Bioresource Technology 304 (2020) 122928

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Effect of aeration rates on enzymatic activity and bacterial community T

succession during cattle manure composting
⁎
Mianshen Gea,b,c, Haibin Zhoua,c, Yujun Shena,c, Haibo Menga,c, , Ran Lia,c, Jun Zhoub,
Hongsheng Chenga,c, Xi Zhanga,c, Jingtao Dinga,c, Jian Wanga,c, Jiarui Wanga,c
a
Academy of Agricultural Engineering Planning and Design, No. 41, Maizidian Street, Chaoyang District, Beijing 100125, China
b
College of Biotechnology and Pharmaceutical Engineering, Nanjing TECH University, Nanjing 211816, China
c
Key Laboratory of Technologies and Models for Cyclic Utilization from Agricultural Resources, Ministry of Agriculture, Beijing 100125, China

A R T I C LE I N FO A B S T R A C T

Keywords: In order to explore changes in microbial enzyme activity and bacterial community, a 60-day composting ex-
Aeration rates periment was conducted using cattle manure and straw under aeration rates of 0.45, 0.68, and
Cattle manure composting 0.90 L min−1 kg−1 fresh weight. High aeration rate increased the cellulase, urease, alkaline and acid phos-
Enzymatic activity phatase activities, but decreased that of invertase and catalase. Cellulase, alkaline phosphatase and catalase were
Bacterial community
the main enzymes that affected the composting process. Microbial analysis showed that high aeration rate in-
creased the uniformity of bacterial community in thermophilic phase, but decreased that in mature phase.
Different aeration rate affected the bacterial community structure and further influenced the relationship be-
tween enzyme and functional bacteria. Regulating the temperature, moisture content and EC in specific phases
to affect bacterial community succession could provide guidance for improving maturity of composting.

1. Introduction that dehydrogenase could be used as an effective method to reflect the

In recent years, the annual production of livestock and poultry
manure in China has reached 3.8 billion tons, while that of cattle
manure has reached 1.38 billion tons. Rapid development of large-scale
farming provides vast amounts of milk and beef, but also produces
extensive amounts of cattle manure. As cattle breeding industry grows,
direct land-use without implementation of appropriate treatments, and
improper use of cattle manure, has caused various environmental pro-
blems. Composting is advantageous because it is inexpensive, im-
proving nutrient content, and decreasing the free metals (Ye et al.,
2019b). Moreover, compost can degrade antibiotics in the environment
to reduce its threat to organisms in the ecosystem (Dolliver et al., 2008;
Ye et al., 2019a). However, the high cellulose and moisture content of
cattle manure can impede the process of composting (Wang et al.,
2011), and use of unfermented compost causes phytotoxicity to the soil.
For these reasons, it is of great significance to improve cattle manure
composting technology to promote maturity.
Composting process can be reflected by studying microbial-com-
munity succession and changes in enzymatic activity. Microorganisms
and the enzymes they secrete are the most important factors driving
composting processes (Wu et al., 2017a). Barrena et al. (2008) reported
biological activity of composting. Due to the high complexity of or-
ganics, it is necessary to improve enzyme activity through experimental
design. However, certain factors in the environment will decline en-
zyme activity. Wu et al. (2017b) pointed that the content of metal ions
would affect urease activity. Ma et al. (2019) showed matured compost
addition could increase the cellulase, peroxidase, arylsulfatase, and
urease in mesophilic phase during sewage sludge composting. Ana-
lyzing a large number of enzymes is not feasible, but evaluating the
most important ones can provide basic information for estimating the
proper estimation of the entire composting process (Vargas-García
et al., 2010). Most studies address only one or two specific problems by
examining the activities of common enzyme. High-throughput se-
quencing is increasingly used to examine changes in microbial com-
munity structure during the composting process. Zhong et al. (2020)
reported that the abundance of Nitrosomonas sp. was dominant am-
monia oxidizing bacteria during dairy manure composting. Tortosa
et al. (2016) found that Planomicrobium and Ohtaekwangia were highly
correlated with main indicators during sheep-manure composting, and
could be used as biomarkers of compost maturation. Enzymatic activity
is affected only by specific functional bacteria, not by the entire bac-
terial community (Ling et al., 2014). Delineating relationships between

⁎
Corresponding author at: Academy of Agricultural Engineering Planning and Design, No. 41, Maizidian Street, Chaoyang District, Beijing 100125, China.
E-mail address: newmhb7209@163.com (H. Meng).

https://doi.org/10.1016/j.biortech.2020.122928
Received 22 December 2019; Received in revised form 21 January 2020; Accepted 27 January 2020
Available online 28 January 2020
0960-8524/ © 2020 Published by Elsevier Ltd.
M. Ge, et al.
enzyme activity and microbial community during composting of cattle
manure is important for improving compost maturity.
Composting is a dynamic process of converting organic matter into
stable humus via various microbial activities under aerobic conditions
(Lopez-Gonzalez et al., 2015). Suitable aeration provides sufficient
oxygen for composting, regulates reactor temperature, controls water
loss and reduces emissions from odorous matters (Zhang et al., 2016).
Xu et al. (2012) found that aeration rate of 0.03–0.04 m−3 min−1 could
effectively improve the composting process and significantly increase
all enzyme activities during the composting. Talib et al. (2014) showed
that using an aeration rate of 0.26 L min−1 kg−1 dry matter (DM)
during rabbit manure composting promoted degradation of organic
components. Aeration is one of the most important factor during
composting because oxygen is essential for microbial activity. Yan et al.
(2016) reported that the ammonia-oxidizing bacteria diversity did not
change significantly with the increase of the aeration rate. However,
most studies on aeration rate during composting have focused on
quality of compost product and emission of gaseous matter, or in-
dependently evaluated the influence of aeration rate on enzyme activ-
ities or microbial community, few researches have systematically re-
vealed the relationship among the physico-chemical indexes, enzymes
and bacterial communities for better understanding the mature process
during composting.
In this study, a long-term composting experiment lasting 60 days in
a closed composting device was performed, and the enzymatic activities
and bacterial community structure were evaluated. The objective was
to: 1) assess the effects of different aeration rates on various indexes and
bacterial community succession during composting of cattle manure; 2)
systematically summarize the relationships among physico-chemical
indexes, enzymatic activities and bacterial communities. This study
help reveal the mechanism of composting maturity and changes in
microbial function under different aeration rates.
2. Materials and methods
2.1. Raw materials and composting experiments
This experiment was performed in the laboratory of Academy of
Agricultural Planning and Engineering, MARA, PRC. Cattle manure
used in this study was obtained from a cattle farm in Hebei Province,
China. Wheat straw, cut into 1 ~ 2-cm pieces, was used as bulking
agent and mixed thoroughly with cattle manure. The physical and
chemical characteristics of raw materials were analyzed before com-
posting, and results were provided in the Supplementary Material. The
60-L composting devices used in this study were designed as described
previously (Shen et al., 2016) with several modifications. Forced
aeration was set at 5-min aeration and 45-min pause. The three dif-
ferent aeration rates were 0.45 L min−1 kg−1 (AR10),
0.68 L min−1 kg−1 (AR15), and 0.90 L min−1 kg−1 (AR20) fresh
weight, respectively.
Temperature probes were used to measure temperature at different
positions in the pile, including the top layer (40 cm from the bottom of
the cylinder), the middle layer (26 cm from the bottom of the cylinder),
and the bottom layer (10 cm from the bottom of the cylinder). Samples
were collected at 2 pm on days 1, 3, 5, 7, 13, 20, 40, and 60.
Approximately 500 g was collected for each sampling and then vor-
texed thoroughly for analysis. The collected samples were divided into
three parts: one part was immediately used for measurement of enzy-
matic activity, another was stored at 4 °C for chemical analysis, and the
third part was stored at –80 °C for DNA analysis.
2.2. Analytical methods
The pH and electrical conductivity (EC) of samples were determined
on the suspension of samples in deionized water at a ratio of 1:10 (w/v)
(Yang et al., 2019). Moisture content and volatile solids (VS) in the
2
Bioresource Technology 304 (2020) 122928
samples were determined by assessing the weight loss at different
temperatures. Ammonium (NH4+-N) and nitrate nitrogen (NO3–-N)
contents were assessed using the method of Guo et al. (2016). Total
nitrogen (TN) and phosphorus (TP) contents were assessed using the
methods of Chen et al. (2017). The E4/E6 represents the ratio of ab-
sorbance at 465 and 665 nm using the method of He et al. (2013).
Germination index (GI) was determined as described previously
(Zucconi, 1981).
2.3. Analysis of enzymatic activities
The enzymatic activities were measured following the method of
Chen et al. (2019). The activities of cellulase and invertase were de-
termined using 3,5-Dinitrosalicylic acid colorimetry, while the activity
of urease and phosphatase were determined using colorimetry of in-
dophenol blue and phenyl phosphate disodium, respectively (see Sup-
plementary Material). The activity of catalase was assessed following
the method of Xue and Huang (2013) with several modifications.
2.4. DNA analysis
The DNA of samples (Day 1, 3, 13, 20, 40 and 60) was extracted
using an Ezup genomic DNA extraction kit for soil (PowerSoil® DNA
Isolation Kit Components, Mo-Bio, Carlsbad, CA, USA) following the
manufacturer’s instructions. The V3-V4 hypervariable regions of bac-
terial 16S rRNA gene were amplified via polymerase chain reaction
(PCR) using primers 338F (ACTCCTACGGGAGGCAGCAG)/ 806R
(GGACTACHVGGGTWTCTAAT). PCR reactions were conducted using
the following settings: 3 min of denaturation at 95 °C, 27 cycles of 30 s
at 95 °C, 30 s for annealing at 55 °C, 45 s for elongation at 72 °C, and a
final extension at 72 °C for 10 min. The purified final products were
subjected to high-throughput sequencing on an Illumina-Miseq PE300
platform (The Center for Genomic Research, Majorbio BioPharm
Technology Co., Ltd, China).
2.5. Statistical analysis
All statistical analyses and mapping were performed using Excel
2016 and Origin 2017 software packages. Operational taxonomic units
(OTUs) were clustered with 97% similarity cutoff using UPARSE (ver-
sion 7.1 http://drive5.com/uparse/); single sequences and chimeras
were removed during clustering. One-way analysis of variance
(ANOVA) was performed at a 95% confidence level by SPSS V.21
software. Redundancy analysis (RDA) via Canoco v.5.0 software was
used to identify correlations among enzymatic activities and various
physico-chemical indexes during composting. Spearman correlation
analysis via R (pheatmap package) software was used to analyze en-
zymatic activity and bacterial genera. Redundancy analysis of en-
vironmental factors and bacterial communities was performed using the
computer R language vegan package.
3. Results and discussion
3.1. Changes in temperature and physico-chemical properties
3.1.1. Temperature
Temperature is considered to be the main parameter for evaluating
composting effects and produces a selective effect in the process of
microbial succession (Zheng et al., 2015). Temperature changes re-
sulting from the different aeration conditions evaluated in this study are
shown in Fig. 1a. Temperature of the three treatments rose sharply to
above 60℃ with 1 day. The highest temperatures achieved under the
three different aeration conditions were reached on day 2 at 69.7, 70.13
and 69.73℃, respectively. On day 5, temperature of AR15 treatment
remained above 50℃, while that of AR20 treatment reached lowest at
38.01℃. Under all three treatment conditions, the temperature
M. Ge, et al. Bioresource Technology 304 (2020) 122928

Fig. 1. Changes in temperature (a), pH (b), EC (c), moisture content (d), VS (e), NH4+-N (f), NO3−-N (g), TN (h), and TP (i) during composting.

3
M. Ge, et al.
Fig. 2. Changes in GI (a) and E4/E6 (b) during composting.
increased slightly after turning on day 13 and approached ambient
temperature after day 17.
3.1.2. Change in pH, EC, moisture content, and VS
The optimum pH (Fig. 1b) range for microbial growth and re-
production during composting is 6.7–9.0 (Bernal et al., 2009), this is
when organic matter in the initial stage of composting can be utilized.
In this research, the initial pH values of AR10, AR15, and AR20 treat-
ments were 9.52, 9.67, and 9.70, respectively. Rapid growth of mi-
croorganisms caused decomposition of carbohydrates such as starch to
produce organic acids, decreased the pH values observed of the three
treatments during mesophilic and thermophilic phases (Huang et al.,
2014). With the consumption of organic acids during composting, the
pH values observed in AR15 and AR20 treatments increased slightly in
cooling and mature phase. However, the pH values observed in AR10
treatment showed a consistent downward trend and finally stabilized at
8.9, this may be related to the partial organic acids produced by the
local anaerobic reaction in the pile. EC can reflect the content of soluble
salts that can cause phytotoxicity during the composting process. The
three treatments evaluated in present study showed a downward trend
in mesophilic and thermophilic phases of composting (Fig. 1c). With the
decrease of temperature, the EC values increased to varying degrees.
The highest value (3.273) of EC was achieved in AR10 treatment on day
13, following by AR20 treatment (2.903) on day 20 and AR15 treat-
ment (2.44) on day 40. The value of EC in AR15 treatment on day 13
was significantly higher than the other treatments, which may be re-
lated to the turning of compost accelerated the decomposition of or-
ganic matter in low aeration treatment, thus releasing a large amount of
mineral salts. During the entire composting process, the safety
threshold of 4 mS cm−1 was never exceeded (García et al., 1991).
Moisture content of the material undergoing composting is critical
for the survival of microorganisms populating. Generally, the most
suitable moisture content for composting is 50%–60% (Gajalakshmi &
Abbasi, 2008). As Fig. 1d showed, the moisture content of the three
treatments was basically between the optimal requirements during the
4
Bioresource Technology 304 (2020) 122928
whole composting process, and all of the three treatments showed a
downward trend. Moisture content of the pile rapidly decreased due to
evaporation in the early stages of composting. The highest aeration
resulted in the lowest moisture content during the mature phase of
composting. As shown in Fig. 1e, VS showed a downward trend during
the entire composting process, which was consistent with the results of
Liu et al. (2019). By day 60, the AR10 treatment resulted in the highest
VS content of the three treatments, which indicated that the organic
matter may not be sufficiently degraded in the low aeration rate
treatment, so that the value of VS remained relatively high in mature
phase.
3.1.3. Changes in nitrogen and phosphorus contents
TN is an important indicator to measure the quality of compost
products. Optimizing aeration rate is important for reducing nitrogen
loss. As shown in Fig. 1f, TN rose rapidly during the mesophilic and
thermophilic phases of composting in the three treatments, which may
be related to the rapid degradation of organic matter due to intense
microbial activity (Li et al., 2020). The maximum value of TN in the
AR15 and AR20 treatments appeared on day 5, while that in the AR10
treatment appeared on day 7, which indicated low aeration rate would
reduce the degradation rate of organic compounds. Compared with the
initial sample, TN of the composting products obtained under AR10,
AR15, and AR20 increased by 46.07%, 28.14%, and 25.68%, respec-
tively, indicating that higher aeration rate resulted in increased ni-
trogen loss. During initial phases of composting, microbial activity in-
creases the decomposition of organic nitrogen, resulting in rapid NH4+
generation in the pile. The results showed that NH4+-N in the AR10 and
AR15 treatments increased rapidly from day 1 to 3 and then decreased,
while NH4+-N content in the AR20 treatment increased gradually from
day 1 to 13 and reached its highest value of 74 mg kg−1, and finally
stabilized (Fig. 1g). The NH4+-N content in AR10 and AR15 treatments
in thermophilic phase was significantly higher than that of AR20
treatment (P < 0.05). As shown on Fig. 1h, NO3–-N content of the
AR10, AR15, and AR20 treatments reached its highest values of 1.8,
5.04, and 3.37 g kg−1 on days 13, 3, and 5, respectively. Higher
aeration rate (AR15, AR20) could significantly enhance NO3–-N content
compared to the AR10 treatment during thermophilic phase
(P < 0.05). As composting temperature decreased, nitrification
transforms NH4+-N into NO3–-N (Brito et al., 2008), and the NO3–-N
content obtained in the AR15 treatment was relatively higher than that
in AR10 and AR20 treatments. The content of TP in the AR15 and AR20
treatments on day 60 increased by 89.09% and 100%, respectively,
compared with that on day 1, but decreased in the AR10 treatment. The
decrease of phosphorus content in the AR10 treatment may be related
to the generation of leachate and the less loss of organic components.
These results indicated that higher aeration rate promoted increased TP
content.
3.2. Changes in maturity indexes
Germination index (GI) and E4/E6 are the most common indicators
of compost maturity (Awasthi et al., 2014; Zucconi, 1981). The GI value
reaches 80–85% indicates that the composting product is completely
mature. Overall, the GI values gradually increased in the three treat-
ments, indicating that compost biotoxicity was decreased by the com-
posting (Fig. 2a). The GI values of AR10, AR15, and AR20 treatments
reached their maximum on day 40 at 96.62%, 89.41%, and 88.54%,
respectively. However, GI values in AR20 treatment decreased to
77.11% on day 60, while the other treatments remained above 80%.
Since the determination of GI is the use of leachate from compost, many
insoluble substances in the sample may also affect plant growth (Meng
et al., 2019). Therefore, evaluation of compost maturity requires using
a combination of various indicators (Bernal et al., 2009). The E4/E6
ratio is used to determine the optical density of a humic acid solution at
465 and 665 nm, smaller values indicate that the compost is well-
M. Ge, et al.
Fig. 3. Change in the activity of cellulase (a), invertase (b), urease (c), catalase (d), alkaline phosphatase (e), neutral phosphatase (f), and acid phosphatase (g) during
composting.
matured and stabilized (Moharana & Biswas, 2016). The Fig. 2b shows
that the E4/E6 values of the three treatments gradually increased from
day 1 to 7, which may be related to the decomposition of organic matter
caused by the robust microbial activity during the early phases of
composting (Shan et al., 2013). In addition, the E4/E6 value of the
AR10 treatment was higher than the other two treatments during the
early phase of composting, indicating that the low aeration rate may be
detrimental to the decomposition of organic matter. However, the E4/
E6 value of the AR15 treatment remained relatively low among the
three treatments, suggesting that aeration rate of 0.68 L min−1 kg−1
was favorable to compost maturity. Additionally, the E4/E6 values on
day 60 were slightly higher than those on day 40, which indicated that
degree of humification of the day-40 product was higher, this finding
was consistent with GI. The phenomenon may be related to the con-
sumption of humus during the mature phase of composting.
5
Bioresource Technology 304 (2020) 122928
3.3. Changes in enzymatic activities
3.3.1. Activities of cellulase and invertase
Cellulase and invertase can hydrolyze cellulose and sucrose into
glucose and energy, which can be used by microorganisms (Nascimento
et al., 2010). High aeration rate had a significant effect on cellulase
activity compared to AR10 treatment in the mesophilic phase, but not
in other phases (P < 0.05). During the early phase of composting,
cellulase activity in the three treatments showed an overall rising trend
and the highest values occurring on day 13 as follows: AR20
(0.508 mg g−1 d−1) > AR15 (0.488 mg g−1 d−1) > AR10
(0.459 mg g−1 d−1) treatment, which indicated that higher aeration
rate was beneficial to increase cellulase activity. Raut et al. (2008)
showed that decomposition of cellulose, hemicellulose, and lignin in
organic matter is mainly related to fungi. High temperature can sig-
nificantly inhibit the activity of fungi that hydrolyze cellulose, which
M. Ge, et al.
Fig. 4. Redundancy analysis of relationships between enzyme activity and
various indexes (a), and percentage of variance for each enzyme (b).
may be the main reason for the relatively-low cellulase activity ob-
served in the early stage of composting. With the decrease of pile
temperature, microorganisms stored enough energy to degrade cellu-
lose (Du et al., 2019), resulting in higher release of cellulase in the
cooling phase.
Changes in invertase activity was shown in Fig. 3b. The activity of
invertase in the three treatments decreased gradually and higher
aeration rate was beneficial to increase invertase activity during the
mesophilic and thermophilic phases. The highest values
(96.554 mg g−1 d−1) of invertase activity was achieved in the AR15
treatment following by AR10 treatment (81.758 mg g−1 d−1) on day
13, which were significantly higher than that in AR20 treatment
(76.147 mg g−1 d−1) on day 20. Invertase activity fluctuated greatly
from d7 to d13, and activity of invertase in the AR15 treatment re-
mained higher than the other two treatments after day 7.
3.3.2. Activity of urease and catalase
Urease participates in the N cycle to hydrolyze urea into carbonic
acid and ammonia during composting. The highest value of urease
activity was reported on day 3 in AR15 and AR20 treatments (1.359
and 1.371 mg g−1 d−1, respectively) followed by AR10 treatment
(1.279 mg g−1 d−1) on day 5 (Fig. 3c). The urease activity in AR10
treatment was significantly higher than that in the AR15 and AR20
treatments on day 7. High aeration rate was beneficial for increasing
maximum of urease activity, while low aeration rate could maintain
6
Bioresource Technology 304 (2020) 122928
urease activity at a high level in mature phase of composting.
Catalase activity showed a similar trend in the three treatments
(Fig. 3d). The maximal value of catalase activity was observed on day 3
as follows: AR10 > AR15 > AR20 treatment. This indicates that the
lowest aeration rate resulted in highest catalase activity. As fermenta-
tion progressed, catalase activity declined from day 3 to 7 and then
increased slightly during the mature phase. Different aeration rates
have no significant effect on catalase activity during composting. Xue
and Huang (2013) also found that catalase activity was less sensitive to
environmental factors than those of other enzymes.
3.3.3. Activity of phosphatases
Phosphatase plays a key role in the P cycle during composting,
hydrolyzing organic phosphorus into different forms of phosphates that
can be absorbed and metabolized by plants. As shown in Fig. 3e, the
activity of alkaline phosphatase continuously increased from day 1 to
13, reaching maximal values on day 13 as follows: AR20
(0.491 mg g−1 d−1), AR15 (0.478 mg g−1 d−1), and AR10
(0.456 mg g−1 d−1). The alkaline phosphatase activity in AR10 treat-
ment on day 20 and 40 were significantly higher than that in AR15 and
AR20 treatments, but tend to be consistent during on day 60. The
neutral phosphatase activity in the AR10 treatment was significantly
lower than that of AR15 and AR20 treatments during mesophilic phase.
The highest neutral activity value in the AR15 and AR20 treatments
were achieved on day 5 (0.45 and 0.446 mg g−1 d−1, respectively),
followed by AR10 treatment on day 13 (0.411 mg g−1 d−1). As shown
in Fig. 3g, the highest values of acid phosphatase were achieved in the
AR20 treatment (0.448 mg g−1 d−1) on day 3 following by AR15
treatment (0.443 mg g−1 d−1) on day 5 and AR10 treatment
(0.43 mg g−1 d−1) on day 3. The activity of acid phosphatase then
declined sharply from day 5 to 7, which was similar with the study
reported by Cunha-Queda et al. (2007). The activity of acid phospha-
tase in the AR15 treatment was significantly higher than that in AR20
treatment during cooling phase. Overall, the activities of three phos-
phatases were relatively lower than that of AR10 treatment in the
mature phase, suggesting that the low pH environment in AR10 treat-
ment was more conducive to the improvement of phosphatase activity
in mature phase.
3.3.4. Relationship between enzymatic activities and physico-chemical
indicators
The relationship between enzymatic activities and various physico-
chemical indexes in composting was identified via redundancy analysis.
As shown in Fig. 4a, the first two axes of RDA accounted for 67.16% of
total variance. Cellulase (44.0%), alkaline phosphatase (9.1%), and
catalase (6.5%) were the main enzymes that affecting the composting
process (P < 0.05). Cattle manure contains high contents of cellulose,
which is closely related to cellulase; therefore, decomposition of cel-
lulose plays an important role in the composting of cattle manure. In
this study, cellulase showed positive correlation with GI and E4/E6, but
negative correlation with temperature, moisture content, and VS. Or-
ganic phosphorus in compost is hydrolyzed into phosphate by phos-
phatase produced by microorganisms, phosphate is then absorbed and
utilized by plants. Criquet et al. (2004) considered acid and alkaline
phosphatases as the most important phosphatases in most soils. In this
study, alkaline phosphatase was positively correlated with TN and
NO3–-N, and negatively correlated with GI and E4/E6. Albrecht et al.
(2010) also showed that acid and alkaline phosphatases are sig-
nificantly correlated with multiple indicators and composting maturity.
Catalase can be used as an indicator of bacterial activity, and can
neutralize active oxygen species generated during bacterial metabolism
(Yao et al., 2006). During composting, catalase was positively corre-
lated with temperature but negatively correlated with GI and E4/E6.
M. Ge, et al. Bioresource Technology 304 (2020) 122928

Fig. 5. Changes in bacterial community at the genus level during composting (1, 2, and 3 represent AR10, AR15, and AR20 treatments, respectively).

3.4. Succession of bacterial community during composting Shannon, Ace, and Chao index in AR10 and AR15 treatments remained
high, while those of AR20 treatment were relatively low. These results
3.4.1. Bacterial richness and diversity indicated that high aeration rate was unfavorable to the uniformity of
Alpha diversity analysis, including Shannon, ACE, Chao, and bacteria during mature phase.
Coverage indexes, can be calculated to measure the richness and di-
versity of bacterial community. In this study, Coverage index of each
3.4.2. Bacterial community structure
sample was above 0.99 (see Supplementary Material), indicating that
Monitoring changes in bacterial community structure during com-
most of the microbial populations in piles were detected (Li et al.,
posting can illustrate the effects of different aeration rates on the bac-
2020). Shannon index values in the AR15 treatment (3.6073) was
terial-community structure. Changes in the bacterial community
higher than those of AR10 and AR20 treatments (3.4313 and 3.3404,
structure at the genus level are shown in Fig. 5. Psychrobacter and
respectively) in the mesophilic phase. Similar trends were observed for
Atopostipes were the major bacterial genera in mesophilic phase, ac-
the Ace and Chao indexes of bacterial community. These results in-
counting for 19.23% and 20.05%, 20.70% and 17.61%, and 29.98%
dicated that selection of initial aeration rate has a certain effect on the
and 18.32% of bacterial abundance in AR10, AR15, and AR20 treat-
bacterial richness and diversity in the mesophilic phase of composting.
ments, respectively. High aeration rate (AR20) significantly increased
During thermophilic phase, bacterial richness and diversity of AR10
relative abundance of Psychrobacter during the mesophilic phase but did
and AR20 treatments remained relatively high but decreased sig-
not significantly affect that of Atopostipes. In thermophilic phase (day
nificantly in AR15 treatment. Tiquia (2005) showed that bacterial di-
3), Psychrobacter and Atopostipes remained the most dominant bacteria
versity continued to increase even when temperatures exceed 60 °C,
in AR15 and AR20 treatments. In addition, 3.9% and 4.79% of Bacillus
which was consistent with the conclusions obtained in the AR10 and
were detected in the AR15 and AR20 treatments. The top three genera
AR20 treatment in this study. In the mature phase, the values of
in the AR10 treatment during the thermophilic phase were Bacillus

7
M. Ge, et al. Bioresource Technology 304 (2020) 122928

Fig. 6. Heat map of Spearman’s correlation analysis between the top fifteen bacterial genera in AR10 (a), AR15 (b), and AR20 (c) treatments and enzyme activities
(The value of P < 0.05 is marked with “*”, P < 0.01 is marked with “**”, and P < 0.001 is marked with “***”), and redundancy analysis between environmental
factors and bacterial communities (d) during composting (1, 2, and 3 represent AR10, AR15, and AR20 treatments, respectively).

8
M. Ge, et al.
(19.5%), Thermobifida (16.3%), and Oceanobacillus (8.94%), which in-
dicates that low aeration rate helped increase the relative abundance of
Bacillus and Thermobifida during the thermophilic phase. The most
abundance of bacteria genera on day 13 in AR10, AR15, and AR20
treatment was Pusillimonas, accounting for 21.41%, 18.17%, and 10.8%
of the bacterial population, respectively. The increase of aeration rate
inhibited the relative abundance of Pusillimonas during the cooling
phase. The relative abundance of Thermobifida in the AR15 and AR20
treatments was the highest, accounting for 17.47% and 20.63% of
bacterial population, respectively, after the pile was turned on day 13.
However, the relative abundance of Thermobifida only accounted for
8.83% in AR10 treatment. During the mature phase (day 40), the major
bacterial genera in AR10 and AR15 treatment were Thermobifida,
Oceanobacillus, and Bacillus, while the major genera in the AR20
treatment were unclassified-o-Micrococcales (9.8%), norank-f-MWH-
CFBK5 (9.33%), and Ruminofilibacter (5.95%). As fermentation pro-
gressed, the difference of the bacterial community in the three treat-
ments was not obvious on d60.
3.4.3. Relationship between enzymatic activity and bacterial community
Studies on relationships between enzymatic activity and functional
bacterial communities during composting are scarce (Ma et al., 2019).
As shown in Fig. 6, catalase activity was significantly positively corre-
lated with the Atopostipes (r = 0.928, P = 0.008), Paeniclostridium
(r = 0.87, P = 0.024), Psychrobacter (r = 0.928, P = 0.008), and
Romboutsia (r = 0.928, P = 0.008) in AR15 treatment. In the AR10
treatment, a significant positive correlation was found between catalase
activity and Romboutsia (r = 0.829, P = 0.042), Paeniclostridium
(r = 0.829, P = 0.042), and Clostridium_sensu_stricto_1 (r = 0.886,
P = 0.019). However, no correlation was found between catalase and
any bacterial genus in the AR20 treatment. Similarly, invertase activity
was significantly positively correlated with Pusillimonas (r = 0.943,
P = 0.005) and norank_f_Sphingobacteriaceae (r = 0.943, P = 0.005) in
AR15 treatment, but showed positive correlation only with Pusillinonas
(r = 0.943, P = 0.005) and Pseudomonas (r = 0.943, P = 0.005) in
AR10 and AR20 treatments, respectively. These results indicated that
proper aeration was beneficial to the contributions of these bacterial
communities to catalase and invertase release. Cellulase was sig-
nificantly positively correlated with norank_f _JG30_KF_CM45 (r = 1,
P = 0) and Pusillimonas (r = 0.829, P = 0.042) in the AR10 treatment,
significantly positively correlated with Pusillimor (r = 0.886,
P = 0.019) in AR15 treatment, and significantly positively correlated
with Pseudoтonas (r = 0.829, P = 0.042) in AR20 treatment. This
suggested that low aeration helped to strengthen the correlation be-
tween bacterial community and cellulase. In AR20 treatment, acid
phosphatase was significantly positively correlated with Romboutsia
(r = 0.9856, P = 0.0003), Paeniclostridium (r = 0.9856, P = 0.0003),
Bacillus (r = 0.8116, P = 0.0499), and Atopostipes (r = 0.9117,
P = 0.0113). Neutral phosphatase was significantly positively corre-
lated with Atopostipes (r = 0.8676, P = 0.0251). In the AR10 and AR15
treatments, phosphatase was not significantly positively correlated with
any bacterial genera. These results indicated that high aeration rate
helped to strengthen the relationship between phosphatase and related
genus.
3.4.4. Relationship between environmental factors and bacterial
communities
Changes in multiple physical and chemical factors during com-
posting drive changes in microbial-community structure, and the re-
dundancy analysis (RDA) is generally used to determine correlations
between microbial community and environmental changes. As shown
in Fig. 6d, the first two sorting axes in the RDA account for 59% of
variance in samples. Among the examined nine environmental factors,
temperature (explaining 73.5% of total variance, P = 0.001), moisture
content (explaining 56.34% of total variance, P = 0.002), and EC
(explaining 39.53% of total variance, P = 0.022) had a significant
9
Bioresource Technology 304 (2020) 122928
impact on succession of bacterial-community structure. The regulation
of these indicators in different phases could provide guidance for actual
production. Temperature and moisture content have a greater influence
on samples in mesophilic and thermophilic phases. Cahyani et al.
(2003) suggested that temperature and available substrates determined
composition of bacterial communities at different composting phases.
Moisture content is another important parameter during the com-
posting process because water molecules are used in the transport of
nutrients required for microbial metabolism and physiological activ-
ities. Liang et al. (2003) found that moisture content was the main
factor affecting microbial activity during composting. In this study,
temperature and moisture content exerted significant effects on bac-
terial-community succession in cattle manure composting. EC showed a
greater influence on bacterial community of the samples during the
cooling phase (day 13). Mao et al. (2018) also found a significant
correlation between EC and bacterial communities during composting
of pig manure and sawdust. TN (explaining 32.61% of total variance,
P = 0.059) showed correlation with samples in mature phase, but this
correlation did not reach statistical significance. In addition, bacterial
community structure of the three treatments showed significant
changes during the thermophilic phase (day 3), but tended to be con-
sistent in the mature phase.
4. Conclusion
The effects of different aeration rates on enzymatic activity and
bacterial community succession during cattle-manure composting was
studied. Cellulase, alkaline phosphatase, and catalase were the main
enzymes that affected the composting process. Aeration rate affected
the succession of bacterial communities via the changes of temperature,
moisture content, and EC in mesophilic, thermophilic and cooling
phase, respectively, which in turn influenced the maturity of cattle
manure composting and the relationship between enzymatic activity
and functional bacteria. In conclusion, an aeration rate of
0.68 L min−1 kg−1 is feasible for simultaneously optimizing cattle-
manure composting and cost savings in agricultural production.
CRediT authorship contribution statement
Mianshen Ge: Methodology, Formal analysis, Investigation, Data
curation, Writing - original draft, Writing - review & editing. Haibin
Zhou: Conceptualization, Methodology, Formal analysis, Writing -
original draft, Writing - review & editing, Funding acquisition. Yujun
Shen: Conceptualization, Supervision, Resources, Writing - review &
editing. Haibo Meng: Conceptualization, Methodology, Supervision,
Writing - review & editing, Funding acquisition. Ran Li: Resources,
Project administration. Jun Zhou: Writing - review & editing.
Hongsheng Cheng: Resources, Investigation. Xi Zhang: Writing - re-
view & editing. Jingtao Ding: Writing - review & editing. Jian Wang:
Writing - review & editing. Jiarui Wang: Resources, Writing - review &
editing.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influ-
ence the work reported in this paper.
Acknowledgement
The project was financially supported by the National Key R&D
Program of China (2017YFD0800202) and Open Project of Key
Laboratory of the Ministry of Agriculture and Rural Affairs
(KLFAW201801).
M. Ge, et al.
References
Albrecht, R., Le Petit, J., Calvert, V., Terrom, G., Périssol, C., 2010. Changes in the level of
alkaline and acid phosphatase activities during green wastes and sewage sludge co-
composting. Bioresour. Technol. 101 (1), 228–233.
Awasthi, M.K., Pandey, A.K., Khan, J., Bundela, P.S., Wong, J.W., Selvam, A., 2014.
Evaluation of thermophilic fungal consortium for organic municipal solid waste
composting. Bioresour. Technol. 168, 214–221.
Barrena, R., Vázquez, F., Sánchez, A., 2008. Dehydrogenase activity as a method for
monitoring the composting process. Bioresour. Technol. 99 (4), 905–908.
Bernal, M., Alburquerque, J., Moral, R., 2009. Composting of animal manures and che-
mical criteria for compost maturity assessment. A review. Bioresour. Technol. 100
(22), 5444–5453.
Brito, L., Coutinho, J., Smith, S., 2008. Methods to improve the composting process of the
solid fraction of dairy cattle slurry. Bioresour. Technol. 99 (18), 8955–8960.
Cahyani, V.R., Matsuya, K., Asakawa, S., Kimura, M., 2003. Succession and phylogenetic
composition of bacterial communities responsible for the composting process of rice
straw estimated by PCR-DGGE analysis. Soil Sci. Plant Nutr. 49 (4), 619–630.
Chen, J., Shi, L., Lliu, H., Yang, J., Guo, R., Chen, D., Jiang, X., Lliu, Y., 2017. Screening of
fermentation starters for organic fertilizer composted from chicken manure. Asian
Agric. Res. 9 (4), 92–98.
Chen, M., Wang, C., Wang, B., Bai, X., Gao, H., Huang, Y., 2019. Enzymatic mechanism of
organic nitrogen conversion and ammonia formation during vegetable waste com-
posting using two amendments. Waste Manage. 95, 306–315.
Criquet, S., Ferre, E., Farnet, A., 2004. Annual dynamics of phosphatase activities in an
evergreen oak litter: influence of biotic and abiotic factors. Soil Biol. Biochem. 36 (7),
1111–1118.
Cunha-Queda, A.C., Ribeiro, H.M., Ramos, A., Cabral, F., 2007. Study of biochemical and
microbiological parameters during composting of pine and eucalyptus bark.
Bioresour. Technol. 98 (17), 3213–3220.
Dolliver, H., Gupta, S., Noll, S., 2008. Antibiotic degradation during manure composting.
J. Environ. Qual. 37 (3), 1245–1253.
Du, J., Zhang, Y., Qu, M., Yin, Y., Fan, K., Hu, B., Zhang, H., Wei, M., Ma, C., 2019. Effects
of biochar on the microbial activity and community structure during sewage sludge
composting. Bioresour. Technol. 272, 171–179.
Gajalakshmi, S., Abbasi, S., 2008. Solid waste management by composting: state of the
art. Crit. Rev. Environ. Sci. Technol. 38 (5), 311–400.
García, C., Hernández, T., Costa, F., 1991. Study on water extract of sewage sludge
composts. Soil Sci. Plant Nutr. 37 (3), 399–408.
Guo, X., Lu, Y., Li, Q., 2016. Effect of adding flue gas desulphurization gypsum on the
transformation and fate of nitrogen during Composting. Compost Sci. Util. 24 (4),
230–237.
He, Y., Xie, K., Xu, P., Huang, X., Gu, W., Zhang, F., Tang, S., 2013. Evolution of microbial
community diversity and enzymatic activity during composting. Res. Microbiol. 164
(2), 189–198.
Huang, Y., Li, R., Liu, H., Wang, B., Zhang, C., Shen, Q., 2014. Novel resource utilization
of refloated algal sludge to improve the quality of organic fertilizer. Environ. Technol.
35 (13), 1658–1667.
Li, Y., Liu, Y., Yong, X., Wu, X., Jia, H., Wong, J.W., Wu, H., Zhou, J., 2020. Odor emission
and microbial community succession during biogas residue composting covered with
a molecular membrane. Bioresour. Technol. 297, 122518.
Liang, C., Das, K., McClendon, R., 2003. The influence of temperature and moisture
contents regimes on the aerobic microbial activity of a biosolids composting blend.
Bioresour. Technol. 86 (2), 131–137.
Ling, N., Sun, Y., Ma, J., Guo, J., Zhu, P., Peng, C., Yu, G., Ran, W., Guo, S., Shen, Q.,
2014. Response of the bacterial diversity and soil enzyme activity in particle-size
fractions of Mollisol after different fertilization in a long-term experiment. Biol.
Fertility Soils. 50 (6), 901–911.
Liu, H., Wang, L., Lei, M., 2019. Positive impact of biochar amendment on thermal bal-
ance during swine manure composting at relatively low ambient temperature.
Bioresour. Technol. 273, 25–33.
Lopez-Gonzalez, J.A., Suarez-Estrella, F., Vargas-Garcia, M.C., Lopez, M.J., Jurado, M.M.,
Moreno, J., 2015. Dynamics of bacterial microbiota during lignocellulosic waste
composting: Studies upon its structure, functionality and biodiversity. Bioresour.
Technol. 175, 406–416.
Ma, C., Hu, B., Wei, M.-B., Zhao, J.-H., Zhang, H.-Z., 2019. Influence of matured compost
inoculation on sewage sludge composting: Enzyme activity, bacterial and fungal
community succession. Bioresour. Technol. 294, 122165.
Mao, H., Lv, Z., Sun, H., Li, R., Zhai, B., Wang, Z., Awasthi, M.K., Wang, Q., Zhou, L.,
2018. Improvement of biochar and bacterial powder addition on gaseous emission
10
Bioresource Technology 304 (2020) 122928
and bacterial community in pig manure compost. Bioresour. Technol. 258, 195–202.
Meng, X., Liu, B., Zhang, H., Wu, J., Yuan, X., Cui, Z., 2019. Co-composting of the biogas
residues and spent mushroom substrate: Physicochemical properties and maturity
assessment. Bioresour. Technol. 276, 281–287.
Moharana, P.C., Biswas, D.R., 2016. Assessment of maturity indices of rock phosphate
enriched composts using variable crop residues. Bioresour. Technol. 222, 1–13.
Nascimento, C.V., Souza, F.H.M., Masui, D.C., Leone, F.A., Peralta, R.M., Jorge, J.A.,
Furriel, R.P.M., 2010. Purification and biochemical properties of a glucose-stimulated
β-D-glucosidase produced by Humicola grisea var. thermoidea grown on sugarcane
bagasse. J. Microbiol. 48 (1), 53–62.
Raut, M., William, S.P., Bhattacharyya, J., Chakrabarti, T., Devotta, S., 2008. Microbial
dynamics and enzyme activities during rapid composting of municipal solid waste–a
compost maturity analysis perspective. Bioresour. Technol. 99 (14), 6512–6519.
Shan, Y.N., Chen, J.H., Wang, L., Li, F., Fu, X.H., Le, Y.Q., 2013. Influences of adding
easily degradable organic waste on the minimization and humification of organic
matter during straw composting. J. Environ. Sci. Health Part B-Pestic. Contam. Agric.
Wastes. 48 (5), 384–392.
Shen, Y., Zhao, L., Meng, H., Hou, Y., Zhou, H., Wang, F., Cheng, H., Liu, H., 2016. Effect
of aeration rate, moisture content and composting period on availability of copper
and lead during pig manure composting. Waste Manage. Res. 34 (6), 578–583.
Talib, A.T., Mokhtar, M.N., Baharuddin, A.S., Sulaiman, A., 2014. Effects of aeration rate
on degradation process of oil palm empty fruit bunch with kinetic-dynamic modeling.
Bioresour. Technol. 169, 428–438.
Tiquia, S., 2005. Microbial community dynamics in manure composts based on 16S and
18S rDNA T-RFLP profiles. Environ. Technol. 26 (10), 1101–1114.
Tortosa, G., Castellano-Hinojosa, A., Correa-Galeote, D., Bedmar, E.J., 2016. Evolution of
bacterial diversity during two-phase olive mill waste (“alperujo”) composting by 16S
rRNA gene pyrosequencing. Bioresour. Technol. 224, 101.
Vargas-García, M., Suárez-Estrella, F., López, M., Moreno, J., 2010. Microbial population
dynamics and enzyme activities in composting processes with different starting ma-
terials. Waste Manage. 30 (5), 771–778.
Wang, H.-Y., Fan, B.-Q., Hu, Q.-X., Yin, Z.-W., 2011. Effect of inoculation with Penicillium
expansum on the microbial community and maturity of compost. Bioresour. Technol.
102 (24), 11189–11193.
Wu, S., He, H., Inthapanya, X., Yang, C., Lu, L., Zeng, G., Han, Z., 2017a. Role of biochar
on composting of organic wastes and remediation of contaminated soils-a review.
Environ. Sci. Pollut. Res. 24 (20), 16560–16577.
Wu, S., Shen, Z., Yang, C., Zhou, Y., Li, X., Zeng, G., Ai, S., He, H., 2017b. Effects of C/N
ratio and bulking agent on speciation of Zn and Cu and enzymatic activity during pig
manure composting. Int. Biodeterior. Biodegrad. 119, 429–436.
Xu, Z., Zhang, L., Li, J., 2012. Effect of different aeration rates on the composting process
and its enzymatic activities. J. Resid. Sci. & Technol. 9 (3), 107–112.
Xue, D., Huang, X., 2013. The impact of sewage sludge compost on tree peony growth and
soil microbiological, and biochemical properties. Chemosphere. 93 (4), 583–589.
Yan, L., Li, Z., Wang, G., Gao, Y., Wang, Y., Gu, J.-D., Wang, W., 2016. Diversity of
ammonia-oxidizing bacteria and archaea in response to different aeration rates
during cattle manure composting. Ecol. Eng. 93, 46–54.
Yang, F., Li, Y., Han, Y., Qian, W., Li, G., Luo, W., 2019. Performance of mature compost
to control gaseous emissions in kitchen waste composting. Sci. Total Environ. 657,
262–269.
Yao, X.-H., Min, H., Lü, Z.-H., Yuan, H.-P., 2006. Influence of acetamiprid on soil enzy-
matic activities and respiration. Eur. J. Soil Biol. 42 (2), 120–126.
Ye, S., Yan, M., Tan, X., Liang, J., Zeng, G., Wu, H., Song, B., Zhou, C., Yang, Y., Wang, H.,
2019a. Facile assembled biochar-based nanocomposite with improved graphitization
for efficient photocatalytic activity driven by visible light. Appl. Catal. B-Environ.
250, 78–88.
Ye, S., Zeng, G., Wu, H., Liang, J., Zhang, C., Dai, J., Xiong, W., Song, B., Wu, S., Yu, J.,
2019b. The effects of activated biochar addition on remediation efficiency of co-
composting with contaminated wetland soil. Resour. Conserv. Recycl. 140, 278–285.
Zhang, H., Li, G., Gu, J., Wang, G., Li, Y., Zhang, D., 2016. Influence of aeration on
volatile sulfur compounds (VSCs) and NH3 emissions during aerobic composting of
kitchen waste. Waste Manage. 58, 369–375.
Zheng, G., Chen, T., Jie, Y., Ding, G., Shen, Y., Niu, M., Liu, H., 2015. Impact of com-
posting strategies on the degradation of nonylphenol in sewage sludge.
Ecotoxicology. 24 (10), 2081–2087.
X.Z. Zhong S.P. Wang Z.Y. Sun Y.Q. Tang K. Kida Insight into the microbiology of nitrogen
cycle in the dairy manure composting process revealed by combining high-
throughput sequencing and quantitative PCR 2020 Bioresour. Technol. 122760.
Zucconi, F., 1981. Biological evaluation of compost maturity. Biocycle. 22, 27–29.