Asiaticoside Induces Osteogenic Differentiation of Human Periodontal Ligament Cells

through the Wnt Pathway

Atika Resti Fitri, Prasit Pavasant,† Supakarn Chamni,‡ and Piyamas Sumrejkanchanakij†

Mineralized Tissue Research Unit, Faculty of Dentistry, Chulalongkorn University,

Bangkok, Thailand
†
Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok,

Thailand
‡
Department of Pharmacognosy and Pharmaceutical Botany, Faculty of Pharmaceutical

Sciences, Chulalongkorn University, Bangkok, Thailand

Corresponding author:

Piyamas Sumrejkanchanakij

Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Henri-Dunant

Road, Pathumwan, Bangkok 10330, Thailand

Phone: +66-2-218-8885

Fax: +66-2-218-8870

E-mail: piyamas.s@chula.ac.th

This is the author manuscript accepted for publication and has undergone full peer review but has not
been through the copyediting, typesetting, pagination and proofreading process, which may lead to
differences between this version and the Version of Record. Please cite this article as doi:
10.1002/JPER.17-0471.

This article is protected by copyright. All rights reserved.

Running title: Asiaticoside activates Wnt/-catenin signaling

Summary: Asiaticoside stimulates osteogenic differentiation through the Wnt/-catenin

signaling of hPDL cells.

The number of words in the text: 3,015

The number of words in the abstract: 236

The number of figures: 5

The number of tables: 1

The number of cited references: 40

This article is protected by copyright. All rights reserved.

 Abstract

Background: Asiaticoside is a compound isolated from Herb Centella asiatica,

which has been shown to promote osteogenic differentiation of human periodontal ligament

(hPDL) cells. This study investigated the molecular mechanism underlying the asiaticoside-

induced osteogenic differentiation of hPDL cells. Methods: hPDL cells were incubated with

various concentrations of asiaticoside to test cell viability by MTT assay. The mRNA

expression levels were analyzed by using quantitative real-time polymerase chain reaction

(PCR). Osteogenic differentiation was determined by alkaline phosphatase activity assay and

alizarin red staining. The subcellular localization of β-catenin was analyzed by both

immunofluorescence and western blot. Results: The results showed that asiaticoside had no

effect on the cell viability at any of the tested concentrations. Real-time PCR revealed that

osterix (OSX) and dentin matrix protein1 (DMP1) mRNA were significantly enhanced by

asiaticoside treatment. Alkaline phosphatase activity and in vitro mineralization were also

significantly induced. Interestingly, asiaticoside dose-dependently increased WNT3A mRNA

expression, but not WNT5A and WNT10B. The activation of Wnt signaling was shown to

result in nuclear accumulation of -catenin as evaluated by immunofluorescence staining and

western blot analysis. Pre-treatment with recombinant human Dickkopf1 (rhDKK1) inhibited

asiaticoside-induced β-catenin nuclear translocation and osteoblast marker gene expression.

Moreover, rhDKK1 attenuated asiaticoside-induced DMP1 protein expression. Conclusion:

The data demonstrate that asiaticoside induces osteogenic differentiation of hPDL cells by

activating the Wnt/β-catenin signaling pathway. The findings suggest that asiaticoside could

be used as a novel therapeutic drug for periodontal tissue regeneration.

Keyword: Triterpenes; osteogenesis; Wnt signal transduction; DMP1 protein, human;

periodontal ligament; regeneration

This article is protected by copyright. All rights reserved.

Introduction

Under certain conditions, such as after the loss of periodontal tissue and/or bone, regeneration

of these tissues is required to restore structure and function.1 Nowadays, active compounds

obtained from different herbal plants are widely used as therapeutic drugs.2 One of these

herbs is Centella asiatica (L.) urban which belongs to the family of Apiaceae, commonly

found in some tropical areas.3 Asiaticoside is one of the main bioactive metabolites isolated

from C. asiatica. Asiaticoside is a triterpenoid saponin with a 30-carbon skeleton that forms a

pentacyclic configuration with a glycosylated side chain (Fig. 1A).2 C. asiatica herb can be

used as an alternative medication for the treatment of skin diseases such as burns,

hypertrophic scars and gastric mucosal lesions.4 It has been proven that asiaticoside promotes

wound healing and contains anti-inflammatory, anti-oxidative, and anti-ulcerative activities.5,6

In addition to that, asiaticoside was shown to induce osteogenic differentiation of human

periodontal ligament (hPDL) cells.7 The mechanisms underlying this induction are not known

yet.

Many signaling pathways have been investigated for their roles in osteogenic

differentiation and among these, Wnt signaling is notably required for osteoblast

differentiation.8 Disrupting the expression of Wnt-associated genes has a significant negative

impact on skeletal development and bone homeostasis.9 It has been reported that Wnt

signaling was upregulated and required for osteoblast differentiation of mesenchymal stem

cells.10 The deletion of β-catenin inhibited the Wnt-attenuated adipogenic differentiation and

Wnt-induced osteoblastogenesis.11 These findings stress the importance of Wnt/-catenin in

osteogenic differentiation.

This article is protected by copyright. All rights reserved.

 Signal activation of Wnt is initiated when Wnt ligands bind to Frizzled (FZD)

receptors and LDL-related protein (LRP) 5/6 coreceptors.12 The assembly of the ligands and

their receptors subsequently triggers two possibly distinct intracellular cascades, namely the

canonical (β-catenin dependent) and the noncanonical Wnt/Ca2+ pathway.13 The canonical

Wnt pathway relies mainly on the stabilization of cytosolic β-catenin leading to the

translocation of β-catenin to the nucleus.14 Nuclear β-catenin incorporates with T-cell

factor/lymphoid enhancer binding factor (TCF/LEF) transcription factors to switch on the

target gene transcription.13,14 This signal can be blocked by Dickkopf1 (DKK1), an

extracellular antagonist of Wnt signaling. DKK1 binds to the receptors of LRP6 and

kremen1/2 and prevents Wnt ligand binding.15,16

As mentioned above, in a previous study7 we showed that asiaticoside could induce

osteogenic differentiation of hPDL cells. The present study aims to clarify signaling involved

in this induction, focusing on the Wnt pathway.

This article is protected by copyright. All rights reserved.

MATERIALS AND METHODS

Cell isolation and culture

hPDL cells were isolated from periodontal ligament of the middle third of healthy third molar

roots as previously described.17 All procedures were approved by the Human Research Ethics

Committee (HREC-DCU 2016-011) from the Faculty of Dentistry, Chulalongkorn

University. All patients provided written informed consent for participation in this study.

hPDL cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with

10% fetal bovine serum, 2 mM L-glutamine, 100 units/ml penicillin, 100 mg/ml streptomycin

and 5 mg/ml amphotericin B.§ Cells from passage 3 to 6 were employed for all experiments.

The experiments were repeated three times using cells from three individual teeth.

Viability assay

MTT assay was performed by using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium

bromide (MTT)║ to determine the cell viability. hPDL cells were plated and treated with

asiaticoside¶ at concentrations of 10, 25, 50 and 100 µM in serum free medium. Cells

incubated with the vehicle (DMSO) were used as the control. After 3 days, the medium was

removed and substituted with MTT solution for about 30 minutes. The formazan crystal was

eluted by solution containing 1:9 dimethyl sulfoxide and glycine buffer. The optical density

was then measured at an absorbance of 570 nm using a microplate reader.# The viable cell

numbers were relatively calculated to the control.

RNA extraction and real time polymerase chain reaction (real time-PCR)

This article is protected by copyright. All rights reserved.

Cells were seeded and incubated without or with asiaticoside (10 and 100 µM) for 1 day. In

some experiments, hPDL cells were pre-treated with recombinant human DKK1 (rhDKK1)

at a concentration of 100 ng/ml for 1 hour prior to asiaticoside treatment. Trizol reagent †† was

used to extract the total cellular RNA. A total of 1 µg of RNA samples was converted to

cDNA by Improm II reverse transcriptase system.‡‡ SYBR green detection system§§ on Mini

Opticon real time PCR system║║ was performed to detect the target genes. The PCR protocol

was as follows: denaturation at 94 °C for 10 s, annealing at 60 °C for 10 s, and extension at

72 °C for 10 s for 45 cycles. Software¶¶ was used to analyze relative gene expression. The

oligonucleotide primers were demonstrated in Table 1.

Alkaline Phosphatase and Mineralization Assay

hPDL cells were cultured with asiaticoside and maintained in osteogenic induction medium

containing 50 μg/ml ascorbic acid## and 5 mM β-glycerophosphate. The medium was

changed every 2 days. Alkaline phosphatase (ALP) enzyme activity was measured after 10

days. The cells were lysed in alkaline lysis buffer and then incubated in the substrate mixture

of 2 mg/ml of p-nitrophenol phosphate,††† 0.1 M of 2-amino-2-methyl-1-propanol,‡‡‡ and 2

mM of MgCl2 at 37° C for 30 minutes. NaOH (50 mM) was added to stop the reaction. The

optical density was measured using a microplate reader# at an absorbance of 410 nm. BCA

assay§§§ was utilized to assess the amount of total cellular protein and used to normalize the

enzyme activity.

To analyze mineralized nodule formation, cells were fixed in cold methanol for 10

minutes, washed with deionized water, and stained with 1% Alizarin Red S solution║║║ at

room temperature for 5 minutes. The amount of deposited calcium was quantified by eluting

This article is protected by copyright. All rights reserved.

with 10% cetylpyridinium chloride monohydrate¶¶¶ in 10mM sodium phosphate. The

absorbance was measured using a microplate reader# at 570 nm.

Immunofluorescence staining

hPDL cells grown on coverslips were fixed in 4% paraformaldehyde and subsequently

permeabilized in 0.1% Triton x100 for 10 minutes. Non-specific binding was blocked with

3% bovine serum albumin in PBS for 1 hour at room temperature. Primary antibodies of

rabbit anti β-catenin### (1:250) and goat anti dentin matrix protein1 (DMP1) (1:100) were

diluted in 1% BSA in PBS and incubated overnight at 4o C. The cells were subsequently

incubated with biotinylated secondary antibody of goat anti-rabbit†††† (1:2000) and rabbit

anti-goat‡‡‡‡ (1:2000) for 1 hour at room temperature. Strep-FITC§§§§ was used to visualize the

target protein. Mounting medium with DAPI║║║║ was applied to preserve fluorescence of

cells and stain the nuclei. Images were analyzed using a fluorescent microscope.¶¶¶¶ In

negative controls, the cells were incubated without the primary antibody.

Protein isolation and Western blot

Cells were seeded in 100 mm culture dishes. Nuclear protein extraction was performed as

previously described,18 using extraction buffer A (10 mM HEPES, 1.5 mM MgCl2, 10 mM

KCL, 0.5 mM DTT) and buffer B (20mM HEPES, 25% (v/v) glycerol, 0.42M NaCl, 1.5mM

MgCl2, 0.2mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride (PMSF) 0.5 mM DTT).

Briefly, the cell pellet was resuspended in buffer A and allowed to stand for 10 min after

which 0.1% NP40 was added. After centrifugation, the supernatant was collected as the

This article is protected by copyright. All rights reserved.

cytoplasmic extract. The formed pellet was dissolved in buffer B and incubated on ice for 1

hour followed by centrifugation. The supernatant was designated as the nuclear extract.

The cell lysate was extracted by RIPA buffer containing proteinase inhibitors.####

Protein concentration was determined by BCA protein assay.§§§ A total of 30 g protein

extract in each sample was separated by 7.5% SDS–PAGE and blotted on PVDF membranes.

The membranes were blocked with 5% skimmed milk in 0.1% PBS/Tween20 for 1 hour at

room temperature. The blots were incubated with primary antibody of mouse anti β-

catenin (1:1000) and mouse anti-actin††††† (1:2000) overnight at 4o C and then incubated

with biotinylated-conjugated secondary antibody of goat anti-mouse‡‡‡‡‡ (1:2000) for 1 hour.

Further, the membrane was incubated with Strep-HRP.§§§§§ The signal was detected by an

enhanced chemiluminescence kit.║║║║║ Semi-quantitative assessment of band density was

performed using image analysis software equipped with a gel imaging machine.¶¶¶¶¶ The -

catenin band density was normalized to actin expression and the expression was calculated

relative to the control.

Statistical analysis

The data were reported as mean ± standard deviation relative to the control from three

independent experiments. For gene expression experiments, data were demonstrated as box

and whisker plots. The line in the box indicates median data, where the upper and lower

borders of the box indicate quartile 3 and 1, respectively. The upper and lower bars

demonstrated maximum and minimal values, respectively. Data were statistically analyzed by

a statistical software program.#####using one-way ANOVA followed by Tukey’s post hoc test

to compare the difference between groups A significant difference was considered when p

value < 0.05.

This article is protected by copyright. All rights reserved.

RESULTS

Asiaticoside does not affect the viability of hPDL cells

hPDL cells were incubated with asiaticoside in serum-free medium for 3 days. MTT assay

was employed to analyze the effect of asiaticoside on cell viability. Results showed that

asiaticoside did not affect the cell viability at any of the tested concentrations (Fig. 1B).

Microscopic analysis of the hPDL cells showed that the cell morphology remained

unchanged after asiaticoside treatment (Fig. 1C). Asiaticoside at 10 µM and 100 µM were

selected for subsequent experiments.

Asiaticoside induces osteogenic differentiation of hPDL cells

To determine the effect of asiaticoside in osteogenic differentiation, hPDL cells were cultured

in growth medium in the presence of asiaticoside (10 and 100 M) for 1 day. The mRNA

levels of osteogenic marker genes were determined (Fig. 2A). The expression of osterix

(OSX) was significantly upregulated by asiaticoside at 100 M, whereas that of runt-related

transcription factor2 (RUNX2) and osteocalcin (OCN) was not influenced. Further,

asiaticoside significantly enhanced expression of the positive regulator of bone

mineralization, DMP1, in a dose dependent manner.

hPDL cells were cultured in osteogenesis inducing medium without or with

asiaticoside (10 and 100 M). Asiaticoside, at a concentration 100 M, markedly enhanced

ALP activity and mineral deposition at day 10 and 14, respectively (Fig. 2B and 2C). At day

5, ALP activity was not different from control (data not shown).

The effect of asiaticoside on mRNA expression of Wnt-associated genes

This article is protected by copyright. All rights reserved.

To elucidate the possible molecular mechanism(s) involved in asiaticoside-induced hPDL cell

differentiation, the expression of Wnt-associated genes was analyzed. Asiaticoside

significantly upregulated WNT3A gene expression in a dose-dependent manner; the mRNA

levels of WNT5A and WNT10B were not altered. The Wnt antagonist, DKK1, was not

affected by asiaticoside treatment. However, AXIN2, a negative regulator of Wnt, was

significantly downregulated by asiaticoside (Fig. 3). The upregulation of WNT3A suggests

that asiaticoside may propagate the signal through the canonical pathway and specifically

target to WNT3A. Therefore, -catenin expression was analyzed subsequently.

Asiaticoside results in Wnt signaling activation

-catenin is a direct target of the canonical Wnt pathway,19 so we next verified the subcellular

localization of -catenin to elucidate the Wnt signaling activation by asiaticoside. Fluorescent

immunocytochemistry showed that β-catenin homogenously stained the cytoplasm of control

cells, while in asiaticoside-treated cells it predominantly localized to the nucleus (Fig.4A).

Lithium chloride (LiCl), an activator of canonical Wnt signaling, was included as a positive

control of -catenin nuclear accumulation and indeed also under these conditions β-catenin

was found primarily in the nuclei (Fig. 4A). Western blot analysis of nuclear and cytoplasmic

extracts confirmed an increase of -catenin in the nuclear fraction in asiaticoside-treated cells

compared with the control. The nuclear-to-cytoplasmic (N/C) ratio of -catenin was

significantly increased in asiaticoside-treated condition (Fig. 4B). Next we analyzed gene

expression of -catenin and found the expression was not different between the control and

asiaticoside-treated condition (Fig. 4C). Correspondingly, the total -catenin protein in a

whole cell lysate remained unchanged (Fig. 4D). These results indicate that asiaticoside

This article is protected by copyright. All rights reserved.

activates the canonical Wnt/β-catenin signaling pathway as demonstrated by the nuclear

translocation of cytoplasmic -catenin.

Recombinant human DKK1 attenuated asiaticoside-induced osteogenic marker gene

expression.

To find out whether the osteogenic differentiation initiated by asiaticoside was transmitted

through the Wnt/-catenin signaling pathway, rhDKK1 was used to block Wnt signal

transduction. Pre-treatment with rhDKK1 resulted in a decrease of -catenin translocation to

the nucleus following asiaticoside incubation (Fig. 5A). Further, asiaticoside-induced OSX

and DMP1 mRNA expression were abolished by pretreatment with rhDKK1 (Fig. 5B) and

the asiaticoside-induced DMP1 protein expression was notably suppressed by rhDKK1 as

shown with immunofluorescence staining (Fig. 5C). These data indicate that the Wnt/-

catenin pathway is involved in the asiaticoside-induced osteogenic differentiation of hPDL

cells.

This article is protected by copyright. All rights reserved.

DISCUSSION

The present data support and extend previous findings on the osteogenic induction of hPDL

cells by asiaticoside.7 Now we have elucidated some of the underlying mechanisms that play

an essential role in this process. Asiaticoside was shown to activate canonical Wnt signaling.

This pathway is crucial in the regulation of bone remodeling and the activation of Wnt leads

to osteoblast differentiation.11,20 The present study demonstrated that asiaticoside enhanced

OSX and DMP1 mRNA expression of hPDL cells, while the RUNX2 mRNA level was not

affected. This appears to be in line with another study in which it was demonstrated that

ectopic Wnt signaling enhanced ossification and the osteogenic marker OSX, but not

Runx2.10

Asiaticoside has been recognized for a long time as a wound healing agent. It was

found to inhibit the formation of hypertrophic scars and keloid via TGF-β/Smad pathway.6

The protective effect of asiaticoside against cognitive dysfunctions associated with diabetes

has been related to the PI3K/Akt/NF-κB pathway.21 We now show that asiaticoside typically

activated Wnt signaling as confirmed by an increased accumulation of β-catenin in the

nucleus. There are several data that support the important role of Wnt in osteoblast

differentiation. WNT3A-induced Alp expression was mediated by OSX and this effect could

be inhibited by DKK1 in murine dental follicle cells.22 It was also shown that WNT3A could

partially rescue Porphyromonas gingivalis LPS-reduced osteogenic activity of rat bone

marrow-derived mesenchymal cells.23 In periodontal tissues, WNT3A was higher expressed

on the tension side in the PDL tissue of tooth receiving orthodontic force.24 Hence, WNT3A

may be specifically targeted by asiaticoside action on hPDL cells.

Disruption of Wnt signaling leads to cementum devastation, root resorption and

arrested tooth root development.25,26 The elimination of Wnt signaling in the periodontal

This article is protected by copyright. All rights reserved.

complex as shown in Wntless (Wls) knockout mice results in a wider periodontal ligament

space and thinner alveolar bone due to a reduction in the expression of osteogenic proteins. 27

Wnt3a was recently reported to be involved in the promotion of mineralization by dental

follicle cells when co-cultured with Hertwig's epithelial root sheath cells in the presence of

decalcified dentin.28 These data clearly imply that Wnt signal is indispensable for the

homeostasis and regeneration of the periodontium.

The present study demonstrated that asiaticoside significantly induced DMP1

expression of hPDL cells. DMP1 is an extracellular matrix protein that belongs to the

SIBLING family,29 and appears to be essential for hard tissue mineralization. Mutation of

DMP1 gene resulted in hypomineralized dentin and affected bone maturation.30 Dmp1

knockout mice are characterized by a reduced amount of mineralized bone with a low mineral

content and an increased crystal size.31 Moreover, a reduction of OSX expression was

observed in odontoblasts of Dmp1 null mice.30 Dmp1-/- mice exhibited a widened predentin

and a hypomineralized dentin.32,33 Those findings proved that DMP1 is required for hard

tissue development and maturation.

Our study showed that pre-treatment with rhDKK1 inhibited the asiaticoside-induced

DMP1 expression, which again suggests a major role played by the Wnts. Direct support for

this is a study showing that,34 in the absence of β-catenin, DMP1 expression was suppressed

in human dental pulp cells, indicating this gene is a direct target of β-catenin signaling.

Together, these results illustrate the participation of Wnt signaling in the modulation of

DMP1 expression; a protein essential for tooth formation.

Some studies reported that inhibition of Wnt signaling could promote osteoblast

differentiation of PDL cells from periodontitis patients.35,36 This appears to be in contrast to

the results of the present study. An important difference between these and our studies is the

source of the cells. We isolated PDL cells from healthy patients, whereas in the other studies

This article is protected by copyright. All rights reserved.

the samples were collected from inflamed periodontal tissue. Although the microenvironment

of the cells definitely affects the response of the cells, whether this difference in origin

explains the different response, needs further investigation.

An important question is how asiaticoside interacts with the cells and how it exerts its

activity. Asiaticoside belongs to the group of triterpenoid saponins which are known as

amphiphilic agents with a hydrophilic sugar chain and a hydrophobic triterpene backbone.2

These properties enable saponins to interact with cholesterol in the plasma membrane of cells

forming insoluble complexes37 and thus creating aqueous pores. In this way cell permeability

is increased. The increase of membrane permeability enables ions and other molecules such

as proteins to enter the cell.38 The similarity in structure between saponin aglycones and

steroids may suggest another fascinating mode of saponin action: its binding to receptors of

glucocorticoids.38 Some reports showed that disruption of glucocorticoid signaling abrogated

the Wnt signals thus suppressing mesenchymal progenitor cells to differentiate towards the

osteoblast lineage.39,40 This suggests an association between glucocorticoid receptor and Wnt

signaling to regulate osteoblastogenesis. Hence, it is hypothesized that asiaticoside exerts its

activity by passing the plasma membrane and its possible recognition by intracellular

glucocorticoid receptors. Further studies are required to reveal the interaction of asiaticoside

and its target in or outside the cell.

CONCLUSION

In conclusion, we postulate the importance of Wnt/β-catenin in asiaticoside-induced

osteogenic differentiation of hPDL cells. These results suggest that asiaticoside can be

utilized as an alternative agent to induce periodontal tissue regeneration. Further studies are

required to precisely identify how asiaticoside interacts with hPDL cells and exerts its

This article is protected by copyright. All rights reserved.

biological activity. This knowledge could help to find new ways to accelerate the

regeneration of periodontium in clinical application.

ACKNOWLEDGMENTS

This study was supported by the Faculty Research Grant, Faculty of Dentistry,

Chulalongkorn University (DRF59018) to P.S., the Ratchadaphisek Sompoch Endowment

Fund 2013 of Chulalongkorn University (CU-56-334-HR) to S.C and P.P. and the Research

Chair Grant 2012 from the National Science and Technology Development Agency

(NSTDA). The Scholarship from the Graduate School, Chulalongkorn University to

commemorate 72nd Anniversary of his Majesty King Bhumibol Adulyadej is gratefully

acknowledged. The authors thank Assoc. Prof. Dr. Thanaphum Osathanon (Department of

Anatomy, Chulalongkorn University) for the helpful comments and editing of the manuscript.

CONFLICT OF INTEREST

The authors declare no potential conflicts of interest with respect to the authorship and/or

publication of this article.

This article is protected by copyright. All rights reserved.

References

1. Kao R T, Murakami S, Beirne O R. The use of biologic mediators and tissue engineering

in dentistry. Periodontol 2000 2009;50:127-153.

2. James J T, Dubery I A. Pentacyclic triterpenoids from the medicinal herb, Centella

asiatica (L.) Urban. Molecules 2009;14:3922-3941.

3. Gohil K J, Patel J A, Gajjar A K. Pharmacological Review on Centella asiatica: A

Potential Herbal Cure-all. Indian J Pharm Sci 2010;72:546-556.

4. Bylka W, Znajdek-Awizen P, Studzinska-Sroka E, Danczak-Pazdrowska A, Brzezinska

M. Centella asiatica in dermatology: an overview. Phytother Res 2014;28:1117-1124.

5. Lee J H, Kim H L, Lee M H, et al. Asiaticoside enhances normal human skin cell

migration, attachment and growth in vitro wound healing model. Phytomedicine

2012;19:1223-1227.

6. Tang B, Zhu B, Liang Y, et al. Asiaticoside suppresses collagen expression and TGF-

beta/Smad signaling through inducing Smad7 and inhibiting TGF-betaRI and TGF-

betaRII in keloid fibroblasts. Arch Dermatol Res 2011;303:563-572.

7. Nowwarote N, Osathanon T, Jitjaturunt P, Manopattanasoontorn S, Pavasant P.

Asiaticoside induces type I collagen synthesis and osteogenic differentiation in human

periodontal ligament cells. Phytother Res 2013;27:457-462.

8. Hayrapetyan A, Jansen J A, van den Beucken J J. Signaling pathways involved in

osteogenesis and their application for bone regenerative medicine. Tissue Eng Part B Rev

2015;21:75-87.

9. Monroe D G, McGee-Lawrence M E, Oursler M J, Westendorf J J. Update on Wnt

signaling in bone cell biology and bone disease. Gene 2012;492:1-18.

This article is protected by copyright. All rights reserved.

10. Day T F, Guo X, Garrett-Beal L, Yang Y. Wnt/beta-catenin signaling in mesenchymal

progenitors controls osteoblast and chondrocyte differentiation during vertebrate

skeletogenesis. Dev Cell 2005;8:739-750.

11. Cawthorn W P, Bree A J, Yao Y, et al. Wnt6, Wnt10a and Wnt10b inhibit adipogenesis

and stimulate osteoblastogenesis through a beta-catenin-dependent mechanism. Bone

2012;50:477-489.

12. Mikels A J, Nusse R. Wnts as ligands: processing, secretion and reception. Oncogene

2006;25:7461-7468.

13. Liu G, Vijayakumar S, Grumolato L, et al. Canonical Wnts function as potent regulators

of osteogenesis by human mesenchymal stem cells. J Cell Biol 2009;185:67-75.

14. Lerner U H, Ohlsson C. The WNT system: background and its role in bone. J Intern Med

2015;277:630-649.

15. Niida A, Hiroko T, Kasai M, et al. DKK1, a negative regulator of Wnt signaling, is a

target of the beta-catenin/TCF pathway. Oncogene 2004;23:8520-8526.

16. Pedersen L, Jensen M H, Krishna S. Dickkopf1--a new player in modelling the Wnt

pathway. PLoS One 2011;6:e25550.

17. Osathanon T, Ritprajak P, Nowwarote N, Manokawinchoke J, Giachelli C, Pavasant P.

Surface-bound orientated Jagged-1 enhances osteogenic differentiation of human

periodontal ligament-derived mesenchymal stem cells. J Biomed Mater Res A

2013;101:358-367.

18. Sumrejkanchanakij P, Tamamori-Adachi M, Matsunaga Y, Eto K, Ikeda M A. Role of

cyclin D1 cytoplasmic sequestration in the survival of postmitotic neurons. Oncogene

2003;22:8723-8730.

19. Kim J H, Liu X, Wang J, et al. Wnt signaling in bone formation and its therapeutic

potential for bone diseases. Ther Adv Musculoskelet Dis 2013;5:13-31.

This article is protected by copyright. All rights reserved.

20. Kramer I, Halleux C, Keller H, et al. Osteocyte Wnt/beta-catenin signaling is required

for normal bone homeostasis. Mol Cell Biol 2010;30:3071-3085.

21. Yin Z, Yu H, Chen S, et al. Asiaticoside attenuates diabetes-induced cognition deficits

by regulating PI3K/Akt/NF-kappaB pathway. Behav Brain Res 2015;292:288-299.

22. Nemoto E, Sakisaka Y, Tsuchiya M, et al. Wnt3a signaling induces murine dental

follicle cells to differentiate into cementoblastic/osteoblastic cells via an osterix-

dependent pathway. J Periodontal Res 2016;51:164-174.

23. Tang Y, Zhou X, Gao B, et al. Modulation of Wnt/beta-catenin signaling attenuates

periapical bone lesions. J Dent Res 2014;93:175-182.

24. Lu J, Duan Y, Zhang M, Wu M, Wang Y. Expression of Wnt3a, Wnt10b, beta-catenin

and DKK1 in periodontium during orthodontic tooth movement in rats. Acta Odontol

Scand 2016;74:217-223.

25. Zhang R, Yang G, Wu X, Xie J, Yang X, Li T. Disruption of Wnt/beta-catenin signaling

in odontoblasts and cementoblasts arrests tooth root development in postnatal mouse

teeth. Int J Biol Sci 2013;9:228-236.

26. Lim W H, Liu B, Hunter D J, Cheng D, Mah S J, Helms J A. Downregulation of Wnt

causes root resorption. Am J Orthod Dentofacial Orthop 2014;146:337-345.

27. Lim W H, Liu B, Cheng D, Williams B O, Mah S J, Helms J A. Wnt signaling regulates

homeostasis of the periodontal ligament. J Periodontal Res 2014;49:751-759.

28. Yang Y, Ge Y, Chen G, et al. Hertwig's epithelial root sheath cells regulate osteogenic

differentiation of dental follicle cells through the Wnt pathway. Bone 2014;63:158-165.

29. Feng J Q, Huang H, Lu Y, et al. The Dentin matrix protein 1 (Dmp1) is specifically

expressed in mineralized, but not soft, tissues during development. J Dent Res

2003;82:776-780.

This article is protected by copyright. All rights reserved.

30. Suzuki S, Haruyama N, Nishimura F, Kulkarni A B. Dentin sialophosphoprotein and

dentin matrix protein-1: Two highly phosphorylated proteins in mineralized tissues. Arch

Oral Biol 2012;57:1165-1175.

31. Ling Y, Rios H F, Myers E R, Lu Y, Feng J Q, Boskey A L. DMP1 depletion decreases

bone mineralization in vivo: an FTIR imaging analysis. J Bone Miner Res 2005;20:2169-

2177.

32. Sreenath T, Thyagarajan T, Hall B, et al. Dentin sialophosphoprotein knockout mouse

teeth display widened predentin zone and develop defective dentin mineralization similar

to human dentinogenesis imperfecta type III. J Biol Chem 2003;278:24874-24880.

33. Ye L, MacDougall M, Zhang S, et al. Deletion of dentin matrix protein-1 leads to a

partial failure of maturation of predentin into dentin, hypomineralization, and expanded

cavities of pulp and root canal during postnatal tooth development. J Biol Chem

2004;279:19141-19148.

34. Han N, Zheng Y, Li R, et al. beta-catenin enhances odontoblastic differentiation of

dental pulp cells through activation of Runx2. PLoS One 2014;9:e88890.

35. Liu Q, Hu C H, Zhou C H, et al. DKK1 rescues osteogenic differentiation of

mesenchymal stem cells isolated from periodontal ligaments of patients with diabetes

mellitus induced periodontitis. Sci Rep 2015;5:13142. doi: 10.1038/srep.2015.13142.

36. Liu N, Shi S, Deng M, et al. High levels of beta-catenin signaling reduce osteogenic

differentiation of stem cells in inflammatory microenvironments through inhibition of the

noncanonical Wnt pathway. J Bone Miner Res 2011;26:2082-2095.

37. Moses T, Papadopoulou K K, Osbourn A. Metabolic and functional diversity of

saponins, biosynthetic intermediates and semi-synthetic derivatives. Crit Rev Biochem

Mol Biol 2014;49:439-462.

This article is protected by copyright. All rights reserved.

38. Augustin J M, Kuzina V, Andersen S B, Bak S. Molecular activities, biosynthesis and

evolution of triterpenoid saponins. Phytochemistry 2011;72:435-457.

39. Zhou H, Mak W, Kalak R, et al. Glucocorticoid-dependent Wnt signaling by mature

osteoblasts is a key regulator of cranial skeletal development in mice. Development

2009;136:427-436.

40. Mak W, Shao X, Dunstan C R, Seibel M J, Zhou H. Biphasic glucocorticoid-dependent

regulation of Wnt expression and its inhibitors in mature osteoblastic cells. Calcif Tissue

Int 2009;85:538-545.

This article is protected by copyright. All rights reserved.

Figure 1

Chemical structure of asiaticoside (A) and its effect on hPDL cell viability. hPDL cells

were treated with asiaticoside (AC) at concentrations of 10, 25, 50, 100 µM in serum free

medium for 3 days. The cell viability was analyzed by MTT assay. Cells cultured with the

vehicle used to dissolve asiaticoside (DMSO) were used as the control. The data were

presented as the percentage of cell number relative to the control (B). Micrographs of hPDL

cells after incubation with asiaticoside for 1 day were taken with an original magnification

x100 (C). Scale bars in micrographs represent 50 µm.

This article is protected by copyright. All rights reserved.

Figure 2

Asiaticoside promotes osteogenic differentiation in hPDL cells. Cells were treated with

asiaticoside (AC) at concentrations of 10 and 100 µM in growth medium for 1 day. The

mRNA expression of osteoblastic gene markers was performed by quantitative real time PCR

(A). To investigate in vitro mineralization, cells were cultured in osteogenic medium in the

absence or presence of asiaticoside at concentrations of 10 and 100 µM. ALP activity was

measured at day 10 (B). In vitro mineral deposition was determined at day 14 using alizarin

red staining (upper panel). Micrographs were obtained with an original magnification x40

(lower panel). The amount of deposited calcium was quantified (C). Scale bars in

micrographs represent 100 µm. Asterisk (*) indicates a significant difference compared with

the control.

This article is protected by copyright. All rights reserved.

Figure 3

The influence of asiaticoside on mRNA expression of Wnt-associated genes in hPDL

cells. Cells were treated with asiaticoside (AC) at concentrations of 10 and 100 µM for 1 day

in growth medium. The mRNA levels of WNT3A, WNT5A, WNT10B, DKK1, and AXIN2

were measured by quantitative real time PCR. Asterisk (*) indicates a significant difference

compared with the control.

Figure 4

Asiaticoside activates Wnt signaling by hPDL cells. Cells were incubated with asiaticoside

(AC) at a concentration of 100 µM in growth medium. β-catenin accumulation was detected

by immunofluorescence staining after an incubation with asiaticoside for 1 day. A negative as

well as a positive (LiCl) control are also shown. Scale bars in micrographs represent 20 µm

(original magnification x400) (A). Levels of β-catenin from cytoplasmic and nuclear fraction

were confirmed by western blot analysis after cells were cultured with 100 µM asiaticoside

for 2 days. Actin was used as the internal control. Semi-quantitative assessment of β-catenin

nuclear/cytoplasmic (N/C) ratio was shown in 4B. The mRNA expression of β-catenin was

shown by quantitative real time PCR (C). Cells were cultured with 100 µM asiaticoside for 2

This article is protected by copyright. All rights reserved.

days and the whole cell lysate was subsequently extracted to examine the β-catenin

expression by western blot (D). Asterisk (*) indicates a significant difference compared with

the control.

Figure 5

DKK1 attenuates the asiaticoside-induced osteogenic marker gene expression in hPDL

cells. Cells were pre-treated with rhDKK1 for 1 hour prior to asiaticoside (AC) stimulation.

At 24 hours after treatment, β-catenin accumulation was examined using an

immunofluorescence staining (original magnification x1000) (A). The mRNA levels of OSX

and DMP1 were determined by real time PCR (B). DMP1 protein expression was detected by

immunofluorescence staining (original magnification x400) (C). Scale bars in micrographs

represent 20 µm. Asterisk (*) indicates a significant difference compared with the control.

Double asterisks (**) indicates a significant difference compared with asiaticoside group.

This article is protected by copyright. All rights reserved.

 Figure 5

A B
C DKK1 AC AC+DKK1
DMP1 OSX
-catenin

DAPI

Merge

C
C DKK1 AC AC+DKK1

DMP1

DAPI

Merge

This article is protected by copyright. All rights reserved.

§
Gibco, Carlsbad, CA, USA
║
USB Corporation, Cleveland, USA
¶
Catalog No. 43191, Sigma-Aldrich, St. Louis, MO, USA
#
Elx800; Biotek, Winooski, VT, USA

R&D system, Minneapolis, MN, USA
††
Thermo Fisher
‡‡
Promega, Madison, WI, USA
§§
Fast Start Essential DNA Green Master; Roche Diagnostic, USA
║║
Bio-Rad, Hercules, CA, USA
¶¶
CFX Manager software, Bio-Rad
##
Sigma-Aldrich

Sigma-Aldrich
†††
Invitrogen, USA
‡‡‡
Sigma-Aldrich
§§§
Thermo Fisher
║║║
Sigma-Aldrich
¶¶¶
Sigma–Aldrich
###
Catalog No. 9582, Cell signaling, Danvers, MA, USA

Catalog No. ab81985, Abcam, Cambridge, UK

††††
Millipore, Temecula, CA, USA
‡‡‡‡
Catalog No. B7014, Sigma-Aldrich
§§§§
Catalog No. S3762, Sigma-Aldrich

This article is protected by copyright. All rights reserved.

║║║║
Vectashield, Burlingame, CA, USA
¶¶¶¶
Axiovert 40CFL, Carl Zeiss, Gottingen, Germany
####
Sigma-Aldrich

Catalog No. 05-613, Cell signaling
†††††
Catalog No. MAB1501, Millipore
‡‡‡‡‡
Catalog No. B2763, Life technologies, Carlsbad, CA, USA
§§§§§
Catalog No. 3999, Cell signaling
║║║║║
Pierce, Thermo Fisher
¶¶¶¶¶
Valber Lourmat, Germany
#####
SPSS Version 22, Chicago, IL, USA

This article is protected by copyright. All rights reserved.

 Gene Primer sequence 5’ 3’ Accession No.
GAPDH Forward: CAC TGC CAA CGT GTC AGT GGT G NM_001289746.1
Reverse: GTA GCC CAG GAT GCC CTT GAG
AXIN2 Forward: GAG TGG ACT TGT GCC ACT TCA NM_004655.3
Reverse: GTT GGC TGG TGC AAA GAC ATA G
-catenin Forward: AAA ATG GCA GTG CGT TTA G NM_001904.3
Reverse: TTT GAA GGC AGT CTG TCG TA
DKK1 Forward: GCC TCA GGA TTG TGT TGT GC NM_012242.2
Reverse: ATC CGG CAA GAC AGA CCT TC
DMP1 Forward: ATG CCT ATC ACA ACA AAC C NM_004407.3
Reverse: CTC CTT TAT GTG ACA ACT GC
OCN Forward: CTTTGTGTCCAAGCAGGAGG NM_199173.4
Reverse: GCCGTAGAAGCGCCGATAGGC
OSX Forward: GCC AGA AGC TGT GAA ACC TC NM001300837.1
Reverse: GCT GCA AGC TCT GCA TAA CC
RUNX2 Forward: CAG ACC AGC AGC ACT CCA TA NM_001278478.1
Reverse: CAG CGT CAA CAC CAT CAT TC
WNT3A Forward: CTG TTG GGC CAC AGT ATT CC NM_033131.3
Reverse: GGG CAT GAT CTC CAC GTA GT
WNT5A Forward: TCA GGC ACC ATT AAA CCA CA NM_003392.4
Reverse: AAT TCA CAG AGG TGT TGC AGC
WNT10B Forward: TTG TGC AGT CGG GCT CTA AG NM_003394.3

Table 1. The oligonucleotide primers

This article is protected by copyright. All rights reserved.

 Reverse: GAT GTG CAG ACC CTG AAG CG

This article is protected by copyright. All rights reserved.