Cytokine 63 (2013) 27–35

Contents lists available at SciVerse ScienceDirect

Cytokine
journal homepage: www.journals.elsevier.com/cytokine

Vitamin D3 supplementation modulates inflammatory responses

from the muscle damage induced by high-intensity exercise in SD rats
Munji Choi a, Hyon Park b, Seongsuk Cho c, Myoungsook Lee a,⇑
a
Dept. of Food and Nutrition and Research Institute of Obesity Sciences, Sungshin Women’s University, Seoul, Republic of Korea
b
Exercise Nutrition & Biochem Lab, Kyung Hee University, Yongin, Republic of Korea
c
Taeneung National Training Center of Korean Olympic Committee, Seoul, Republic of Korea

a r t i c l e i n f o a b s t r a c t

Article history: Vitamin D is an important factor for calcium and phosphorus homeostasis. A negative relationship has
Received 8 May 2012 been observed between vitamin D status and diseases such as cancer, arthritis, diabetes, and muscle fiber
Received in revised form 15 March 2013 atrophy. However, the relationship between vitamin D and prevention of skeletal muscle damage has not
Accepted 19 March 2013
been clearly elucidated. The purpose of this study was to investigate the effects of vitamin D on exercise-
Available online 10 May 2013
induced muscle changes. Rats were divided into 3 groups: (1) sedentary control (C: n = 10), (2) high-
intensity exercise (HE: n = 10), and (3) high-intensity exercise with vitamin D supplementation (HED:
Keywords:
n = 10; i.p. 1000 IU/kg body weight). Rats were trained for 30 min/day on treadmills (5 days/week for
Vitamin D3
High-intensity running
8 weeks) with the running speed gradually increased up to 30 m/min at a 3° incline. At the end of the
Skeletal muscle damage training period, the running speed was 38 m/min at a 5° incline. The high-intensity exercise significantly
Pro-inflammatory cytokines increased plasma creatine kinase (CK) and lactate dehydrogenase (LDH) activity. In addition, IL-6 and
TNF-a levels as well as phosphorylation of AMPK, p38, ERK1/2, IKK, and IjB were significantly increased.
Vitamin D-treated rats showed a significant decrease in plasma CK level, phosphorylation of AMPK, p38,
ERK1/2, IKK, and IjB, and gene expression of IL-6 and TNF-a. Furthermore, the protein expression of vita-
min D receptor (VDR) was highly increased in the muscles of HED-treated rats, respectively. Therefore,
we concluded that vitamin D may play a pivotal role in exercise-induced muscle damage and inflamma-
tion through the modulation of MAPK and NF-jB involved with VDR.
Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction
Muscle tissues may be damaged following high-intensity exer-
cise. High-intensity exercise results in structural damage of muscle
cells, as evidenced by an increase in the plasma activity of cytosolic
enzymes such as creatine kinase (CK) and lactate dehydrogenase
(LDH) [1–3]. Furthermore, inflammation during exercise is linked
to muscle damage. When exercising at high intensity, leukocytes
stimulate the release of pro-inflammatory cytokines such as TNF-
a, IL-8, and IL-6.
The physiological conditions such as influx of intracellular cal-
cium, ROS accumulation, and mitogen-activated protein kinases
(MAPKs) activation have all been shown to activate NF-jB, leading
to the hypothesis that exercise may also activate NF-jB [4,5] NF-jB
is one of the signaling molecules activated during exercise and most
genes activated by NF-jB have been shown to be pro-inflammatory
and to be involved in the inflammatory process [6]. High-intensity
exercise also activates MAPK, stress-activated proteins, such as
⇑ Corresponding author. Tel.: +82 2 920 7457; fax: +82 2 920 2078.
E-mail addresses: mlee@sungshin.ac.kr, drmlee79@gmail.com (M. Lee).
p38 and ERK1/2 [7] p38 MAPK shares common kinase substrates
with ERK1/2 is rapidly activated in rat and mouse models of exercise
[8–10], as well as in both trained and untrained human skeletal
muscles following acute submaximal cycling [11,12] and marathon
running exercise [13]. Exercise-induced changes are not limited to
the activation of the ERK signaling cascade, as activation of p38
MAPK has also been observed [9,10,13]. It is reported that MAPK
may fulfill an important function as a cellular intermediary coupling
perceived alterations in stress with adaptive changes in oxidative
stress, metabolic actions, and gene regulation [7].
Vitamin D3 (cholecalciferol) is synthesized by ultraviolet irradi-
ation (UV) in the skin from its precursor 7-dehydrocholesterol or
ingested with food. The active form of vitamin D, 1,25(OH)2D3, is
an important factor for calcium and bone homeostasis that acts
by binding to the vitamin D receptor (VDR), which belongs to the
nuclear receptor superfamily. From epidemiologic and clinical
studies, a negative relationship has been observed between vita-
min D status and diseases such as cancer [14], arthritis, diabetes
[15], muscle fiber atrophy, and cardiovascular disease [16]. A
strong correlation has been described between low serum
25(OH)D levels and higher rates and longer duration of generalized

1043-4666/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.cyto.2013.03.018
28 M. Choi et al. / Cytokine 63 (2013) 27–35
muscle aches and pains [17]. In addition, vitamin D may improve
muscle strength through a highly specific nuclear receptor in mus-
cle tissues [18]. Recently, vitamin D was shown to potentially im-
prove athletic performance and protect muscle damage in vitamin
D-deficient athletes [18]. Other study in healthy endurance-trained
runners has shown the inverse association between 25(OH)D and
TNF-a concentrations [19]. However, one study reported a not sig-
nificant changes in TNF-a and IL-6 level in high dose vitamin D
supplementation-healthy overweight and obese subjects following
a 12-week progressive resistance exercise training program [20].
The physiologic relevance of such vitamin D effects in vivo has
not been proved yet, nor has the role of the VDR.
Therefore, we hypothesized that vitamin D3 would be beneficial
for skeletal muscles damages from high-intensity exercise and we
suggested that one of reasons would be the modulation of inflam-
mation via the MAPK-NF-jB signaling involved the VDR.
2. Materials and methods
2.1. Animals and exercise protocol
Thirty male Sprague–Dawley rats weighting 120–130 g
(4 weeks old) were purchased from Nara Biotech (Seoul, Korea).
Rats were fed a standard chow diet (Purina Mills Inc., Korea) and
tap water ad libitum and housed in a room maintained at
23 ± 2 °C with a 12-h light–dark cycle for 8 weeks. The treatment
of the rats and the study protocol were approved by the ethical
committee of Sungshin University and carried out in an ethical
manner by following the guidelines provided. Rats were randomly
divided into 3 groups: a sedentary control group (C, n = 10); high-
intensity exercise group (HE, n = 10); and high-intensity exercise
plus vitamin D3 supplementation group (HED, n = 9). Body weight
did not differ between the groups at the beginning of the experi-
ment. Rats in the vitamin D3 treatment group were injected intra-
peritoneally with 25 lg cholecalciferol (Sigma, St. Louis, Mo) per kg
of body weight, is equivalent to 1000 IU vitamin D3 once a day for
8 weeks. This concentration of vitamin D3 was decided by rat’s
requirement when Ca and P are fed in adequate amounts [21].
Vitamin D3 was diluted in 100% propylene glycol (Junsei Chemical,
Tokyo, Japan). Rats were trained for 30 min/day (5 days/week for
8 weeks) using a rodent treadmill (Dual treadmill; SK-DTR8L,
Seoul, Korea). Max running speed was increased up to 32, 34, 36,
and 38m/min at the beginning of 2nd, 4th, 6th, and 8th week of
training at a 3°incline. So, at the end of the training period, running
speed was 38m/min at a 5°incline.
2.2. Sample collection
After a rest period of 18 h after the last workout session, the rats
were weighed and anesthetized with diethyl ether. Blood was rap-
idly collected from the abdominal aorta and then centrifuged
(2000 rpm, 15 min, 4 °C) to isolate the plasma, which was stored
at 80 °C until further analyses. The soleus and gastrocnemius mus-
cles were removed, immediately soaked in liquid nitrogen, and
stored at 80 °C.
2.3. Creatine kinase activity assay
CK activity was measured using a CK kit (Bio Assay, CA, USA)
according to the manufacturer’s instructions. The CK assay kit is
based on enzyme-coupled reactions in which creatine phosphate
and ADP are converted to creatine and ATP by CK; the generated
ATP is used to phosphorylate glucose by hexokinase to generate
glucose-6-phosphate, which is then oxidized by NADP in the pres-
ence of glucose-6-phosphate dehydrogenase. The produced
NADPH, measured at 340 nm, is proportionate to the CK activity
in the sample. Data are reported as U/L plasma. One unit of CK will
transfer 1 lmol of phosphate from phosphocreatine to ADP per
min at pH 6.0.
2.4. Lactate dehydrogenase activity assay
LDH activity was measured using a LDH kit (Bio Assay, CA, USA)
according to the manufacturer’s instructions. The LDH assay is
based on the reduction of the tetrazolium salt MTT in a NADH-cou-
pled enzymatic reaction to a reduced form of MTT that exhibits an
absorption maximum at 565 nm. The intensity of the purple color
formed is directly proportional to the enzyme activity. Data are re-
ported as IU/L plasma. One unit (IU) of LDH will catalyze the con-
version of 1 lmol of lactate to pyruvate per min at pH 8.2.
2.5. Cytokine assay
Skeletal muscle tissue was homogenized in 10 volumes of an
ice-cold buffer (10 mM HEPES, 1.5 mM magnesium chloride,
10 mM potassium chloride, 0.5 mM dithiothreitol, and 0.05% Non-
idet P-40) containing a protease inhibitor cocktail (Pierce, Rock-
ford, IL). Homogenates were centrifuged at 14,000 rpm for
10 min at 4 °C; the supernatants were removed. The assay was per-
formed according to the manufacturer’s instructions (BioLegend,
San Diego, CA). The change in color was measured at a wavelength
of 450 nm using a microplate reader (Multiskan Spectrum; Thermo
Electron Co., Vantaa, Finland). Measurements were performed in
duplicate. Cytokine levels are expressed as pg/mg total protein.
2.6. Protein expression analysis by western immunoblot
Soleus and medial gastrocnemius muscles were collected and
rinsed in PBS. Cytoplasmic and nuclear extracts of tissues were iso-
lated using NE-PER nuclear and cytoplasmic extraction reagents
(Pierce, Rockford, IL) and the Halt™ protease and phosphate inhib-
itor single-use cocktail (Pierce). Samples were boiled at 95 °C for
5 min in 2 Laemmli sample buffer (0.125 M Tris–HCl [pH 6.8],
4% SDS, 20% glycerol, 10% 2-mercaptoethanol, and 0.004% bromo-
phenol blue). Boiled samples were run on 8–10% SDS–polyacryl-
amide gels (20–40 lg/lane). The gels were blotted on
nitrocellulose membranes (Bio-Rad, Hercules, CA) and stained with
Ponceau red (Sigma Chemical, St. Louis, MO) to confirm equal load-
ing and transferring of proteins to the membrane in each lane. The
membranes were blocked in 5% skim milk or BSA in Tris-buffered
saline with 0.1% Tween 20 and probed with corresponding anti-
bodies against NFjB, phosphorylated IjB, IjB, phosphorylated
IKK-a/b, IKKb, phosphorylated AMPK, AMPK, phosphorylated p38
MAPK, p38 MAPK, phosphorylated ERK1/2 (all from Cell Signaling,
Danvers, MA), ERK1/2 (Santa Cruz Biotechnology, Santa Cruz, CA),
and VDR (Abcam, Cambridge, MA) for 3 h. Additionally, as a second
means of confirming equal loading, the membranes were also
probed for a-tubulin (Cell Signaling) and lamin B1 (Abcam, Cam-
bridge, MA). Secondary antibodies were conjugated to horseradish
peroxidase (Enzo Life Sciences, Farmingdale, NY), and the signals
were developed by chemiluminescence (BioFX, Owings Mills,
MD). The signals were visualized by exposing the membranes to
X-ray films (Agfa, Mortsel, Belgium) and quantified using an Image
J Analyzer (NIH, Bethesda, USA).
2.7. Gene expression analysis by real-time PCR
For gene expression analysis, total RNA was isolated from medial
gastrocnemius muscles using TRIzol Reagent (Favorgen Bio-
tech Corp., Taiwan); 2 lg of total RNA was treated with RNase-
free DNase I (Qiagen, Valencia, CA) to avoid genomic DNA
 M. Choi et al. / Cytokine 63 (2013) 27–35
contamination. Samples with a 260:280 nm absorbance ratio of
P1.9 were reverse-transcribed using the ReverTra Ace qPCR RT
Kit (Toyobo, Osaka, Japan). PCR amplification of the cDNA template
was performed using the Thunderbird SYBR qPCR mix (Toyobo, Osa-
ka, Japan) on a MJ Mini-Opticon thermocycler (Bio-Rad Laborato-
ries, Hercules, CA, USA). PCR conditions were 95 °C for 1 min
followed by 40 cycles of amplification consisting of 95 °C for 10 s,
58 °C for 10 s, and 72 °C for 30 s. Each value was normalized to GAP-
DH as the housekeeping gene to control for variations in the amount
of input cDNA. Table 1 shows the sequences of PCR primers used in
this study. The relative expression level of the genes was calculated
using the DDCt method compared to the C group.
2.8. Lipid profiles and protein concentration
Triglyceride (TG) and total cholesterol (TC) (Boeringer mann-
heim, Germany) were measured by enzymatic assays in plasma
and liver. The protein content of the samples was measured by
the method of Bradford; BSA was used as standard [22].
2.9. Statistical analysis
Analysis was performed using SPSS v. 18.0 (SPSS, Chicago, USA).
Statistical significance was assessed using 1-way analysis of vari-
ance with Duncan’s test. Any value of less than 0.05 was consid-
ered significant. All values are shown as mean ± SE.
3. Results
3.1. Animal characteristics
The animals were 13 weeks of age at the end of the study. Initial
and final body weight, weight gain, and the concentrations of plas-
ma and hepatic total triglyceride and cholesterol are shown in Ta-
ble 2. Significantly (p = 0.000) less weight gain was observed in the
exercise groups (HE group: 288.50 ± 6.99 g; HED group:
286.00 ± 7.20 g) as compared with that in the C group
(338.90 ± 10.45 g). The concentration of plasma total TG in both
exercise groups was significantly lower as compared with that in
the C group. There were no significant differences in hepatic lipid
profiles between the groups.
3.2. Plasma muscle damage markers
The activity of plasma CK and LDH, well-known muscle damage
markers, is shown in Fig. 1. The plasma CK activity of HE rats
(260.44 ± 12.76 U/L) was significantly increased as compared with
that of the C group (161.04 ± 19.73 U/L). Furthermore, plasma CK
activity was significantly decreased by vitamin D3 treatment in
the HED group as compared with that in the HE group. The plasma
LDH activity in HE rats (134.83 ± 14.19 IU/L) was significantly in-
creased as compared with that in the C group (75.13 ± 7.51 IU/L).
However, treatment with vitamin D3 (102.09 ± 23.51 IU/L) slightly
lowered LDH activity as compared with that in the HE group.
3.3. Cytokine analysis
Pro-inflammatory cytokines are important mediators of tissue
damage. The amount of IL-6 and TNF-a derived from skeletal mus-
cles is shown in Fig. 2. High-intensity exercise significantly in-
creased the production of inflammation-associated cytokines,
including IL-6 and TNF-a, derived from the soleus muscle. Treat-
ment with vitamin D3 significantly reduced exercise-induced pro-
duction of soleus TNF-a, whereas treatment with vitamin D3 was
associated with a small but statistically insignificant decrease in
29
Table 1
Primers used for real-time PCR.
Primers Sequences (50 –30 )
GAPDH Forward GTGAAGCTCATTTCCTGGTAT
Reverse CAGGGTTTCTTACTCCTTGG
TNF-a Forward TGAACTTCGGGGTGATCG
Reverse GGGCTTGTCACTCGAGTTTT
IL-6 Forward TGATTGTATGAACAGCAGTGAT
Reverse CCAGAAGACCAGAGCAGAT
IL-6. However, there was no significant difference in the cytokine
concentrations derived from the medial gastrocnemius muscle
and plasma (Figs. 2 and 3).
3.4. VDR protein expression
Western immunoblot analysis of nuclear VDR protein expres-
sion is shown in Fig. 4. VDR antibody bands were recognized at
48 kda standard. Only the HED group, treated with vitamin D3,
showed a significant increase in VDR protein expression in both
the soleus and medial gastrocnemius muscle.
3.5. MAPK pathway protein expression
To examine whether the expression of MAPK pathway proteins
was changed, homogenates of skeletal muscles from rats were as-
sessed by western immunoblot analysis with anti-phospho-AMPK,
AMPK, phospho-p38 MAPK, p38 MAPK, phospho-ERK1/2, and
ERK1/2 antibodies. As shown in Fig. 5, high-intensity exercise
strongly increased the phosphorylation of AMPK in both the soleus
and medial gastrocnemius muscle. Further, the phosphorylation of
p38 MAPK and ERK1/2 was significantly increased in both the soleus
and medial gastrocnemius muscle of rats in the HE group. In the
HED group, the phosphorylation of AMPK, p38 MAPK, and ERK1/2
was significantly decreased as compared with that in the HE group.
These findings indicate that vitamin D3 treatment attenuated the in-
crease in AMPK, p38 MAPK, and ERK1/2 phosphorylation.
3.6. NF-jB pathway protein expression
To examine whether the expression of NF-jB pathway proteins
was changed, homogenates of skeletal muscles from rats were as-
sessed by western immunoblot analysis with anti-NF-jB, phos-
pho-IjB, IjB, phospho-IKK, and IKK antibodies. Fig. 6 shows the
expression of NF-jB pathway proteins in skeletal muscle cytoplas-
mic and nuclear extracts. There was no significant difference in the
expression of cytoplasmic NF-jB in either the soleus or medial gas-
trocnemius muscle. High-intensity exercise significantly increased
the nuclear translocation of p65 NF-jB in both the soleus and med-
ial gastrocnemius muscle. Further, high-intensity exercise induced
the degradation of IjB in the medial gastrocnemius muscle and the
phosphorylation of IKK in the soleus muscle. Treatment with vita-
min D3 significantly decreased the nuclear translocation of p65 NF-
jB in the medial gastrocnemius muscle, whereas it only slightly,
but not significantly, decreased the nuclear translocation of p65
NF-jB in the soleus muscle. Vitamin D3 also significantly inhibited
high-intensity exercise-induced degradation of IjB in both the so-
leus and medial gastrocnemius muscle. In the medial gastrocne-
mius muscle, the phosphorylation of IKK was decreased as
compared with that in the HE group. These results indicate that
vitamin D3 blunts NF-jB activity in skeletal muscles.
30 M. Choi et al. / Cytokine 63 (2013) 27–35

Table 2
Animal characteristics.

C (n = 10) HE (n = 10) HED (n = 9)

Initial body weight (g) 124.90 ± 1.46 125.80 ± 1.26 124.56 ± 2.38
Final body weight (g) 463.80 ± 9.99b 414.30 ± 7.12a 410.56 ± 8.45a
Weight gain (g) 338.90 ± 10.45b 288.50 ± 6.99a 286.00 ± 7.20a
Plasma total triglyceride level (mg/dL) 88.86 ± 1.50b 83.68 ± 1.19a 84.02 ± 1.88a
Plasma total cholesterol level (mg/dL) 85.65 ± 1.95b 81.58 ± 2.04ab 77.67 ± 1.75a
Hepatic total triglyceride level (mg/dL/mg protein) 8.29 ± 0.77 8.70 ± 1.62 8.78 ± 0.85
Hepatic total cholesterol level (mg/dL/mg protein) 3.95 ± 0.37 3.76 ± 0.28 4.15 ± 0.60

Values are means ± SE. C, sedentary control group; HE, high-intensity exercise group; HED, high-intensity exercise plus vitamin D3 administration group. Different letters
indicate statistically significant differences between groups. Data were analyzed by 1-way analysis of variance with Duncan’s test.

300
b (A) 8
SOL
b
250 7 GAS
a
ab

IL-6 (pg/mg protein)

6
200 a a
CK(U/L)

5
150
4
100
3
50
2

0 1
C HE HED
0
160 b C HE HED
140
ab
120
(B) 8
SOL b
7 GAS
TNF-alpha (pg/mg protein)

100
LDH(UI/L)

a
a 6
80 a
60 5

40 4

20
0
C HE HED
Fig. 1. Plasma creatine kinase (CK) and lactate dehydrogenase (LDH) activity in the
plasma of rats. Each bar represents the mean ± SE. C, sedentary control group; HE,
high-intensity exercise group; HED, high-intensity exercise plus vitamin D3
administration group. Different letters indicate statistically significant differences
between groups. Data were analyzed by 1-way analysis of variance with Duncan’s
test.
3.7. Gene expression analysis by real-time PCR
The expression of IL-6 and TNF-a mRNA derived from the med-
3
2
1
0
C HE HED
Fig. 2. The amount of IL-6 (A) and TNF-a (B) derived by ELISA from the soleus (SOL)
and medial gastrocnemius (GAS) muscles of rats. Cytokines were normalized to the
protein concentration of the sample, as determined by the Bradford protein assay.
Each bar represents the mean ± SE. C, sedentary control group; HE, high-intensity
exercise group; HED, high-intensity exercise plus vitamin D3 administration group.
Different letters indicate statistically significant differences between groups. Data
were analyzed by 1-way analysis of variance with Duncan’s test.

ial gastrocnemius muscle is shown in Fig. 7. high-intensity exercise

significantly increased IL-6 and TNF-a mRNA expression, by 271%
and 199%, respectively, in the medial gastrocnemius muscle when
compared to the C group. The IL-6 and TNF-a mRNA content of the
HED group was lower than that of the C group (t-test; p = 0.001).
Vitamin D3 significantly reduced high-intensity exercise-induced
gene expression of IL-6 and TNF-a mRNA.
4. Discussion
In this study, we found that vitamin D3 treatment modulates
the elevation in muscle damage markers such as CK and the pro-
duction of pro-inflammatory cytokines induced by high-intensity
exercise. Vitamin D-treated rats showed a significant decrease in
plasma CK level, phosphorylation of AMPK, p38, ERK1/2, IKK, and
IjB, and gene expression of IL-6 and TNF-a. Furthermore, vitamin
D receptor (VDR) protein expression was highly increased in the
muscles of HED rats. The mechanism of MAPK and NF-jB activa-
tion involved the VDR in muscle of exercise-trained rats may be
suggested. In this study, we focused in comparison of muscle fiber
types, soleus and the medial gastrocnemius muscle. Soleus muscle,
as a slow twitch, which is predominantly composed of mitochon-
dria-rich type I fibers and mainly uses oxidative metabolism for
energy production, whereas the medial gastrocnemius muscle, as
a mixed twitch, is composed of mixed type I and II fibers and has
a lower volume of mitochondria.
Vitamin D regulates not only calcium and phosphorus homeo-
stasis but also immunomodulatory action by regulating the activity
of immune cells such as macrophages and T cells [23,24]. The
 M. Choi et al. / Cytokine 63 (2013) 27–35 31

(A) 18 the inflammation factors, are still unclear [24,25]. Skeletal muscle
damage caused by high-intensity exercise involves diverse mecha-
16
Plasma IL-6 (pg/mL) nisms. Upregulation of pro-inflammatory cytokines such as IL-6
14
and TNF-a increases the activation of NF-jB, leading to the expres-
12 sion of the E3 enzyme MuRF-1 and protein degradation [26], and
10 finally increasing CK levels in the circulation as a response to myo-
8 fibrillar disintegration and also released due to the increase in per-
6
meability due to inflammation. The plasma activity of CK and LDH,
well-known biomarkers of muscle tissue damage [27,28], was sig-
4
nificantly increased after our study exercise protocol. Our data
2 indicate that vitamin D3 treatment prevents the elevation in plas-
0 ma CK levels. Assy et al. [29] reported that adding vitamin D to the
C HE HED therapy of patients with chronic HBV genotype D infection may
significantly improve muscle pain and decrease CK elevation.
14
(B) The concentration of IL-6 and TNF-a derived from the soleus
12 muscle was increased in the HE group. Furthermore, our results
α (pg/mL)

agree with experimental data showing that vitamin D is able to

10 suppress the production of TNF-a [30,31]. In vitro studies have
shown that the release of TNF-a can be suppressed by calcitriol
8
Plasma TNF-α

in a dose-dependent fashion [32]. However, no significant differ-

6 ences in IL-6 and TNF-a protein levels in the medial gastrocnemius
muscle were observed between the 3 groups. Therefore, we exam-
4
ined the expression of IL-6 and TNF-a mRNA by real-time PCR in
2 the medial gastrocnemius muscle. We observed a decrease in
p65 NF-jB nuclear translocation in the gastrocnemius muscle of
0 vitamin D3-treated rats. It appears that vitamin D3 may suppress
C HE HED
the production of cytokines. We also found higher IL-6 and TNF-
Fig. 3. The amount of IL-6 (A and C) and TNF-a (B and D) derived by ELISA from the a contents in the soleus muscle than the medial gastrocnemius
plasma of rats. Each bar represents the mean ± SE. C, sedentary control group; HE, muscle. It has been reported that intramuscular triglyceride level
high-intensity exercise group; HED, high-intensity exercise plus vitamin D3 in the soleus muscle is higher than that in the gastrocnemius mus-
administration group. Data were analyzed by 1-way analysis of variance with cle in exercise-trained rats [33]. Thus, the higher IL-6 and TNF-a
Duncan’s test.
concentrations observed, especially those in the soleus muscle
and the exercise-stressed intramuscular triglyceride may contrib-
ute to the production of pro-inflammatory cytokines. We also
SOL VDR found no significant difference in the amount of plasma IL-6 and
Lamin B1 TNF-a. However, One study reported that a daily 83-lg vitamin
D supplement significantly decreased plasma IL-6 and TNF-a con-
centrations in overweight subjects with inadequate vitamin D sta-
GAS VDR tus [34]. Several studies have shown that chronic exercise is
associated with systemic anti-inflammatory effects, with a reduc-
Lamin B1 tion in pro-inflammatory markers such as IL-6 and TNF-a in the
C HE HED plasma [35–37]. Exercise training for 8 weeks may lower the basal
plasma concentration of IL-6 and TNF-a compared with that of
300 sedentary rats. A new study has shown that IL-6 appears to be re-
SOL
quired for exercise-induced decrease in TNF-a mRNA expression in
GAS b subcutaneous adipose tissue [38]. 1,25(OH)2D3 may induce its bio-
250
logic responses through a high-affinity intracellular VDR [39].
b
VDR protein level

Lacking the VDR in fibroblasts induced the pro-inflammatory re-

200
(% of control)

sponses followed by high intrinsic NF-jB activity, which was find-

ing that agrees with our results [40]. The VDR is expressed at
150
a particular stages of differentiation, from myoblasts to myotubes,
a implying that skeletal muscle may potentially be a physiologic tar-
a a
100 get of 1,25(OH)2D3 [41,42]. However, the existence of the VDR in
skeletal muscles is controversial. The presence of the VDR in skel-
50 etal muscles has been clearly demonstrated in myoblasts, human
skeletal muscle cells, and tissues [41–45]. Previous studies have
0 failed to detect receptors in freshly removed muscle, possibly be-
C HE HED cause of the large amounts of vitamin D-binding protein, which
make it difficult to identify receptors [46]. Wang and Deluca [47]
Fig. 4. Protein expression of the vitamin D receptor (VDR) in nuclear extracts of rat failed to detect the VDR protein by immunohistochemistry and
soleus (SOL) and medial gastrocnemius (GAS) muscles. The ratio obtained for the C
western immunoblot assays in rat skeletal muscle tissue. However,
group is reported as 100%. Each bar represents the mean ± SD of 9–10 rats per
group. Data were analyzed by 1-way analysis of variance with Duncan’s test.
our data demonstrate the existence of the VDR protein in both the
Different letters indicate statistically significant differences between groups. soleus and gastrocnemius muscle of rats. The difference between
these previous findings and our findings may be explained as fol-
molecular mechanism of vitamin D3 roles, inhibiting NF-jB activ- lows: (1) Wang and Deluca did not disclose which muscle they
ity, arresting the nuclear translocation of p65/p50, and regulating used, and (2) we examined only nuclear extract protein, because
32 M. Choi et al. / Cytokine 63 (2013) 27–35

(A) (B)
SOL p-AMPK SOL p-p38
AMPK p38
GAS p-AMPK GAS p-p38
AMPK p38
200 250
SOL SOL
180 b GAS c
GAS

phospho p38/ p38 protein level

phospho AMPK/ AMPK protein

160 b 200

c b
140
level (% of control)

(% of control)
120 150
b
a a
100 a
a a
80 100

60

40 50

20

0 0
C HE HED C HE HED
(C)
SOL p-ERK1/2

ERK1/2
GAS p-ERK1/2

ERK1/2
600
SOL
GAS c
500
protein level (% of control)
phospho ERK1/2/ ERK1/2

400
b

300

200
b
a a a
100

0
C HE HED

Fig. 5. Protein expression of phospho-AMPK (A), phospho-p38 (B), and phospho-ERK1/2 (C) in cytoplasmic extracts of rat soleus (SOL) and medial gastrocnemius (GAS)
muscles. The ratio obtained for the C group is reported as 100%. Each bar represents the mean ± SD of 9–10 rats per group. Data were analyzed by 1-way analysis of variance
with Duncan’s test. Different letters indicate statistically significant differences between groups.

the VDR in muscle tissues is a nuclear receptor that binds to 1,25- matory molecules in cellular responses [48,49]. It has also been
dihydroxyvitamin D with high affinity. proposed that p38 MAPK functions as a positive downstream
MAPKs, ERK, JNK, and p38 MAPK, and transcription factor NF-jB mediator of AMPK in skeletal muscles [50,51]. In our study, we
are important mediators of cellular responses to extracellular sig- found that high-intensity exercise strongly increased the phos-
nals. p38 MAPK, protein that participates in signaling mechanisms phorylation of p38 MAPK and ERK1/2 in both the soleus and gas-
in responses to pro-inflammatory cytokines, and NF-jB are trocnemius muscle. The phosphorylation of AMPK, a well-known
thought to play an important role in the regulation of pro-inflam- upstream signal of p38 MAPK, also paralleled that of p38 MAPK.
 M. Choi et al. / Cytokine 63 (2013) 27–35 33

(A) (B)
SOL cy- NF B SOL nu- NF B
α -tubulin Lamin B1
GAS cy- NF B GAS nu- NF B
α-tubulin Lamin B1

200 250 SOL

SOL b
180 GAS GAS
160 200

protein level (% of control)

protein level (% of control)

Nuclear NFkB/ Lamin B1

Cytosolic NFkB/ -tubulin

140 b

120 150 ab

100
a
a a
80 100

60

40 50

20

0 0
C HE HED C HE HED

(C) (D)
SOL p-I B SOL p-IKK
I B IKK
GAS p-I B GAS p-IKK
I B IKK

180 160
SOL SOL
b
160 GAS b 140 GAS
b
phospho IKK/ IKK protein level

ab
phospho IkB/ IkB protein level

140
120

120 a b
100
(% of control)
(% of control)

b a b a
100
80
80 a
60
60 a

40 40

20 20

0
0
C HE HED
C HE HED
Fig. 6. Protein expression of cytoplasmic NFjB (A), nuclear NFjB (B), phospho-IjB (C), and phospho-IKK (D) in rat soleus (SOL) and medial gastrocnemius (GAS) muscles. The
ratio obtained for the C group is reported as 100%. Each bar represents the mean ± SD of 9–10 rats per group. Data were analyzed by 1-way analysis of variance with Duncan’s
test. Different letters indicate statistically significant differences between groups.

These findings support the role of p38 MAPK as a positive down-
stream regulator of AMPK-mediated metabolic effects in skeletal
muscles. Although rats in the HED group exercised at an equal
intensity to those in the HE group, the protein expression of AMPK,
an important regulator of energy metabolism during exercise, was
significantly lower in the HED group compared with the HE group.
It seems that vitamin D-treated rats were less stressed during
high-intensity exercise. We found that the high-intensity exercise
activated ERK2 in the soleus muscle and a single exercise bout or
acute muscle contraction has been shown to activate ERK2.
34 M. Choi et al. / Cytokine 63 (2013) 27–35
(A) 400
350 b
300
IL-6 mRNA level
(% of control)
250
200
150
a
100
50 a Appendix A. Supplementary material
0 Supplementary data associated with this article can be found, in
C HE HED
(B) 300
b References
250
α mRNA level
(% of control)
200
150
ab
TNF-α
100
50
a [5] Marini A, Jiang X, Wu X, Pan H, Guo Z, Mattson M, et al. Preconditioning and
0
C HE HED
Fig. 7. Gene expression of IL-6 (A) and TNF-a (B) in the medial gastrocnemius
muscle. The ratio obtained for the C group is reported as 100%. Each bar represents
the mean ± SD of 9–10 rats per group. Data were analyzed by 1-way analysis of
variance with Duncan’s test. Different letters indicate statistically significant
differences between groups.
Activation of the NF-jB family of transcription factors by path-
ogen-associated molecules constitutes an important first step in
signaling muscle protein breakdown. Constitutive activation of
the IjB kinase in skeletal muscles leads to significant upregulation
of NF-jB and severe muscle wasting [52,53]. Cytokines stimulate
the activation and nuclear translocation of NF-jB in skeletal mus-
cle cells and NF-jB was activated in muscles after acute exercise
[54,55]. Our data demonstrate a significant increase in the nuclear
translocation of p65 NF-jB and related proteins in response to
high-intensity exercise in skeletal muscles. Vitamin D3 may inhibit
the nuclear translocation of p65 NF-jB and the phosphorylation of
IKK and IjB. Other studies have demonstrated stabilization of the
IjB protein by 1,25(OH)2D3, leading to the arrest of p65 nuclear
translocation and, thus, a reduction in NF-jB activity [56,57].
A limitation of the present study was that, (1) direct evidences
that how inflammation factors related with VDR related mecha-
nism and how Vitamin D inhibits the translocation of NF-jB would
not be shown because amounts of muscles were not enough to
measure the active forms of vitamin D, (2) histopathologic changes
on progress of liver damage including fiber degeneration and
necrosis were not examined, and (3) indirect biomarkers of CK
and LDH were not enough to be prediction markers of muscle dam-
age because they are very dependent on several factors released
from the other tissues. However, our study demonstrates that vita-
min D3 plays a pivotal role in high-intensity exercise-induced mus-
cle damage and inflammation modulated by MAPK-NF-jB
activation. High-intensity exercise activates p38 MAPK, which
may stimulate nuclear translocation of p65 NF-jB, as well as
TNF-a and IL-6 gene expression. Therefore, the supplementation
with vitamin D3 may be beneficial in the rapid recovery or in pro-
tecting muscle damage from consistent training.
Acknowledgments
[This work is supported by Cooperative Research Program for
Agriculture Science&Technology Development (Project
No.PJ907089), Technology Commercialization Support Program,
Ministry for Food, Agriculture, Forestry and Fisheries (Project No.
811003031SU000), and based on a master’s thesis in sungshin
University.]
the online version, at http://dx.doi.org/10.1016/j.cyto.2013.03.018.
[1] García-López D, Cuevas MJ, Almar M, Lima E, De P, José A, et al. Effects of
eccentric exercise on NF-[kappa]B activation in blood mononuclear cells. Med
Sci Sports Exerc 2007;39:653.
[2] Kim HJ, Lee YH, Kim CK. Biomarkers of muscle and cartilage damage and
inflammation during a 200 km run. Eur J Appl Physiol 2007;99:443–7.
[3] VinÑa J, Gomez Cabrera MC, Lloret A, Marquez R, Minana JB, Pallardó FV, et al.
Free radicals in exhaustive physical exercise: mechanism of production, and
protection by antioxidants. IUBMB Life 2000;50:271–7.
[4] Sen CK, Packer L. Antioxidant and redox regulation of gene transcription.
FASEB J 1996;10:709–20.
neurotrophins: a model for brain adaptation to seizures, ischemia and other
stressful stimuli. Amino Acids 2007;32:299–304.
[6] Jiménez-Jiménez R, Cuevas MJ, Almar M, Lima E, García-López D, De Paz JA,
et al. Eccentric training impairs NF-[kappa]B activation and over-expression of
inflammation-related genes induced by acute eccentric exercise in the elderly.
Mech Ageing Dev 2008;129:313–21.
[7] Kramer HF, L.J. Goodyear. Exercise, MAPK, and NF-jB signaling in skeletal
muscle. J Appl Physiol 2007;103:388–95.
[8] Dufresne SD, Bjorbak C, El-Haschimi K, Zhao Y, Aschenbach WG, Moller DE,
et al. Altered extracellular signal-regulated kinase signaling and glycogen
metabolism in skeletal muscle from p90 ribosomal S6 kinase 2 knockout mice.
Mol Cell Biol 2001;21:81.
[9] Goodyear L, Chang P, Sherwood D, Dufresne S, Moller D. Effects of exercise and
insulin on mitogen-activated protein kinase signaling pathways in rat skeletal
muscle. Am J Physiol-Endocrinol Metabol 1996;271:E403–8.
[10] Nader GA, Esser KA. Intracellular signaling specificity in skeletal muscle in
response to different modes of exercise. J Appl Physiol 2001;90:1936.
[11] Widegren U, Wretman C, Lionikas A, Hedin G, Henriksson J. Influence of
exercise intensity on ERK/MAP kinase signalling in human skeletal muscle.
Pflügers Arch Eur J Physiol 2000;441:317–22.
[12] Yu M, Stepto NK, Chibalin AV, Fryer LGD, Carling D, Krook A, et al. Metabolic
and mitogenic signal transduction in human skeletal muscle after intense
cycling exercise. J Physiol 2003;546:327–35.
[13] Yu M, Blomstrand E, Chibalin AV, Krook A, Zierath JR. Marathon running
increases ERK1/2 and p38 MAP kinase signalling to downstream targets in
human skeletal muscle. J Physiol 2001;536:273–82.
[14] Giovannucci E, Liu Y, Rimm EB, Hollis BW, Fuchs CS, Stampfer MJ, et al.
Prospective study of predictors of vitamin D status and cancer incidence and
mortality in men. J Natl Cancer Inst 2006;98:451–9.
[15] Pittas AG, Lau J, HU F, Dawson-Hughes B. The role of vitamin D and calcium in
type 2 diabetes. A systematic review and meta-analysis. Journal of Clinical
Endocrinology and Metabolism. 2007. p. 2007–0298v1 [jc].
[16] Dietrich T, Joshipura KJ, Dawson-Hughes B, Bischoff-Ferrari HA. Association
between serum concentrations of 25-hydroxyvitamin D3 and periodontal
disease in the US population. Am J Clin Nutr 2004;80:108.
[17] Erkal M, Wilde J, Bilgin Y, Akinci A, Demir E, Bödeker R, et al. High prevalence
of vitamin D deficiency, secondary hyperparathyroidism and generalized bone
pain in Turkish immigrants in Germany: identification of risk factors.
Osteoporos Int 2006;17:1133–40.
[18] Bischoff-Ferrari HA, Dietrich T, Orav EJ, Hu FB, Zhang Y, Karlson EW, et al.
Higher 25-hydroxyvitamin D concentrations are associated with better lower-
extremity function in both active and inactive persons aged 60 y. Am J Clin
Nutr 2004;80:752.
[19] Willis KS, Smith DT, Broughton KS, Larson-Meyer DE. Vitamin D status and
biomarkers of inflammation in runners. Open Access J Sports Med
2012;3:35–42.
[20] Carrillo AE, Flynn MG, Pinkston C, Markofski MM, Jiang Y, Donkin SS, et al.
Vitamin D supplementation during exercise training does not alter
inflammatory biomarkers in overweight and obese subjects. Eur J Appl
Physiol 2012;1:1–8.
[21] Krinke G. The laboratory rat: Academic press; 2000.
[22] Bradford MM. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal
Biochem 1976;72:248–54.
 M. Choi et al. / Cytokine 63 (2013) 27–35
[23] Mathieu C, Adorini L. The coming of age of 1,25-dihydroxyvitamin D3 analogs
as immunomodulatory agents. Trends Mol Med 2002;8:174–9.
[24] Veldman CM, Cantorna MT, DeLuca HF. Expression of 1,25-
dihydroxyvitamin D3 receptor in the immune system. Arch Biochem
Biophys 2000;374:334–8.
[25] Chen Y, Kong J, Sun T, Li G, Szeto FL, Liu W, et al. 1, 25-Dihydroxyvitamin D3
suppresses inflammation-induced expression of plasminogen activator
inhibitor-1 by blocking nuclear factor-kB activation. Archives of
Biochemistry and Biophysics; 2010.
[26] Lecker SH, Goldberg AL, Mitch WE. Protein degradation by the ubiquitin–
proteasome pathway in normal and disease states. J Am Soc Nephrol
2006;17:1807–19.
[27] Ebbeling CB, Clarkson PM. Exercise-induced muscle damage and adaptation.
Sports Med (Auckland, NZ) 1989;7:207.
[28] Viña J, Gimeno A, Sastre J, Desco C, Asensi M, Pallardó FV, et al. Mechanism
of free radical production in exhaustive exercise in humans and rats; role
of xanthine oxidase and protection by allopurinol. IUBMB Life
2000;49:539–44.
[29] Assy N, Djibre A, Tzuker M, Dabush S, Ali T, Abu Mouch S. 704 vitamin D
supplement prevents myalgia and elevation of cpk in chronic hepatitis B
patients treated with telbivudine. J Hepatol 2011;54. S283-S.
[30] Schleithoff SS, Zittermann A, Tenderich G, Berthold HK, Stehle P, Koerfer R.
Vitamin D supplementation improves cytokine profiles in patients with
congestive heart failure: a double-blind, randomized, placebo-controlled
trial. Am J Clin Nutr 2006;83:754–9.
[31] Yang L, Wang J, Fan Y, Chen S, Wang L, Ma J. Effect of 1,25 (OH) 2D3 on rat
peritoneal mesothelial cells treated with high glucose plus lipopolysaccharide.
Cellular Immunology; 2011.
[32] Muller K, Haahr P, Diamant M, Rieneck K, Kharazmi A, Bendtzen K. 1,25-
Dihydroxyvitamin D3 inhibits cytokine production by human blood
monocytes at the post-transcriptional level. Cytokine 1992;4:506–12.
[33] Nadeau KJ, Ehlers LB, Aguirre LE, Moore RL, Jew KN, Ortmeyer HK, et al.
Exercise training and calorie restriction increase SREBP-1 expression and
intramuscular triglyceride in skeletal muscle. Am J Physiol-Endocrinol Metab
2006;291:E90–8.
[34] Zittermann A, Frisch S, Berthold HK, Götting C, Kuhn J, Kleesiek K, et al.
Vitamin D supplementation enhances the beneficial effects of weight loss on
cardiovascular disease risk markers. Am J Clin Nutr 2009;89:1321.
[35] Batista Jr ML, Santos RVT, Lopes RD, Lopes AC, Costa rosa LFBP, Seelaender
MCL. Endurance training modulates lymphocyte function in rats with post-MI
CHF. Med Sci Sports Exerc 2008;40:549.
[36] Batista M, Santos R, Oliveira EM, Seelaender MCL, Costa Rosa L. Endurance
training restores peritoneal macrophage function in post-MI congestive heart
failure rats. J Appl Physiol 2007;102:2033.
[37] Lira FS, Rosa JC, Yamashita AS, Koyama CH, Batista Jr ML, Seelaender M.
Endurance training induces depot-specific changes in IL-10/TNF-[alpha] ratio
in rat adipose tissue. Cytokine 2009;45:80–5.
[38] Brandt C, Jakobsen AH, Adser H, Olesen J, Iversen N, Kristensen JM, et al. IL-6
regulates exercise and training-induced adaptations in subcutaneous adipose
tissue in mice. Acta Physiologica; 2011.
[39] Haussler M, Jurutka P, Hsieh JC, Thompson P, Selznick S, Haussler C, et al. New
understanding of the molecular mechanism of receptor-mediated genomic
actions of the vitamin D hormone. Bone 1995;17:S33–8.
35
[40] Szeto FL, Sun J, Kong J, Duan Y, Liao A, Madara JL, et al. Involvement of the
vitamin D receptor in the regulation of NF-[kappa]B activity in fibroblasts. J
Steroid Biochem Mol Biol 2007;103:563–6.
[41] Costa EM, Blau HM, Feldman D. 1,25-dihydroxyvitamin D3 receptors and
hormonal responses in cloned human skeletal muscle cells. Endocrinology
1986;119:2214.
[42] Simpson R, Thomas G, Arnold A. Identification of 1,25-dihydroxyvitamin D3
receptors and activities in muscle. J Biol Chem 1985;260:8882.
[43] Boland R, Norman A, Ritz E, Hasselbach W. Presence of a 1,25-dihydroxy-
vitamin D3 receptor in chick skeletal muscle myoblasts. Biochem Biophys Res
Commun 1985;128:305–11.
[44] Buitrago C, Vazquez G, De Boland AR, Boland R. The vitamin D receptor
mediates rapid changes in muscle protein tyrosine phosphorylation induced
by 1,25 (OH) 2D3. Biochem Biophys Res Commun 2001;289:1150–6.
[45] Capiati DA, Vazquez G, Tellez Inon MT, Boland RL. Role of protein kinase C in
1,25 (OH) 2-vitamin D3 modulation of intracellular calcium during
development of skeletal muscle cells in culture. J Cell Biochem
2000;77:200–12.
[46] Levy FO, Eikvar L, Frøysa A, Hansson V. Differential displacement. A simple
method to study receptors for 1,25-dihydroxyvitamin D 3 in the presence of
contaminating serum vitamin D binding protein. Biochem Biophys Res
Commun 1985;130:1020–6.
[47] Wang Y, DeLuca HF. Is the vitamin D receptor found in muscle? Endocrinology
2011;152:354.
[48] Azzolina A, Bongiovanni A, Lampiasi N. Substance P induces TNF-[alpha] and
IL-6 production through NF [kappa] B in peritoneal mast cells. Biochimica et
biophysica acta (BBA)-molecular. Cell Res 2003;1643:75–83.
[49] Baldassare JJ, Bi Y, Bellone CJ. The role of p38 mitogen-activated protein kinase
in IL-1ß transcription. J Immunol 1999;162:5367.
[50] Lemieux K, Konrad D, Klip A, Marette A. The AMP-activated protein kinase
activator AICAR does not induce GLUT4 translocation to transverse tubules but
stimulates glucose uptake and p38 mitogen-activated protein kinases a and ß
in skeletal muscle. FASEB J 2003;17:1658–65.
[51] Shapiro L, Dinarello CA. Osmotic regulation of cytokine synthesis in vitro. Proc
Nat Acad Sci 1995;92:12230.
[52] Pahl HL. Activators and target genes of Rel/NF-kappaB transcription factors.
Oncogene 1999;18:6853.
[53] Cai D, Frantz JD, Tawa Jr NE, Melendez PA, Oh BC, Lidov HGW, et al. IKK [beta]/
NF-[kappa] B activation causes severe muscle wasting in mice. Cell
2004;119:285–98.
[54] Langen RCJ, Schols AMWJ, Kelders MCJM, Wouters EFM, Janssen-Heininger
YMW. Inflammatory cytokines inhibit myogenic differentiation through
activation of nuclear factor-jB. FASEB J 2001;15:1169–80.
[55] Ji L, Gomez-Cabrera M, Steinhafel N, Vina J. Acute exercise activates nuclear
factor (NF)-jB signaling pathway in rat skeletal muscle. FASEB J
2004;18:1499–506.
[56] Giarratana N, Penna G, Amuchastegui S, Mariani R, Daniel KC, Adorini L. A
vitamin D analog down-regulates proinflammatory chemokine production by
pancreatic islets inhibiting T cell recruitment and type 1 diabetes
development. J Immunol 2004;173:2280.
[57] Zhang Z, Yuan W, Sun L, Szeto F, Wong K, Li X, et al. 1,25-Dihydroxyvitamin D3
targeting of NF-jB suppresses high glucose-induced MCP-1 expression in
mesangial cells. Kidney Int 2007;72:193–201.