Forensic DNA Analysis

DNA (Deoxyribonucleic acid)

❑ Biomolecule containing genetic information
❑ Polymer composed by repeating units called nucleotides
➢ Nucleotide (building block of DNA) contains a sugar molecule
(deoxyribose), a phosphate group and a nitrogen-containing base.
➢ The bases in DNA are adenine (A), guanine (G), cytosine (C), and
thymine (T).
 Complementarity of strands in the

DNA Structure
DNA double helix.

❑ Double Helix (Like a Twisted Ladder)

❑ Two polynucleotide strands held together by hydrogen bonds between

A-T and G-C base pairs

❑ DNA is written as the order of its

bases:

5’-CAATCGTCA-3’

just one side (one strand) is written

 Where is DNA ?
(https://rsscience.com/cel
l-biology-on-the-dining-
table-animal-cell-model-
part-i/)

- Nuclear DNA - Chromosomal DNA

- Nuclear DNA
- Mt-DNA - Plasmid (circular DNA)
- Mitochondrial DNA
(Mt-DNA)
- Chloroplast DNA
(Cp-DNA)
Nuclear DNA is packaged into Chromosomes
Human DNA
❑ All types of cells in human body contain a copy of the same DNA
❑ In each body cell: Three billion (3,000,000,000) bp of nuclear DNA + multiple copies of
16,569bp of mtDNA
Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania
❑ Nuclear DNA is packaged into 23 pairs of chromosomes
➢ As diploid organisms, human chromosomes come in
pairs (one inherited from Mother and one from Father).
➢ Autosomes = chromosome pairs No. 1 – 22,
➢ Sex chromosome (No. 23) → determined gender:
 Male for the pair of X (large) and Y chromosomes
(small).
 Female for the pair of two X chromosomes.
❑ Exception for gamete (egg and sperm cells) → 23
chromosomes (haploid cell)
Human DNA
❑ Human Genome Project suggests :

➢ 95% of nuclear genome = non-coding sequences

➢ 5% are made up of genes encoding proteins

❑ Non-coding sequences : reveal individual variability → potential for identification purposes.

❑ Among humans, most of the 3 billion bases in DNA are ordered exactly the same.

➢ 99.8% of the DNA sequence in all humans is identical

➢ the 0.2% difference in DNA sequence is more than enough to distinguish human from
one another.

❑ No two individuals have identical DNA (except identical twins)

How does DNA differ among humans?

Several ways the DNA sequence can be different :
1.

Person 1 TGGTAGAGCCTTGTTACTCG
Person 2 TGGTAGAGCCTCGTTACTCG

➢
Several ways the DNA sequence can be different :
2.
➢

Person 1 GACTACGTCGTTATTCCAGT
Person 2 GACTACGTCGTATTCCAGT
Person 3 GACTACGTCGTTTATTCCAGT
Several ways the DNA sequence can be different :

Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..
1 2 3 4 5 6
Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT..
1 2 3 4 5
Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..
1 2 3 4 5 6 7

➢
DNA Analysis Techniques
1. Restriction Enzymes → cutting DNA strand at specific region

http://www.agrilearner.com/restriction-endonuclease/

https://openlab.citytech.cuny.edu/bio-oer/analyzing-dna/propagating-dna-in-bacteria/3/#Recombinant_DNA_Technology
DNA Analysis Techniques
2. Electrophoresis → Separating DNA fragments according to size (fragment length)

➢ Gel Electrophoresis

http://universe84 a.com/collection/gel-electrophoresis/

M= DNA mix
(-)= negative control
1 = DNA sample

Stiawan, E. (2016) Studi Forensik 6 Galur

Diatom Laut Tropis, ITB, Bandung.
DNA Analysis Techniques
➢ Capillary Electrophoresis

Mmassy, B. (2012) Dna forensic, Dar

es salaam, Tanzania

the first peak appear belongs to the

shortest DNA fragment
 Length
DNA Analysis Techniques
Capillary
➢ Capillary Electrophoresis /sample
1.

2.

Sample 1 = DNA mix 3

Sample 2 = a single fragment of DNA
Sample 3 = mix od two DNA fragments
Mmassy, B. (2012) Dna forensic,
Dar es salaam, Tanzania
DNA Analysis Techniques
3. PCR (Polymerase Chain Reaction) → multiplying a
small specific part of DNA → suitable for the purpose
of analyzing (typing) small amounts of degraded DNA.

PCR products (amplicons) can be detected by

electrophoresis

After one cycle of PCR → 2 copies

After 30 cycles → billions copies
DNA Analysis Techniques
4. Sequencing → determining the nucleic acid sequence
→ the order of the four bases (thymine, cytosine,
adenine, guanine) in DNA sample.

The sequence of DNA starting from nucleotide number 100 to 138

Forensic DNA Analysis

DNA can be restored from any material that contains cells.

❑ Saliva ❑ Hair
❑ Semen ❑ Teeth
❑ Blood ❑ Bone
❑ Tissue ❑ Maggot Crops
Forensic DNA Analysis – evidence containing DNA
1. Collection of Evidences

❑ Unknown Samples → Saliva, Semen, Blood, Stains, Tissue, Hair, Teeth, Bones

❑ Known Samples → Blood or buccal swabs from victim/suspect//known person

2. avoid Contamination
The mixing of a sample being collected with DNA from other sources can result in contamination.

❑ Do not touch, cough, sneeze, or bleed on a sample.

❑ Wear gloves and utilize disposable instruments

❑ Pack up items separately

❑ Do not mix unknown samples with known samples (from victim or suspect)
Forensic DNA Analysis
3. Packaging Evidence
❑ Wrap up all items individually

❑ Insert collected samples into paper bags, not plastic

❑ Air dry samples to avoid DNA degradation caused by moisture or humidity

❑ Keep evidence at room temperature and out of the sun

Forensic DNA Analysis

DNA analysis methods:

1. Restriction Fragment Length

Polymorphisms (RFLP)

2. Short tandem repeats (STRs)

3. Mitochondrial DNA (mtDNA)

Butler, J.M. (2005) Forensic DNA Typing, 2nd Ed.,

Elsevier Academic Press, Burlington, USA.
Short tandem repeats (STRs)
❑ Presently the most frequently used of all forensic markers

❑ Located in the nuclear DNA (chromosomes)

❑ Enable Individual identification

❑ Differentiate people by its length

❑ Used in the FBI CODIS database

Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania

Short tandem repeats (STRs) – nomenclature/terminology
❑ Locus or Loci:
➢ Points to the location on the chromosome
❑ Naming the STR marker Hummel, S. (2003) Ancient DNA Typing, Springer, Berlin Heidelberg.

➢ Markers outside the gene

example: D5S51
➢ Markers inside the gene (intron)
example: TH01 ;
▪ TH is initials of gene name = Tyrosine
hydroxylase gene (in chromosome 11)
▪ 01 = the STR located within intron 1 of
the tyrosine hydroxylase gene.
example: HUMTH01 (HUM = human)
Short tandem repeats (STRs)
❑ Allele:
➢ Indicates the type or variant of DNA
➢ For STRs, alleles represent the number of repeats.

Example: Locus: D5S818

Alleles: 7,9 (heterozygous)

Homologous pair of
chromosome number 5.
Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania
Short tandem repeats (STRs)
Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania

❑ 13 loci used in
CODIS
Short tandem repeats (STRs)

1. Extraction of DNA

➢ Separates DNA from sample

2. PCR → amplifies the STR markers of DNA

3. Electrophoresis (gel or capillary)

➢ Separates amplified fragments according to size

➢ Results an arrangement or pattern of bands on the

gel and/or peaks on the diagram (DNA fingerprint)
Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania
Short tandem repeats (STRs)

Black and white image of STR gel Color image of STR gel

Samples will have one or two bands at each STR marker/loci. Two different markers can be loaded in a same
One path for only one marker well together and migrated at a same path
Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania
 Short tandem repeats (STRs)
Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania

DNA Ladder -
v
size standard

Sample
v
(Person 1)

Sample
v
(Person 2)
Short tandem repeats (STRs)

TPOX CSF1PO D5S818 D8S1179

Blood stain 7,9 10,13 7,15 8,8

Suspect 1 8,9 10,10 9,10 11,12
Suspect 2 10,11 9,13 8,14 9,12
Suspect 3 7,9 10,13 7,15 8,8

Blood stain may have come from the Suspect 3

Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania

How to determine the human gender..?

❑ Located on Yp11.2 at Y-chromosome and the homologous region

of Xp22.31-p22.1 at X-chromosome
❑ Encodes a protein of tooth enamel
❑ At intron 1 of this gene → 6 bp deletion at X-chromosome

Test to intron 1 region of

amelogenin gene.

Different amplicon size and peaks

pattern between female (XX) and
male (XY).
Hummel, S. (2003) Ancient DNA Typing, Springer, Berlin Heidelberg.
Short tandem repeats (STRs)
The application of dye labels to the STRs and amelogenin (XY) loci allows a simultaneous
analysis of much more STRs (multi locus STRs analysis)

the peaks of STRs markers

v
which have the same amplicon
size can be distinguished by
v
different color:
v
➢ FGA , D18S51 and D7S820
➢ VWA, D2S11 and D13S317
➢ D3S1358, D8S1179, XY
and D5S818

Hummel, S. (2003) Ancient DNA Typing, Springer, Berlin Heidelberg.

32
Comparison of DNA profiles of 2 individuals obtained with multiple STR markers:
STR length variation at unique sites on 10 different chromosomes (A – J)
(random match probability of this test is approximately 1 in 3 trillion).

Butler, J.M. (2005) Forensic DNA Typing, 2nd Ed., Elsevier Academic Press, Burlington, USA.
Forensic DNA
analysis

Complete STR method

Overview of biology,
technology, and genetic
components of DNA
typing

Butler, J.M. (2005) Forensic DNA Typing, 2nd Ed.,

Elsevier Academic Press, Burlington, USA.
Mitochondrial DNA (mtDNA)
Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania

❑ One ring or circular DNA

➢ 16,569 pb (“letters”) long

➢ Coding for 37 genes

❑ D loop = non-coding region

➢ Hypervariable regions (HVR I+II)

Hummel, S. (2003) Ancient DNA Typing,
❑ Inherited only through the females of Springer, Berlin Heidelberg.

previous generation → All members of a

maternal lineage show the same mtDNA

➢ Enable to identify individuals at the

family lineage level
Mitochondrial DNA (mtDNA)

❑ Multiple copies in each mitochondria

➢ Multiple mitochondria in each cell

➢ used in cases of old or severely degraded DNA (bones, hair shafts)

❑ Highly valuable markers in terms of phylogenetic or population genetic studies

Example: 9 bp deletion at control region of the cytochrome c oxidase subunit II (COII/tRNALys)

➢ found in Native American individuals, Pacific islander and many southeast Asians

➢ Absent in Caucasian and many Africans populations

❑ For forensic analysis, mtDNA sequence is examined (not the length)

❑ Publicly accessible database are available for worldwide human population

Mitochondrial DNA (mtDNA)

❑ DNA Extraction from cells sample

❑ PCR Amplification of marker region (HVR I or HVR II)

❑ Sequencing of amplicon (PCR product)

❑ DNA Sequences are compared to each other

Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania

Mmassy, B. (2012) Dna forensic, Dar es salaam, Tanzania
Thank you for
your attention