138) and inserted downstream of the CAG promoter and a series of polyadenylation signals flanked by loxP
sites (floxed stop). The entire expression cassette was flanked on each side by homologous arms (1 kb each) corresponding to se-
quences on each side of the area targeted by the Rosa26 gRNAs (Figure S3). For the generation of LSL-Cas9 rats, this donor plasmid
was mixed with one pair of nickase-compatible gRNAs identified in the rat Rosa26 locus (Table S2), synthesized and transcribed us-
ing Guide-IT synthesis kit (Clontech, Mountain View, CA, USA), and injected into the pronuclei of LE rat zygotes along with mRNA
encoding Cas9 nickase (Tri-Link, San Diego, CA, USA). Injected embryos were incubated overnight. Those that developed to the
2-cell stage were transferred to pseudopregnant Sprague-Dawley females and brought to term. The tissue from pups was genotyped
by PCR and sequence confirmed. The resulting transgenic rat was designated ‘‘LE-(ROSA)26 em1(CAG-Cas9)Ottc’’ and registered
with the Rat Genome Database (#13208224) and deposited at the Rat Resource and Research Center (RRRC#833). Herein, LE-
(ROSA)26 em1(CAG-Cas9)Ottc rats are referred to as ‘‘LSL-Cas9’’ rats. Animals were bred with WT LE rats from Charles River Lab-
oratories for 4–5 generations then heterozygous animals were crossed to generate homozygous animals for experiments.
LSL-Cas9 x DAT-iCre transgenic rat
DAT-iCre rats were backcrossed to WT LE rats at least 10 generations before crossing the LSL-Cas9 rats that had been crossed at
least 4 generations with WT LE.
DIO-mCherry transgenic reporter rat
The coding region of mCherry was amplified with linkered oligos and Addgene #26975 as a template. This insert was recombined into
the backbone (pAAV EF1a DIO EYFP, Addgene 27056, digested with NheI and AscI restriction enzymes) using In-Fusion cloning mix
(Clontech) to produce pAAV EF1a DIO mCherry (Addgene #47626). The pAAV EF1a DIO mCherry plasmid was digested with MluI and
RsrII, gel purified away from the plasmid backbone, and microinjected into fertilized oocytes harvested from a LE rat by the NIMH
Transgenic Core. Surviving pups were screened for the integrated transgene by PCR genotyping. This line (LE-Tg(DIO-mCherry)
2Ottc) has 0.5-0.7 copies of the transgene per copy of Ggt1 (indicating 1 copy per haploid genome) as determined by droplet digital
PCR. The resulting transgenic rat was designated ‘‘LE-Tg(DIO-mCherry)2Ottc’’ and registered with the Rat Genome Database
(#8693598) and deposited at the Rat Resource and Research Center (RRRC#687). Herein, ‘‘LE-Tg(DIO-mCherry)2Ottc’’ rats are

e3 Neuron 102, 105–119.e1–e8, April 3, 2019

referred to as ‘‘DIO-mCherry’’ rats. Animals were bred with WT LE rats from Charles River Laboratories for 4–5 generations, then het-
erozygous animals were crossed with DAT-iCre animals for detection of mCherry expression.
CRISPR-Cas9-mediated knockin of LSL-Cas9 nickase using rat spermatogonial stem cells
The LSL-Cas9n donor plasmid was constructed using the coding region for FLAG-tagged NLS-tagged SpCas9(D10A), which was
amplified from pX461 (Addgene 48140) and inserted downstream of the CAG promoter and a series of polyadenylation signals
flanked by loxP sites (floxed stop) and upstream of an FRT-flanked neomycin selection marker (FRT-PGK-NeoR-FRT). The entire
expression cassette was flanked on each side by homologous arms corresponding to sequences spanning 191 bp upstream and
604 bp downstream of the area targeted by the Rosa26 gRNAs (Figure S3). LSL-Cas9 nickase rats were generated at UT South-
western Medical Center’s Mutant Rat Resource by spermatogonia-mediated gene transfer (Chapman et al., 2015) using sterile-testis
complementation (Richardson et al., 2009). Brown Norway rat (Charles River) spermatogonial cultures were co-transfected with the
LSL-Cas9n donor plasmid (20 mg) and a plasmid expressing the Rosa26_A gRNA along with FLAG-tagged Cas9-2A-GFP (20 mg) us-
ing a Neon transfection apparatus (4 3 106 total spermatogonia transfected in 850 mL Resuspension Buffer R; 10X electroporations
in 100 mL tips with 2 pulses at 1100 V, 20 m) and then selected in a G418-containing medium (70 mg/mL G418 d2-d8 post-electro-
poration) on feeder layers of DR4 mouse embryonic fibroblasts, prepared as previously described (Chapman et al., 2015). Selected
G418-resistant spermatogonial culture was transplanted into a single testis of busulfan-treated, male-sterile Brown Norway recipient
rats (Ivics et al., 2011). Transplanted recipient rats (n = 3) were paired with wild-type female Sprague Dawley (Envigo) rats at 60 days
post-transplantation for breeding to generate F1 hybrid Brown Norway: Sprague Dawley germline mutant progeny. The resulting
transgenic rat was backcrossed on to LE rats and designated ‘‘LE.Cg-(ROSA)26 em1(CAG-Cas9*D10A)Ottc,’’ registered with the
Rat Genome Database (#13602097), and deposited at the Rat Resource and Research Center (RRRC#834). Herein, ‘‘LE.Cg-
(ROSA)26 em1(CAG-Cas9*D10A)Ottc’’ rats are referred to as ‘‘LSL-Cas9 nickase’’ rats.

Cell culture
Primary cortical neurons were isolated from E15-16 Sprague-Dawley rats (mix of males and females) as described previously
(Howard et al., 2008) and plated on PEI-coated 96-well plates. Cells were maintained at 37 C with 5.5% carbon dioxide in neurobasal
media (Thermo Fisher Scientific) supplemented with 2% B-27 (Thermo Fisher Scientific) and 0.5 mM L-glutamine (Sigma-
Aldrich) with a 50% media exchange every fortnight. On 6 days-in-vitro (DIV6), cells were transduced with 5 mL AAV Cas9
(0.6-1.0x1012 vg/mL) and AAV Manf gRNA or AAV control gRNA (1.7-1.9x1012 vg/mL). On DIV15, cells were harvested for RNA isola-
tion or protein analysis. Each sample consists of cells from three wells pooled together.
PC-12 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 10%
heat-inactivated horse serum, 5% fetal bovine serum (FBS), and 1% penicillin/streptomycin at 37 C with 5.5% carbon dioxide.
The cell line has been confirmed to be rat using PCR analysis for various genes, and photomicrographs show similar morphology
to images available on ATCC website (https://www.attc.org) for PC-12 cells. Cells plated onto a 24-well plate underwent transfection
procedures with a total of 0.5 mg plasmid DNA/well (triple-transfection with plasmids encoding Cas9, gRNA, and Cre or Flpo in a ratio
of 2:1:1, respectively) using Lipofectamine 3000 reagent (1.5 mL/well; Thermo Fisher Scientific). Two days post-transfection, cells
were re-plated onto a 24-well plate, and one day later, the cells were exposed to a 48-h puromycin (2 mg/mL) selection procedure.
The selected cells were maintained in selection-free media for four days before collection of genomic DNA.

METHOD DETAILS

Viral vector construction

The AAV vector encoding SpCas9 (pX551) was a gift from Feng Zhang (Addgene plasmid # 60957; Swiech et al., 2015) and the
corresponding AAV is referred to as ‘‘AAV Cas9’’ herein. This plasmid was modified to encode the D10A nickase variant by PCR
with mutagenic primers and ligation-independent cloning to produce pAAV MeCP2 HA-SpCas9n(D10A), an AAV packaging vector
(Addgene 112719), referred to herein as ‘‘AAV nickase.’’
Guide RNA seed sequences composing an ‘‘SpCas9 nickase’’-compatible pair were selected for rat Rosa26, Th, and Manf using
http://zlab.bio/guide-design-resources (Table S2), synthesized as an oligonucleotide duplex and ligated into the BbsI restriction sites
of pmU6-gRNA and phU6-gRNA (gifts from Charles Gersbach, Addgene 53187 and 53188; Kabadi et al., 2014). These mU6 and hU6
expression cassettes were then inserted into pAAV EF1a eGFP (Addgene 60058; Savolainen et al., 2014) using ligation-independent
cloning (InFusion, Takara) to produce Addgene 113156, 113155, and 116157.
The modification of the mouse U6 promoter to include a transcription terminator flanked by loxP elements was previously
described (Tiscornia et al., 2004). It was adapted for expressing gRNAs in AAV vectors by synthesizing the mU6* and the floxed
mU6 terminator as a gBLOCK (Integrated DNA Technologies, Coralville, IA) and using it to replace the mU6 promoter in pmU6-
gRNA (Addgene 53187), to produce Addgene 113160. The addition of the TH4042 A gRNA sequence followed by the transfer of
the entire expression cassette into the AAV backbone was performed using the method described above, to produce pAAV (flox-
stop) Th gRNA A EF1a eGFP (Addgene 113158).

Neuron 102, 105–119.e1–e8, April 3, 2019 e4

 The nuclear-red-to-green Cre-dependent switching vector, pAAV EF1a Nuc-flox(mCherry)-eGFP (Addgene 112677) was con-
structed by amplifying the coding region of mCherry from Addgene 47636 with linkers encoding a nuclear localization signal followed
by a loxP site. This amplicon was recombined into pAAV EF1a flox(tagRFP)-eGFP upstream of loxP-eGFP using ligation-independent
cloning.
The AAV vectors expressing the iRFP713 reporter along with iCre or Flpo recombinases (Addgene 112683 and 112684) were con-
structed by using the coding region for iRFP713 tagged with a nuclear localization signal to replace the eGFP cassette in pAAV CMV-
IE eGFP-2A-iCre and pAAV CMV-IE eGFP-2A-FLPo.
The AAV vector expressing iCre (pAAV EF1a-Cre; Addgene 89760) was constructed by using the coding region for iCre (Shimshek
et al., 2002) to replace the V5-synuclein region in Addgene 60057.
All constructs were sequence verified. All gRNA-containing vectors co-express GFP under the EF1alpha promoter. Schematics of
the vectors produced in this study and deposited at Addgene are shown in Figure S3.

Production of AAV vectors

All AAV vectors were produced using triple transfection method as previously described (Howard and Harvey, 2017). All vectors were
produced using serotype 1 capsid proteins and titered by droplet digital PCR.

Intracranial injections
Adult LE rats (> 8 weeks) were anesthetized with intraperitoneal injections of ketamine (80 mg/kg) and xylazine (8 mg/kg) and placed
into a stereotaxic frame (Stoelting Co., Wood Dale, IL). The rats received intracranial AAV injections into the SN at the following co-
ordinates: AP 5.8, ML ± 1.8, DV 7.4 mm from the bregma. A total of 1.0 mL of AAV was injected into each hemisphere at a rate of
0.5 mL/min using a Nanofil 10 mL syringe with a 33G blunt needle and coupled to a UMP4 microinjector pump (World Precision In-
struments, Sarasota, FL). Following injection, the needle was lifted 0.5 mm, and kept in place for an additional 4 min to reduce back-
flow of the AAV. Detailed information on viral injections and animals is provided in Table S1.

Immunohistochemistry
Rats were deeply anesthetized with isoflurane and transcardially perfused with heparinized phosphate-buffered saline (PBS) fol-
lowed by a 4% paraformaldehyde (PFA) solution. The brains were post-fixed in 4% PFA for 2 h, and then incubated in 18% and
30% sucrose before being flash-frozen. Using a freezing microtome, 30 mm cryosections were collected and washed for 30 min
in PBS. Following blocking in 4% goat serum and 0.3% Triton X-100 for 1 h at room temperature (RT), the sections were incubated
in primary antibody in blocking solution (1:2000 mouse anti-TH, Millipore, Burlington, MA, #MAB318, RRID:AB_2201528; 1:2000 rab-
bit anti-MANF, custom-made by Yenzym Antibodies, South San Francisco, CA (Henderson et al., 2013); 1:1000 rabbit anti-Cre-
recombinase, BioLegend, San Diego, CA, #908001, RRID:AB_2565079; or 1:1000 mouse anti-FLAG, Sigma-Aldrich, St. Louis,
MO, #F1804, RRID:AB_262044) overnight at 4 C. The next day, sections were washed in PBS for 30 min and then incubated in
secondary antibody in blocking solution at RT (1:500 dilution, all from Thermo Fisher Scientific; goat anti-mouse Alexa Fluor (AF)
568, #A-11004, RRID:AB_141371; goat anti-rabbit AF680, #A-21109, RRID:AB_2535758, goat anti-mouse AF680, #A-21058,
RRID:AB_2535724; goat anti-rabbit AF568, #A-11011, RRID:AB_143157; or goat anti-rabbit AF488, #A-11034, RRID:AB_2576217).
Next, sections were washed for 30 min in PBS, followed by a 10-min wash in DAPI (1:3000, Thermo Fisher Scientific). Sections were
mounted onto microscope slides with Mowiol mounting media (Sigma-Aldrich).

Image analysis and cell counting

Microscopy
Confocal images were acquired using a Nikon system (Nikon Eclipse E800 microscope body, Nikon C2 Confocal microscope sys-
tem, NIS-Elements imaging software version 4.40; Nikon Instruments Inc., Melville, NY). Low-magnification images were taken using
an Olympus MVX10 microscope (Tokyo, Japan) attached to a DP80 camera.
Densitometry Analysis
Densitometry analysis of midbrain and striatal coronal sections was performed in Fiji/ImageJ (Schindelin et al., 2012) (version 2, NIH).
After background subtraction, a rectangular region of interest (ROI) was drawn around the SN of the control (contralateral) hemi-
sphere (received control gRNA or other injection control), using eGFP fluorescence (if available) as a guide to determine size and
placement. The same ROI was used for the ipsilateral SN (received Th or Manf gRNA). The integrated density of TH or MANF immu-
nofluorescence was normalized to DAPI, and all ipsilateral results are presented as percentage of contralateral side.
Cell counting
Sections from the midbrain of LSL-Cas9 X DAT-iCre rats were co-immunolabelled for FLAG and TH, or MANF and TH. The SN
was imaged at 20x magnification using confocal microscopy. Immunopositive cells were manually identified and counted using
Fiji/ImageJ software.

RNA in situ hybridization (RNAscope)

Three DAT-iCre transgenic rats and one WT animal were euthanized with isoflurane and their brains were removed and immediately
frozen in dry ice. Brains were cut into 12 mm sections, directly mounted onto Superfrost Plus slides (Thermo Fisher Scientific,

e5 Neuron 102, 105–119.e1–e8, April 3, 2019

Waltham, MA) and stored at 80 C until further processing. RNA in situ hybridization of Dat and iCre mRNA was performed
according to the User Manual for Fresh Frozen Tissue using RNAscope Multiplex Fluorescent Reagent Kit (Advanced Cell
Diagnostics, Newark, CA). Briefly, mounted brain sections were fixed in 10% neutral buffered formalin (Thermo Fisher Scientific)
for 20 min on ice, followed by two rinses in distilled water and then dehydrated in 50%, 70% and 100% ethanol. Slides were
kept at 20 C in 100% ethanol overnight. The next day, the slides were dried at RT for 10 min, and then incubated with pre-
treatment IV solution at RT for 20 min. After rinsing in PBS, target probes specific for rat Dat and iCre mRNA were applied to the
brain sections and incubated at 40 C for 2 h in the HybEZ oven (Advanced Cell Diagnostics). The RNAscope probes used were
Rn-Slc6a3-C1, that targets region of 827-1913 NM_012694.2 (#319621), and a custom-made target probe for iCre-C2 (#423321).
Sections were then incubated with preamplifier and amplifier probes by applying AMP1 at 40 C for 30 min, AMP2 at 40 C for
15 min and AMP3 at 40 C for 30 min, followed by incubation in AMP4 ALtB 40 C for 15 min. Finally, the sections were stained
with DAPI for 30 s to visualize nuclei. Images from RNA hybridized sections were acquired using Nikon inverted microscope with
a 20x (N.A 0.8) objective. For quantification of labeled cells, Dat-positive and Cre-positive cells were counted in three sections
from three DAT-iCre rats.

Heteroduplex digestion and TIDE analysis

CRISPR-mediated indels were detected by heteroduplex digestion assay with either T7E1 (New England Biolabs) or Resolvase
(Takara). Genomic DNA isolation was performed using Macherey-Nagel Tissue Spin columns according to the manufacturer’s
instructions. CRISPR-mediated mutagenesis was assayed by amplifying the region surrounding the site complementary to the
gRNA(s) using Q5 polymerase (New England Biolabs) and digesting the product with T7E1 or Resolvase. A list of genotyping primers
is provided in Table S3.
CRISPR-mediated mosaicism in cell populations was observed using the TIDE analysis. Individual wells of 96-well plate containing
primary cortical neurons isolated from Sprague Dawley rats were transduced with AAV Cas9 and either rAAV2-retro Th gRNAs or
rAAV2-retro Rosa26 gRNAs. One week later, the genomic DNA was isolated by proteinase K digestion and subjected to TIDE analysis
(Brinkman et al., 2014) at the Th and Rosa26 loci. Briefly, the target locus was amplified by PCR using Q5 polymerase using gene-
specific primers, then subjected to Sanger sequencing using a nested primer (Table S3). The resulting chromatograms were analyzed
by TIDE (TIDE version 2.0.1, code developed by Brinkman et al., 2014, and hosted online at https://tide.deskgen.com/ by Deskgen)
using the sequence of the gRNA closest to the sequencing primer with a maximum indel size of 20 basepairs.

RNA isolation and quantitative reverse transcription PCR (RT-qPCR)

RNA was isolated using the Nucleospin RNA kit (Takara Bio, Mountain View, CA), including an on-column DNase treatment. Using the
iScript cDNA synthesis kit (Bio-Rad, Hercules, CA), 0.5 mg RNA was reverse transcribed into cDNA. The cDNA was further diluted
1:20 in water, and 5 mL was loaded as technical duplicates onto white-walled 96-well PCR plates (Bio-Rad), together with a 15 mL
master mix consisting of TaqMan Universal PCR Mix (Thermo Fisher Scientific), and 450 nM primers and 100 nM FAM- or HEX-
labeled probes (in-house designed, Integrated DNA Technologies) specific for rat mesencephalic astrocyte-derived neurotrophic
factor (Manf), RNA polymerase II (Polr2a), and ubiquitin-conjugating enzyme 2i (Ube2i). The following sequences were used for detec-
tion of transcripts: Manf forward, cggttgtgctactacattgga; Manf reverse, gggccagaggcttcgatac; Manf probe, ccacagatgatgccgccac
caag; Polr2a forward, tagtcctacctactccccaacttc; Polr2a reverse, agtagccaggagaagtgggag; Polr2a probe, actcgcccaccagtcccacc
tact; Ube2i forward, gccaccactgtttcatccaaa; Ube2i reverse, gccgccagtccttgtcttc; Ube2i probe, cgtgtatccttctggcacagtgtgc. Real-
time qPCR was performed with C1000 Thermal Cycler CFX96 Real-Time System (Bio-Rad) using following template: pre-incubation
12 min (50 C for 4 min, 95 C for 5 min), amplification with 50 repeats (94 C for 20 s, 60 C) for 1 min). Results were quantified using the
Bio-Rad CFX Manager software with Cq values determined using the single threshold mode. The average Cq values for Manf were
normalized to the geometric mean of the Cq for the reference genes Ube2i and Polr2a (delta Cq), and results are presented as relative
expression compared to control group using the 2ddCq value.

Western blot
For TH western blot, 8- to 10-weeks-old DAT-iCre line 1, 5, 6 transgenic and WT male rats (3 rats from each line) were anesthetized
and the brains were removed. The midbrain and striatum regions were collected from single slides with a rat brain slicer matrix (ZIVIC
Ins, Pittsburgh, PA) on ice. Tissues were lysed in a modified RIPA buffer containing 50 mM Tris-HCl (pH 7.4), 0.25% sodium deox-
ycholate, 150 mM NaCl, 1 mM EDTA, 1% NP-40, and protease inhibitors (Sigma-Aldrich), homogenized 10 s (Polytron PT1200 ho-
mogenizer, Kinematica, Luzern, Switzerland), and then centrifuged at 11,000 rpm for 15 min at 4 C. After quantification of protein
concentration in the supernatant with a DC assay (Bio-Rad), 10 mg total protein was separated on 4%–12% NuPAGE gels using
MES running buffer (Thermo Fisher Scientific). Proteins were transferred to 0.20-mm PDVF membranes (Thermo Fisher Scientific)
and immunoblotted with rabbit anti-TH (1:1000; Millipore #AB152, RRID: AB_390204) and mouse anti-actin (1:1000, Abcam,
Cambridge, UK, #ab3280, RRID:AB_303668) antibodies in blocking reagent (LI-COR Biosciences, Lincoln, NE). The protein bands
were detected with an Odyssey scanner (LI-COR) using IR700- and IR800-labeled secondary antibodies (1:2000, Rockland Immu-
nochemicals, Gilbertsville, PA).

Neuron 102, 105–119.e1–e8, April 3, 2019 e6

Protein analysis using Wes
10-weeks-old DAT-iCre line 6 transgenic and WT rats (7 rats from each line) unilaterally injected with AAV Cas9 and AAV LSL-Th
gRNA into the midbrain were analyzed for TH protein expression through capillary western blot (Wes, Protein simple, San Jose,
CA). Six weeks after injection, the animals were anesthetized and the brains were removed. The left and right midbrain regions
were collected by taking a 2 mm diameter punch of the tissue. Tissues were lysed in a modified RIPA buffer (described above), son-
icated 10 s at 10 A (Ultrasonic Processor GE 70, Cole Parmer, Vernon Hills, IL), and then centrifuged at 11,000 rpm for 15 min at 4 C.
After quantification of protein concentration in the supernatant using a DC assay (Bio-Rad), 0.2 mg of total protein was transferred to
12-230 kDa Separation Modules (Protein Simple) for separation and detection using mouse anti-TH (1:50; Millipore #MAB318, RRID:
AB_2201528) and mouse anti-actin (1:50; Cell Signal Technology mAb 3700S, RRID: AB_2242334) primary antibodies, and the Anti-
Mouse Detection Module (Protein Simple,). The relative amount of TH protein was determined using the areas under peaks from the
chemiluminescence chromatograms provided by the Compass for SW software (version 4.0.0, Protein Simple). TH values were
normalized to actin before relating the injected left side to the non-injected right side.
For protein detection in primary cortical neuron cultures, cells were lysed in RIPA buffer (above) and 1 mg protein was loaded onto
WES 25-well plates for separation of 12-230 kDa proteins (ProteinSimple). MANF and actin proteins were detected using rabbit anti-
MANF (YenZym) and mouse anti-actin (Abcam #ab3280) as primary antibodies, and HRP-conjugated anti-rabbit and anti-mouse
secondary antibodies according to the instructions in the WES separation kit (ProteinSimple).

Biotinylation and DAT internalization

Coronal midbrain sections were isolated from male WT or DAT-iCre transgenic rats (line 1, 5, and 6). Midbrain sections (1 mm) were
hemisected, and one half was treated with vehicle control and the other with 10 mM amphetamine for 30 min at 37 C in oxygenated
artificial cerebral spinal fluid (aCSF, in mM: 126 NaCl, 3.5 KCl, 1.3 MgCl2, 2 CaCl2, 1.2 NaH2PO4, 25 NaHCO3, 10 glucose). The tissue
was then rapidly chilled to halt subsequent protein trafficking and all membrane proteins were biotinylated with 2 mg/mL of a cell-
impermeable biotinylation reagent, sulfosuccinimidyl 2-(biotinamido) methyl-1,3-dithiopropionate (Pierce). Lysates were made of
these preparations and biotinylated proteins were isolated with Neutravidin beads (Pierce) and separated on an SDS gel and probed
with antibodies directed at either DAT (Millipore, MAB369) or EAAT3 (EAAC11-A, Alpha Diagnostics, San Antonio, TX).

Electrophysiology
Animals were deeply anesthetized with isoflurane and transcardially perfused with an ice-cold modified aCSF (m-aCSF) containing
(in mM) 93 NMDG, 93 HCl, 2.5 KCl, 1.2 NaH2PO4, 30 NaHCO3, 20 HEPES, 25 Glucose, 5 Na-ascorbate, 2 Thiourea, 3 Na-pyruvate,
10 MgSO4, 0.5 CaCl2. Brains were rapidly removed, and horizontal midbrain slices (200–220 mm) were made using a vibratome (Leica
VT-1000S). Slices were then incubated in aCSF containing (mM) 92 NaCl, 2.5 KCl, 1.2 NaH2PO4, 30 NaHCO3, 20 HEPES, 25 Glucose,
5 Na-ascorbate, 2 Thiourea, 3 Na-pyruvate, 2 MgSO4, 0.5 CaCl2 (32–34 C) for 15–30 min. Following this, the holding chamber was
kept at room temperature for the duration of the experiment. Slices were transferred to a recording chamber and superfused
(2–3 mL/min) with aCSF containing (in mM) 126 NaCl, 2.5 KCl, 1.2 MgCl2, 2.4 CaCl2, 1.2 NaH2PO4, 21.4 NaHCO3, 11.1 glucose main-
tained at 32–34 C. All solutions were continually oxygenated (95% oxygen, 5% carbon dioxide). Glass pipettes (tip resistance
2–4 MU) were used for whole cell recordings and were filled with an intracellular solution containing (mM) 115 K-gluconate,
20 KCl, 1.5 MgCl2, 0.025 EGTA, 10 HEPES, 2 Mg-ATP, 0.2 Na-GTP, 10 Na2-phosphocreatine (pH 7.2–7.3, 290 mOsm/kg).
Cells were identified using an upright microscope with differential interference optics (Olympus BX61WI) equipped with a scanning
confocal system (Olympus Fluoview F1000). Images were acquired using Olympus Fluoview software (version 3.0).
Electrophysiology data were acquired using an Axopatch 200 B amplifier (Molecular Devices, San Jose, CA) in either voltage clamp
or current clamp mode. Data were filtered at 5 kHz and digitized at 10 kHz using a National Instruments USB-6221 digitizer (Austin,
TX). WinWCP software (University of Strathclyde, Glasgow, UK) was used to collect electrophysiological data. Recordings of spon-
taneous cell firing rates were performed using zero-current mode. During whole cell voltage clamp recordings, neurons were main-
tained at a holding potential of 60 mV. Holding currents reported represent the amount of current injected to maintain the cell
at 60 mV. Input resistance was calculated using 10 mV steps during voltage clamp recordings.

Voltammetry
Slice preparation
Rats were anesthetized with isoflurane and the brains rapidly removed and placed in ice-cold m-aCSF. Coronal hemisections
(280 mm) containing the striatum were cut using a vibratome (Leica VT1000S). Slices were incubated in standard oxygenated
aCSF at 34-35 C for 10-15 min, then allowed to stabilize at room temperature for > 30 min prior to initiating recordings. During re-
cordings, slices were continuously superfused with aCSF using a peristaltic pump (Cole-Parmer Instruments, Vernon Hills, IL) at a
rate of 2 mL/min, and maintained at 30-32 C.
Voltammetric recordings
Carbon fibers (7 mm diameter) were vacuum-aspirated into borosilicate pipette glass. Pipettes were pulled using a conventional
patch-pipette puller, and the ends of the carbon fiber were cut to allow 25-30 mm exposed length protruding from the pipette
tip. Pipettes were back filled with a 4 M potassium acetate/150 mM KCl solution and connected to a standard patch pipette
holder/head stage assembly. A patch clamp amplifier (HEKA EVA-8, Digitimer, Ft. Lauderdale, FL) was used to deliver voltage

e7 Neuron 102, 105–119.e1–e8, April 3, 2019

and measure current from the head stage. Voltammetric scan and stimulation timing protocols were performed using PCI-based A/D
boards (National Instruments) and LabView-based software (TarHeel CV, University of North Carolina, Chapel Hill, NC). Scans con-
sisted of sweeps from 0.4 to 1.3 V and back to 0.4 V, at a rate of 400 V/s, and were obtained at 50 Hz. A 5 s control period preceded
each electrically-evoked response and was used to obtain a background current that was digitally subtracted from the current ob-
tained during the peak of the response. All signals used in analyses matched the expected voltammetric profile for dopaminergic
neurons.
Electrically-evoked signals in brain slices
Under stereoscopic magnification, carbon fibers were lowered to a depth of 100 mm in the dorsolateral striatum. A bipolar stimu-
lating electrode was positioned 75-100 from the carbon fiber. A single, constant current pulse (10-180 mA, 1 ms duration) was deliv-
ered every 90 s to elicit dopamine release. A pre-drug input-output curve was first generated by varying the stimulus intensity.
Following construction of the input-output curve, 3-4 baseline signals were obtained at maximal stimulus intensity. A cocaine
(5 mM) solution was then added into the recording chamber for 10-15 min, until a stable drug response was observed. Signals
were analyzed using a non-linear regression analysis that distinguishes dopamine release from DAT-mediated uptake (Hoffman
et al., 2016).

QUANTIFICATION AND STATISTICAL ANALYSIS

Experimental parameters for all in vivo work can be found in Table S1. All results are shown as mean ± standard error (SE) unless
otherwise stated in figure legends or Results. Statistical analysis was performed using Prism software (GraphPad, San Diego,
CA). For comparison of two experimental groups, Student’s t test was applied. One-way ANOVA and Tukey’s test were used to
compare the outcome from more than two treatment groups. For repeated voltammetry measures, a two-way ANOVA together
with Holm-Sidak’s test were used to test for differences between WT and DAT-iCre rats. A p value < 0.05 was considered significant.
Data points identified as statistical outliers with single Grubbs’ test were removed from the dataset.

Neuron 102, 105–119.e1–e8, April 3, 2019 e8