Dna Extraction From Rice Seeds

Methods in
Molecular Biology 1099
Robert J. Henry
Agnelo Furtado Editors
Cereal
Genomics
Methods and Protocols
METHODS IN M O L E C U L A R B I O LO G Y ™
Series Editor
John M. Walker
School of Life Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For further volumes:

http://www.springer.com/series/7651
Cereal Genomics
Methods and Protocols
Edited by
Robert J. Henry
Queensland Alliance for Agriculture and Food Innovation,
The University of Queensland, St. Lucia, QLD, Australia
Agnelo Furtado
Centre for Nutrition and Food Science, Queensland Alliance for Agriculture
and Food Innovation, The University of Queensland, St. Lucia, QLD, Australia
Editors
Robert J. Henry Agnelo Furtado
Queensland Alliance for Agriculture and Food Centre for Nutrition and Food Science
Innovation, The University of Queensland Queensland Alliance for Agriculture and Food
St. Lucia, QLD, Australia Innovation, The University of Queensland
St. Lucia, QLD, Australia
ISSN 1064-3745 ISSN 1940-6029 (electronic)

ISBN 978-1-62703-714-3 ISBN 978-1-62703-715-0 (eBook)
DOI 10.1007/978-1-62703-715-0
Springer New York Heidelberg Dordrecht London
Library of Congress Control Number: 2013953327
© Springer Science+Business Media New York 2014

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed. Exempted from this
legal reservation are brief excerpts in connection with reviews or scholarly analysis or material supplied specifically for
the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work.
Duplication of this publication or parts thereof is permitted only under the provisions of the Copyright Law of the
Publisher’s location, in its current version, and permission for use must always be obtained from Springer. Permissions
for use may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to prosecution
under the respective Copyright Law.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
While the advice and information in this book are believed to be true and accurate at the date of publication, neither
the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be
made. The publisher makes no warranty, express or implied, with respect to the material contained herein.
Printed on acid-free paper
Humana Press is a brand of Springer

Springer is part of Springer Science+Business Media (www.springer.com)
Preface
Cereals are the major source of calories in human diets and remain central to food security
as demand for food increases as human populations grow and food consumption per person
increases due to economic development. Cereals are the seeds of grasses (Poaceae family)
that were domesticated by humans at the beginnings of agriculture. The main species of
cereals cultivated today are wheat, rice, maize, barley, sorghum, and millet. These are spe-
cies of great social and economic importance. Genomics tools may allow others to be
domesticated in the future. The genomes of the cereals hold the genetic information that
determines their productivity and nutritional and functional attributes.
The continuous genetic improvement of cereals is essential to global food security.
Analysis of cereal genomes has application in wild and domesticated germplasm screening
to find new sources of desirable traits. Advances in DNA sequencing technologies are
revealing the diversity available. Functional genomics links gene sequences to utility in cere-
als. Genes for disease resistance, productivity, nutritional value, and food functionality are
all important targets in the cereals. Molecular selection tools allow recombination of these
genes to develop superior genotypes and accelerate genetic gain. Genome modification
using transgenic approaches allows novel traits to be developed in the cereals.
This volume of Methods in Molecular Biology provides modern protocols for the anal-
ysis and manipulation of cereal genomes. Techniques for isolation and analysis of DNA and
RNA from both the vegetative tissues and from the more challenging seeds of cereals are
described. Tools for the isolation, characterization and functional analysis of cereal genes
and their transcripts are detailed. Methods for molecular screening of cereals and for their
genetic transformation are also covered. The volume provides a comprehensive resource for
those studying cereal genomes.
St. Lucia, QLD, Australia Robert J. Henry

St. Lucia, QLD, Australia Agnelo Furtado
v
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
1 DNA Extraction from Vegetative Tissue for Next-Generation Sequencing . . . . 1

Agnelo Furtado
2 DNA Extraction from Rice Endosperm (Including a Protocol for
Extraction of DNA from Ancient Seed Samples) . . . . . . . . . . . . . . . . . . . . . . . 7
Chiaki Mutou, Katsunori Tanaka, and Ryuji Ishikawa
3 RNA Extraction from Cereal Vegetative Tissue . . . . . . . . . . . . . . . . . . . . . . . . 17
Julie A. Pattemore
4 RNA Extraction from Developing or Mature Wheat Seeds . . . . . . . . . . . . . . . 23
Agnelo Furtado
5 cDNA Library Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
Maarten Kooiker and Gang-Ping Xue
6 Preparation of High Molecular Weight gDNA and Bacterial Artificial
Chromosome (BAC) Libraries in Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Siddanagouda S. Biradar, Xiaojun Nie, Kewei Feng, and Song Weining
7 The Polymerase Chain Reaction (PCR): General Methods. . . . . . . . . . . . . . . . 65
Daniel L.E. Waters and Frances M. Shapter
8 Mutation and Mutation Screening. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
L. Slade Lee, Bradley J. Till, Helen Hill, Owen A. Huynh,
and Joanna Jankowicz-Cieslak
9 The Quantitative Real-Time Polymerase Chain Reaction
for the Analysis of Plant Gene Expression . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Timothy L. Fitzgerald and Richard B. McQualter
10 Cloning of DNA Fragments: Ligation Reactions in Agarose Gel . . . . . . . . . . . 117
Agnelo Furtado
11 Rapid Cloning of Genes and Promoters for Functional Analyses . . . . . . . . . . . 123
Peer M. Schenk
12 Genome Walking . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
Frances M. Shapter and Daniel L.E. Waters
13 Functional Analysis by Protein Biochemistry . . . . . . . . . . . . . . . . . . . . . . . . . . 147
Louis M.T. Bradbury
14 Genomic Southern Blot Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159
Leigh Gebbie
15 Northern Hybridization: A Proficient Method for Detection
of Small RNAs and MicroRNAs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
Shazia Iram
vii
viii Contents
16 Protein Blotting Protocol for Beginners . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 189

Lars A. Petrasovits
17 Genetic Transformation of Wheat via Particle Bombardment. . . . . . . . . . . . . . 201
Caroline A. Sparks and Huw D. Jones
18 Sorghum Genetic Transformation by Particle Bombardment . . . . . . . . . . . . . . 219
Guoquan Liu, Bradley C. Campbell, and Ian D. Godwin
19 Genetic Transformation of Wheat via Agrobacterium-Mediated
DNA Delivery. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
Caroline A. Sparks, Angela Doherty, and Huw D. Jones
20 A Protocol for High-Throughput Agrobacterium-Mediated
Barley Transformation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
Wendy A. Harwood
21 Agrobacterium-Mediated Transformation: Rice Transformation. . . . . . . . . . . . 261
Inez H. Slamet-Loedin, Prabhjit Chadha-Mohanty,
and Lina Torrizo
22 Agrobacterium-Mediated Transformation of Maize
(Zea mays) Immature Embryos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 273
Hyeyoung Lee and Zhanyuan J. Zhang
23 A Technical Platform for PCR-Based SNP Screening
in Cereals and Other Crops. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281
Zining Wang
24 A Method for Discovery of Genome-Wide SNP Between
Any Two Genotypes from Whole-Genome Re-sequencing Data . . . . . . . . . . . 287
S. Gopala Krishnan, Daniel L.E. Waters, and Robert J. Henry
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 295
Contributors
SIDDANAGOUDA S. BIRADAR • State Key Laboratory of Crop Stress Biology in Arid Areas,
College of Agronomy, Yangling Branch of China Wheat Improvement Center, Shaanxi,
P.R. China
LOUIS M.T. BRADBURY • Department of Biological Sciences, Lehman College, City
University of New York, New York, NY, USA; Horticultural Sciences Department,
University of Florida, Gainesville, FL, USA
BRADLEY C. CAMPBELL • School of Agriculture and Food Sciences, The University of
Queensland, Brisbane, QLD, Australia
PRABHJIT CHADHA-MOHANTY • Plant Breeding, Genetics, and Biotechnology,
International Rice Research Institute, Metro Manila, Philippines
ANGELA DOHERTY • Plant Biology and Crop Science Department, Rothamsted Research,
Harpenden, Hertfordshire, UK
KEWEI FENG • State Key Laboratory of Crop Stress Biology in Arid Areas, College of
Agronomy, Yangling Branch of China Wheat Improvement Centre, Yangling, Shaanxi,
P.R. China
TIMOTHY L. FITZGERALD • CSIRO Plant Industry, St. Lucia, Brisbane, QLD, Australia
AGNELO FURTADO • Centre for Nutrition and Food Science, Queensland Alliance for
Agriculture and Food Innovation, The University of Queensland, St. Lucia,
QLD, Australia
LEIGH GEBBIE • Australian Institute for Bioengineering and Nanotechnology,
The University of Queensland, Brisbane, QLD, Australia
IAN D. GODWIN • School of Agriculture and Food Sciences, The University of Queensland,
WENDY A. HARWOOD • Department of Crop Genetics, John Innes Centre, Norwich, UK
ROBERT J. HENRY • Queensland Alliance for Agriculture and Food Innovation,
HELEN HILL • Southern Cross Plant Science, Southern Cross University, Lismore, NSW,
Australia
OWEN A. HUYNH • Plant Breeding and Genetics Laboratory, Joint FAO/IAEA
Division of Nuclear Techniques in Food and Agriculture, IAEA Laboratories Seibersdorf,
Vienna, Austria
SHAZIA IRAM • School of Agriculture and Food Sciences, The University of Queensland,
RYUJI ISHIKAWA • Faculty of Agriculture and Life Science, Hirosaki University, Hirosaki,
Aomori, Japan
JOANNA JANKOWICZ-CIESLAK • Plant Breeding and Genetics Laboratory, Joint FAO/IAEA
Division of Nuclear Techniques in Food and Agriculture, IAEA Laboratories Seibersdorf,
Vienna, Austria
ix
x Contributors
HUW D. JONES • Plant Biology and Crop Science Department, Rothamsted Research,
MAARTEN KOOIKER • Plant Ecophysiology, Institute of Environmental Biology,
Utrecht University, Utrecht, The Netherlands
S. GOPALA KRISHNAN • Division of Genetics, Indian Agricultural Research Institute,
New Delhi, India
HYEYOUNG LEE • Division of Plant Sciences, University of Missouri, Columbia, MO, USA
L. SLADE LEE • Cooperative Research Centre for Remote Economic Participation,
Division of Research, Southern Cross University, Lismore, NSW, Australia
GUOQUAN LIU • School of Agriculture and Food Sciences, The University of Queensland,
Brisbane, QLD, Australia
RICHARD B. MCQUALTER • Australian Institute for Bioengineering and Nanotechnology,
The University of Queensland, Brisbane, QLD, Australia
CHIAKI MUTOU • National Institute of Aerobiological Sciences, Tsukuba, Ibaraki, Japan
XIAOJUN NIE • State Key Laboratory of Crop Stress Biology in Arid Areas, College of
Agronomy, Yangling Branch of China Wheat Improvement Centre, Yangling, Shaanxi,
P.R. China
JULIE A. PATTEMORE • Graham Centre for Agricultural Innovation (NSW Department
of Primary Industries and Charles Sturt University), Charles Sturt University,
North Wagga, NSW, Australia
LARS A. PETRASOVITS • Australian Institute for Bioengineering and Nanotechnology,
PEER M. SCHENK • School of Agriculture and Food Sciences, Queensland Alliance for
Agriculture and Food Innovation, The University of Queensland, St. Lucia, QLD,
Australia
FRANCES M. SHAPTER • Southern Cross Plant Science, Southern Cross University, Lismore,
NSW, Australia
INEZ H. SLAMET-LOEDIN • Genetic Transformation Laboratory, Plant Breeding, Genetics,
and Biotechnology, International Rice Research Institute, Metro Manila, Philippines
CAROLINE A. SPARKS • Plant Biology and Crop Science Department, Rothamsted Research,
KATSUNORI TANAKA • Faculty of Humanities, Hirosaki University, Hirosaki, Aomori, Japan
BRADLEY J. TILL • Plant Breeding and Genetics Laboratory, Joint FAO/IAEA Division of
Nuclear Techniques in Food and Agriculture, IAEA Laboratories Seibersdorf,
Vienna, Austria
LINA TORRIZO • Plant Breeding, Genetics, and Biotechnology, International Rice Research
Institute, Metro Manila, Philippines
ZINING WANG • Plant Genome Mapping Laboratory, University of Georgia, Athens,
GA, USA
DANIEL L.E. WATERS • Southern Cross Plant Science, Southern Cross University, Lismore,
NSW, Australia
SONG WEINING • State Key Laboratory of Crop Stress Biology in Arid Areas, College of
Agronomy, Yangling Branch of China Wheat Improvement Center, Shaanxi, P.R. China
GANG-PING XUE • CSIRO Plant Industry, St. Lucia, Brisbane, QLD, Australia
ZHANYUAN J. ZHANG • Division of Plant Sciences, University of Missouri, Columbia,
MO, USA
Chapter 1
DNA Extraction from Vegetative Tissue for Next-Generation

Sequencing
Agnelo Furtado
Abstract
The quality of extracted DNA is crucial for several applications in molecular biology. If the DNA is to be
used for next-generation sequencing (NGS), then microgram quantities of good-quality DNA is required.
In addition, the DNA must substantially be of high molecular weight so that it can be used for library
preparation and NGS sequencing. Contaminating phenol or starch in the isolated DNA can be easily
removed by filtration through kit-based cartridges. In this chapter we describe a simple two-reagent DNA
extraction protocol which yields a high quality and quantity of DNA which can be used for different appli-
cations including NGS.
Key words DNA, Plant, Starch contamination, High molecular weight, Next-generation sequencing
1 Introduction
One of the most important methods in genetics or genomics is the

extraction of good-quality deoxyribonucleic acid (DNA).
Although DNA is isolated on a routine basis, the quantity and
quality of isolated DNA are dependent on several factors, such as
the skills of the operator, the understanding of the principles of
the method, the method for isolation, the age and type of tissue
used, and contaminants in the tissue selected. Although sheared
DNA can be used for PCR application, high-quality and relatively
unsheared DNA is a prerequisite for use in next-generation
sequencing (NGS) applications. We describe here a simple two-
reagent DNA extraction protocol for vegetative tissue. This
method is a modification of a published method [1] which can be
used to isolate DNA of high quality and quantity for use in differ-
ent applications including NGS. Further purification of the
extracted DNA can be achieved by passing a DNA through the
DNaeasy Plant mini kit (Qiagen, USA).
Robert J. Henry and Agnelo Furtado (eds.), Cereal Genomics: Methods and Protocols, Methods in Molecular Biology,
vol. 1099, DOI 10.1007/978-1-62703-715-0_1, © Springer Science+Business Media New York 2014
1
2 Agnelo Furtado
2 Materials
1. 1 M Tris–HCl, pH 8: Take 121.1 g of Tris base and dissolve in

800 μL of distilled water. Adjust the pH to 8.0 with concen-
trated HCl, and then adjust the final volume to 1 L with
distilled water.
2. 0.5 M Ethylenediaminetetraacetic acid (EDTA): Take 93.05 g
of EDTA disodium salt (FW = 372.2), dissolve in 400 mL
water, adjust the pH to 8 with NaOH, and then adjust the final
volume to 500 mL with distilled water.
3. Nuclear lysis buffer: 200 mM Tris–HCl, pH 7.5, 50 mM
EDTA, 2 M NaCl, and 2 % cetyl trimethylammonium bro-
mide (CTAB). For 1 L of this solution, take 200 mL of 1 M
Tris–HCl, pH 8, 100 mL of 0.5 M EDTA, pH 8.0, 116.88 g
of NaCl, and 20 g of CTAB. Add 500 mL of distilled water,
and dissolve all components with a magnetic stirrer. Then
adjust the final volume to 1 L with distilled water. This solu-
tion can be autoclaved and kept on the shelf. When
required, add in beaker and dissolve (with gentle mixing)
0.6 % of sodium sulfite or sodium metabisulfite.
4. 5 % Sarkosyl solution: Take 5 g of Sarkosyl in 100 mL of
distilled water. This solution can be autoclaved and kept on the
shelf. When required aliquot into beakers.
5. TE buffer: 10 mM Tris–HCl, pH 8, 1 mM EDTA. Take 10 mL
of 1 M Tris–HCl and add 2 mL of 500 mM EDTA pH 8.0.
Adjust the final volume to 1 L with distilled water.
6. 10 mg/mL RNAaseA solution.
7. Mortar and pestle.
8. Liquid nitrogen.
9. Steel spatula.
10. 50 mL tubes and tube racks.
11. Fume hood.
12. 65 °C water bath.
13. Phenol:chloroform:isoamyl alcohol (25:24:1).
14. Chloroform.
15. Isopropanol.
16. 70 % ethanol prepared in distilled water (v/v).
17. Centrifuge for 50 mL tubes.
18. DNA electrophoresis unit with gel documentation system.
19. DNA stain: Either Ethidium bromide solution or SYBRSafe
(Life technologies).
DNA Extraction for Next Generation Sequencing 3
3 Method
1. Take 3 g of tissue (leaf or seedlings) and using a mortar and

pestle grind to a fine powder under liquid nitrogen.
2. Immediately transfer the frozen powder into a 50 mL tube.
3. Immediately add 8 mL of nuclear lysis buffer and 2 mL of 5 %
Sarkosyl solution. Close the cap, and gently tap the tube till all
the frozen tissue comes in contact with the added buffer
solutions.
4. Incubate the tubes at 65 °C for 45 min with periodic mixing
by inverting the tubes (5–8 mixing steps) (see Note 1).
5. Add 5 μL of 10 mg/mL RNAaseA solution, and incubate at
room temperature for 5 min.
6. After the incubation add 5 mL of phenol:chloroform:isoamyl
alcohol (25:24:1). Tighten the caps well before mixing to
avoid spillage of phenol.
7. Mix to form an emulsion. Mix gently by inverting the tube
about 50 times (see Note 2).
8. Centrifuge the tubes at 3,500 × g for 5 min in a swing out
bucket rotor. The phenol–chloroform–isoamyl alcohol mix-
ture collects at the bottom followed by particulate matter at
the interface, followed by aqueous phase containing DNA,
possibly RNA, and other soluble substances (see Note 3).
9. Transfer the supernatant (aqueous phase, about 2–3 mL) into
fresh 50 mL tubes, and add 5 mL of chloroform. Tighten the
caps well before mixing to avoid spillage of chloroform.
10. Mix to form an emulsion. Mix gently by inverting the tube
about 50 times (see Note 4).
11. Centrifuge the tubes at 3,500 × g for 5 min. The chloroform
collects at the bottom followed by particulate matter at the
interface, followed by aqueous phase containing DNA
(see Note 3).
12. Transfer the supernatant (aqueous phase, about 2–3 mL) into
15 mL tubes.
13. Add 0.6 mL of isopropanol for every 1 mL of supernatant, and
mix to precipitate DNA.
14. Incubate at room temperature for 10 min, and centrifuge at
3,500 × g for 5 min (see Note 3).
15. Discard the supernatant, and add 3 mL of 70 % ethanol to
wash the DNA pellet (see Note 5).
16. Incubate at room temperature for 10 min, and centrifuge at
3,500 × g for 5 min.
4 Agnelo Furtado
17. Discard the supernatant, and place the tubes upside down to
drain out the remainder of the supernatant.
18. Dry the DNA precipitate in air by leaving the tubes on
the bench for 5–10 min or by drying at 37 °C for 5 min
(see Note 6).
19. Add 0.5–1 mL of TE buffer (pH 8.0). Leave the tubes at room
temperature overnight to hydrate the DNA. The next day the
DNA can be easily dissolved by gently mixing. If the DNA
does not completely dissolve then add more TE and incubate
at 55 °C. Any particulate matter if present can be separated by
centrifugation.
20. The DNA solution can be transferred into Eppendorf tubes
and stored at 4 °C or frozen at –20 °C for long-term storage.
21. Determine the quality of DNA using a spectrophotometer.
Determine that the ratio of absorbance readings at 260/280 nm
is between 1.8 and 2 (see Note 7).
22. Determine the extent of shearing by resolving the DNA in a
0.7 % agarose gel in 0.5× TBE buffer.
23. The concentration of high-molecular-weight DNA resolved in
the gel can be calculated by comparing the intensity of the
stained sample DNA to that of known DNA controls also
resolved on the same gel.
4 Notes
1. During this step DNA forms a complex with CTAB. CTAB

also inhibits most nucleases and proteases. Mixing gets easier
as the solution in the tube warms up. The mixing should be
carried out gently enough so as to form a slurry of the ground
tissue in the buffers used. If the slurry is not achieved after two
or three mixes add a bit more of the NLB. Do not proceed to
the next step if the slurry is not formed, as this will reduce
DNA yield.
2. During this step the phenol will denature all proteins. The
chloroform breaks any bonds between DNA and proteins.
Thus, the formation of the emulsion is important for chloro-
form to free the DNA from any bound proteins. This then
leaves the DNA in the solution, while the denatured proteins
can be separated by centrifugation.
3. As CTAB precipitates below 15 °C, do not carry out centrifu-
gation below 15 °C. Centrifugation can be carried out at room
temperature.
4. During this step any phenol in the aqueous phase is dissolved
in the chloroform phase. The presence of phenol in the DNA
can inhibit downstream reactions involving the isolated DNA.
DNA Extraction for Next Generation Sequencing 5
5. In this step the DNA is maintained in the precipitate form,

while salts are dissolved in the water component of the 70 %
ethanol.
6. The DNA precipitate should not be overdried due to difficulty
of dissolving in TE buffer.
7. An absorbance ratio at 260/280 below 1.8 indicates protein
or phenol contamination. A ratio above 2.0 indicates RNA
contamination.
Reference
1. Carroll BJ, Klimyuk VI, Thomas CM et al element dissociation from T-DNA loci in
(1995) Germinal transpositions of the maize tomato. Genetics 139:407–420
Chapter 2
DNA Extraction from Rice Endosperm (Including a Protocol

for Extraction of DNA from Ancient Seed Samples)
Chiaki Mutou, Katsunori Tanaka, and Ryuji Ishikawa
Abstract
Deoxyribonucleic acid (DNA) extracted from endosperm can be effectively used for rapid genotyping
using seed tissue, to evaluate seed quality from packaged grains and to determine the purity of milled
grains. Methods outlined here are optimal procedures to isolate DNA from endosperm tissue of modern
rice grains and of aged rice remains preserved between 50 and 100 years. The extracted DNA can be used
to amplify regions of chloroplast genomic DNA (ctDNA), mitochondrial genomic DNA (mtDNA), and
nuclear genomic DNA using standard PCR protocols. In addition, we describe an optimal procedure to
process archaeological grain specimens, aged for a couple of thousand years, to isolate DNA from these
ancient samples, referred to here as ancient DNA (aDNA). The aDNA can be successfully amplified by
PCR using appropriate primer pairs designed specifically for aDNA amplification.
Key words Endosperm, Urea, Organellar DNA, nDNA, Ancient DNA
1 Introduction
Deoxyribonucleic acid (DNA) extracted from grain tissue of mod-

ern rice grains is frequently used for genotyping by polymerase
chain reaction (PCR) in order to check the purity of seed sample
lots. DNA can be extracted from endosperm tissue from aged grain
material preserved between 50 and 100 years. However, extracting
DNA from archaeological grain specimens can often be difficult
and challenging. In addition, the PCR amplification of DNA from
archaeological grain specimens, referred to here as ancient DNA
(aDNA), is usually hampered due to low DNA content and inhibi-
tion by high starch and carbon in the samples. However, the
removal of PCR inhibitors by appropriate filters and designing
primers to amplify short genomic regions can be used as a strategy
for the efficient application by PCR of desired targets in the aDNA
[1, 2]. A robust and simple method for processing archaeological
grain specimens to extract aDNA of good quality is necessary.
Successful amplification of aDNA offers opportunities to examine
7
8 Chiaki Mutou et al.
the genetics of modern-day crops resulting from evolution and

human selection. In this chapter, we outline robust and simple
DNA extraction methods which can be applied to rice grains
derived from modern rice grains, aged rice grains preserved
between 50 and 100 years, and archaeological grain specimens
aged for a couple of thousand years.
2 Materials
2.1 For DNA 1. Dried rice kernels of Indica and Japonica varieties, CH55(6-11)
Extraction from and Nipponbare, respectively, were used as tissue for DNA
Modern Rice Grains extraction.
3. Urea solution: For 200 mL solution add the following: 84 g of
urea, 14 mL of 5 M NaCl, 10 mL of 1 M Tris–HCl pH 8.0,
8 mL of 0.5 M EDTA pH 8, and 10 mL of 20 % Na-N-lauryl
sarcosine. Add sterile distilled water to adjust the final volume
to 200 mL. As urea is heat sensitive do not heat the solution
above 70 °C and do not autoclave.
4. 5 M NaCl: For 1 L solution, take 292.2 g of sodium chloride
and add 900 mL of distilled water. Mix to dissolve, and then
adjust the final volume to 1 L with distilled water.
5. 1 M Tris–HCl, pH 8.0: For 1 L solution, take 121.1 g of Tris
base and add 600 mL of distilled water. Adjust the pH to 8.0
by adding 28 mL of 0.1 N HCl and then dropwise till pH 8.0
is achieved. Adjust the final volume to 1 L with distilled water.
6. 0.5 M EDTA, pH 8.0: For 1 L solution, take 186.1 g of EDTA
(disodium salt) and add 500 mL of distilled water. The EDTA
will dissolve fully at pH 8.0. Adjust the pH to 8.0 as follows.
Using a stirring bar to mix the solution, add 18 g of sodium
hydroxide pellets followed by pH adjustment to 8.0 using
dropwise addition of 10 M NaOH solution. Adjust the final
volume to 1 L with distilled water.
7. TE-buffer, Tris–HCl pH 8.0 and 1 mM EDTA: To make
100 mL solution of TE buffer, take 1 mL of 1.0 M Tris–HCl
(pH 8.0) and 0.2 mL EDTA (0.5 M) and adjust the final vol-
ume to 100 mL with distilled water.
8. 20 % w/v Na-N-lauryl sarcosine, in distilled water: To make
100 mL solution, take 20 g of Na-N-lauryl sarcosine and add
60 mL of distilled water. Gently stir for dissolving, but do
not apply heat. Adjust the final volume to 100 mL with
distilled water.
9. Sterile distilled water up to 400 mL.
DNA Extraction from Rice Endosperm 9
10. Phenol/chloroform 1:1 v/v.

11. Isopropanol.
12. Microfuge, temperature controlled to 4 °C (tabletop
centrifuge).
2.2 For DNA For DNA extraction from dehulled rice grains preserved for about
Extraction from Aged 100 years as stockpiled rice:
Rice Grains
1. 2 mL screw-capped tubes.
2. Liquid nitrogen (liq N2).
3. Bead grinder, example Multi-Beads Shocker (Yasui Kikai Co.,
Osaka, Japan).
4. CTAB solution: CTAB 8 g, 2 M Tris–HCl, pH 8, 10 mL,
0.5 M EDTA 8 mL, NaCl 16.36 g, PVP 2 g. Adjust the final
volume to 200 mL with distilled water.
5. Extraction buffer (freshly prepared): Take 1 mL 2× CTAB
solution and 2 μL 2-mercaptoethanol.
6. Water bath, 60 °C.
7. Chloroform/isoamyl alcohol (v/v, 24:1).
8. Microfuge (tabletop centrifuge).
9. 3 M Na-acetate: To prepare 100 mL of solution, take 40.82 g
of sodium acetate trihydrate and add 50 mL of distilled water.
Adjust the pH to 5.2 with glacial acetic acid, and then adjust
the final volume to 100 mL with distilled water.
10. 70 % Ethanol, v/v in distilled water.
11. Isopropanol.
12. TE buffer, Tris–HCl pH 8.0 and 1 mM EDTA: To make
100 mL solution of TE buffer, take 1 mL of 1.0 M Tris–HCl
(pH 8.0) and 0.2 mL EDTA (0.5 M) and adjust the final vol-
ume to 100 mL with distilled water.
13. TE + RNase solution: Take 10 mg RNase and dissolve in 1 mL
of TE buffer.
2.3 For DNA 1. Ancient rice remains such as chaff and grain.
Extraction from 2. Gamma ray-sterile distilled H2O (γ-sterile distilled water).
Archaeological Grain
3. Bead grinder, for example Multi-Beads Shocker (Yasui Kikai
Specimens
Co., Osaka, Japan).
4. 0.5 N NaOH: For 100 mL, take 2 g of NaOH and dissolve in
100 mL of distilled water.
5. Extraction buffer, 0.1 M Tris–HCl, pH 8.0: For 100 mL
solution, take 10 mL of 1 M Tris–HCl, pH 8.0
(see Subheading 2.1, item 5) and add 90 mL of distilled water.

8. 99.9 % absolute ethanol and cooled to or below −20 °C.
9. 3 M Sodium acetate: To prepare 100 mL of solution, take
40.82 g of sodium acetate trihydrate and add 50 mL of dis-
tilled water. Adjust the pH to 5.2 with glacial acetic acid, and
then adjust the final volume to 100 mL with distilled water.
10. Ethachinmate (Nippongene Co. Ltd, Japan).
11. 70 % Ethanol (v/v) in distilled water and cooled to or below
−20 °C.
12. 1 M Tris–HCl, pH 8.0: For 1 L solution, take 121.1 g of Tris
base and add 600 mL of distilled water. Adjust the pH to
8.0 by adding 28.0 mL of 0.1 N HCl and then dropwise till
pH 8.0 is achieved. Adjust the final volume to 1 L with dis-
tilled water.
13. 0.5 M EDTA, pH 8.0: For 1 L solution, take 186.1 g of EDTA
(disodium salt) and add 500 mL of distilled water. The EDTA
will dissolve fully at pH 8.0. Adjust the pH to 8.0 as follows.
Using a stirring bar to mix the solution, add 18 g of sodium
hydroxide pellets followed by pH adjustment to 8.0 using
dropwise addition of 10 M NaOH solution. Adjust the final
volume to 1 L with distilled water.
14. 10 mM TE buffer, 10 mM Tris–HCl pH 8.0, and 1 mM
EDTA: To make 100 mL solution of TE buffer, take 1 mL of
1.0 M Tris–HCl (pH 8.0) and 0.2 mL EDTA (0.5 M) and
adjust the final volume to 100 mL with distilled water.
15. Column filter (Wizard Plus SV Minipreps DNA Purification
Systems, Promega, USA). Ultraviolet light box emitting
254 nm ultraviolet light.
3 Method
3.1 For DNA 1. Use a mortar and pestle to crush each sample of rice kernel.
Extraction from One kernel per tube is enough to extract DNA for PCR
Modern Rice Grains protocols.
(Urea Extraction with 2. Transfer the powdered grain into an Eppendorf tube, and add
Phenol/Chloroform 600 μL of urea solution
Treatment) 3. Mix the contents by vortexing a couple of times, and incubate
the tubes for 1 h at room temperature (RT).
4. Centrifuge the tubes at 10,600 × g for 5 min at RT using a
micro-centrifuge.
5. Transfer 300 μL of the supernatant into a clean Eppendorf
tube, and add 200 μL of phenol/chloroform solution.
6. Mix the contents of the tubes by vortexing (see Note 1).
1 2 3 4
a
Total genomic DNA (gDNA)
b
Chloroplast genomic region
amplified
c
Mitochondrial genomic
region amplified
d
SSR amplified from nuclear
DNA
e
602 bp fragment amplified
from nuclear DNA
Fig. 1 Total genomic DNA (gDNA) isolated from leaf and grains of two rice varieties
and successful amplification of chloroplast, mitochondrial, and nuclear regions by
PCR. Lanes 1 and 3, Oryza japonica Nipponabare; lanes 2 and 4, Oryza japonica
indica Ch55; lanes 1 and 2, leaf tissue; lanes 3 and 4, endosperm tissue. (a) Total
genomic DNA resolved by agarose gel electrophoresis from rice grain, extracted
with urea solution, and purified with phenol/chloroform treatment and from leaf
tissue using an alternate protocol; (b) chloroplast genomic region amplified; (c)
mitochondrial genomic region amplified; (d) an SSR motif amplified from nuclear
DNA by a silver staining; (e) 660 bp fragment amplified from nuclear DNA
7. Centrifuge the tubes at 12,000 rpm for 5 min at 4 °C using a

micro-centrifuge.
8. Transfer 200 μL of the supernatant into a clean Eppendorf
tube, and add equal volume of isopropanol.
9. Mix the contents gently by inverting the tubes, and incubate
the tubes at 4 °C for 1 h.
10. Centrifuge the tubes at 12,000 rpm for 5 min at 4 °C using a
micro-centrifuge.
11. Discard the supernatant, and dry the pellet under vacuum for
2 min.
12. Dissolve the pellet in 200 μL of TE buffer, and then check the
quality and quantity of DNA (see Note 2).
13. Dilute the DNA and then use in a PCR reaction (see Note 3, Fig. 1).
1 2 3 4 5 6 7 8 9 M
Fig. 2 Aged dehulled grains and their DNA successfully amplified. (a) Aged dehu-
lled rice grain cultivated about 50–100 years ago used in this study; (b) success-
ful PCR amplification of a short region from nuclear genomic DNA (nDNA) isolated
from aged rice grains. PCR products amplified with the RM3604 SSR primers for
rice. M, 100 bp DNA ladder; lanes 1–9, aged rice grain specimens
3.2 DNA Extraction Dehull rice grains preserved for about 100 years as stockpiled
from Aged Rice Grains rice; Fig. 2a.
1. Take grains of rice samples one each in 2 mL screw-capped
tubes. Close the lid tightly, immerse the tube in liquid nitrogen
for a few minutes to freeze the sample, and then grind the fro-
zen rice grain into a fine powder using a bead grinder.
2. Before the sample thaws, add 600 μL of extraction buffer and
incubate the tubes in a 60 °C water bath for 30 min with peri-
odic mixing by gently inverting the tubes every 10 min.
3. Add 600 μL of chloroform/isoamyl alcohol (24:1), and mix by
inverting the tubes several times until an emulsion is achieved.
4. Centrifuge the tubes at 12,000 rpm for 10 min using a
microfuge.
5. Transfer about 500 μL of the supernatant into a clean sterile

2 mL Eppendorf tube, and add 300 μL of isopropanol and
50 μL of 3 M Na-acetate.
6. Mix the contents by inverting the tubes several times, and then
incubate the tubes on ice for 30 min.
7. Centrifuge the tubes at 12,000 rpm for 10 min using a microfuge.
8. Discard the supernatant, and wash the pellet by adding 70 %
ethanol followed by inverting the tubes a few times.
9. Centrifuge the tubes at 12,000 rpm for 5 min using a microfuge,
and discard the supernatant.
10. Air-dry the pellet completely, add 30 μL of TE + RNase, and
then incubate at 60 °C to dissolve the DNA.
11. Dilute the isolated DNA 1/20 in sterile TE buffer before using
it for PCR amplification (see Note 4, Fig. 2b).
3.3 Extraction This method outlines a method to extract total DNA from archae-
of DNA from ological grain specimens (aDNA) using a published procedure [3]
Archaeological Grain but with minor modifications (see Note 5). Sterilize all pipet tips
Specimens and tubes by exposing to ultraviolet light at 254 nm for 30 min.
Ensure that all steps are carried out under clean bench conditions
and wearing plastic gloves except when cleaning archaeological
grain specimens and during the grinding procedure (see Note 6).
1. Clean each archaeological rice sample of any debris by sonica-
tion of samples under γ-sterile distilled water.
2. Dry each sample by air-drying and then using a bead grinder
to grind the samples into a fine powder in the presence of
25 μL of 0.5 N NaOH.
3. Using a sterile spatula, transfer the ground sample each into a
sterile Eppendorf tube.
4. Add 475 μL of extraction buffer, and gently mix by inverting
the tubes several times.
5. Incubate the tubes in a 65 °C water bath for 10 min, and then
centrifuge at 8,900 × g for 10 min using a microfuge.
6. Transfer the supernatant into a clean sterile Eppendorf tube
containing 900 μL of cooled 99.9 % ethanol. Mix gently by
inverting the tubes several times.
7. Centrifuge the tubes at 11,000 rpm for 10 min using a microfuge,
and transfer the supernatant into a fresh sterile Eppendorf tube
containing 30 μL of 3 M sodium acetate and 3.0 μL of ethachin-
mate. Mix gently by inverting the tubes several times.
microfuge, and transfer the supernatant into a fresh sterile
Fig. 3 Successful PCR amplification of a short region from nuclear genomic DNA
(nDNA) isolated from archaeological rice grain specimens. (a) Electrophoresis of
PCR products amplified, from ten archaeological rice grain specimens, with
Rpl14–Rpl16-specific primer sets; M1, 100 bp DNA ladder; M2, 20 bp DNA lad-
der; J, Modern japonica cv. “Nipponbare”; NC, no-template negative control
(dH2O); 1–10, archaeological rice grain specimens; (b) remains, ancient rice
remains such as chaff and grain (archaeological rice grain specimens). Sequence
details of primers to amplify nuclear genomic regions corresponding to indica
and japonica rice and archaeological rice specimens
Eppendorf tube containing 300 μL of 70.0 % ethanol. Mix

gently by inverting the tubes several times.
microfuge.
10. Discard the supernatant, and dry the pellet in air for a few
minutes.
11. Add 50 μL of TE buffer, and incubate the tubes for 10–15 min
in a 50 °C water bath to dissolve the pellet.
12. After the pellet has dissolved, transfer the aDNA solution into
a column filter to remove possible inhibitors affecting PCR.
13. The column-filtered aDNA can be stored at 4 °C or at −22 °C
for long-term storage.
14. Use the extracted aDNA for PCR amplification (see Note 7, Fig. 3).
4 Notes
1. Make sure that an even emulsion is obtained.

2. This method was successfully used to isolate high-molecular-
weight genomic DNA from endosperm tissue of Indica and
Japonica varieties, CH55(6-11) and Nipponbare, respectively
(Fig. 1). Genomic DNA from leaf tissue, isolated using an

alternate method (not described here), was used as a positive
control. The DNA concentration was determined by spectro-
photometry and also by intensity comparison of agarose
gel-resolved high-molecular-weight standard DNA controls.
3. The extracted DNA can be diluted to 35 ng/μL and be used
in a PCR for the successful amplification of chloroplast, mito-
chondrial, and genomic regions (Fig. 1b–e).
4. Amplified SSR amplicons were checked by electrophoresis (Fig. 2b).
5. In general, depending on materials such as plant or animal,
large-scale or small-scale, and modern or ancient samples, a
minor change might be needed in the DNA extraction proce-
dures as well as in PCR condition and desired amplicon size.
6. In case of ancient DNA extraction, working condition should
also be taken into account to avoid any contamination from
outside sources of DNA. The use of a negative control in the
PCR is essential, and we recommend undertaking extraction
replicates.
7. PCR amplification is basically done by a commonly used PCR
procedure. However, the PCR primer set should be designed to
amplify PCR products with a size less than 100 bp. Due to dete-
rioration of aDNA [4] during the PCR step leading to reduction
of PCR amplification, we recommend a second PCR amplifica-
tion step. This can be done using the PCR product from the first
amplification as a template and the same primer pair or design-
ing nested primer sets. Check the amplified PCR products by
resolving in a 3.0 % agarose gel using electrophoresis.
References
1. Pääbo S, Higuchii RG, Wilson AC (1989) 3. Aoki C, Nshimura T, Yasui S, et al (1999)

Ancient DNA and the polymerase chain Modification of DNA and RNA extraction
reaction. J Biol Chem 264:9709–9712 method in rice leaf using Multi Bead Shocker.
2. Yang DY, Eng B, Waye JS et al (1998) Technical Breeding Res Suppl 1:18
note: improved DNA extraction from ancient 4. Pääbo S, Poinar H, Serre D et al (2004) Genetic
bones using silica-based spin columns. Am J analyses from ancient DNA. Annu Rev Genet
Phys Aanthropol 105:539–543 38:645–679
Chapter 3
RNA Extraction from Cereal Vegetative Tissue

Julie A. Pattemore
Abstract
Ribonucleic acid (RNA) extraction is the necessary first step in many protocols, primarily to investigate
genes and gene expression. RNA comes in a variety of forms: total RNA, ribosomal RNA, messenger RNA
(mRNA), and small interfering RNA (siRNA) to name a few. In some instances, total RNA is all that is
required; however most applications will require the enrichment for some particular form of RNA. In
plants, including cereals, total RNA is a mixture of many types of RNA and enrichment is generally
required. In this protocol, the TRIzol® method of RNA extraction from cereal leaf material is described,
as it is a relatively simple technique.
Key words Plant RNA, TRIzol®
1 Introduction
A range of ribonucleic acid (RNA) extraction methods are avail-

able for isolating plant RNAs, depending on the tissues being
sampled. In general, cereal leaves are amenable to RNA extraction
and do not require complicated methods. In this section, the
TRIzol® method is described as a simple and inexpensive method
for RNA extraction from leaves. The TRIzol® method of RNA
extraction is an improvement on a protocol originally published in
1987 [1].
2 Materials
TRIzol® [2] is a phenol and guanidine isothiocyanate solution and

should be handled with utmost care. Always refer to the MSDS.
Always wear gloves when handling TRIzol®, preferably nitrile or
double-gloved latex. Avoid contact with skin or clothing or breath-
ing vapor and use in a fume hood. TRIzol can be stored for up to
12 months at 4 °C.
17
18 Julie A. Pattemore
RNA is rapidly degraded by RNases which are ubiquitous in

the laboratory environment. Use pipettors dedicated to RNA work
if possible. Decontaminate the work area and pipettes with
RNaseZAP® (Life Technologies Australia Pty Ltd) [3], a surface
decontaminant. Change gloves frequently.
2. Liquid nitrogen.
3. TRIzol® (Life Technologies, Australia).
4. DNase/RNase-free microtubes.
5. Refrigerated microfuge.
6. Chloroform.
7. Isopropyl alcohol (isopropranol).
8. 75 % Ethanol (v/v) in RNase-free distilled water.
9. RNase-free water.
10. RNaseZap® (Life Technologies, Australia).
11. DNase/RNase-free aerosol barrier pipette tips.
12. Vortex mixer.
13. Powder-free gloves.
14. Safety glasses.
3 Methods
Carry out all steps at room temperature (RT) unless otherwise

stated. Use DNase/RNase-free tips and tubes. While working
periodically spray RNaseZap onto gloves and pipettes to inactivate
RNases.
1. Using a mortar and pestle, grind less than 100 mg of plant tis-
sue to a fine powder in liquid nitrogen. Grind up to 100 mg of
tissue per mL of TRIzol® (see Note 1).
2. After grinding, transfer the powder to a microfuge tube, add
1 mL of TRIzol®, and shake moderately for several seconds.
Following homogenization, remove insoluble material from
the homogenate by centrifugation at 14,000 × g for 10 min at
2–8 °C (see Notes 2 and 3).
3. Transfer the supernatant to a fresh RNase-free tube, and pro-
ceed with chloroform addition and phase separation.
4. Incubate the homogenized samples for 5 min at RT to permit
the complete dissociation of nucleoprotein complexes.
5. Add 0.2 mL chloroform per 1 mL of TRIzol®. Secure the cap,
shake tubes vigorously by hand for 15 s, and incubate them at
RT for 2–3 min.
RNA Extraction from Vegetative Tissue 19
6. Centrifuge the samples at no more than 14,000 × g for 15 min

at 2–8 °C in a microfuge.
7. Transfer the supernatant to a fresh RNase-free tube.
8. Precipitate the RNA by mixing with isopropyl alcohol. Use
0.5 mL of isopropyl alcohol per 1 mL of TRIzol® used for
initial homogenization.
1. Incubate the samples at RT for 10 min, and centrifuge at no
more than 14,000 × g for 10 min at 2–8 °C in a microfuge.
2. Remove the supernatant, and wash the RNA pellet once with
75 % ethanol, adding at least 1 mL 75 % ethanol per 1 mL of
TRIzol® used for homogenization. Mix the sample by vortex-
ing, and centrifuge at no more than 5,500 × g for 5 min at
2–8 °C in a microfuge.
3. The RNA precipitate can be stored in 75 % ethanol at 2–8 °C
for at least 1 week or at least 1 year at −5 to −20 °C.
4. Briefly dry the RNA pellet (air-dry or vacuum dry for 5–10 min
only) (see Note 4).
5. Dissolve RNA in RNase-free water by passing the solution a
few times through a pipette tip and incubating for 10 min at
55–60 °C (RNA can also be redissolved in 100 % formamide
and stored at −70 °C).
6. Check RNA concentration and quality on Agilent Bioanalyzer
RNA chip (see Notes 5 and 6).
4 Notes
1. Homogenize in either an RNase-free precooled mortar and

pestle or an enclosed bead beater. When grinding in liquid
nitrogen, ensure that the sample does not thaw out. When
using a mechanical homogenizer ensure that the samples do
not get hot by moderating the speed and intensity of shaking.
Make a note of the volume of TRIzol® used. Samples can be
stored at −60 to −70 °C for at least 1 month prior to homog-
enization using RNAlater® (Life Technologies Australia Pty
Ltd). RNAlater® [4] is a nontoxic storage reagent which per-
meates and stabilizes cellular RNA and may be used before
homogenization to minimize the need to process samples or
freeze in liquid nitrogen immediately.
2. The resulting pellet contains extracellular membranes, polysac-
charides, and high-molecular-weight DNA, while the superna-
tant contains RNA.
3. Following centrifugation, the mixture separates into a lower
red phenol–chloroform phase, an interphase, and a colorless
upper aqueous phase containing the RNA.
20 Julie A. Pattemore
Fig. 1 Electropherogram (left) and digital gel (right) of total RNA (RIN 6.7) from
14-day-old wheat leaves analyzed on a Bioanalyzer 2100 RNA 6000 nano chip.
The 25S and 18S peaks correspond to the two darkest bands at the top of the
digital gel
4. Be careful not to over-dry the RNA pellet as this will increase

its insolubility. Partially dissolved RNA samples have an
A260/280 ratio less than 1.6.
5. Once the RNA is extracted, an aliquot should be run on an
Agilent Bioanalyzer 2100 RNA 6000 nano chip to assess quan-
tity and integrity. While the quantity of RNA is important, the
integrity of RNA is vital to establish before proceeding to
downstream applications such as cDNA library construction or
microarray analysis. Full-length transcripts are often required
for downstream applications; however, RNA is rapidly
degraded. When analyzing RNA samples using an Agilent
Bioanalyzer 2100, an RNA integrity number (RIN) is auto-
matically generated for each sample. The RIN is an unbiased
numerical scale from 1 to 10. The RIN decreases as degrada-
tion progresses. A typical output of the Agilent Bioanalyzer
2100 RNA 6000 nano chip from total RNA extracted from
wheat leaves is an electropherogram and a digital gel (Fig. 1.).
An example of degraded RNA is provided in Fig. 2.
RNA Extraction from Vegetative Tissue 21
Fig. 2 Electropherogram and digital gel of degraded total RNA (RIN 2.3) from
10-day-old wheat leaves analyzed on a Bioanalyzer 2100 RNA 6000 nano chip.
When compared to intact RNA, note the large fall in fluorescence units (FU) on
the y-axis and shift from well-defined peaks to smaller fragments on the electro-
pherogram and a dark smear at the bottom of the digital gel
6. If extracting RNA from underground tissue such as root sam-

ples, you may only observe two peaks corresponding to the
cytosolic ribosome large subunit 25S and mitochondrial ribo-
some smaller subunit 18S. Chloroplast rRNA peaks are likely
to be missing from these tissues.
References
1. Chomczynski P, Sacchi N (1987) Single-step 3. RNaseZap® technical insert (Life Technologies

method of RNA isolation by acid guanidinium Australia, Pty Ltd)
thiocyanate-phenol-chloroform extraction. Anal 4. RNAlater® technical insert (Life Technologies
Biochem 162:156–159 Australia, Pty Ltd)
2. TRIzol® Reagent technical insert
(Life Technologies Australia, Pty Ltd)
Chapter 4
RNA Extraction from Developing or Mature Wheat Seeds

Agnelo Furtado
Abstract
Cereal grains, as storage tissues of the plant, contain high amounts of starch. Purification of RNA from
plant tissue especially from seed tissue can be challenging due to this high starch content. Starch copre-
cipitates with RNA in the presence of isopropanol or ethanol and can interfere with the extraction process
and downstream reactions. Thus the removal of starch by using appropriate methods is necessary for
obtaining pure RNA to be processed for functional genomics analysis. We describe a method to isolate
large amount of good-quality RNA from developing and mature wheat grain which can also be adapted
to other cereal grains.
Key words RNA, Extraction, Starch, Cereal, Grain
1 Introduction
Purification of ribonucleic acid (RNA) from biological tissue is now

a routine procedure thanks to several kit-based methods. Extracting
good-quality RNA is important in plant functional genomics where
several techniques are used, such as RT-PCR, RNAi analysis, and
transcript profiling using NGS or microarray. The most common of
the RNA extraction methods use guanidium thiocyanate–phenol–
chloroform extraction [1, 2]. The use of a single solution based
around phenol–chloroform for extracting RNA is an attractive
option, and although it comes with the need to handle hazardous
chemicals such as phenol, it can be used to isolate RNA of good
quality from a number of species. The use of kit-based filter car-
tridge methods obviates the need to use hazardous chemicals such
as phenol–chloroform and provides highly purified RNA, but the
per-sample cost is high as compared to the latter method, mainly as
several cartridges need to be used to obtain the high amounts of
RNA required for genomic application such as transcriptome
23
24 Agnelo Furtado
sequencing. However, the use of both methods in sequence can

provide the benefits of both methods to isolate large amounts of
highly purified RNA. Thus, the RNA can be first isolated using the
guanidium–phenol method followed by purification using the
kit-based filter cartridge methods but using a single cartridge.
Isolation of purified RNA for different plant tissues can pose differ-
ent challenges mainly due to impurities in different plant tissues,
such as phenolic compounds and starch. Starch coprecipitates at the
RNA precipitation step with isopropanol, leading to reduced yield
of RNA and high contamination with starch. In addition, impuri-
ties in the isolated RNA can interfere with downstream reactions.
The method described here is a combination of two distinct
methods, which can be used to isolate high yields of good-quality
RNA from wheat seed tissue: the Trizol plus RNA purification kit
(Invitrogen, USA) in sequential combination with the RNeasy
Plant Mini Kit (Cat# 74903, Qiagen, USA).
2 Materials
2.1 Pulverizing 1. Liquid nitrogen.

of Seed 2. Cryo-jars; 50 mL (Retsch, USA).
3. Metal ball; 2.5 cm in diameter and 63 g in weight.
4. Mixer Mill (Cat# MM301, Qiagen or Retsch, USA).
5. Developing or mature wheat grains; fresh or frozen.
6. Polystyrene containers with 1 ft (30 cm) dimensions
(length × breadth × height), RNAse-free 50 mL tubes (Falcon,
USA).
7. Protective eyewear and gloves.
8. Bleach solution containing 1 % sodium hypochlorite solution,
prepared in water (v/v).
2.2 First-Step RNA 1. RNaseZap.

Extraction 2. Trizol plus RNA purification kit (Invitrogen, USA).
3. Refrigerated centrifuge suitable for 50 mL tubes.
4. Chloroform RNAse-free tubes, 15 and 50 mL.
5. RNAse-free filtered tips, 20, 200, and 1,000 μL.
2.3 Second-Step 1. RNeasy Plant Mini Kit (Cat# 74903, Qiagen, USA).
RNA Extraction 2. 96–100 % Ethanol.
4. RNAse-free tubes, 2 mL.
RNA Extraction from Wheat Seeds 25
3 Methods
Use DNase/RNase-free tips and tubes. While working periodically

spray RNaseZap onto gloves and pipettes to inactivate RNases. The
method described here can be scaled to the weight of seed used.
3.1 Pulverizing 1. Take roughly 500 mg of seeds (10 developing or 15 mature

of Seed seeds). Follow the sterilization step if using mature seeds
(see Note 1).
2. Place the seeds in an appropriate container, and snap freeze the
seeds in liquid nitrogen before pulverization.
3. Cool the Cryo-jars and the metal balls by immersing in liquid
nitrogen for 2–3 min (or until no bubbling of liquid
nitrogen).
4. Remove the cooled Cryo-jars and metal ball and place for
1 min partly immersed in liquid nitrogen contained in another
polystyrene container. This step ensures evaporation of any
residual liquid nitrogen from the metal ball, the inside of the
Cryo-jars, and lids (see Note 2).
5. Immediately transfer the snap-frozen wheat seeds into the
cooled Cryo-jar, place the cooled metal ball, and then close the
Cryo-jar with its screw-cap lid (see Note 3).
6. Immerse the closed Cryo-jars containing the metal ball and the
seeds into liquid nitrogen to cool. Keep immersed until no
bubbling is observed.
7. Using a pair of tongs take the cooled Cryo-jar and mount on
the mixer mill for grinding (see Note 4).
8. Start the mixer mill at these settings: time at 60 s and fre-
quency of oscillations at 25.
9. At the end of the cycle, dismount the Cryo-jars, unscrew the
lids, and using a liquid nitrogen-cooled spatula transfer the
seed powder into 50 mL tubes kept in a rack that is immersed
in liquid nitrogen.
10. The pulverized seed powder can now be used for RNA extrac-
tion or be stored at −70 °C until further use.
3.2 First-Step RNA Steps 1–7 should be carried out in a fume hood except for the
Extraction centrifugation of tubes.
1. Transfer the pulverized seed powder (500 mg) at −70 °C into
a 50 mL tube containing 5 mL of Trizol reagent (see Note 5).
2. Mix sample by gentle inversion or rocking motion for 2–3 min
at room temperature, and incubate the lysate at room tempera-
ture for 5 min to allow complete dissociation of nucleoprotein
complexes.
26 Agnelo Furtado
3. Centrifuge at 15,000 rpm (no more than 12,000 × g) for

10 min at 4°C.
4. Transfer the supernatant into a fresh 15 mL tube, and measure
the volume. Add 0.2 mL chloroform per 1 mL TRIzol® reagent
used. Shake the tube vigorously by hand for 15 s (see Note 6).
5. Incubate for 2–3 min at room temperature.
6. Centrifuge at 15,000 rpm (no more than 12,000 × g) for
10 min at 4 °C (see Note 7).
7. Transfer the colorless upper phase (app 2 mL) containing the
RNA to a fresh 15 mL RNase-free tube.
3.3 Second-Step The next steps are part of the Qiagen RNeasy mini kit. As the RNA
RNA Extraction is present in the aqueous phase (Subheading 3.2, step 7) we start
the purification procedure by starting at the RLC step of the
Qiagen RNeasy kit step. We strongly recommend adding 2 mL of
RLC buffer to every 2 mL of RNA aqueous solution (see Note 8).
Follow the procedure outlined below, which are selected steps
extracted from the RNeasy handbook supplied with the kit.
1. Add 1 mL of RLC buffer for every 1 mL of RNA aqueous
solution. Mix the contents thoroughly by inverting the tubes
several times.
2. Add 0.5 volume of ethanol (96–100 %), and mix immediately
by pipetting or gently inverting the tubes several times
(see Note 9). Proceed immediately to the next step.
3. This step is trapping the RNA onto a membrane anchored into
a spin column (RNeasy spin column). Transfer the ethanol–
RNA mixture from step 2 including any precipitate that may
have formed to an RNeasy spin column (pink) placed in a
2 mL collection tube (this is supplied with the kit). Close the
lid, and centrifuge for 15 s at 7,400 × g using a microfuge.
Discard the flow-through (see Note 10). Reuse the collection
tube for the next step.
4. The next step involves washing the spin column membrane.
Add 700 μL of RW1 buffer to the RNeasy spin column, close
the lid, and centrifuge for 15 s at 10,000 rpm using a microfuge.
Discard the flow-through (see Note 11). Reuse the collection
tube in the next step.
5. This next step also involves washing the spin column mem-
brane. Add 500 μL buffer RPE (see Note 12) to the RNeasy
spin column, close the lid gently, and centrifuge for 15 s at
10,000 rpm using a microfuge. Discard the flow-through.
Reuse the collection tube in the next step.
6. This next step also involves washing the spin column membrane.
Add 500 μL buffer RPE to the RNeasy spin column, close the
lid gently, and centrifuge for 2 min at 10,000 rpm using a
microfuge (see Note 13).
RNA Extraction from Wheat Seeds 27
7. We strongly recommend this step although it is indicated as

optional in the kit handbook. Discard the old collection tube
with the flow-through, place the RNeasy spin column in a
new 2 mL collection tube, and centrifuge at full speed for
1 min (see Note 14).
8. After centrifugation, carefully remove the RNeasy spin column
from the collection tube so that the column does not contact
the flow-through. Otherwise, carryover of ethanol will occur.
9. Place the RNeasy spin column in a new 1.5 mL collection tube
(supplied with kit). Add 90 μL RNase-free water directly to the
spin column membrane and not on the inner side of the spin
column. Close the lid gently, and centrifuge for 1 min at
10,000 rpm, using a microfuge, to elute the RNA.
10. If the expected RNA yield is >30 μg, repeat step 11 using
another 30–50 μL RNase-free water or using the eluate from
step 9 (if a high RNA concentration is required).
4 Notes
1. If using mature seeds then surface sterilize prior to extraction.

Rinse with 70 % ethanol for 1 min, and then rinse several times
with distilled water and blot dry.
2. Ensure that liquid nitrogen is not present inside the Cryo-jars.
Make sure that all liquid nitrogen evaporates from the Cryo-
jars before proceeding to the next step.
3. If residual liquid nitrogen is carried over via the frozen seeds,
ensure that it evaporates before securing the Cryo-jar lid.
4. Attempting to pulverize the seeds using a mortar and pestle is
not a good choice. When frozen the seeds become hard like
stones, and crushing them in a mortar and pestle involves
banging the seeds with the pestle to fracture the seeds into
smaller bits. This process leads to material spilling out of the
mortar. Thus, pulverizing frozen seeds using this method
causes the loss of precious material, and it is preferable to use
the mixer mill to pulverize the seeds.
5. The sample volume should not exceed 10 % of the volume of
TRIzol® reagent used for homogenization.
6. Vortexing may increase DNA contamination of your RNA
sample. Avoid vortexing if your downstream application is sen-
sitive to the presence of DNA, or perform a DNase digestion
step during RNA purification or after purification.
7. After centrifugation, the mixture separates into a lower, red
phenol–chloroform phase, an interphase, and a colorless upper
aqueous phase which contains the RNA. The volume of the
aqueous upper phase should be approx 2.5 mL.
28 Agnelo Furtado
8. It is not necessary to add the RLC buffer as indicated in the

RNeasy procedure for leaf tissue, but it is critical for seed tissue
or tissues containing high amounts of starch.
9. Do not centrifuge. Precipitates may be visible after addition of
ethanol, but this does not affect the procedure.
10. If the ethanol–RNA mixture volume exceeds 700 μL, then
centrifuge successive aliquots in the same RNeasy spin column
but discarding the flow-through after each centrifugation.
11. After centrifugation, carefully remove the RNeasy spin column
while ensuring that the spin column does not come into con-
tact with the flow-through. Discard all the flow-through, and
place RNeasy spin column back into the empty collection tube.
12. Buffer RPE is supplied as a concentrate. Ensure that ethanol is
added to buffer RPE before use.
13. This step involves a longer centrifugation time to ensure that
the column is dry and does not contain ethanol as carryover
during RNA elution. Residual ethanol may interfere with
downstream reactions.
14. Perform this step to eliminate any possible carryover of buffer
RPE or if residual flow-through remains on the outside of the
RNeasy spin column after step 6.
References
1. Chomczynski P, Sacchi N (2006) The single-step 2. Bird IM (2005) Extraction of RNA from cells
method of RNA isolation by acid guanidinium and tissue. Methods Mol Med
thiocyanate-phenol-chloroform extraction: 108:139–148
twenty-something years on. Nat protoc 1:581–
585. doi:10.1038/nprot.2006.83
Chapter 5
cDNA Library Preparation

Maarten Kooiker and Gang-Ping Xue
Abstract
The construction of full-length cDNA libraries allows researchers to study gene expression and protein
interactions and undertake gene discovery. Recent improvements allow the construction of high-quality
cDNA libraries, with small amounts of mRNA. In parallel, these improvements allow for the incorporation
of adapters into the cDNA, both at the 5′ and 3′ end of the cDNA. The 3′ adapter is attached to the oligo-
dT primer that is used by the reverse transcriptase, whereas the 5′ adapter is incorporated by the template
switching properties of the MMLV reverse transcriptase. This allows directional cloning and eliminates
inefficient steps like adapter ligation, phosphorylation, and methylation. Another important step in the
construction of high-quality cDNA libraries is the normalization. The difference in the levels of expression
between genes might be several orders of magnitude. Therefore, it is essential that the cDNA library is
normalized. With a recently discovered enzyme, duplex-specific nuclease, it is possible to normalize the
cDNA library, based on the fact that more abundant molecules are more likely to reanneal after denatur-
ation compared to rare molecules.
Key words Reverse transcriptase, Duplex-specific nuclease, MMLV, Template switching, mRNA,
cDNA, Library
1 Introduction
The construction of cDNA libraries is an important technique that

allows for the discovery of expressed genes and splicing forms, and
the library can be screened for gene products that interact with
other proteins, DNA, or antibodies. Several developments have
occurred during the last decades, allowing for the construction of
high-quality cDNA libraries with as little as 50 ng of mRNA as
starting material, whereas previously several micrograms were nec-
essary. Therefore it is possible to make high-quality cDNA libraries
from a few cells if the sample size is small or the tissue type is rare.
Ideally, only full-length clones of the mRNAs are included in a
cDNA library. However, since many transcripts are not stable and
the reverse transcriptase (RT) enzyme is often interrupted (due to
secondary structure of the RNA or other factors), cDNA
29
30 Maarten Kooiker and Gang-Ping Xue
libraries often contain a large amount of truncated cDNA clones.

To overcome this problem, different strategies were developed.
One of these strategies makes use of the fact that mature eukary-
otic mRNA molecules are 5′ capped. For example, Carnicini et al.
[1] described the biotinylation of the cap, allowing full-length and
mature mRNA molecules to be selected. Subsequently, they made
use of the enzyme terminal deoxynucleotidyl transferase to add an
oligo(dG) tail to the 3′ end of the cDNA. The second strand of
cDNA is synthesized by priming the first strand with an oligo(dC)
primer, containing a restriction enzyme recognition site as well.
This method generates full-length cDNA clones, though the bioti-
nylation step is a time-consuming two-step process. Another strat-
egy makes use of the ability of the Moloney murine leukemia virus
retro transcriptase (MMLV RT) to switch RNA template when
arrived at the end of the RNA strand [2]. This property of MMLV
RT is used to attach an adapter at the 3′ end of the first-strand
cDNA. Since this template switching preferentially occurs when
the enzyme reaches the end of the molecule, with this method
preferably full-length RNA molecules contain the adapter, whereas
partially retro-transcribed RNAs do not have the adapter and hence
will not be included in the cDNA library.
Another problem with cDNA library construction is the vari-
ability of expression levels of genes. The expression of high
expressed genes may be several orders higher than the expression
of low expressed genes. Thus, there is a risk that genes with low
expression may get lost in the procedure and consequently may
not be represented in the cDNA library. On the other hand, genes
that are highly expressed may result in hundreds of positive clones
when the library is screened for interactions. To solve these prob-
lems the cDNA library should be normalized. Several methods
have been developed for this normalization, and most of the meth-
ods make use of the fact that more abundantly present DNA mol-
ecules are more likely to reanneal after denaturation [3]. However,
most of these methods have various drawbacks like unequal nor-
malization for long and short cDNAs and the secondary structures
of cDNA resulting in cleavage of cDNAs if restriction enzymes are
used for normalization [4]. Most of the drawbacks can be pre-
vented by making use of the enzyme duplex-specific nuclease
(DSN) that preferentially cleaves double-stranded DNA molecules
(DNA–RNA and DNA–DNA) [5]. This enzyme is stable at high
temperatures that prevent the double-stranded features of cDNA
molecules caused by secondary structures. Therefore this enzyme
is ideal to degrade abundant transcripts and normalize cDNA
libraries [5–7]. After this normalization step, an amplification step
with as few cycles as possible will result in a normalized
double-stranded cDNA population with adapters that will allow
for the cloning of cDNAs into the vector of choice.
cDNA Library Preparation 31
With the use of MMLV RT- and DSN-directed depletion of

abundant transcripts, cDNA libraries that are full-length enriched
and normalized can be constructed in a short time and with rela-
tively small amount of total RNA or mRNA as starting material.
2 Materials
2.1 First-Strand 1. 100 U/μL SMARTScribe MMLV reverse transcriptase

cDNA Synthesis (Clontech, USA).
2. 50 ng to 1 μg mRNA.
3. Adapter A: 5′-AACCTGATGTAGTTAGCTGAGGCCAT
TATGGCC (T)30VN-3′ (with V is A, C, or G and N is any
nucleotide): underlined is the Sfi I recognition site, and
sequences in bold can be varied, (see Note 1).
4. Adapter B: 5′-d(GCCATTGCACACGACTACCTGGGCC
GCCTCGGCC)-r(GGG)-3′ (where r stands for ribonucleo-
tides; underlined is the Sfi I recognition site, and sequences in
bold can be varied, see Note 1).
5. 10 mM dNTP mix containing dATP, dCTP, dGTP, and dTTP,
each at 10 mM.
6. 50 mM Dithiothreitol (DTT).
7. 5× First-strand buffer; 250 mM Tris–HCl, pH 8.3, 30 mM
MgCl2, and 375 mM KCl.
8. 40 U/μL RNasin Plus (Promega, USA).
9. 2 U/μL RNase H.
10. RNase-free water.
2.2 Second-Strand 1. cDNA from previous step.

Synthesis 2. Oligo C: GCCATTGCACACGACTACCTG (sequence corre-
sponding to the adapter sequence of “Adapter B” above).
3. Oligo D: GCACCTGAGGTGGTTAGCTGA (sequence cor-
responding to the adapter sequence of “Adapter A” above).
4. 5× Expand High FidelityPLUS reaction buffer with 7.5 mM
MgCl2 (Roche Applied Science, NSW, Australia).
each at 10 mM.
6. 5 U/μL Expand High FidelityPLUS enzyme blend (Roche
Applied Science, NSW, Australia).
7. PCR purification kit (QIAquick PCR Purification kit, Qiagen,
USA).
8. 4 M Sodium chloride.
9. 100 % Ethanol.
10. 75 % Ethanol (v/v) prepared in distilled water.

11. 20 mg/mL Glycogen (Roche).
2.3 Normalization 1. Double-stranded cDNA.

2. 4× Hybridization mix: 200 mM HEPES, pH 7.4, 2 M NaCl,
and 0.8 M EDTA.
3. 2 U/μL Duplex Specific Nuclease (Evrogen, Moscow, Russia).
4. 10× DSN buffer (Evrogen, Moscow, Russia).
5. 50 mM DSN storage buffer; Tris–HCl, pH 8.0.
2.4 Analysis of cDNA 1. Normalized cDNA.

Normalization 2. 5× Expand High FidelityPLUS reaction buffer with 7.5 mM
MgCl2 (ROCHE Applied Science, NSW, Australia).
each at 10 mM.
4. Oligo C: GCCATTGCACACGACTACCTG (sequence corre-
2.5 Amplification 1. Normalized cDNA.

of cDNA 2. 5× Expand High FidelityPLUS reaction buffer with 7.5 mM
MgCl2 (Roche Applied Science, NSW, Australia).
each at 10 mM.
4. Oligo C: GCCATTGCACACGACTACCTG (sequence corre-
7. PCR purification kit (e.g., QIAquick PCR Purification kit,
Qiagen, USA).
8. 4 M Sodium chloride.
9. 100 % Ethanol.
11. 0.2× TE buffer: 2 mM Tris–Cl, pH 8 and 0.2 mM EDTA.
12. 20 mg/mL Glycogen (Roche, USA).
2.6 Digestion 1. 20 U/μL Sfi I restriction endonuclease (New England Biolabs,

and Ligation USA).
2. 10× NE Buffer 4 (New England Biolabs, USA).
3. 3 U/μL T4 DNA ligase (Promega, USA).
4. 5× T4 ligase buffer: 125 mM Tris–Cl, pH 7.6, 30 mM MgCl2,
2.5 mM DTT, and 12.5 % (w/v) PEG8000.
5. 0.5 μg/μL pTripleEx2Vector (Clontech, USA).
6. Library scale competent cells (e.g., MAX Efficiency DH5α
Competent Cells, Invitrogen).
7. PCR purification kit (QIAquick PCR Purification kit, Qiagen,
USA).
8. 4 M NaCl.
9. 10 mM ATP.
10. 100 % Ethanol.
12. 1 U/μL calf intestine alkaline phosphatase (Roche, USA).
13. CHROMA SPIN TE-400 Column (Clontech, USA).
14. 20 mg/mL Glycogen (Roche, USA).
15. Phenol:chloroform:isoamyl alcohol (PCI) (25:24:1, v/v/v).
16. Chloroform:isoamyl alcohol (CI) (24:1, v/v).
3 Methods
3.1 First-Strand The most important factor in making a good cDNA library is the
Synthesis preparation of high-quality mRNA (poly A+ RNA) and take
necessary precautions to prevent the degradation of RNA (see Note
2). Preferably use purified mRNA although total RNA can be used.
In this protocol it is essential to make use of MMLV RT, as it has
the template switching property. The oligo-dT used to prime the
reverse transcriptase has an adapter A, which can contain a rare
restriction site like Sfi I or a sequence that is homologous to
nucleotides from a yeast vector (which will allow you to use
homologous recombination in yeast downstream, see Note 3).
Adapter B is a DNA–RNA hybrid, which will allow the MMLV RT
to switch template when at the end of the RNA [2].
1. Prepare a PCR tube with the following contents:
mRNA (0.5 μg/μL) 2 μL

Adapter A (12 μM) 1 μL
RNase-free water 1 μL
2. Incubate tube at 72 °C for 2 min in a thermocycler with heated

lid (see Note 4).
3. Cool the tube on ice for 2 min, and briefly spin tube.
4. Add the following mix to the tube:
5× First-strand buffer 2 μL
DTT (50 mM) 0.5 μL
dNTP mix 1 μL
SMARTScribe MMLV 1 μL
reverse transcriptase
RNasin Plus 0.5 μL
5. Mix by pipetting, and incubate in a thermal cycler with heated

lid (see Note 4) for 10 min at 42 °C (see Note 8).
6. Add 1 μL of adapter B (12 μM) to the reaction tube, mix by
pipetting, and incubate for 1.5 h at 42 °C.
7. Inactivate enzyme for 10 min at 70 °C.
8. Cool the tube for 2 min on ice, add 1 μL RNase H (2 units),
and incubate at 37 °C for 20 min, followed by heating at 85 °C
for 5 min.
9. Proceed to second-strand synthesis or store cDNA at −20 °C.
3.2 Double-Stranded This step makes use of the specific adapter that is incorporated by
cDNA Synthesis MMLV RT. Only cDNA molecules with these adapters are primed
for second-strand synthesis, using the specific sequence added to
the cDNA by the incorporation of adapter A and adapter B.
1. Prepare the following mix in a PCR tube:
cDNA from 10 μL
Subheading 3.1
Oligo C (10 μM) 8 μL
Oligo D (10 μM) 8 μL
5× EHF PLUS
buffer 40 μL
dNTP mix 4 μL
EHFPLUS enzyme blend 2 μL (see Note 5)
H2O Up to 200 μL final volume
2. Mix well by pipetting, and divide it into four tubes. Incubate

at 94 °C for 1 min using a thermal cycler with heated lid
(see Note 4), and then cycle six to eight times through the fol-
lowing conditions:
94 °C for 15 s.
60 °C for 30 s.
68 °C for 6 min.
3. After cycles, do final elongation at 68 °C for 15 min.
4. Purify the PCR reaction with QIAquick PCR purification kit,
and elute DNA in a total volume of 100 μL of 0.2× TE.
5. Determine the concentration of the purified cDNA. (If the
concentration is lower than 50 ng/μL precipitate the cDNA
by adding 1/20 volume of NaCl and 2.5 volumes of 100 %
ethanol to the DNA (optional: 10 μg of glycogen may be
added to prevent the potential loss of DNA during precipita-
tion, see Note 6). Leave on ice for 4 h, and spin tube at
12,000 × g and 4 °C for 20 min. Wash the pellet carefully with
75 % ethanol. Dissolve the DNA to a final concentration of
50–75 ng/μL in 0.2× TE buffer (see Note 10)).
3.3 Normalization As there might be a difference in the presence of several magnitudes

of the expression between high and low expressed genes, a
normalization step is required. This will allow cloning of rare
transcripts and prevent picking up thousands of positive clones that
represent the same expressed gene when the library is screened.
1. Prepare four PCR tubes containing the following mix:
Double-stranded cDNA 15 μL
(50–75 ng/μL)
4× Hybridization mix 5 μL
2. Overlay the reaction mixture with a drop of mineral oil (see

Note 7), and spin the tube at 10,000 × g for 1 min.
3. Incubate the tube in a thermocycler with heated lid (see Note 4)
for 2 min at 98 °C and 5 h at 68 °C.
4. Prepare four tubes labelled 5, 2.5, 1.25, and 0 containing the
following mix, and preheat the tube for 5 min at 68 °C:
10× DSN buffer 5 μL

H2O 20 μL
5. Dilute the DSN enzyme with storage buffer to obtain 1, 0.5,

and 0.25 U/μL solutions. Add 5 μL of the diluted enzymes to
the labelled tubes from step 3 and 5 μL of water to the tube
labelled 0.
6. Add the preheated DSN mix (a total volume of 30 μL) at

68 °C to the cDNA tube at 68 °C, and incubate at 68 °C for
25 min (see Note 11).
7. Inactivate DSN by heating at 95 °C for 8 min. Samples can be
stored at −20 °C for cDNA amplification.
3.4 Analysis of cDNA Optimal DSN treatment is determined according to a published

Normalization procedure [6]. Additionally the normalization can be tested by
PCR-amplifying a selected set of genes known to have a wide range
of expression levels using gene-specific primers (see Note 9).
1. Set up a PCR reaction using the procedure as described in
Subheading 3.5 and the non-normalized control sample tube
labelled 0. Take a sample of 5 μL from the PCR mixture at
cycles 7, 9, 11, 13, and 15. Run these samples on a 1.5 % (w/v)
agarose gel to determine the optimum number of cycles. The
optimum number of cycles is reached when the smear and
some bands of abundant transcripts are visible [6].
2. Prepare PCR reactions as above with the normalized sample
tubes using the optimum number of cycles plus an additional
5–9 cycles. Run 5 μL of these PCR products on a 1.5 % (w/v)
agarose gel to determine which tube has the best normalized
cDNA. The optimum cDNA normalization is reached when
no bands are visible in the amplification product and the high-
molecular-weight cDNAs are not degraded [6].
3.5 Amplification This step is necessary to obtain a sufficient amount of double-

of cDNA stranded DNA for construction of a cDNA library, but care should
be taken to keep the number of amplification cycles to the
minimum, as some DNAs amplify more efficiently than others, and
therefore too many cycles will result in a bias.
1. Prepare ten PCR tubes containing the following mix:
Normalized cDNA 1 μL
5× EHFPLUS buffer 10 μL
10 mM dNTP mix 1 μL
Oligo C (10 μM) 2 μL
Oligo D (10 μM) 2 μL
EHFPLUS enzyme blend 0.5 μL (see Note 5)
H2O Up to 50 μL
2. In a thermocycler with heated lid (see Note 4) incubate the

tube at 95 °C for 2 min and perform 10–16 cycles (to obtain
about 1 μg PCR product per 50 μL of reaction) through the

following steps:
94 °C for 15 s.
60 °C for 30 s.
68 °C for 6 min.
3. After cycles, do the final elongation at 68 °C for 15 min.
4. Pool the PCR products (depending on column capacity), and
purify the amplified PCR product with a PCR-cleanup kit
(e.g., QIAquick PCR Purification kit, Qiagen). Pool the eluted
cDNA and proceed to the next step.
5. Precipitate the DNA with 1/20 volume of 4 M NaCl and 2.5
volumes of ethanol (optional: 10 μg of glycogen may be added
to prevent the potential loss of DNA during precipitation),
keep on ice for 4 h, and spin at 12,000 × g and 4 °C for 20 min.
Wash pellet with 75 % ethanol, and resuspend DNA in 10 μL
H2O (or 0.2× TE buffer if you need to store the DNA)
(see Note 10).
3.6 Digestion At this point the double-stranded cDNA should contain adapters
and Ligation at both ends of the DNA molecule that contain very rare restriction
sites such as Sfi I for directional cloning. These sites should be
present in your vector as well, allowing the ligation of the cDNA
into your vector of interest.
1. Digest the vector and the cDNA in two separate tubes contain-
ing the following mix:
Vector or cDNA 10 μL
10× NEBuffer 4 10 μL
Sfi I restriction 5 μL
endonuclease
H2O Up to 100 μL
2. Incubate tubes at 50 °C for 3 h.

3. Dephosphorylate the vector by adding 2 μL of CIAP (1 U/μL)
to the digested vector. Incubate for 1 h at 37 °C.
4. Clean up the vector DNA with a QIAquick PCR clean-up kit.
5. Do the size fractionation of the digested cDNA sample with a
CHROMA SPIN TE-400 column, following the manufactur-
er’s instructions. Pool the fractions containing the desired sizes
of cDNAs. Clean up the cDNAs by extraction once with PCI
and once with CI to remove residual proteins.
6. Precipitate the vector DNA and fractionated cDNAs with

1/20 volume of NaCl and 2.5 volumes of ethanol (optional:
10 μg of glycogen may be added to prevent the potential loss
of DNA during precipitation). Keep on ice for 4 h. Spin DNA
at 12,000 × g and 4 °C for 20 min. Wash pellet with 75 % etha-
nol. Dissolve DNA in about 10 μL H2O (see Note 10).
7. Set up four ligation reactions with the following mix:
Vector (0.25 μg/μL) 2 μL 2 μL 2 μL 2 μL

cDNA (0.2 μg/μL) 1 μL 1.5 μL 2.5 μL 4 μL
5× T4 ligation buffer 2 μL 2 μL 2 μL 2 μL
10 mM ATP 0.5 μL 0.5 μL 0.5 μL 0.5 μL
H2O 4 μL 3.5 μL 2.5 μL 1 μL
T4 DNA ligase 0.5 μL 0.5 μL 0.5 μL 0.5 μL
8. Ligate at 16 °C for 16–20 h.

9. Transform the ligation mixes to library scale competent cells,
following the manufacturer’s instructions.
10. To determine the titer of the library, plate a small aliquot of the
library on selective plates and calculate the number of clones
present in the libraries.
4 Notes
1. If the cDNA library is to be transformed into yeast and inte-

grated into the vector with homologous recombination, the
sequence of the adapters A and B have to be homologous to
the insertion site of the vector (see Clontech Mate and Plate
Library construction manual for more information).
2. When working with RNA, take necessary standard precautions
like wearing gloves and using RNase-free reagents. If necessary
use products like RNaseZap (Invitrogen, USA) to clean work-
bench, pipettes, and other surfaces.
3. For more information on the library construction using
homologous recombination in yeast refer to the Clontech
Mate and Plate Library construction manual [8].
4. If a thermocycler with heated lid is not available overlay the
reaction mix with a drop of mineral oil.
5. For the amplification of very long transcripts it is possible to
use the enzyme Advantage 2 Polymerase Mix (Clontech,
USA), though the error rate of this enzyme is higher compared
to the Expand High FidelityPLUS enzyme mix. If choosing to
use this enzyme adhere to the composition of the PCR mix as

described by the manufacturer.
6. Glycogen might decrease the efficiency of downstream
enzymatic reactions, but it lowers the risk of losing the DNA
pellet, which might be a problem when precipitating small
amounts of DNA.
7. It is important to overlay the reaction mix with mineral oil, as
otherwise the evaporation will lead to a change of concentra-
tion of salts, which will affect the hybridization of the cDNA.
8. The transcription of full-length cDNA may be increased by
adding trehalose to the reaction mixture, allowing the reverse
transcriptase to be active at a higher temperature. This increased
temperature decreases secondary structures of the RNA, result-
ing in an increase of reverse transcription of long mRNA mol-
ecules and mRNA molecules with strong secondary structures.
See ref. 9 for procedures.
9. When testing the normalization by amplification of specific
genes, design primers to amplify a high expressed gene and a
low expressed gene. After amplification of the genes by normal
PCR, visualize the PCR products on a gel. The intensity of the
bands amplified from the normalized sample should be more
similar than the bands amplified from the non-normalized
sample.
10. With ethanol precipitations take special care that all ethanol is
evaporated before dissolving the DNA in water or TE. Residual
ethanol will interfere with downstream enzymatic reactions.
Do not overdry the pellet as this will give problems with dis-
solving the DNA.
11. Add the DSN enzyme as quickly as possible, without allowing
the reaction mixture to cool down, as this will result in an
increase of annealing of cDNA molecules and formation of
secondary structures, which will result in the degradation of
the cDNA by the DSN enzyme.
References
1. Carninci P, Kvam C, Kitamura A et al (1996) 3. Young DD, Anderson M (1985) Quantitative

High-efficiency full-length cDNA cloning by analysis of solution hybridization. In: Hames BD,
biotinylated CAP trapper. Genomics Higgins SJ (eds) Nucleic acids hybridisation: a
37:327–336 practical approach. IRL Press, Oxford, pp 47–71
2. Zhu YY, Machleder EM, Chenchik A et al (2001) 4. Zhulidov PA, Bogdanova EA, Shcheglov AS et al
Reverse transcriptase template switching: a SMART (2004) Simple cDNA normalization using kam-
approach for full-length cDNA library construc- chatka crab duplex-specific nuclease. Nucleic
tion. Biotechniques 30:892–897 Acids Res 32:e37. doi:10.1093/nar/gnh031
5. Shagin DA, Rebrikov DV, Kozhemyako VB remove selected transcripts from cDNA popula-
et al (2002) A novel method for SNP detection tions. Mol Biotechnol 41:247–253
using a new duplex-specific nuclease from crab 8. Clontech (2009) Make your own “Mate&Plate"
hepatopancreas. Genome Res 12:1935–1942 library system user manual. PT2085-1.
6. Bogdanova EA, Barsova EV, Shagina IA et al 9. Carninci P, Nishiyama Y, Westover A et al
(2011) Normalization of full-length-enriched (1998) Thermostabilization and thermoactiva-
cDNA. Methods Mol Biol 729:85–98 tion of thermolabile enzymes by trehalose and
7. Bogdanova EA, Shagina IA, Mudrik E et al its application for the synthesis of full length
(2009) DSN depletion is a simple method to cDNA. Proc Natl Acad Sci U S A 95:520–524
Chapter 6
Preparation of High Molecular Weight gDNA and Bacterial

Artificial Chromosome (BAC) Libraries in Plants
Siddanagouda S. Biradar, Xiaojun Nie, Kewei Feng, and Song Weining
Abstract
Bacterial artificial chromosome (BAC) libraries are extremely valuable large-insert DNA libraries for
physical mapping, positional cloning, comparative genomic analysis, complete genome sequencing, and
evolutionary studies. Due to their stability and relative simplicity BAC libraries are most preferred over
other approaches for cloning large genomic DNA fragments for large-insert libraries. Isolation of intact
high molecular weight (HMW) DNA is a critical step underlying the success of large-insert genomic DNA
library construction. It requires the isolation of purified nuclei, embedding them into LMP agarose plugs,
restriction digestion of the plugs, and quite often size selection using PFGE and electro-elution of insert
DNA. The construction of BAC libraries is complex and challenging for most molecular laboratories.
To facilitate the construction of BAC libraries, we present a step-by-step protocol for isolation of HMW
DNA and construction of plant BAC libraries.
Key words Plant, Bacterial artificial chromosome (BAC), Pulsed field gel electrophoresis (PFGE),
Genomic DNA library
1 Introduction
Isolation of high-quality high molecular weight DNA (HMW-

DNA) is the most critical and challenging step for constructing
successful plant genome libraries. For plants, the presence of plant
cell wall, plastids, and secondary metabolites like polyphenolics
readily contaminates the DNA and makes it unusable for down-
stream applications. Hence, for high-quality HMW DNA isolated
from plants, we need to take care to get rid of organellar DNA,
phenolic substances and avoid physical shearing of the DNA dur-
ing preparation. In the late 1980s, cloning of megabase-sized
DNA fragments became possible with the advent of cloning vec-
tors like Yeast Artificial Chromosomes (YACs) with 300–1,500 kb
carrying capacity [1]. However, they posed serious drawbacks like
chimaerism, low cloning efficiency, instability of the insert DNA
fragments, and were found unsuitable for high-resolution genome
41
42 Siddanagouda S. Biradar et al.
analysis [2–4]. To circumvent these drawbacks, several other

cloning systems with different carrying capacity have been estab-
lished, viz., cosmid (35–45 kb) [5], fosmid (35–45 kb) [6], P1
phage (25 kb) [7], BAC (50–300 kb) [8], P1-derived artificial
chromosome (PAC, 100–300 kb) [9], and Human Artificial
Chromosome (HAC, 2,000 kb) [10].
A Bacterial Artificial Chromosome (BAC) is basically a DNA
construct, based on a single copy functional fertility plasmid (or
F-plasmid) which is used for transforming and cloning in bacteria.
In general, the carrying capacity of BAC vector is 150–350 kb.
Shizuya et al. [8] have demonstrated that BAC vectors allow
efficient cloning of large DNA fragments even larger than 350 kb.
Moreover the BAC cloning system is highly stable, facilitates easy
handling and propagation of clones and relative ease of clone DNA
isolation, and allows for efficient screening by polymerase chain
reaction (PCR) or hybridization. Generally, these BAC vectors
possess minimal sequences required for autonomous replication, a
selective antibiotic resistant gene, a multiple cloning sites cassette
(MCS) and a reporter gene favoring insertional inactivation i.e.,
blue and white assay for selection of transformants.
Constructions of genomic or chromosome-specific BAC librar-
ies have been reported in plants with different insert sizes like
Arabidopsis thaliana [11], rice [12], sorghum [13], lettuce [14],
soybean [15, 16], apple [17], Triticum monococcum [18], and bar-
ley [19]. Because of their stability and ease, BACs became domi-
nant cloning vectors and are an invaluable resource for large-scale
physical mapping [20–22], comparative mapping and evolutionary
studies [23, 24], map-based gene cloning [25], analysis of gene
structure and function, and also for developing polymorphic
markers for targeted genome regions [26].
A DNA library is a pool of cloned DNA fragments of an organ-
ism. There are three types of DNA libraries viz. genomic libraries
(formed from genomic DNA which represent entire genome),
cDNA libraries (formed from reverse-transcribed RNA which
represents only the transcribed genes), and randomized mutant
libraries (formed by de novo gene synthesis with altered/preferred
codons incorporated). A genomic DNA library (also called as gene
bank or clone bank) is a set of clones that together represents the
entire genome of an organism. The number of clones depends on
both the size of the genome and the size of inserts tolerated by the
cloning vector.
There are different techniques used in library preparation.
Generally, they include the isolation of intact nuclei containing high
molecular weight (HMW) DNA, followed by embedding them
into agarose plugs. The purified DNA is then partially digested
using an endonuclease restriction enzyme and subjected to pulsed-
field gel electrophoresis (PFGE) for size-fractionation before isola-
tion by electro-elution/dialysis. Vector preparation includes plasmid
gDNA Library Construction 43
isolation from host cells, purification and digestion with restriction

enzyme and then dephosphorylation of the vector to prevent self-
ligation. Finally, both the digested genomic DNA fragments and
the preprepared cloning vector are ligated using a DNA ligase
enzyme and then electroporated into competent E. coli cells. Each
bacterial cell contains on average one construct (Vector + insert). As
the bacterial culture grows, the recombinant DNA (rDNA) within
them is propagated and thus cloned.
The presence of multiple cloning sites (MCS) within the LacZ
gene favors the selection of recombinant clones through blue-
white assay. Individual colonies are picked up and grown on
microtiter plates which are further confirmed by preparing a mini-
prep of BAC DNA and analyzing after NotI enzyme digestion. The
entire collection of cells and the DNA within represent the com-
plete genomic DNA library. These recombinant clones can be fro-
zen at −80 °C and stored for the long term. A DNA library can be
easily replicated. Because of their wide application, genomic DNA
library preparation has become a mainstay of current molecular
biology. Although there have been recent advances and improve-
ments in the methodology, BAC library preparation remains rela-
tively challenging. Hence, in this chapter we have described
genomic DNA library preparation using BAC vectors in detail.
2 Materials
All the chemicals used should be of analytical grade and media/

solutions should be prepared using deionized/distilled water
unless otherwise noted.
2.1 Host and Vector 1. The DH10B strain of E. coli bacteria is the preferred host for
BAC library construction (see Note 1).
2. The pBeloBAC11 vector (7.4 kb) is the commonly used BAC
vector for DNA library construction (see Note 2).
2.2 Buffers 1. LB (Luria-Bertani) media; To prepare 100 mL LB broth, add

and Media Solutions 1.0 g bacto-tryptone, 0.5 g bacto-yeast extract, 1.0 g NaCl to
90 mL water and make up the final volume to 100 mL using
water. Adjust pH to 7.0 (see Note 3) and autoclave. Store at
room temperature (see Note 4).
2. 5 % w/v CM (chloramphenicol) stock solution; 5 % w/v chlor-
amphenicol dissolved in 100 % ethanol. To prepare 10 mL of
CM stock solution, dissolve 0.5 g of chloramphenicol in 10 mL
of 100 % ethanol and filter-sterilize (see Note 5). Store at
–20 °C (see Note 6).
3. SEB (Sucrose-based Extraction Buffer); 10 % v/v TKE (0.1 M
Tris Base, 1 M KCl, 0.1 M EDTA, pH 9.4–9.5 autoclaved and
stored at 4 °C), 500 mM sucrose, 4 mM spermidine, 1 mM

spermine tetrahydrochloride (see Note 7), 0.1 % w/v ascorbic
acid, 2.0 % w/v PVP, and 0.13 % w/v sodium diethyldithiocar-
bamate. To prepare 1 L SEB buffer, add 100 mL TKE, 171.2 g
of sucrose, 1.0 g spermidine, 0.35 g spermine tetrahydrochlo-
ride, 1.0 g ascorbic acid, 20.0 g PVP-40, and 1.3 g sodium
diethyldithiocarbamate to 900 mL water and make up the final
volume to 1,000 mL using water. Store at −20 °C (see Note 8).
4. SEB+BME; 0.2 % v/v β-mercaptoethanol (see Note 9) in SEB.
For 1 L SEB+BME buffer, 0.45 mL β-mercaptoethanol is
required (see Note 10).
5. SEB+BME/Triton; 10 % v/v Triton X-100 in SEB+BME.
6. Lysis Buffer; 1 % w/v sodium lauryl sarcosine, 0.1 mg/mL
proteinase K, 0.1 % w/v ascorbic acid, 2.0 % w/v PVP-40,
and 0.13 % w/v sodium diethyldithiocarbamate (stored
at −20 °C) dissolved in 0.5 M EDTA (pH 9.1) stock solution
(see Note 11).
7. SOC (Super Optimal Broth with Catabolic repr.) Media; 2 %
Bacto tryptone, 0.5 % yeast extract, 10 mM NaCl, 2.5 mM
KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM Glucose, pH
7.0. Store at room temperature (see Note 12).
8. Freezing media; To prepare 1,000 mL freezing media, add
10 g bacto-tryptone, 5 g bacto-yeast extract, 10 g NaCl,
13 mM KH2PO4, 36 mM K2HPO4, 1.7 mM sodium citrate,
6.8 mM (NH4)2SO4, and 4.4 % v/v glycerol. Autoclave and
then add filter-sterilized MgSO4 stock solution to 0.4 mM
(see Note 13).
9. 10 mg/mL Ethidium bromide; Store in a light-proof con-
tainer at room temperature (see Note 14).
10. X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside)
stock solution: 2 % w/v X-gal dissolved in N,N-
dimethylformamide. To prepare 5 mL of X-gal stock solution,
add 0.1 g of X-gal in 5 mL N,N-dimethylformamide. Store in
a light-proof container at –20 °C (see Note 15).
11. IPTG (isopropyl β-D-1-thiogalactopyranoside) stock solution,
20 % w/v. To prepare 5 mL of IPTG stock solution, dissolve
1.0 g of IPTG in 5 mL water. Filter-sterilize and store as
1.0 mL aliquots at −20 °C.
12. PMSF (phenylmethylsulfonyl fluoride), 0.1 M. To prepare
100 mL of 0.1 M PMSF, dissolve 1.742 g of PMSF in 100 mL
of 100 % ethanol. Store at −20 °C (see Note 16).
13. TE Solution, 1×: 10 mM Tris (pH 7.5) and 1 mM EDTA. To
prepare 1 L of 1× TE solution, add 10 mL of 1 M Tris–HCl,
pH 7.5 and 0.2 mL of 0.5 M Na2EDTA to 900 mL water and
make up the volume to 1,000 mL using water. Autoclave and
store at room temperature (see Note 17).
14. BAC Miniprep solutions

Solution I: 50 mM Tris–HCl, pH 8.0, 10 mM EDTA, and
100 μg/mL RNase A. To prepare 1,000 mL solution, dissolve
6.06 g Tris base, 3.72 g EDTA·2H2O in 800 mL H2O and
adjust the pH to 8.0 using concentrated HCl. Make up the final
volume to 1,000 mL using water. Store at 4 °C (see Note 18).
Solution II: 200 mM NaOH and 1 % SDS. To prepare 1,000 mL
solution, dissolve 8.0 g NaOH pellets in 900 mL of water and
add 50 mL of 20 % SDS solution. Make up the final volume to
1,000 mL using water. Store at room temperature (see Note 19).
Solution III: 3.0 M potassium acetate, pH 5.5. To prepare
1,000 mL solution, dissolve 294.5 g of potassium acetate in
900 mL water and adjust the pH to 5.5 with glacial acetic acid
(~110 mL). Make up the volume to 1,000 mL using water.
Store at room temperature (see Note 20).
2.3 Enzymes, 1. HindIII enzyme with 10× buffer and 100× BSA (see Note 21).
DNA Markers, 2. Not I enzyme with 10× buffer and 100× BSA.
and Chemicals
3. HK phosphatase with 10× phosphatase buffer.
4. T4 DNA ligase with 10× ligase buffer.
5. Proteinase K.
6. Uncut Lambda DNA (see Note 22).
7. Lambda DNA/HindIII (see Note 23).
8. 1 kb and 100 bp DNA ladders (see Note 24).
9. PFGE marker (see Note 25).
10. Agarose.
11. Glycerol.
12. DMSO (Dimethyl sulfoxide).
13. Ethylenediaminetetraacetic acid (EDTA).
14. Ethanol.
15. Isopropanol.
16. Isopropylthiogalactoside (IPTG).
17. Ethidium bromide.
18. Sodium dodecyl sulfate (SDS).
19. Tris(hydroxymethyl)aminomethane (Tris).
20. 5-Bromo-4-chloro-3-indolyl-beta-D-galactoside (X-gal).
21. Yeast extract.
22. Protease peptone.
23. Sodium pyruvate.
24. Glucose.
25. Diethyl ether.
26. Liquid nitrogen.

27. Miniprep Kits.
2.4 Supplies 1. Plug molds (see Note 26).

and Equipment 2. Handheld plate replicator.
3. 96- or 384-well microtiter plates.
4. Cheese cloth and Miracloth squares (see Note 27).
5. Nitrocellulose filters: pore size of 0.025 μm.
6. Solution filters: pore size of 0.22 μm.
7. Pestle and mortar.
8. Small paint brush.
9. Centrifuge tubes and bottles of different size.
10. Tooth picks.
11. Laminar air flow cabinets/hoods with UV lamps and Bunsen
burner.
12. Incubators/water bath (30, 37, and 55 °C).
13. Orbital shaker incubator.
14. Refrigerated centrifuge machine (with different rotors).
15. Refrigerator (4, −80, and −20 °C freezers).
16. PFGE CHEF Gel apparatus with CHEF mapper, cooling
module, and CHEF gel casting stand. (Bio-Rad CHEF-DR II
is commonly used).
17. UV Transilluminator/Gel documentation system: UV light
sourced with fixed camera to capture image of ethidium
bromide-stained agarose gels.
18. Electroporation system (Gene Pulser II apparatus (Bio-Rad) is
commonly used).
19. Electrophoresis unit.
20. Simple Microscope.
21. Pipettors (Multichannel pipettors are preferred).
22. Dialysis tubing.
3 Methods
3.1 Vector A good vector preparation is the critical step for success in BAC
Preparation library construction (see Note 28).
1. Plasmid isolation: Streak E. coli (DH10B strain) clone contain-
ing the BAC vector (pBeloBAC11) on LB agar plate contain-
ing chloramphenicol (12.5 μg/mL), X-gal (50 μg/mL), and
IPTG (25 μg/mL). Incubate plates for growth at 37 °C over-
night (see Note 29).
2. On the morning of the next day, inoculate a single E. coli

(DH10B) colony from plate grown overnight into 5 mL of
Luria broth (see Note 30) containing 30 μg/mL chloram-
phenicol and incubate for 8–10 h at 37 °C with continuous
shaking of 250 rpm (see Note 31).
3. Inoculate 1 mL of the pre-culture into two large culture flasks
(see Note 32) containing 1,000 mL of Luria broth with
chloramphenicol (30 μg/mL), pre-warmed to 30 °C.
Incubate for 4–6 h at 37 °C with continuous shaking of
250 rpm (see Note 33).
4. Pour the culture to 500 mL centrifuge bottles and harvest the
bacterial cells by centrifugation at 4 °C for 15 min at 3,000 × g.
5. Plasmids can be isolated from these pelleted bacterial cells
using any commercially available large-construct plasmid isola-
tion kit (see Note 34).
6. Restriction digestion:
7.5 μL 10× buffer.
1.5 μL 100× BSA.
5.0 μL Hind III enzyme (10 U/μL) (see Note 35).
10 μg of vector DNA (approx. 50–60 μL).
Make up the final volume to 75 μL using ddH2O. Mix contents
briefly by gentle tapping and incubate the reaction mixture at
37 °C for 2 h (see Note 36).
7. Inactivation of Restriction enzyme: Restriction enzymes can
be inactivated by heating the digestions at 65 °C for 15–20 min
(see Note 37).
8. Dephosphorylation:
5.0 μL of 100 mM CaCl2.
5.0 μL HK phosphatase (1 U/μL).
2.5 μL of 10× phosphatase buffer.
75 μL of digested vector.
Make up the volume to 100 μL with ddH2O. Gently mix the
contents of the tube, and incubate at 30 °C for 2 h (see Note 38).
9. Inactivation of Phosphatase enzyme: Phosphatase enzyme
can be inactivated by heating the samples at 65 °C for 20 min
(see Note 39).
10. Self-Ligation test:
2.5 μL 10× ligase buffer.
1.0 μL of T4 DNA ligase (1 U/μL).
5.0 μL digested and dephosphorylated vector.
Make up the volume to 10.0 μL with ddH2O water. Mix gen-
tly by tapping and incubate at room temperature for 2 h for
self-ligation (see Note 40).
11. Inactivation of T4 DNA ligase: T4 DNA Ligase activity can be

inactivated by heating samples at 65 °C for 20 min (see Note 41).
12. Check 2.0 μL of the sample on a 1 % w/v agarose gel in
1× TAE buffer. Stain the gel with 0.5 μg/mL EtBr (ethidium
bromide) for 15–20 min and wash with distilled water thor-
oughly. Expose the gel to UV transilluminator for visualiza-
tion (see Note 42).
13. Test Ligation: This is carried out to check the vector quality.
20 ng vector DNA.
10 μL 10× ligase buffer.
6 μL T4 DNA ligase (1 U/μL).
200 ng of λH3 DNA (see Note 43).
Make up the final volume to 100 μL using ddH2O water.
Gently mix the reaction volume and incubate at 16 °C over-
night (see Note 44).
14. Inactivation of T4 DNA ligase: T4 DNA Ligase activity
can be inactivated by heating samples at 65 °C for 20 min
(see Note 41).
15. When self-ligation and test ligation results are positive, the
digested and dephosphorylated vector can be purified using a
phenol–chloroform extraction method. Purified vector can be
stored at 4 °C until use (see Note 45).
16. The vector DNA concentration can be estimated by running
2 μL of vector on a 1 % agarose mini-gel prepared in 1× TAE
buffer along with 0.5, 1.0, 2.0, and 4.0 μL of 1× uncut lambda
DNA (i.e., 25, 50, 100, and 200 ng, respectively) for
15–20 min. Stain the gel with 0.5 μg/mL EtBr for 15–20 min
and then wash with distilled water thoroughly. Expose the gel
to a UV transilluminator and photograph. By comparing rela-
tive fluorescence in the sample (vector) and standard lanes
(uncut lambda DNA), the concentration of vector DNA can
be easily determined.
17. Adjust the vector DNA to the final concentration of 10 ng/μL
using ddH2Owater. Store at –80 °C.
3.2 Preparation Success of large-insert genomic DNA library construction depends

of Insert DNA upon isolation of intact HMW DNA. The presence of plant cell
wall, plastids, and other secondary compounds like polyphenolics
poses severe contamination problems for high-quality DNA isola-
tion and leads to physical shearing during preparation which in
turn makes them unusable for all the downstream processes. The
isolation of megabase DNA has been successfully carried out in
several plant species [27–30].
1. To isolate HMW nuclear DNA, take about 50–100 g of fresh
or frozen plant tissue and ground into fine powder in liquid
nitrogen using a pestle and mortar. Immediately transfer to a

1,000 mL flask containing ice-cold SEB+BME buffer (see Note
46).
2. Gently swirl the mixture using a magnetic stir bar on ice for
10 min and then filter the homogenate through two layers of
cheese cloth and one or two layers of miracloth in a funnel into
four ice-cold 250 mL centrifuge tubes (see Note 47).
3. After adding 1/20 volume of SEB+BME/Triton buffer to each
tubes, gently swirl the contents on ice for 10 min. Sediment
the filtered homogenate by centrifugation at 1,800 × g for
10–15 min at 4 °C (see Note 48).
4. Decant the supernatant and add 10 mL of ice-cold SEB+BME to
each pellet. Gently resuspend the pellet using a small paint
brush. Transfer the nuclear suspensions into new 50 mL cen-
trifuge tubes and add 5 mL of SEB+BME buffer to each tube.
Pellet the nuclei by centrifuging tubes at 1,800 × g for 15 min
at 4 °C (see Note 49).
5. Decant the supernatant and wash the pellet 2–3 times by
resuspending into 5 mL of ice-cold SEB+BME buffer followed
by centrifugation at 1,800 × g for 15 min at 4 °C. Consolidate
all the nuclear suspensions into a single tube before the final
wash. Decant the supernatant after final wash (see Note 50).
6. Resuspend the pelleted nuclei in 20 mL of SEB (without β-
mercaptoethanol). Centrifuge at 1,800 × g for 15 min at 4 °C.
7. Decant the supernatant and add 1–2 mL of SEB buffer. Gently
resuspend the pelleted nuclei using a small paintbrush. Store
on ice.
8. A nuclei count can be done by examining a drop of the
nuclei suspension under contrast phase light microscopy
(see Note 51).
9. To embed nuclei in LMP agarose plugs (see Note 52), prepare
a 1 % LMP agarose solution and incubate at 45 °C in a water
bath. Isolated nuclei in SEB buffer should be pre-warmed at
45 °C water bath for 5–10 min before being embedded in aga-
rose (see Note 53).
10. Mix an equal volume of 1 % LMP agarose solution and pre-
warmed nuclei in SEB buffer (see Note 54).
11. Aliquot the LMP agarose and nuclei mixture into prechilled
plug molds at the rate of 100 μL solution per plug and allow
to solidify at 4 °C (see Note 55).
12. To purify DNA from LMP agarose plugsincubate plugs into a
50 mL centrifuge tube containing Lysis buffer at 50 °C with
gentle shaking (30 rpm) for 48 h (see Note 56).
13. After 48 h of incubation, decant the lysis buffer and wash the
plugs with 10–20 volumes of ice-cold TE buffer for 1 h
(see Note 57). Store the plugs in TE buffer at 4 °C until fur-

ther use (see Note 58).
14. For PMSF treatment, wash the plugs containing the embed-
ded nuclei three times with 10–20 volumes of ice-cold 1× TE
buffer containing 0.1 mM phenylmethyl sulfonyl fluoride
(PMSF) by incubating at 4 °C for 1 h (see Note 59).
15. Wash the plugs containing embedded nuclei three times with
10–20 volumes of 1× TE buffer (without PMSF) at 4 °C for
1 h. Store the washed plugs in 1× TE solution at 4 °C
(see Note 60).
16. DNA analysis (see Note 61): Prepare 1.0 % (w/v) PFGE aga-
rose gel in 0.5× TBE buffer. Load the agarose plug, PFGE
lambda ladder and different concentrations of uncut lambda
DNA into agarose gel (see Note 62).
17. Pulse-field gel electrophoresis can be performed using 1.0 %
agarose gel in 0.5× TBE with 12 °C buffer temperature, 0.5×
TBE buffer in PFGE chamber, 6.0 V/cm, 50–90 s pulse with
linear ramping for 18 h (see Note 63).
18. Stain the gel with 0.5 μg/mL EtBr for 15–20 min and wash
with distilled water thoroughly. Expose the gel to a UV transil-
luminator and photograph.
19. DNA concentration in plugs can be estimated based on relative
staining intensity compared with known concentrations of
uncut lambda DNA (see Note 64).
20. To test restriction digestion (see Note 65), a test restriction
digestion should be carried out to optimize the quantity of
restriction enzyme required to digest for each batch of plugs.
A total of 8–10 test digests can be done with different concen-
trations of restriction enzyme. It also helps to know the aver-
age size of the DNA fragments. Cut each plug into half to
reduce the number of plugs to be used for test digestion. Set
up the digestion reactions as follows:
Half agarose plug with embedded nuclei.
20 μL 10× HindIII buffer.
20 μL Spermidine (40 mM).
20 μL Albumin BSA (1 mg/mL).
0 μL Dithiothreitol (DTT) (10 mM).
0, 0.1, 0.2, 0.5, 1, 2, 3, 4, 5, and 10 U HindIII (10 U/μL)
(see Note 66).
Make up the volume to 200 μL using ddH2O. Gently mix the
contents and incubate on ice for 1 h so that diffusion of restric-
tion enzyme into agarose plugs takes place. Incubate the tubes
for partial digestion at 37 °C for 15–20 min (see Note 67).
21. The restriction enzyme digestion can be stopped by adding
1/10th volume of 0.5 M EDTA (pH 8.0) to each tube and
keeping the tubes on ice (see Note 68).
22. Prepare a 1 % PFGE agarose gel in 0.5× TBE buffer and load
the partially digested DNA plugs along with a PFGE lambda
ladder at both flanking ends of a gel (see Note 69).
23. Seal the wells on the gel with some leftover molten 1 % TBE
agarose gel and perform Pulse-field gel electrophoresis at
12 °C buffer temperature, 0.5× TBE buffer in PFGE chamber,
6.0 V/cm, 50–90 s pulse with linear ramping for 18 h.
24. Stain the gel with 0.5 μg/mL EtBr for 20 min with gentle shak-
ing and wash with distilled water thoroughly. Expose the gel to
a UV transilluminator and photograph. The enzyme concentra-
tion of the test digestion reaction which gave the majority of
the DNA fragments in the 100–150 kb range is chosen as the
optimum for partial digestion (see Note 70).
25. For the restriction digestion of agarose plugs: Digestion reac-
tion on a large scale is performed by carrying out a number of
reactions (approx. 15–20 reactions) using enzyme concentra-
tion determined as optimum in test digestion with all other
same parameters. Double the enzyme units considered as opti-
mum in test digestion to digest one plug. After digestion,
enzyme can be inactivated by adding 1/10th volume of 0.5 M
EDTA (pH 8.0) (see Note 71).
26. For the first size selection of insert DNA (see Note 72), pre-
pare 1.0 % PFGE agarose gel in 0.5× TBE. Cut and remove the
agarose gel between 4 and 6 center wells of the gel to make
one large slot well. Add small amount of melted agarose to seal
bottom of slot well and allow it to solidify. Transfer the par-
tially digested plug into slot well (see Note 73).
27. Load PFGE Lambda Ladder at both flanking ends of the large
slot well. Seal all the wells with melted agarose and allow it to
solidify.
28. Perform PFGE with 1.0 % agarose gel in 0.5× TBE, 12 °C
buffer temperature, 6.0 V/cm, and 50–90 s pulse for 18 h
(see Note 74).
29. Using scalpel blade, cut both flanking regions of the gel con-
taining the lambda ladder and little portion of plug loaded in
slot well. Stain the cut gel with 0.5 μg/mL EtBr for 15–20 min
and wash with distilled water thoroughly. Expose the stained
gel to UV transilluminator (see Note 75).
30. Under UV, cut the flanking gel with scalpel blade at lower
boundary of target size required using ladder as reference.
Resemble the gel on glass plate using both stained and
unstained portion of gel. Cut the unstained gel to get rid of
smaller DNA fragments using nicks created on stained gel.
Thus we obtained DNA fragments ranging between 100 and
350 kb (see Note 76).
31. For the second size selection (see Note 77), perform PFGE
with 4.5 V/cm, 5 s pulse for 15 h (all other conditions remain
same) as described in points 26–30 (First Size Selection) by

loading the DNA fragments obtained during first size selec-
tion. After PFGE, we are left with an unstained gel containing
DNA fragments sized between 100 and 350 kb (see Note 78).
32. For the electro-elution and dialysis of size-selected insert DNA
from agarose, place the agarose slice containing size selected
DNA fragments into a thin dialysis bag. Fill the dialysis bag
with 500 μL of 1× TAE buffer and close both the ends without
creating any air bubbles.
33. Place the dialysis bag in an electrophoresis chamber transverse
to the direction of current flow. Add sufficient electrophoresis
buffer to the chamber and perform electro-elution at 100 V,
4 °C, for 1 h (see Note 79).
34. After electro-elution, discard the gel slice from the dialysis bag
(see Note 80). HMW-DNA attached to the dialysis bag can be
released into the buffer by placing the dialysis bag back into
the electrophoresis apparatus and reversing the current for
1 min. Collect around 500 μL buffer containing HMW-DNA
fragments from the dialysis tube (see Note 81).
35. Drop dialyze the HMW-DNA by placing the buffer obtained
from the dialysis tube onto a nitrocellulose filter. Store at 4 °C.
In this way we obtain HMW-DNA digested with HindIII
enzyme and ready for BAC cloning. Proceed to ligation with
vector immediately (see Note 82).
3.3 Library 1. Test Ligation: An efficient ligation reaction needs an optimum
Construction concentration of insert DNA and vector. Hence, it is necessary
to carry out a series of 4–5 test ligations with different molar
ratios of insert DNA. Set up test ligation reactions as follows:
1 μL vector DNA (14–16 ng/μL).
10 μL 10× ligation buffer.
5 μL T4 DNA ligase (1 U/μL).
20, 40, 60, and 80 μL insert DNA (1–2 ng/μL).
Make up the volume to 100 μL using ddH2O. Gently tap the
reaction mixture and incubate at 15 °C overnight.
2. Inactivation of T4 DNA ligase: T4 DNA Ligase activity can be
inactivated by heating samples at 65 °C for 20 min.
3. Prepare a 1 % PFGE agarose gel in 0.5× TBE buffer and load
the ligated product along with PFGE lambda ladder at both
flanking ends. Seal the wells on the gel with some leftover mol-
ten gel and perform PFGE at 12 °C buffer temperature, 0.5×
TBE buffer in the PFGE chamber, 6.0 V/cm, 50–90 s pulse
with linear ramping for 18 h.
4. Stain the gel with 0.5 μg/mL EtBr for 20 min with gentle
shaking and wash with distilled water thoroughly. Expose the
gel to a UV transilluminator and photograph. Molar ratios of
both Insert DNA and vector at which ligation is effective are

chosen as optimum for ligation.
5. Ligation reaction on a large volume is performed using an
optimized insert DNA concentration and all other parameters
remain the same. Inactivation of ligase can be achieved by
heating the samples at 65 °C for 20 min.
6. Desalting of ligated product: This can be done by placing the
ligated product on agarose cone for 1 h on ice. Store the
desalted ligated product at 4 °C (see Note 83).
7. Electroporation of ligated product (see Note 84): Thaw
DH10B competent cells on ice for a few minutes. Precool the
electroporator cuvettes on ice.
8. Place 30 μL of competent cells into 4 microcentrifuge tubes
(0.5 mL) and then add 3.0 μL of the ligated product into each
microcentrifuge tube (see Note 85). Gently tap to mix the
contents and incubate on ice.
9. Set up the electroporation device as follows: resistance 100 Ω,
capacitance 25 μF, and voltage gradient of 12.5 kV/cm.
10. Carry out electroporation by transferring the mixture
(competent cells + ligated product) to an ice-chilled electro-
porator cuvette and placing it in the electroporation cham-
ber (see Note 86).
11. Add 1 mL of sterile SOC media to each cuvette at room tem-
perature. Transfer the contents to 50 mL centrifuge tubes and
incubate at 37 °C with 250 rpm shaking for exactly for 1 h.
12. Spread 100 μL of grown culture on LB agar plate containing
chloramphenicol (12.5 μg/mL), IPTG (25 μg/mL), and
X-gal (50 μg/mL). Incubate the plates overnight at 37 °C
(see Note 87).
13. Preparation of DNA LibraryPicking clones and incubation:
Pick each white clone (recombinant) manually using sterile
tooth picks or robotically using an automated colony picker
and inoculate in wells of 96- or 384-well microtiter plates con-
taining freezing medium. The inoculated microtiter plates are
incubated for growth at 37 °C for 14–16 h with gentle shak-
ing. The DNA library is now prepared and plates can be stored
at −80 °C (see Note 88).
14. Library replication: The DNA library can be replicated into
96- or 384-well microtiter plates containing 200 μL LB and
chloramphenicol using handheld replicator or an automated
plate replicator. Incubate the plates overnight at 37 °C. Store
at –80 °C (see Note 89).
15. Library storage: The DNA library can be stored as individual
clones in 96- or 384 well microtiter plates as glycerol stocks
at –80 °C (see Note 90).
3.4 Characterization The BAC library can be characterized by estimating the average
of BAC Library insert size.
1. Miniprep of BAC DNA: This uses an alkaline-lysis method of
plasmid-DNA isolation from bacterial cultures (see Note 91).
Randomly select 10–15 clones from the BAC library and grow
each clone separately on LB agar plates containing chloram-
phenicol (12.5 μg/mL), X-gal (50 μg/mL), and IPTG
(25 μg/mL) at 37 °C overnight.
2. Inoculate a single white colony from an overnight grown plate
into 20 mL of Luria broth containing 30 μg/mL of chloram-
phenicol and incubate overnight at 37 °C with continuous
shaking of 250 rpm.
3. Centrifuge overnight grown cultures at 8,000 × g, 4 °C for
10 min and discard the supernatant.
4. Add 150 μL of ice-cold solution I and resuspend the pellet by
vortexing.
5. Add 200 μL of ice-cold solution II and mixed by inverting
tubes 10–15 times slowly and keep the tubes on ice for 3 min
(see Note 92).
6. Add 150 μL of ice-cold solution III and mix vigorously by
inverting tubes. Incubate the tubes on ice for 15 min and then
centrifuge at 8,000 × g at 4 °C for 10 min.
7. Pipette the supernatant into new 1.5 mL tubes and add 750 μL
of prechilled isopropanol. Mix vigorously by inverting tubes
and incubate at room temperature for 2 min. Centrifuge tubes
at 8,000 × g at 4 °C for 10 min.
8. Discard the supernatant and wash the pellet twice with 500 μL
of 70 % ethanol at room temperature.
9. Dry the pellet at room temperature for 3–4 h. Resuspend pellet
in 50 μL of ddH2O and incubate at 37 °C for 30 min. Store
the plasmid at 4 °C (see Note 93).
10. NotI digestion: Set up restriction digestion reaction as follows:
0.6 μL NotI (10 U/μL).
1 μL 10× buffer.
8 μL of BAC clone DNA and make up the volume to 10 μL
using ddH2O. Incubate the reaction mixture at 37 °C for 2 h.
11. Inactivate the restriction enzyme by heating tubes at 65 °C for
15 min.
12. Checking the digestion product: Load the digested product
and PFGE Lambda markers on 1 % (w/v) PFGE agarose gel
and perform PFGE with 0.5× TBE buffer at 6.0 V/cm, 5–15 s
pulse, 12 °C for 16 h.
13. Stain the gel with 0.5 μg/mL EtBr for 15–20 min and wash
with distilled water thoroughly. Expose the gel to a UV
transilluminator and photograph. The insert DNA size can be
estimated by comparing it with a PFGE lambda ladder
(see Note 94). The BAC library is now created, characterized
and average insert size of BAC library is determined.
4 Notes
1. Bacterial DH10B cells for electroporation can be purchased

from a commercial company, available as ElectroMAX™
DH10B™ cells or can also be prepared in the laboratory
following a routine competent cells preparation protocol using
the DH10B strain of E. coli.
2. The pBeloBAC11 vector possess multiple cloning sites, viz.,
Hind III, BamH1, and SphI of which the first two produce 5′
overhangs favorable for cloning. It also contains minimal
elements required for self-replication, a selectable marker gene
and a reporter gene.
3. A lower ionic strength like 1 N NaOH can be used to adjust
the pH.
4. 1.5 g w/v Bacto Agar is added before adjusting the pH to
prepare solid Luria agar media.
5. Chloramphenicol can be sterilized using a 0.22 μm filter.
6. To prepare LB plates with Chloramphenicol: Add 25.0 μL of
Chloramphenicol (CM) stock solution to 100 mL of LB broth.
Chloramphenicol should be added after autoclaving LB media
and just before use at room temperature. These plates should
be prepared 1 h prior to use and dried in a sterile laminar
air-flow chamber to prevent condensation.
7. Spermine and Spermidine-HCL are irritant and corrosive.
8. SEB buffer should be freshly prepared just prior to use. It is
also called as a homogenization buffer and its pH is important
for success of HMW-DNA isolation. Since the DNA is acidic in
nature, to maintain its integrity, the pH of the buffer must be
higher than 8.
9. β-Mercaptoethanol is toxic and irritant. Handle with gloves.
10. β-Mercaptoethanol should be added after autoclaving SEB
buffer and just before use.
11. Proteinase K is an irritant and may cause allergic reactions.
12. Add filter-sterilized MgSO4 and glucose after autoclaving SOC
media just prior to use.
13. Allow media to cool to 50 °C after autoclaving and then add

filter-sterilized MgSO4 solution in laminar-flow hood. MgSO4
solution should not be autoclaved because it will precipitate on
autoclaving.
14. Ethidium bromide is a mutagen and carcinogen. Wear gloves
while handling.
15. X-gal is sensitive to light. Hence it should be stored in a light
proof container.
16. PMSF is highly toxic and has very short half life in aqueous
solution. PMSF prepared in TE buffer is effective only for 1–2
weeks. Prepare a stock solution in 100 % ethanol for long-term
storage.
17. TE solutions often develop a precipitate. Do not use precipi-
tated solutions. Prepare them fresh.
18. Solution I is also called a resuspension buffer.
19. Solution II is also called a NaOH–SDS Solution or lysis
buffer.
20. Solution III is also called a neutralization buffer and should be
chilled on ice before use.
21. Enzymes generally used for restriction digestion are Hind III
and BamH1.
22. Uncut lambda DNA is used as a standard check for restriction
digestion and ligation reactions.
23. Lambda DNA/HindIII is used as a molecular weight size marker.
24. 1 kb and 100 bp DNA ladders are used as molecular weight
markers.
25. Midrange-PFGE markers can also be used to determine the
exact insert size from CHEF gels.
26. Plug molds of 2 mm × 5 mm × 10 mm rectangle size are
preferred.
27. Prepare squares of 3 cm2 size and autoclaved before use.
28. Vector predigested with BamH1 or HindIII and dephosphory-
lated is also commercially available.
29. LB plates should be prepared 1 h before use and dried in a
sterile laminar hood to avoid condensation. If plates are pre-
pared a few days earlier and stored at 4 °C, then plates should
be kept in a laminar hood to bring to room temperature.
30. Use a 30 mL culture tube.
31. Generally the culture is grown overnight at 37 °C.
32. Use a 3 L culture flasks.
33. Culture should be grown to a cell density of approximately
1 × 109 cells/mL (A600 = 1.0–1.2). It needs approximately
4–6 h to attain this state.
34. Plasmid isolation can also be done by using a conventional

alkaline lysis method using solution I, II, and III. Please refer
to BAC minipreps section (Subheading 3) of this chapter.
35. Enzyme should not be used at more than 10 % of the final
reaction volume because the enzyme storage buffer contains
glycerol which inhibits the process of digestion. If the restric-
tion enzyme concentration for digestion is not optimized, then
set up 6–8 test digestion reactions with different concentration
of enzyme and optimize the amount of enzyme to be used.
36. Use a water bath for the incubation. After digestion, check 2 μL
of the digested product on a normal 1 % agarose gel along with
appropriate markers to check whether the plasmid is digested or
not. A single band of size 7.4 kb should be visible. If not, extend
the incubation time of the digestion process. Since the vector
size is large, an overnight digestion can also be used.
37. Use a water bath for inactivation of the restriction enzyme.
It is necessary to inactivate the enzyme as it hinders the
downstream reactions. After heating at 65 °C, allow
the reaction to cool at room temperature for 5–10 min and
proceed to next step.
38. Use a water bath for incubation. Dephosphorylation is done to
avoid self-ligation and circularization of plasmid DNA. HK
phosphatase refers to heat-killable phosphatase either bacterial
or from calf-alkaline phosphatase.
39. Use water bath for heating the samples. After inactivation,
allow the reaction mixture to cool at room temperature for
5–10 min. Dephosphorylated vector should be purified by
phenol–chloroform extraction.
40. Self-ligation reaction can also be incubated overnight (12–
14 h) at 16 °C. This is done mainly to avoid false positives.
Vector molecules that are not dephosphorylated tend to re-
circularize or form concatamers with other molecules.
41. Use water bath for inactivation of T4 DNA Ligase activity.
42. Upon UV exposure, a 7.5 kb single DNA band should be
visible. It is the dephosphorylated, non self-ligated and linear
vector. Undigested plasmid DNA, such as self-ligated circu-
larized (non-dephosphorylated) plasmid DNA and vector
concatamers, migrate more slowly than linear molecules and
are visible at molecular weights greater than7.5 kb.
43. The λH3 DNA is the lambda DNA digested with HindIII
enzyme. Care should be taken that both vector molecule and
lambda DNA should be digested with the same enzyme for
test ligation.
44. Do not vortex the reaction mixture as it may shear the λH3
DNA. A reaction mixture without λH3 DNA can be used as
negative (self ligation) control.
45. Alternatively, the entire dephosphorylated reaction mixture

can be used for a self-ligation test and run on a 1 % agarose gel.
The DNA band at 7.5 kb can be purified from the gel and
stored at 4 °C until further use. This method bypasses the phe-
nol–chloroform extraction process. Further purification and
desalting is not required at this step.
46. The pestle and mortar needs to be precooled in −20 °C for 1 h
prior to use. For every one gram of fresh/frozen plant tissue
used, approximately 10 mL of SEB+BME buffer is required (e.g.,
for 50 g of ground tissue powder, 500 mL of ice-cold SEB+BME
is required. β-Mercaptoethanol (BME) is added to the SEB
buffer just prior to use. BME limits the oxidation of polyphe-
nols and avoids browning. The higher pH of the SEB buffer
inhibits the activity of endogenous nucleases. It is advisable to
expose plants to darkness for 2 days prior to collecting the leaf
sample for DNA extraction.
47. To obtain more nuclei, the homogenate can be squeezed using
clean gloved hands. If there is no availability of miracloth, then
3–4 layers of cheese cloth can serve the purpose. This is done
mainly to separate the plant cell debris out of nuclei.
48. Addition of Triton X-100 results in preferential lysis of chloro-
plasts and mitochondria. At this step nuclei will be separated
from chloroplasts, mitochondria and other secondary metabo-
lites like polyphenolics.
49. The paint brush should be soaked in SEB buffer for 10 min
before use.
50. Repeated washing help maximum removal of chloroplasts,
mitochondria, and other substances like polyphenolics.
51. Mix a small drop of nuclei suspension with an equal volume of
1.0 % methylene blue on a microscope slide and observe under
a microscope. Under contrast phase microscopy, intact nuclei
appear to be dark-blue.
52. DNA shearing can be overcome by embedding purified nuclei
into agarose plugs. Agarose provides the physical support for
the DNA to remain intact. It acts as a solid, yet porous matrix
which allows diffusion of chemicals and protects DNA from
shearing. Generally, the DNA concentration embedded in
LMP agarose plugs will be 5–10 μg/100 μL plug.
53. Incubation at 45 °C does not damage nuclei in SEB buffer
because the sucrose present in SEB buffer stabilizes nuclei.
54. Use a wide-bore pipette tip prepared by cutting off the fine tip
to handle nuclei. Agarose plug molds should be kept on ice
and be sure that plug molds are properly sterilized if they are
being reused.
55. Use a wide-bore pipette tip to place mixture into plug molds.
It could take approximately 30 min to solidify. Plugs should be
white to light yellow in color. Plugs can also be allowed to set
fully overnight at 4 °C. Generally, 2 g of leaf tissue generates 1
plug.
56. A sterile spatula tip can be used to transfer plugs into lysis buf-
fer. After 24 h of incubation, replace the lysis buffer with fresh
lysis buffer.
57. Plugs can also be washed with 0.5 M EDTA (pH 9.0) for 1 h
and then with 0.05 M EDTA (pH 8.0) for another 1 h.
58. Agarose Plugs can also be stored in 0.05 M EDTA (pH 8.0)
solution. For long-term storage, use 70 % ethanol.
59. Washing can also be done on ice with gentle shaking. PMSF is
very toxic and should be handled with gloves. PMSF destroys
residual proteinase K (lysis buffer) in the plugs.
60. Washing can also be done on ice with gentle shaking. Plugs are
stable in 1× TE solution for a few months without much DNA
degradation. Repeated washing removes high concentrations
of EDTA (TE buffer) from plugs otherwise, this inhibits
restriction digestion process.
61. The DNA concentration per plug can be estimated based on
the relative staining intensity compared with DNA standards.
This also helps to check for DNA degradation.
62. Use a spatula tip to transfer plugs to gel. 20 μL (10 μg), 10 μL
(5 μg), and 5 μL (2.5 μg) of 10× uncut lambda DNA can be
used as standards.
63. TAE buffer has a lower buffering capacity compared to TBE
buffer and is more readily exhausted during extended electro-
phoresis. Because of this always use TBE buffer for PFGE.
Even small differences in ionic strength may affect migration
of DNA in PFGE. Therefore use the same batch of buffer to
prepare the gel and in the electrophoresis chamber. Make up
the gel volume with water if it is reduced while melting the
agarose to maintain the same ionic concentration. Ensure that
air bubbles are not created while preparing agarose gel.
64. If the average DNA fragment length is less than 100 kb, then
the DNA is degraded and new plugs will need to be prepared.
65. HMW-DNA in plugs should be free from all contaminants as
they may interfere with the restriction digestion process.
HMW-DNA should be partially digested with a suitable
enzyme (Hind III in this case) to give clonable fragments of
the desired size (100–350 kb). Use the same restriction enzyme
which was used to prepare the vector.
66. HindIII enzyme should be freshly diluted using ddH2O water.

HindIII and BamH1 are the commonly used enzymes in BAC
library construction.
67. Partial digestion can also be done up to 1 h.
68. Gently agitate tubes after adding EDTA. The digestion reac-
tion can also be stopped using 0.5× TBE buffer. Digested
product cannot be stored on ice for more than 3 h.
69. A spatula tip can be used to transfer the partially digested DNA
plugs into well.
70. Destaining can also be done using 0.5× TBE buffer for 20 min
with gentle shaking.
71. We have optimized the enzyme concentration for a half plug in
the test digestion. Hence add double the number of enzyme
units considered as optimum to digest one plug. If there is no
digestion, then possible reasons could be: inactive enzyme,
DNA in plugs may not be restrictable, and reagents may be
contaminated or because the EDTA concentration is high.
72. It is necessary to know whether the size of the DNA fragments
is suitable for BAC library construction or not. DNA fragments
ranging between 100 and 350 kb are required at this step.
73. Use a spatula tip to transfer plugs into slot well. Modified
combs to give a long slot well are commercially available and
can be used while preparing the gel.
74. Nucleases present in the electrophoresis buffer and PFGE
chamber could hinder the size fractionation process. Hence
the PFGE chamber should be properly cleaned before use.
75. The unstained gel piece containing plug should not be exposed
to UV. If exposed to UV, it greatly affects the cloning efficiency.
76. Stained and unstained part of the gel should not come in
contact.
77. Some shorter fragments (less than 100 kb) do get trapped by
the longer DNA fragments if the DNA concentration in the
plugs is relatively high and these are not eliminated during the
first size selection. Hence a second size selection should be
performed which eliminates the smaller DNA fragments which
preferentially ligate the vector.
78. There are some reports where they go for triple size selection
to generate consistently large inserts and higher transforma-
tion efficiency.
79. Ensure that DNA fragments have left the gel by staining a
piece of gel from a gel slice with EtBr and illuminate under
UV. If not all removed, put the dialysis bag back into chamber
for a new run.
80. Care should be taken not to lose any buffer as it contains the
HMW-DNA.
81. Use a wide-bore pipette tip to collect the buffer from the dialy-
sis bag. After collecting the buffer from dialysis bag, it can also
be washed using 1 mL 1× TAE buffer but for ligation the DNA
needs to be concentrated again by reducing its volume.
82. Before ligation, some dialyzed DNA can be run on 1 % agarose
gel with an appropriate DNA ladder to check the exact size of
the DNA fragments obtained.
83. The ligated product contains high salt concentrations which
affects electroporation. Hence it is necessary to desalt the
ligated product before transformation. The ligated product is
stable at 4 °C for 4–5 days. Proceed to transformation imme-
diately without storing the ligation product.
84. The concentration of ligated product, the strength of electric
field, and the length of electric pulse determines the efficiency
of transformation.
85. A 1:10 ratio of ligated product to competent cells by volume is
commonly used.
86. Bubbles should not be formed in the mixture. Clean the out-
side surface of cuvette before placing it in the electroporation
chamber. Do not shock bacterial cells in a cuvette more than
once. The electric shock during electroporation creates holes
in the plasma membrane of the bacterial cells and allows the
BAC to be taken up by the bacteria.
87. It is necessary to incubate plates for 14–16 h at 37 °C for blue
color development. Incubation at 4 °C for an additional 1–2 h
will intensify the blue color. Calculate the titer value of the
library, i.e., cfu/μL. If there are more than 100 cfu/plate, then
it is said to be a good transformation. Recombinant clones
appear white in color. If fewer white colonies are obtained,
then adjust the ratio of ligated product to bacterial cells and do
the electroporation again.
88. Prior to picking recombinant clones from the plates, prepare
microtiter plates by depositing 50 μL of freezing medium in
each well of sterile 96- or 384-well plates using handheld
pipettors. It is better to use multichannel pipettors to avoid
contamination and to save time. Proper sterilization of the
microtiter plates is necessary if they are being reused.
89. Sterilize the stainless steel handheld replicator by dipping pins
into 70 % alcohol. If a polypropylene replicator is used then
12 % v/v bleach is used to rinse thoroughly and then wash
with ddH2O. Allow the pins to dry completely before using for
replication.
90. Microtiter plates should be properly covered with plastic wrap

and stored at −80 °C. A final concentration of 15–20 % glyc-
erol can be used for long-term storage. It constitutes the mas-
ter copy of the library.
91. Minipreps can also be done using any commercially available
large-construct miniprep kit. Since the BAC vector replicates
in one or two copies per cell, a large volume of culture is
required to isolate a sufficient plasmid.
92. Do not vortex at this step and do not keep on ice for more
than 3 min.
93. BAC preparations can be stored at −20 °C for several days.
94. If the digestion is successful, then two bands are observed; one
is the vector backbone (7.4 kb) and the other is the DNA
insert. The Insert DNA size can be easily estimated by compar-
ing it with the PFGE ladder. Average insert size of the BAC
library can also be calculated. If no bands are observed, then
there could be a problem with the digestion reaction. Repeat
the digestion process.
References
1. Burke DT, Carle GF, Olson MV (1987) 9. Ioannou PA, Amemiya CT, Garnes J et al
Cloning of large segments of exogenous DNA (1994) A new bacterio-phage P1-derived vec-
into yeast by means of artificial chromosome tor for the propagation of large human DNA
vectors. Science 236:806–812 fragments. Nat Genet 6:84–89
2. Neil DL, Villasante A, Fisher RB et al (1990) 10. Harrington JJ, Van Bokkelen G, Mays RW et al
Structural instability of human tandemly (1997) Formation of de novo centromeres
repeated DNA sequences cloned in yeast artifi- and construction of first-generation human
cial chromosome vectors. Nucl Acids Res artificial microchromosomes. Nat Genet 15:
18:1421–1428 345–355
3. Anderson C (1993) Genome shortcut leads to 11. Choi S, Creelman RA, Mullet JE et al (1995)
problems. Science 259:1684–1687 Construction and characterization of bacterial
4. Venter JC, Smith HO, Hood L (1996) A new artificial chromosome library of Arabidopsis
strategy for genome sequencing. Nature 381: thaliana. Plant Mol Biol Rep 13:124–128
364–366 12. Wang GL, Holsten TE, Song WY et al (1995)
5. Collins J, Hohn B (1978) Cosmids: a type of Construction of a rice bacterial artificial chro-
plasmid gene-cloning vector that is package- mosome library and identification of clones
able in vitro in bacteriophage lambda heads. linked to the Xa-21 disease resistance locus.
Proc Natl Acad Sci U S A 75:4242–4246 Plant J 7:525–533
6. Kim UJ, Shizuya H, De Jong PJ et al (1992) 13. Woo SS, Jiang J, Gill BS et al (1994)
Stable propagation of cosmid sized human Construction and characterization of a bacte-
DNA inserts in an F factor based vector. rial artificial chromosome library of Sorghum
Nucleic Acids Res 20:1083–1085 bicolor. Nucleic Acids Res 22:4922–4931
7. Pierce JC, Sauer B, Sternberg N (1992) A posi- 14. Frijters ACJ, Zhang Z, Damme MV et al
tive selection vector for cloning high molecular (1997) Construction of a bacterial artificial
weight DNA by the bacteriophage P1 system: chromosome library containing large EcoRI
improved cloning efficacy. Proc Natl Acad Sci and HindIII genomic fragments of lettuce.
U S A 89:2056–2060 Theor Appl Genet 94:390–399
8. Shizuya H, Birren B, Kim UJ et al (1992) 15. Marek LF, Shoemaker RC (1997) BAC contig
Cloning and stable maintenance of development by fingerprint analysis in soybean.
300-kilobase-pair fragments of human DNA in Genome 40:420–427
Escherichia coli using an F-factor-based vector. 16. Tomkins JP, Mahalingham R, Smith H et al
Proc Natl Acad Sci U S A 89:8794–8797 (1999) A bacterial artificial chromosome
library for soybean PI 437654 and the identifi- 24. Sorrells ME, La Rota M, Bermudez-Kandianis
cation of clones associated with cyst nematode CE et al (2003) Comparative DNA sequence
resistance. Plant Mol Biol 41:25–32 analysis of wheat and rice genomes. Genome
17. Vinatzer BA, Zhang HB, Sansavini S (1998) Res 13:1818–1827
Construction and characterization of a bacte- 25. Faris JD, Fellers JP, Brooks SA et al (2003) A
rial artificial chromosome library of apple. bacterial artificial chromosome contig span-
Theor Appl Genet 97:1183–1190 ning the major domestication locus Q in wheat
18. Lijavetzky D, Muzzi G, Wicker T et al (1999) and identification of a candidate gene. Genetics
Construction and characterization of a bacte- 164:311–321
rial artificial chromosome (BAC) library for the 26. Cregan PB, Mudge J, Fickus EW et al (1999)
A genome of wheat. Genome 42:1176–1182 Targeted isolation of simple sequence repeat
19. Saisho D, Myoraku E, Kawasaki S et al (2007) markers through the use of bacterial artificial
Construction and characterization of a bacte- chromosomes. Theor Appl Genet 98:919–928
rial artificial chromosome (BAC) library from 27. Kleine M, Cai D, Elbl C et al (1995) Physical
the Japanese malting barley variety “Haruna mapping and cloning of a translocation in sugar
Nijo”. Breeding Sci 57:29–38 beet (Beta Vulgaris L.) carrying a gene for nem-
20. Cai WW, Reneker J, Chow CW et al (1998) An atode (Hererodera schachtii) resistance from B.
anchored framework BAC map of mouse chro- procumbens. Theor Appl Genet 90:399–406
mosome 11 assembled using multiplex oligonu- 28. Woo SS, Rastogi VK, Zhang HB et al (1995)
cleotide hybridization. Genomics 54:387–397 Isolation of megabase-size DNA from sor-
21. Kelley JM, Field CE, Craven MB et al (1999) ghum sand applications for physical mapping
High throughput direct end sequencing of and bacterial and yeast artificial chromo-
BAC clones. Nucleic Acids Res 27:1539–1546 some library construction. Plant Mol Biol
22. Mozo T, Dewar K, Dunn P et al (1999) A Rep 13:82–94
complete BAC-based physical map of the 29. Zhang HB, Zhao X, Ding X et al (1995)
Arabidopsis thaliana genome. Nat Genet 22: Preparation of megabase-size DNA from plant
271–275 nuclei. Plant J 7:175–184
23. Dubcovsky J, Ramakrishna W, SanMiguel PJ 30. Ganal MW (1996) Isolation and analysis of high-
et al (2001) Comparative sequence analysis of molecular-weight DNA from plants. In: Birren B,
colinear barley and rice bacterial artificial chro- Lai E (eds) Nonmammalian genomic analysis: a
mosomes. Plant Physiol 125:1342–1353 practical guide. Academic, San Diego, pp 61–73
Chapter 7
The Polymerase Chain Reaction (PCR): General Methods

Daniel L.E. Waters and Frances M. Shapter
Abstract
The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and
is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the
cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter
introduces the principles of PCR and discusses practical considerations from target sequence definition
through to optimization and application.
Key words PCR, Template DNA, Taq DNA polymerase, Primer design, Melting temperature
1 Introduction
The polymerase chain reaction (PCR) is an integral component of

many protocols and is perhaps the key technique of molecular biol-
ogy. PCR converts very low quantities of DNA into very high
quantities which can be used directly or in downstream applica-
tions. Following publication of the original method in 1985 [1],
the basic PCR procedure has been modified, expanded, and applied
to a vast array of problems and techniques, generating a very long
list of specialized applications. This chapter introduces and dis-
cusses the principles of the generic PCR method.
During the process of mitotic cell division, a copy of the
genome is created for each new somatic cell. This process doubles
the amount of DNA which is shared equally between the two new
cells. The doubling of nuclear DNA takes place at each cell division
as a multicellular organism is created through continuous cell divi-
sion starting from the original progenitor cell. The single genome
copy in the original single progenitor cell is converted into many
billions of copies in the fully mature organism. PCR relies on simi-
lar principles and isolated components of this process to convert
very low concentrations of DNA into very high concentrations.
The primary physical components of PCR are (1) the template
DNA, the DNA which is copied; (2) deoxynucleotide triphosphates
65
66 Daniel L.E. Waters and Frances M. Shapter
Fig. 1 Schematic diagram of PCR. Starting with a single copy of target DNA
sequence, each cycle of PCR (heating/denaturation, cooling/annealing, and extend-
ing) doubles the amount of target DNA molecules increasing the concentration of the
target DNA exponentially. The number of target DNA molecules increases in the
series 1, 2, 4, 8, 16, …, 2n where “n” is the total number of PCR cycles
(dNTPs), the building blocks of DNA. The four nucleotides are

adenine triphosphate (ATP), thymine triphosphate (TTP), guanine
triphosphate (GTP), and cytosine triphosphate (CTP); (3) Taq
DNA polymerase, the enzyme which joins the nucleotides together
creating a mirror image of the template; (4) oligonucleotide prim-
ers, a sequence of DNA complementary to the target DNA and to
which DNA polymerase binds and initiates DNA synthesis; and (5)
a buffer solution of appropriate ionic strength and pH.
PCR utilizes the heat-stable DNA polymerase Taq DNA poly-
merase derived from the thermophilic bacterium Thermus aquaticus
(Fig. 1). Thermal stability allows the enzyme to withstand the heat-
ing required to denature DNA and maintain activity at relatively
high temperatures which improves primer specificity. There are
three core steps in PCR as follows. Step (1): Denaturation. The
PCR tube, a very small test tube, containing the PCR components
The Polymerase Chain Reaction 67
is heated to 94–96 °C. This denatures the DNA, splitting the two
complementary strands apart. Step (2): Annealing. The tube is
cooled which allows the DNA primers to bind or anneal through
base pairing with their target sequence. The primer DNA sequence
is complementary to the target. Step (3): Extension. DNA poly-
merase binds to the DNA primers and then extends the primers one
nucleotide at a time, simultaneously reading the template and then
placing a nucleotide which complements the template. For example
if the template strand has an “A,” DNA polymerase places a “T” in
the newly synthesized strand at the complementary position.
By repeating this process through a number of cycles, the con-
centration of the target DNA increases exponentially. If, for exam-
ple, there was a single copy of target available for amplification, one
cycle of PCR will generate a single copy which doubles the amount
of target. In the second cycle of PCR there will be two targets
which can be copied, doubling the amount of target to four. The
third cycle doubles the target from four to eight, then eight to
sixteen, and so on. Assuming perfect efficiency of the PCR, there is
doubling of the template DNA at each cycle and the final number
of target molecules is Y = X(2n) where “X” is the number of targets
at cycle one, “n” is the number of cycles, and “Y” is the final num-
ber of target molecules. PCR routinely proceeds for 25–35 cycles,
and so PCR can multiply the amount of target DNA in the order
of 225–235 times.
PCR experiments proceed in a number of steps. First, the tar-
get sequence needs to be defined and primers designed. Then the
PCR is optimized and following optimization applied to the sam-
ples of interest.
2 Materials
1. Primer design software.

2. PCR machine.
3. Pipettes and pipette tips (0–20 μL, 0–200 μL, 0–1 mL).
4. 1.5 mL Eppendorf tubes.
5. Thin-walled PCR tubes.
6. Taq polymerase buffer, 10×.
7. Taq polymerase.
8. 50 mM MgCl2.
9. 10 μM Forward primer.
10. Reverse primer.
11. 10 μM dNTPs.
12. Isolated genomic DNA.
13. Sterile deionized water.
3 Methods
3.1 PCR After the nature of the DNA sequence within and surrounding the
Primer Design target region, PCR primer quality is the key determinant of how
robust any one PCR is. PCR primer design is usually undertaken
using PCR primer design software. Many very effective PCR
primer design programs are open access and can be found on the
Internet. Each piece of software uses an algorithm which gives
weight to each of the PCR design parameters. Given the number
of parameters which impact upon PCR efficiency and the clear
difficulties in accounting for each of them in primer design, primer
design software packages are recommended.
1. Primer specificity. There are often several regions of very simi-
lar sequence within a genome. Identifying sequences appropri-
ate for primer annealing is nontrivial and a common source of
error. Depending on the purpose of the experiment, primers
need to anneal to either unique or non-unique regions of the
target. If the purpose is to amplify one target sequence, the
primers must anneal to regions of the target which are unique
to that region if they are not to amplify nontarget, closely
related sequences. Intron and intergenic sequences are gener-
ally appropriate primer-binding sites for amplification of unique
target regions. In contrast, conserved coding sequences shared
by a gene family are useful for amplifying members of that
gene family. Functional gene regions such as catalytic or sub-
strate-binding domains define gene identity. These regions are
highly conserved, and if the target gene is part of a gene family,
primers binding to these conserved regions may amplify more
than one member of the gene family.
2. Melting temperature (Tm). The temperature at which double-
stranded DNA separates and becomes single-stranded DNA is
the Tm. Design primer pairs with a Tm of 50–60 °C which is
closely matched, ideally within 1 °C of each other (see Note 1).
3. Primer length. The optimal length of PCR primers is around
18–22 bp. Primers of this length achieve the right balance
between specificity and appropriate annealing temperature; the
longer the primer, the greater the specificity and the higher the
annealing temperature.
4. GC content, total, and 3′ end. The total GC content of a primer
should be 50 % ± 10 %. Gs and Cs within five nucleotides of the
3' end of primers stabilize primers. More than three Gs or Cs
should be avoided within five nucleotides of the 3′ end of
primers. A low GC content in the 3′ region minimizes the risk
of false priming.
5. Secondary structure. If the 5′ and 3′ ends of a primer are com-
plementary to each other, the 5′ end can loop back and bind to
the 3′ end of the primer forming a hairpin structure. Similarly,

hairpin secondary structure in the target region can seriously
interfere with the primer binding. In either case, the yield of
PCR product will be reduced.
6. Primer dimers. A primer can bind both to itself or its pair. This
needs to be accounted for and avoided, particularly comple-
mentary sequences at the 3′ end of primers.
7. Repeat sequence. A repeat sequence within the primer-binding
site can lead to mis-priming and should be avoided. Where it is
not possible to avoid repeat sequence, they should be kept to a
minimum and as a rule of thumb not exceed four.
3.2 Empirical Tests After the primers have been designed and are available for use, the
and Optimization PCR must be empirically tested.
1. Dilute the oligonucleotide primers in sterile deionized water to
a working concentration of 10 μM. Mix well and centrifuge.
2. Thaw concentrated stocks of dNTP. After thawing, mix well
and centrifuge. In a single Eppendorf tube, mix and dilute in
sterile deionized water all four dNTPs so that the final concen-
tration of each dNTP is 2.5 mM. Mix well and centrifuge.
3. Thaw the 10× buffer (−MgCl2) and 50 mM MgCl2 supplied
with the Taq polymerase and genomic DNA. After thawing,
mix well and centrifuge.
4. Pipette the following components and amounts into two thin-
walled PCR tubes (see Notes 2, 3, and 4). Include a no-
template negative control (see Note 5). Mix well and centrifuge
(see Note 6).
Negative control
Component Test PCR (μL) PCR (μL)
10× Buffer (−MgCl2) 2.5 2.5
50 mM MgCl2 1 1
Forward primer 10 μM 1 1
Reverse primer 10 μM 1 1
dNTPs 2.5 mM each 2 2
Taq polymerase 0.2 0.2
Template (genomic DNA) 1 0
10 ng/μL
Water 16.3 17.3
Total 25 25
5. Place the PCR tubes in a thermal cycler, and amplify the target
DNA using the following PCR conditions:
Initial denaturation: −94 °C, 5 min.

Denaturation: −94 °C, 30 s.
Annealing: −Primer Tm −5 °C, 30 s.
Extension: −72 °C, 1 min per 1 kb of PCR fragment length.
Final extension: −72 °C for 5 min.
6. Analyze the outcome of the PCR by gel electrophoresis. If the
PCR is successful, a band or bands of the expected size of high
signal strength will be detected. There should be no band in
the negative control lane.
7. In the event of PCR failure, the PCR needs to be optimized.
Alteration of any of the PCR parameters, either PCR compo-
nents or cycling conditions, can affect the final outcome.
However, annealing temperature and Mg2+ concentration have
the greatest impact. If the annealing temperature is too high or
the Mg2+ concentration is too low, the primers do not bind.
If the annealing temperature is too low or the Mg2+ concentra-
tion too high, the primers bind nonspecifically, amplifying
nontarget sequences (see Notes 7–18).
8. Create the following master mix which contains all the compo-
nents of the PCR with the exception of water and 50 mM
MgCl2:
Component (μL)
10× Buffer 55
Forward primer 10 μM 22
Reverse primer 10 μM 22
dNTPs 2.5 mM each 44
Taq polymerase 4.4
Template (genomic DNA) 10 ng/μL 22
Total 169.4
9. Set up five sets of four PCR tubes, each with the following
components:
Component Set 1 (μL) Set 2 (μL) Set 3 (μL) Set 4 (μL) Set 5 (μL)
Master mix 7.7 7.7 7.7 7.7 7.7
50 mM MgCl2 0.75 1 1.5 2 2.5
Deionized (MilliQ) 16.55 16.3 15.8 15.3 14.8
water
Total 25 25 25 25 25
10. Set up a no-template negative control which has the highest

concentration of MgCl2:
Component Negative control PCR (μL)

10× Buffer 2.5
50 mM MgCl2 2.5
Forward primer 10 μM 1
Reverse primer 10 μM 1
dNTPs 2.5 mM each 2
Taq polymerase 0.2
Template (genomic DNA) 10 ng/ μL 0
Deionized (MilliQ) water 14.8
Total 25
11. Program the gradient PCR machine to generate a uniform

50–60 °C temperature gradient across the heating block at the
annealing step of the PCR cycle. There is no temperature gra-
dient for the denaturation and annealing steps.
Initial denaturation:−94 °C, 5 min.
Denaturation: −94 °C, 30 s.
Annealing: −50–60 °C gradient, 30 s.
Extension: −72 °C, 1 min per 1 kb of length.
Final extension: −72 °C for 5 min.
12. Evenly space the four PCR tubes of each set across the heating
block of the gradient PCR machine. One tube of each set
should be at the lowest temperature (50 °C) and one tube at
the highest temperature (60 °C). The negative control tube
needs to be positioned at the lowest annealing temperature
(50 °C). Run the PCR program.
13. Analyze the PCR products by gel electrophoresis. If the PCR
is successful, a band of the expected size and of high signal
strength will be detected in at least one lane and no bands in
the negative control lane. This will identify which annealing
temperature and MgCl2 concentration are appropriate for sub-
sequent experiments. If there are nonspecific amplification
products, increase the annealing temperature or decrease the
concentration of MgCl2. MgCl2 concentration can be critical.
Slight concentration differences can bracket a nonspecific lad-
der and no PCR product at all. If there is no signal, lower the
annealing temperature further or add more MgCl2.
4 Notes
1. The annealing temperature can be altered to match the Tm of

the PCR primers. However, robust PCR primers accurately
amplify target sequence over a wide range of annealing tem-
peratures; many primer pairs designed by PCR primer design
software generate the target PCR product using generic PCR
solutions and default PCR machine cycling conditions.
2. The extension time of the PCR needs to be increased for lon-
ger fragments. Taq polymerase adds nucleotides at a rate of
around 2,000/min. An extension time of 30 s is appropriate
for PCR products of less than 1 kb in length.
3. The initial denaturation and final extension can be omitted,
often without any impact upon the final outcome. Holds of
4 °C post PCR are common but not necessary. DNA is very
stable at room temperature, and there is no nuclease activity
remaining after PCR cycling.
4. 10 ng/μL of DNA is routinely used for PCR amplification of
rice genomic DNA. DNA concentration in a PCR is depen-
dent on genome size; the larger the genome, the greater the
quantity of DNA that needs to be added to the PCR.
5. In common with most experiments, a range of positive and
negative controls can be included in PCR experiments. These
controls are optional with one very important exception: the
no template DNA negative control. PCR is very sensitive and
can be used to amplify low concentrations of DNA. Once PCR
primers have generated PCR product, this product is in rela-
tively very high concentrations and may contaminate subse-
quent PCR experiments. Particular PCR products may be so
problematic that the primer pair for that PCR must be aban-
doned. In order to detect the presence of contaminating
sequences, a no-template DNA negative control must be
included in all PCR experiments. Contaminated DNA stocks
or test solutions are the most problematic. Ideally, dummy
DNA extractions are run through the whole DNA extraction
procedure which can be used as PCR negative controls.
6. It is important to ensure that all mixtures are homogeneous.
All solutions must be well mixed after thawing, creation of a
new solution, and before being mixed with other solutions.
7. The purpose of PCR is to generate high concentrations of
DNA sequences of interest. However, high concentrations of
DNA pose a risk to subsequent PCR experiments. PCR prod-
uct can contaminate PCR reagents, including DNA and RNA
samples, pipettes, and laboratory surfaces and will give rise to
false positives if appropriate steps are not taken. Because of
this, it is very important to ensure that PCR products are never
brought into contact with PCR preparation areas, reagents, or

pipettes. If PCR product is to be stored, it should be stored in
areas which are separate from genomic DNA or any samples
which may be used in PCR. Ideally, material and air flow one
way from preparation areas to post-PCR areas.
8. Published papers often include PCR protocols. It is important
to remember that PCR protocols are only guidelines. Each
laboratory will need to empirically determine the conditions
which allow amplification of a particular fragment of DNA in
that laboratory. Each PCR machine, DNA polymerase, and
DNA sample will behave differently and affect the outcome of
the PCR. Practitioners of PCR need to understand the princi-
ples of PCR and have the confidence to modify PCR condi-
tions as required.
9. Primers with a high Tm are more likely to undergo stable non-
specific annealing and generate spurious nontarget PCR prod-
ucts. There are three hydrogen bonds between GC pairs and
only two between AT. The extra hydrogen bond between the
G and C means that GC pairs are more stable than AT pairs.
GC content and primer length are the primary determinants of
Tm; longer and high GC content primers have higher Tm.
10. Taq polymerase incorporates incorrect bases at a low but sig-
nificant rate. For many applications including direct sequenc-
ing of PCR products this is not important. If, however, DNA
sequence is derived from individual molecules arising from
PCR, cloned PCR products for example, steps need to be
taken to ensure that the sequence is accurate. Addition of
proofreading enzymes to the PCR or creating a consensus
sequence from several clones minimizes the significance of this
issue. The improved accuracy of proofreading enzymes is also
useful when PCR products are cloned for protein expression.
11. PCR components are reasonably stable if measures are taken to
exclude microbial and nuclease contamination. Primers are an
exception. Primers are most stable when stored in high con-
centration and therefore should not be diluted to working
concentrations until needed. Diluting primers to 10× working
concentration is a common practice. These should be discarded
1 month after dilution.
12. Native Taq polymerase is active across a wide range of tempera-
tures. If reactions are set up at room temperature, Taq poly-
merase extends primers which have bound both nonspecifically
to the template DNA and to each other. This can lead to the
formation of nonspecific PCR products and primer dimers.
Traditionally, the response was to minimize Taq polymerase
activity by setting up PCRs on ice. The development of chemi-
cal- or antibody-inactivated Taq polymerase has circumvented
this need. There are a number of commercial Taq polymerase

preparations in which the enzyme has been inactivated by the
addition of a chemical or an antibody. The chemical or the
antibody inactivation is removed by the addition of heat.
“Hotstart” enzymes such as these generally return higher
yields of more specific PCR products and are recommended
for most PCR applications.
13. Long-range PCR: PCR is routinely undertaken to amplify
DNA fragments ranging from 100 to 5 kbp in length. Longer
fragments up to 40 kbp can be amplified, but these are more
challenging. Given that long amplicons require long, intact
template, DNA quality is particularly important in long-range
PCR. Any degradation or physical shearing of the template
DNA will reduce amplification efficiency. Long-range PCR
often requires enzyme cocktails and additives. The enzyme
cocktails include proofreading enzymes such as Pfu. Taq
polymerase does not have a proofreading capacity while Pfu
DNA polymerase from Pyrococcus furiosus is thermostable
and has “proofreading” activity that decreases the error rate
by about a fivefold relative to Taq polymerase [2]. Long-
range PCR is often employed for tasks where acquisition of
DNA sequence is the ultimate goal, and therefore DNA
sequence accuracy is important. Mis-incorporated bases can
also interfere and stall DNA synthesis which leads to reduc-
tions in PCR product yield.
14. Compounds such as DMSO and betaine weaken hydrogen
bonding between nucleotides are also utilized in PCR, relaxing
secondary structure which may interfere with DNA polymer-
ization. The longer the amplicon, the greater the chance a por-
tion of the target sequence will be difficult to amplify, hence
the need for such additives in long-range PCR particularly.
Longer primers up to 35 bp are commonly used in long-range
PCR; longer primers are more specific and have higher Tm in
part to counteract the addition of additives which reduce inter-
nucleotide hydrogen bonding. Long templates require long
extension times of 15–20 min.
15. PCR enhancer compounds: A number of compounds can be
added individually or in combination to improve PCR perfor-
mance. The compounds include dimethyl sulfoxide (DMSO),
N,N,N-trimethylglycine (betaine), formamide, glycerol, non-
ionic detergents, bovine serum albumin, polyethylene glycol,
and tetramethylammonium chloride. Detergents minimize
aggregation of polymerase, while the other enhancers gener-
ally either minimize template secondary structure which inter-
feres with DNA synthesis and nonspecific primer binding or
stabilize Taq polymerase.
16. Commercial PCR optimization kits which efficiently test

many buffer combinations and PCR conditions are available,
for a price. If a kit is not used then optimization can proceed
in three steps. The first two steps described here apply to
most applications. If a PCR primer pair is not successful after
completing the first two steps, designing a new primer or
primer pair is usually the most efficient means of achieving a
positive result.
17. A touch down PCR [3] can be attempted in the event of non-
specific amplification. In a touch down PCR, the annealing
temperature reduces at each cycle relative to the previous cycle
by a defined amount until the final annealing temperature is
reached, which is then maintained until the PCR is
completed.
18. The quantities described here are convenient pipetting vol-
umes. PCRs can be run in very small volumes, saving reagent
costs. The PCR can be scaled accordingly, maintaining the
relative proportions of each component.
References
1. Saiki R, Scharf S, Faloona F et al (1985) Enzymatic mostable DNA polymerases. Nucleic Acids Res
amplification of beta-globin genomic sequences 24:3546–3551
and restriction site analysis for diagnosis of sickle 3. Don RH, Cox PT, Wainwright BJ et al (1991)
cell anaemia. Science 230:1350–1354 Touchdown PCR to circumvent spurious prim-
2. Cline J, Braman JC, Hogrefe HH (1996) PCR ing during gene amplification. Nucleic Acids
fidelity of Pfu DNA polymerase and other ther- Res 19:4008
Chapter 8
Mutation and Mutation Screening

L. Slade Lee, Bradley J. Till, Helen Hill, Owen A. Huynh,
and Joanna Jankowicz-Cieslak
Abstract
Molecular techniques have created the opportunity for great advances in plant mutation genetics and the
science of mutation breeding. The powerful targeted induced local lesions in genomes (TILLING) tech-
nique has introduced the possibility of reverse genetics—the ability to screen for mutations at the DNA
level prior to assessing phenotype. Fundamental to TILLING is the induction of mutant populations
(or alternatively, the identification of mutants in the environment); and mutation induction requires an
understanding and assessment of the appropriate mutagen dose required. The techniques of mutation
induction, dose optimization, and TILLING are explained.
Key words Mutagens, Dose optimization, TILLING, EcoTILLING, EMS
1 Introduction
Mutations are heritable changes in the DNA, can be either naturally

occurring (spontaneous) or man-made (induced), and form the
basis of much genetic variation. Genetic variation is important for
any species to be able to adapt to changing external factors such as
biotic and abiotic stress.
Since the discovery that X-rays caused genetic changes in
Drosophila [1] and barley [2], the use of both ionizing radiation
such as X-rays, gamma rays, and neutrons and chemical mutagens
for inducing variation in seed and vegetatively propagated plants
has been referred to as mutagenesis and has become an established
plant breeding technique. Mutagenesis was used extensively for
crop improvement during the 1960–1990s resulting in significant
economic benefit and increased crop security, with numerous
examples including bread wheat and rice varieties in China, India,
Thailand, Pakistan, and Australia, durum wheat in Italy, sorghum
in Africa, and barley in Europe [3].
77
78 L. Slade Lee et al.
1.1 Induced Induced mutant populations have become indispensable resources

Mutation for introducing genetic variation and for studying gene function in
plant genomics research. In mutation breeding, the main strategy
is to improve one or two major crop traits. Many mutant crop
varieties have resulted from a loss of gene function; for example,
the loss of function in GBSSI leads to waxy or no-amylose starch
[4] which has application in the food and livestock industries. The
fragrant aroma in certain rice varieties attracts a higher price and is
reported to be due to a loss of function of betaine aldehyde
dehydrogenase in rice [5] and also in soybean [6].
Other instances of loss of gene function that have been
incorporated into many modern cereal varieties are the semidwarf
1 (sd-1) [7] and shattering genes [8]. Induced mutation often
results in such loss of function and is a powerful tool for enriching
genetic variation in plants. Of a total of approximately 3,200
mutated plant entries listed in the FAO/IAEA Mutant Varieties
Database (http://mvgs.iaea.org/Search.aspx) almost half are
cereals.
Mutations that occur spontaneously may be due to errors in
DNA replication or environmentally induced factors including
ultraviolet radiation and chemical exposure [9]. Induced muta-
tion causes random changes across the genome but at a much
higher frequency than that occurring spontaneously. Chemical
agents, e.g., ethyl-methanesulfonate (EMS) and N-ethyl-N-
nitrosourea (ENU), are commonly used and have been reported
to produce point mutations [10, 11]. Numerous other alkylating
agents have also been employed to induce mutagenesis along
with a variety of different compounds including ethidium bro-
mide and other acridines, base analogues, and azide salts [9].
EMS induces alkylation of guanine resulting in G/C-to-A/T
transitions [12]. As a result, such alkylating agents can bring
about genetic changes that cause amino acid substitutions affect-
ing protein structure and function as well as truncation changes
that knock out protein activity.
Physical agents such as X-rays, UV rays, neutrons, and gamma
radiation have been widely used and account for over 60 % of reg-
istered mutant cultivars in the Mutant Varieties Database. Gamma
radiation using cobalt-60 is popular because it can deliver an accu-
rate dose, and the required dosage can be delivered over a specified
period of time, brief or extended, by manipulation of the way the
sample is presented to the source. A broad range of mutagenic
effects occur at the molecular DNA level in plants. Fast neutrons
have been used to introduce small-to-medium DNA deletions
[13, 14, 15] and inversions, insertions and translocations are also
reported [16]. Deletions and inversions also result from X-ray
exposure, [15] and gamma-rays as well as fast neutrons (heavy
ions) are reported to cause deletions in sizes ranging from single or
a few bases [17, 18, 19] up to very large fragments (>6Mbp) [18].
Mutation and Mutation Screening 79
1.2 Dose Traditionally, induction of mutated plant populations was

Optimization undertaken for plant breeding purposes. With the advent of
modern molecular biology methods, the requirement to generate
such populations has widened to also provide resources for research
on specific gene identification and characterization. Regardless of
the reason for creating a mutated plant population, one of the first
issues that must be addressed is mutagen dose optimization. This
need applies whether the mutagenic agent is physical (irradiation)
or chemical. The simplest approach is to consult the scientific
literature for information on previously applied treatments. Whilst
this provides a starting point, caution is required in relying on prior
work; numerous factors affect responses to mutagenic treatments
and mutagen doses. Accordingly, it is wise to establish the optimum
procedure at the outset for the specific application at hand.
There are remarkably few accounts of dose response investiga-
tions published in the scientific literature. This may be because it is
considered as a routine preliminary procedure which yields valu-
able information for the user but little in the way of novel research
results. Good examples, however, are provided by Harding and
Mohamad [20], Plewa et al. [21], and Sarduie-Nasab et al. [22].
Two aspects to dose optimization must be recognized: (1) manag-
ing dose delivery (dosimetry) and (2) assessment of dose response.
It is beyond the scope of this publication to discuss the complex
field of mutagen dosimetry, suffice to say that for irradiation it is a
hazardous and highly specialized technical field, and the assistance
of an accredited dosimetrist is required. The appropriate setup of
dose optimization experiments is, however, essential to ensure that
results are accurate and reliable. Where chemical mutagens are
used the situation is straightforward as all work can be conducted
in any well-equipped laboratory. Extreme caution is necessary in
dealing with mutagenic compounds, and absolute containment
must be ensured. A range of factors must be considered in prepara-
tion for assessing dose responses in order to provide confidence
that results are valid, reliable, and accurate. Of fundamental impor-
tance, the circumstances pending in the dose optimization experi-
mentation must be identical to the eventual treatments that are to
be applied to produce the required mutant population.
1.3 Experimental Plewa et al. [21] compared mutation rates of the yg2 locus in maize
Design induced by both irradiation and chemical mutagens for a series of
doses. The results were used to estimate a comparative mutation
rate between mutagens. However, the mutagen used may impart
its distinct mutagenic effects, so it is generally imprudent to
extrapolate and anticipate outcomes for a particular mutagen
treatment on the basis of a plant species response to a different
mutagen [23]. Similarly, responses typically vary between species
and between genotypes of a single plant species [9]; mutation rates
have even been shown to vary amongst gene loci [24]. Further, the
100
90
80
70
% mortality
60
50
40
30
20
LD50
10
0
0 2 4 6 8 10
dose
Fig. 1 Typical mortality response of populations exposed to incremental mutagen

doses
state of plant material affects its response to mutagens—such as its

physiological state and moisture content, as does the prevailing
physical environmental of the treatment—temperature, and pH,
for example [9, 23, 25].
Regardless of the mutagen, mutation rate is directly propor-
tional to dose [23, 26] up to the point of lethality. However, indi-
vidual mortality, dependent upon the gene(s) and precise site and
nature of specific mutation, may occur at any point on the dosage
continuum. Mortality rate in a population exposed to mutagenesis
typically follows a sigmoid response (Fig. 1).
For a particular type of plant material, of a given species/
genotype, in a certain physiological state and a specific environ-
ment situation, the mutagen dose at which 50 % mortality occurs
for the treated population is the LD50 (lethal dose for 50 %) which
represents the dose region of most stable declension response.
Selection of the most desirable dosage to produce a mutant popula-
tion then becomes a compromise between greater survival and
lower mutation rate, on the one hand, and greater mortality but
higher mutation rate, on the other, with the LD50 indicating the
region of central tendency. Accordingly, dosage optimization neces-
sitates experimentation with a range of dosage treatments under
conditions otherwise identical to those which will apply to muta-
genic treatment of the required population. However, the researcher
must be aware that optimizations done on the initial mutated pop-
ulation (the M1) will include nonheritable and possibly non-genetic
phenomena (e.g., epigenetic deregulation) and that large data sets
do not yet exist on genomic effects of mutagenesis in the M1 to add
extra precision to interpretation of phenotypic response to dose.
However, because the time required to progress to an M2 popula-
tion prior to optimizing dosage is rarely an available luxury for the
researcher, LD50 of the M1 generation is currently the best proxy

indicator of the effect of mutagenic response to a given situation;
but such optimization data should be interpreted with caution.
In the case of chemical mutagens, this involves a straightfor-
ward assessment of responses to a range of concentrations and
exposure times, typically by immersion in a solution concentration
series. Conversely, in the case of irradiation treatments, attenuation
of the energy of bombardment occurs as radiation penetrates the
target. Thus, the arrangement of plant material exposed to the
source will affect the dose received by any particular propagule.
Whilst dosimetrists can accurately calculate the radiation dose
arriving at any specific location in a particular facility, care is
required to ensure that the plant material actually receives the cal-
culated dose. Propagules should ideally be arranged mounted in a
flat plane presented perpendicular to the source to minimize vari-
ability of dose actually received.
Lastly, the researcher must decide which response factors are to
be measured to assess the mutation rate. A variety of direct measures
of mutation rate at the molecular level has been developed [27]
including the yg2 assay in maize [21, 26]; however, for the straight-
forward purposes of dose optimization, proxy measures are usually
employed. Such responses include germination percentage, seedling
survival, chlorophyll abnormality incidence, growth rates, and rela-
tive sizes of particular plant parts [20, 22, 25]. Moreover, qualitative
responses, particularly the rate of incidence of morphological vari-
ants, are sometimes used as crude indicators of mutagenic response
to dosage [23]. The researcher must clarify the exact measurement
parameters to be employed. For example, growth responses are time
dependent [20], so records are required at specific time points.
Lundqvist [23] reported that despite seeds receiving a lethal dose,
they may germinate and the seedlings do not die until lethally
mutated developmental genes are required to be induced (refer
Lundqvist’s thesis pg.15); thus success in germination does not nec-
essarily equate with nonlethality for a given dose of the mutagen.
The method below provides an example for dose optimization
for seeds treated with EMS, the approach typically employed for
producing populations for targeted induced local lesions in
genomes (TILLING) as discussed in the section later in this chap-
ter. Use of EMS-mutagenized TILLING populations is widely
reported, and a broad range of EMS treatments has been employed
involving soaking of seeds variously in concentrations between 20
and 100 mM for 10–20 h [28]. This provides a reference range
which the researcher may adopt for dose optimization with their
particular species of interest.
For the purposes of the method reported here, a control plus
eight EMS concentrations will be investigated: 10, 30, 50, …,
150 mM incrementing by 20 mM, with separate batches of seeds
exposed for 10 and 20 h in each of the EMS concentrations.
1.4 Mutation Depending on the type of mutagen employed and the DNA
Screening changes expected, different methods of detection have been used
to distinguish mutants from the original untreated genotype.
Traditionally, “forward genetics” was used, whereby visual
assessment of the mutant phenotype, such as chlorophyll
deficiencies, leaf and stem abnormality, seed size and shape, or
other observable traits, was employed. Early molecular techniques
used DNA fingerprinting and mapping of cereal mutations with
PCR-based markers including restriction fragment length
polymorphisms (RFLPs) [29–31], random amplification of
polymorphic DNA (RAPD) [32–34], simple sequence repeats
(SSRs) [35–38], and amplified fragment length polymorphisms
(AFLPs) [36, 39–42] for detecting variation. The problem with
these technologies is that they are an indirect approach, done
without obtaining the DNA sequence, which is the benchmark in
molecular genetics; and the cost in terms of time, resources, and
technical expertise required per data point is high.
More recently, sensitive and rapid detection methods using
“reverse genetic” screening approaches by sequencing [43], dena-
turing high-pressure liquid chromatography (DHPLC) [10], or
enzymatic cleavage of heteroduplex DNA with single-strand-
specific endonucleases such as CEL I first described in 1998 [44]
have been used.
The reverse genetic approach that combines the high fre-
quency of point mutations induced by EMS treatments, with
detection of heteroduplexed DNA between wild-type and mutant
DNA fragments, initially using DHPLC, has been called TILLING
[45]. It was first demonstrated in Arabidopsis [10] and since has
been adopted for crops such as barley [46], wheat [47], maize
[48], and sorghum [49] using primarily enzymatic mismatch
cleavage methods for mutation discovery. TILLING has become a
routinely used method for study in EMS-mutated populations and
was also employed to detect 2–4 bp deletions in rice induced by
gamma radiation [19]. Where this technology is used to investi-
gate natural mutations in a population the approach is termed
EcoTILLING [50].
In another approach for detection of mutants in gamma-
irradiated populations, PCR primers designed to flank the genes of
interest have been demonstrated to reveal deletions in plants [51].
Alternatively, capillary electrophoresis (CE) is an efficient tech-
nique that has been used for analysis of DNA polymorphism in
natural and mutated populations [50, 52]. CE has the advantages
of improved efficiency, sensitivity, and throughput. This technique
has been shown to be powerful enough to discriminate between
two SNPs of the EAAC-1 gene that corresponds to three haplo-
types, which were subsequently confirmed by cycle sequencing
[52]. More recently, next-generation sequencing approaches have
been adapted for mutation discovery and TILLING [53].
In this chapter we provide standardized protocols for the

induction and detection of mutations that are suitable for most
laboratories equipped for molecular biology. These methods can
be used as tools to support breeding programs and test hypothe-
sized gene function.
2 Materials
This chapter deals with both dose optimization and TILLING

techniques. Dose optimization is a necessary preliminary step to
any mutation induction experimentation. The researcher may be
wishing to induce a mutant population to conduct TILLING or,
indeed, for some very different reason such as mutation breed-
ing or comparative dosimetry. For this reason, the reader may
wish to refer to one or the other of the two techniques described,
or both, as befits their particular requirement. The materials for
dose optimisation are presented first, followed by the TILLING
materials.
2.1 Dose 1. High-quality seed of desired species and cultivar(s): Sufficient

Optimization: EMS number as befits the situation; the greater the number the
Mutation Requisites more reliable the data obtained—ideally 50–100 seeds per
treatment batch (1,000–2,000 total).
2. EMS AR grade, M.W. 124.2.
3. Analytical balance, weighing trays, and spatula.
4. Deionized water and stirring rods.
5. One 1 L beaker and eighteen 600 mL beakers for EMS
solutions.
6. Personal protective equipment and a laboratory fume hood for
solution preparation.
CAUTION: EMS is an irritant and carcinogenic.
2.2 Dose 1. Petri dishes of sufficient size to contain the requisite number of
Optimization: Seed seeds of the species in question allowing separate dish(es) for
Germination each treatment.
Requisites 2. Filter paper to suit the Petri dishes.
3. Sterile water and laboratory wash bottle.
4. Means of labelling beakers and Petri dishes.
5. Strainer and hazardous liquid waste receptacle.
2.3 TILLING/ 1. One bunch of celery (approx. 0.5 kg).

EcoTILLING: 2. Juicer (e.g., BRAUN type 4290), or equivalent.
Extraction of CJE
3. Tris–HCl, 1 M, pH 7.7.
4. KCl, 0.5 M.
5. Phenylmethylsulfonyl fluoride (PMSF), 0.1 M in isopropanol
(prepared fresh).
6. Tris–HCl/KCl buffer: 0.1 M Tris–HCl, pH 7.7, 0.5 M KCl,
and 100 μM PMSF (prepared fresh).
7. Ammonium sulfate (NH4)2SO4.
8. Dialysis membrane with a 10,000 kDA molecular weight cutoff
(Spectra/Por® 7, Spectrum Laboratories, Cat. No. 132119).
Prepare according to manufacturer’s instructions (see Note 6).
9. Dialysis tubing clips (Spectra/Por® Closures, Spectrum
Laboratories, Cat. No. 132736).
2.4 TILLING/ 1. Ex-Taq Hot Start Version Kit (Takara, Japan). Includes DNA
EcoTILLING: PCR Taq polymerase, 10× Ex-Taq PCR buffer, and 2.5 mM (each)
dNTPs. Store at −20 °C (see Note 7).
2. Tris–EDTA (TE) buffer, 1×: 10 mM Tris–HCl, 1 mM ethyl-
ene diamine tetraacetic acid (EDTA), pH 7.4.
3. Forward primer (Tm 67–73 °C) 100 μM in TE. Store at −80 °C
(see Note 8).
4. Reverse primer (Tm 67–73 °C) 100 μM in TE. Store at −80 °C.
2.5 TILLING/ 1. Crude celery juice extract (CJE), prepared as in Subheading 3.4
EcoTILLING: CJE (see Note 9).
Digestion 2. CJE buffer, 10×: 5 mL 1 M MgSO4, 5 mL 1 M 4-(2-hydroxyethyl)-
1-piperazineethanesulfonic acid (HEPES), pH 7.5, 2.5 mL 2 M
KCl, 100 μL 10 % Triton® X-100, 5 μL 20 mg/mL bovine
serum albumin, and 37.5 mL water. Store aliquots at −20 °C.
3. CJE master mix: 2.4 mL water, 420 μL 10× CJE buffer, and
CJE (see Note 9).
4. Stop solution: 0.225 M EDTA, pH 8.0.
2.6 TILLING/ 1. TBE running buffer, 0.5×: 45 mM Tris–borate, 1 mM EDTA,

EcoTILLING: pH8.3.
Electrophoresis 2. 1.5 % agarose gel in 0.5 % TBE containing 0.5 μg/mL
ethidium bromide. Let gel solidify at least 40 min before use
(see Note 10).
3. Horizontal electrophoresis apparatus for agarose gels.
4. Loading dye, 6×: 30 % glycerol, 0.1 % bromophenol blue in
water (see Note 11).
5. DNA Molecular mass ladder (Life Technologies Cat. No.
15628-019, or equivalent).
3 Methods
The reader may wish to refer to dose optimization technique or to

TILLING, or both, as befits their particular requirement.
The methods for dose optimisation are presented first, followed by
the TILLING methods. The latter protocol is a low-cost variation
of standard TILLING and EcoTILLING methods. While of lower
throughput, it is designed to be accessible to most laboratories
with basic molecular biology capabilities and thus suitable for
developing countries where resources may be limited. References
to higher throughput approaches are supplied.
3.1 Dose 1. Prepare the concentration series of EMS in deionized water,

Optimization: EMS including a pure water control treatment:
Solutions
mM 0 10 30 50 70 90 110 130 150
−1
gl 0 1.241 3.723 6.205 8.687 11.169 13.651 16.133 18.615
2. Commencing with the lowest concentration, make up the

above EMS solutions each in a 1 L beaker, and then decant
approximately equal volumes into each of the two 600 mL bea-
kers labelled with the concentration and 10 and 20 h, respec-
tively; proceed to make each subsequent solution in turn.
3.2 Dose 1. Noting the time, immerse a separate treatment batch of seeds
Optimization: EMS into each of the nine solutions.
Mutation Treatments 2. After 10 h quickly pour each of the “10-h” treatment batches
into a strainer and rinse thoroughly with sterile water ensuring
to capture the residue EMS solution for disposal in a hazard-
ous waste container; then tip the seeds into separately pre-
pared, appropriately labelled Petri dish(es) containing at least
five layers of filter paper; perform this procedure for each of the
concentration treatments for this time point.
3. When all of the nine treatment batches are dispensed, arrange
the seeds in each Petri dish such that they are spaced equidis-
tantly with sufficient room to permit shoot and root growth
typical of the species in question, add sterile water such that
free water remains but seeds are not immersed, and cover.
4. After 20 h repeat the above procedure for the second series of
concentration treatments.
5. Store the Petri dishes in a low-light environment, and check
daily for adequate moisture, adding sterile water as necessary
until all data recording is completed.
1. At regular recorded intervals from the time of sowing record

3.3 Dose appropriate data for each of the 18 treatments at each occa-
Optimization: Seedling sion; for instance:
Growth and Data (a) Days from sowing.
Records
(b) Number germinated.
(c) Number germinated and subsequently died.
(d) Radicle, hypocotyl, and plumule length.
(e) Radicle and hypocotyl diameter.
(f) Abnormalities.
2. The data should be combined and analyzed to provide infor-
mation on growth rates, mortality, LD50, and the like, as befits
the researcher’s requirements to ascertain the most suitable
mutagen dose for the purposes of producing the mutant popu-
lation required (see Notes 1–5).
3.4 TILLING/ 1. Wash celery bunch, remove leafy material, and pass celery
EcoTILLING: through a juicer or other device to extract liquid (approxi-
Extraction of CJE mately 400 mL of juice should be produced from one bunch).
2. Centrifuge the juice at 2,600 × g for 20 min. Carefully transfer
the supernatant to a new tube without disturbing the pelleted
debris.
3. To the cleared celery juice, add stock solutions 1 M Tris, pH
7.7 and 100 mM PMSF to obtain a final concentration of
0.1 M Tris–HCl and 100 μM PMSF.
4. Measure the volume of juice in a graduated cylinder, and add
144 g/L (NH4)2SO4 to obtain a final concentration of 25 %
(w/v). Mix gently at 4 °C for 30 min, and spin in a centrifuge
at 15,000 × g for 40 min. Carefully transfer the supernatant to
a new tube.
5. Measure the volume of supernatant in a graduated cylinder,
and add 390 g/L (NH4)2SO4 to the solution to obtain a final
concentration of 80 % (w/v). Mix gently at 4 °C for 30 min,
and centrifuge at 15,000 × g for 90 min.
6. Discard the supernatant without disturbing the pellet.
7. Suspend the pellet in Tris/KCl buffer containing PMSF
(approx. 40 mL or 1/10th of the volume of juice obtained in
Subheading 3.4, step 1).
8. Transfer solution to pre-prepared dialysis membrane, taking
care to seal the ends properly to avoid leakage.
9. Dialyze by placing the tubing in a beaker containing 4 L of
Tris/KCL buffer containing PMSF and stirring for 1 h at 4 °C.
10. Replace dialysis buffer each hour over 4 h, totaling in 4 buffer
exchanges and a minimum of 16-h dialysis (see Note 12).
Fig. 2 Low-cost polymorphism discovery by enzymatic mismatch cleavage. (a) Enzymatic activity from pre-
pared celery juice extract (CJE) is determined empirically using varying amounts of CJE while keeping input
PCR product from four polymorphic rice samples constant. Low amounts of enzyme (light gray bar ) have no
observable effect when compared to a zero enzyme control (white bar ). Underdigestion (dark gray ) produces
faint smearing and barely visible bands, while over-digestion (black bar ) results in a reduction in full-length
PCR product and weak banding. (b) Optimized CJE and a standard 1.5 % ethidium bromide-stained agarose
gel are used to detect single-nucleotide polymorphisms. Two cleaved fragments (marked by asterisk ) whose
sizes sum to the full-length PCR product (top band ) are produced when a nucleotide polymorphism is present
in the tested sample. (c) Signal intensity can be improved through modifications in electrophoresis conditions.
High-quality banding and polymorphism discovery are achieved in samples of Lupinus angustifolius when
using a 1.5 % gel with an agarose mixture of 1:2 fine agarose:standard agarose. (d) Alternative gel conditions
may also be considered to improve signal intensity. 10 μL of digested PCR product from control Arabidopsis
thaliana samples is evaluated on an E-Gel® system (Life Technologies)
11. After completing all dialysis steps, spin the enzyme solution at
10,000 × g for 30 min to remove any impurities. Recover
supernatant, and store at −20 °C in aliquots (see Note 13).
12. Determine the activity of enzyme by performing steps in
Subheadings 3.5–3.7 with varying amounts of CJE (see Fig. 2a).
3.5 TILLING/ 1. Prepare PCR master mix. Per 9 samples: 109.5 μL water, 20 μL
EcoTILLING: PCR 10× Ex-Taq buffer, 16 μL 2.5 mM dNTP mixture, 2 μL for-
and Heteroduplex ward primer, 2 μL reverse primer, 0.5 μL Ex-Taq (see Note 14).
Formation 2. Add 5 μL of genomic DNA to PCR tubes or plates. Keep
samples at 4 °C (see Notes 15–17).
3. Add 15 μL of the PCR reaction mix to each well. Centrifuge

for 2 min at 1,000 × g.
4. Place samples in thermal cycler, and run the following pro-
gram: 95 °C for 2 min; loop 1 for 8 cycles (94 °C for 20 s,
73 °C for 30 s, reduce temperature 1 °C per cycle, 72 °C for
1 min); loop 2 for 45 cycles (94 °C for 20 s, 65 °C for 30 s,
72 °C for 1 min); 72 °C for 5 min; 99 °C for 10 min; loop 3
for 70 cycles (70 °C for 20 s, reduce temperature 0.3 °C per
cycle); hold at 8 °C (see Note 18).
5. After PCR, place samples on ice and continue with enzyme
digestion (see Subheading 3.6) or store samples at −20 °C for
later use.
3.6 TILLING/ 1. Prepare CJE master mix on ice.

EcoTILLING: CJE 2. Add 20 μL of CJE reaction mixture directly to each PCR sam-
Digestion ple, and place in centrifuge for 2 min at 1,000 × g (see Notes 9
and 19).
3. Incubate at 45 °C for 15 min (see Note 20).
4. Place samples on ice, and add 5 μL of 0.225 M EDTA to stop
enzyme activity. Samples can be stored at −20 °C for weeks.
3.7 TILLING/ 1. Prepare agarose gel assembly by placing freshly prepared gel in
EcoTILLING: Agarose electrophoresis tank containing 0.5× TBE buffer (see Note 21).
Gel Electrophoresis 2. Combine 2 μL of 6× loading dye with 10 μl digested sample.
3. Load samples into wells alongside molecular weight ladder.
Run gel at 130 V for 1.5 h.
4. Photograph gel, and analyze for cleaved bands (see Note 22).
4 Notes
1. EMS is moderately soluble in water and has a half-life in solu-

tion at room temperature of approximately 4 days.
2. All procedures should be performed at room temperature
bearing in mind the germination requirements for the species
in question.
3. The preferred EMS concentration will depend upon the
intended use of the mutated population; for TILLING popu-
lations treatments resulting in percentage survival of 70–80 %
(i.e., concentrations well below LD50) are found to produce
satisfactory mutation rates for CEL I screening; conversely,
plant breeders regularly use a mutagen concentration that gen-
erates mortality higher than LD50 and apply it to large number
of seeds in order to ensure high mutation rates, thereby maxi-
mizing the probability of achieving rare beneficial mutations in
genes of interest (mutants are back-crossed to regular breeding

lines to introgress the desired mutation).
4. Post-emergent mortality indicates a lethal dose—depending
on the level of occurrence, the researcher may decide whether
this phenomenon is incorporated with non-emergent lethality
or analyzed as a separate phenomenon.
5. The control treatments, in addition to establishing a baseline,
should be used to assess the background germination rate of
the seed used and may necessitate incorporation into the data
analysis; preferably, untreated seed exhibiting >98 % germina-
tion should be used, and a preliminary germination test may be
required if in doubt.
6. Some pretreatment of the membrane may be required such as
soaking in low-concentration H2SO4. The Spectra/Por® mem-
brane is favored because it is pretreated and ready to use after
30-min incubation in distilled water.
7. The DNA polymerase represents the most expensive consum-
able in the TILLING and EcoTILLING assay. Highly proces-
sive, hot start and proofreading enzymes improved band
intensity and reduced background when using the Li-Cor fluo-
rescence detection platform [54]. Less expensive enzymes may
be suitable for other detection platforms. These can be tested
using positive control materials following the methods
described here. Positive control materials for plant mutation
detection are supplied by the Plant Breeding and Genetics
Laboratory of the FAO/IAEA Joint Programme (http://
mvgs.iaea.org/LaboratoryProtocols.aspx).
8. Amplicon sizes are typically between 700 and 1,600 base pairs.
This was determined to be optimal for the Li-Cor gel system as
it allowed for the greatest sensitivity and resolution coupled
with 4-h run times enabling multiple gel runs in a single work
day. Longer amplicons can be considered for many gel systems.
The Primer 3 program has typically been used for primer
design for TILLING and EcoTILLING applications. For
example, >90 % of primers designed from the genome of
Arabidopsis thaliana were successfully used in assays as part of
the Arabidopsis TILLING Project [55]. Useful tools for
primer selection are the CODDLe input utility for assembly of
gene models and protein homology models and CODDLe for
choosing the region of the gene with the highest density of
potentially deleterious alleles induced by mutagenic treatment
(http://www.proweb.org/input/).
9. Crude CJE has been widely used for TILLING and
EcoTILLING [56]. Commercially available enzymes and
biochemical purification from other plant materials can be
considered [19, 57, 58]. While CJE works over a broad range
of pH and salt concentration and therefore should be compat-

ible with most PCR buffers, this may not be true of all enzymes
and modifications to reaction conditions may be required.
Activity is determined empirically (see Fig. 2a).
10. Modifications of the agarose gel composition or visualization
dye used may improve sample resolution and sensitivity
(see Fig. 2).
11. Loading dyes can occlude stained bands and limit the sensitiv-
ity of the gel assay. The amount of loading dye can be limited
to the amount needed to follow sample loading into lanes and
indicate when electrophoresis can be terminated.
12. Longer dialysis times do not reduce the recovered enzymatic
activity. For convenience, the third or fourth dialysis is typically
performed overnight.
13. Enzymatic activity is stable in Tris–KCl buffer with no added
glycerol for years when stored at −20 or −80 °C. Depending
on the purity of the extraction, repeated freeze–thaw cycles
can reduce enzymatic activity. Aliquots are typically prepared
such that no more than four freeze/thaw cycles are subjected
per tube.
14. It is important to take care to minimize PCR contamination if
the same primer pairs are to be used in multiple assays. PCR
amplification is typically much more efficient from PCR prod-
ucts versus low concentrations of genomic DNA. PCR
contamination will result in high-quality gel images but a
failure to identify nucleotide polymorphisms within the
genomic DNA.
15. The optimal amount of input genomic DNA should be deter-
mined empirically. For most gel systems, a PCR product yield
of 10 ng/μL is sufficient. However, a higher yield of PCR
product may improve band visibility when using lower sensitiv-
ity platforms such as ethidium bromide staining. It may be
necessary to adjust the CJE digestion conditions by using more
CJE and/or increasing incubation time if increased PCR prod-
uct is used in assays.
16. The quality of genomic DNA input into the PCR reaction is
an important factor for successful polymorphism discovery.
Test the preferred method of DNA extraction on a small sub-
set of the population before scaling up to prepare the entire
DNA library. Certain assays, such as those employing fluores-
cently labeled primers, may be more sensitive to genomic
DNA quality than others [54]. Commercial kits such as the
FastPrep® System from MP Biomedicals and DNeasy® kits
from Qiagen have been successfully used for a variety of plants
[55, 59–65].
17. Sample pooling can be used to increase screening throughput

and to reduce assay costs. This has been extensively used for
TILLING applications using the Li-Cor platform and to a
lesser extent for EcoTILLING assays using various readout
platforms [50, 56, 66, 67]. Optimal pooling for the readout
platform of choice should be determined empirically. Both
one-dimensional and two-dimensional pooling strategies have
been described [54]. Note that it is much easier to visually
detect a band of known molecular weight than to discover a
rare and previously unknown band in a population of many
samples. Therefore a lower pooling may be optimal for
TILLING assays to discover low-frequency induced alleles.
Pooling may also hinder the unambiguous association of com-
mon polymorphisms to specific accession in EcoTILLING
applications where heterozygosity is high [68].
18. Cycling conditions have been optimized for 1.5 kb fragments
with primers of approximately Tm 70 °C. The first eight touch-
down cycles were found to be important for amplification with
fluorescently labeled primers for mutation detection using the
Li-Cor DNA analyzer. Cycling conditions may require further
optimization if using different Taq enzyme or primer melting
temperature.
19. When beginning TILLING reactions, consider removing
2–4 μL of PCR product before the CJE digestion. This can be
run on an agarose gel to test for PCR amplification and aids in
troubleshooting.
20. If the activity of prepared enzyme activity is low, incubation
time can be lengthened.
21. There are a range of alternative polymorphism discovery meth-
ods that can be considered for TILLING. These can broadly
be categorized as electrophoretic or non-electrophoretic meth-
ods. The first publication of TILLING described the use of
denaturing HPLC [10]. Other methods, such as high-resolu-
tion melt analysis and capillary electrophoresis, have also been
used for TILLING [69–71]. Most recently, Comai and col-
leagues described the use of next-generation sequencing
(NGS) using the Illumina technology for TILLING [53].
While NGS approaches are likely to dominate the field in the
future, the majority of TILLING and EcoTILLING publica-
tions to date have described various electrophoretic methods
such as capillary separation, ethidium staining of polyacryl-
amide gels, and use of low-cost agarose gels. Perhaps the most
extensively used system has been fluorescent detection of
cleaved fragments in eightfold pools using Li-Cor DNA ana-
lyzers. This was the system developed by the Seattle TILLING
Project that from 2000 to 2010 delivered over 8,000 induced
mutations to plant and Drosophila melanogaster research com-

munities [72] (http://tilling.fhcrc.org).
22. Cleavage of heteroduplex DNA with single-strand-specific
nucleases such as CJE results in nicks and double-strand breaks.
When using native electrophoresis, only double-strand breaks
are visualized as DNA fragments of lower molecular weight
than the full-length PCR product. Each polymorphism should
produce two bands whose molecular weights sum to the weight
of the full-length product. Due to incomplete cleavage, mul-
tiple polymorphisms in a DNA fragment can be simultaneously
detected. Use of denaturing electrophoresis may increase sig-
nal intensity as nicked DNA can also be visualized. Data evalu-
ation can be aided by the use of image analysis software such as
GelBuddy or ImageJ [73, 74].
Acknowledgments
Authors B.J.T., O.A.H., and J.J-C. wish to thank Kamila Kozak-

Stankiewicz for supplying lupine samples used for making Fig. 2c.
Funding for the work on low-cost TILLING and EcoTILLING
was provided by the Food and Agriculture Organization of the
United Nations and the International Atomic Energy Agency
through their Joint FAO/IAEA Programme of Nuclear Techniques
in Food and Agriculture.
References
1. Muller HJ (1927) Artificial transmutation of 8. Konishi S, Izawa T, Lin SY et al (2006) An
the gene. Science 66:84–87 SNP caused loss of seed shattering during rice
2. Stadler LJ (1928) Mutations in barley induced domestication. Science 312:1392–1396
by x-rays and radium. Science 68:186–187 9. van Harten AM (1998) Mutation Breeding:
3. Ahloowalia BS, Maluszynski M, Nichterlein K theory and practical applications. Cambridge
(2004) Global impact of mutation-derived University Press, Cambridge, p 113ff
varieties. Euphytica 135:187–204 10. McCallum CM, Comai L, Greene EA et al
4. Wang ZY, Zheng F, Shen G et al (1995) The (2000) Targeted screening for induced muta-
amylose content in rice endosperm is related to tions. Nat Biotechnol 18:455–457
the post-transcriptional regulation of the waxy 11. Wienholds E, van Eeden F, Kosters M et al
gene. Plant J 7:613–622 (2003) Efficient target-selected mutagenesis in
5. Bradbury LMT, Fitzgerald TL, Henry RJ et al zebrafish. Genome Res 13:2700–2707
(2005) The gene for fragrance in rice. Plant 12. Greene E, Codomo C, Taylor N et al (2003)
Biotechnol J 3:363–370 Spectrum of chemically induced mutations
6. Juwattanasomran R, Somta P, Chankaew S et al from a large-scale reverse-genetic screen in
(2011) A SNP in GmBADH2gene associates Arabidopsis. Genet 164:731–740
with fragrance in vegetable soybean variety 13. Li X, Song Y, Century K et al (2001) A fast
"Kaori" and SNAP marker development for the neutron deletion mutagenesis-based reverse
fragrance. Theor Appl Genet 122:533–541 genetics system for plants. Plant J 27:
7. Monna L, Kitazawa N, Yoshino R et al (2002) 235–242
Positional cloning of rice semidwarfing gene, 14. Bruggemann E, Handwerger K, Essex C et al
sd-1: rice "Green revolution gene" encodes a (1996) Analysis of fast neutron-generated
mutant enzyme involved in gibberellin synthesis. mutants at the Arabidopsis thaliana HY4
DNA Res 9:11–17 locus. Plant J 10:755–760
15. Shirley BW, Hanley S, Goodman HM (1992) 28. Henikoff S, Comai L (2003) Single-nucleotide
Effects of ionizing radiation on a plant mutations for plant functional genomics. Annu
genome: analysis of two arabidopsis transpar- Rev Plant Biol 54:375–401
ent testa mutations. Plant Cell 4:333–347 29. Laurie DA, Pratchett N, Allen RL et al (1996)
16. Shikazono N, Suzuki C, Watanabe H et al RFLP mapping of the barley homeotic mutant
(2005) Analysis of mutations induced by car- lax-a. Theor Appl Genet 93:81–85
bon ions in Arabidopsis thaliana. J Exp Bot 30. Voylokov AV, Korzun V, Borner A (1998)
56:587–596 Mapping of three self-fertility mutations in rye
17. Kazama Y, Hirano T, Saito H et al (2011) (Secale cereale L.) using RFLP, isozyme and
Characterization of highly efficient heavy-ion morphological markers. Theor Appl Genet
mutagenesis in Arabidopsis thaliana. BMC 97:147–153
Plant Biol 11:161–170 31. Williams KJ, Fisher JM, Langridge P (1996)
18. Naito K, Kusaba M, Shikazono N et al (2005) Development of a PCR-based allele-specific
Transmissible and nontransmissible mutations assay from an RFLP probe linked to resistance
induced by irradiating Arabidopsis thaliana to cereal cyst nematode in wheat. Genome
pollen with gamma rays and carbon ions. 39:798–801
Genet 169:881–889 32. Godwin ID, Sangduen N, Kunanuvatchaidach
19. Sato Y, Shirasawa K, Takahashi Y et al (2006) R et al (1997) RAPD polymorphisms among
Mutant selection from progeny of gamma-ray- variant and phenotypically normal rice (Oryza
irradiated rice by DNA heteroduplex cleavage sativa var indica) somaclonal progenies. Plant
using brassica petiole extract. Breed Sci Cell Rep 16:320–324
56:179–183 33. Osipova ES, Koveza OV, Troitskij AV et al
20. Harding SS, Mohamad O (2009) (2003) Analysis of specific RAPD and ISSR
Radiosensitivity test on two varieties of fragments in maize (Zea mays L.) somaclones
Terengganu and Arab used in mutation breed- and development of SCAR markers on their
ing of roselle (Hibiscus sabdariffa L.). Afr J basis. Russ J Genet 39:1412–1419
Plant Sci 3:181–183 34. Suo GL, Huang ZJ, He CF et al (2001)
21. Plewa MJ, Dowd PA, Wagner ED (1984) Identification of the molecular markers linked
Calibration of the maize yg2 assay using to the salt-resistance locus in the wheat using
gamma radiation and ethylmethanesulfonate. RAPD-BSA technique. Acta Botanica Sinica
Environ Mutagen 6:781–795 43:598–602
22. Sarduie-Nasab S, Sharifi-Sirchi GR, Torabi- 35. Fu H-W, Li Y-F, Shu Q-Y (2008) A revisit of
Sirchi MH (2010) Assessment of dissimilar mutation induction by gamma rays in rice
gamma irradiations on barley (Hordeum vul- (Oryza sativa L.): implications of microsatel-
gare spp.). J Plant Breed Crop Sci 2:59–63 lite markers for quality control. Mol Breed
23. Lundqvist U (1992) Mutation Research in 22:281–288
Barley. PhD Thesis. Swedish University of 36. Lu JY, Zhang WL, Xue H et al (2010) Changes
Agricultural Sciences, Svalov in AFLP and SSR DNA polymorphisms
24. Koornneeff M, Dellaert LWM, van der Veen induced by short-term space flight of rice
JH (1982) EMS- and relation-induced muta- seeds. Biol Plantarum 54:112–116
tion frequencies at individual loci in Arabidopsis 37. Salina E, Borner A, Leonova I et al (2000)
thaliana (L.) Heynh. Mutat Res 93:109–123 Microsatellite mapping of the induced sphaero-
25. Lee LS, Izquierdo L, Rice N et al (2004) coccoid mutation genes in Triticum aestivum.
Modifying sorghum starch/protein structure Theor Appl Genet 100:686–689
for human consumption. 54th Cereal Chemistry 38. Schmidt AL, Mitter V (2004) Microsatellite
Division Conference of the Royal Australian mutation directed by an external stimulus.
Chemical Institute. Canberra, pp 308–310 Mutat Res 568:233–243
26. Schy WE, Plewa MJ (1989) Molecular dosim- 39. Castiglioni P, Pozzi C, Heun M et al (1998)
etry studies of forward mutation induced at An AFLP-based procedure for the efficient
the yg2 locus in maize by ethyl methanesulfo- mapping of mutations and DNA probes in bar-
nate. Mutat Res 211:231–241 ley. Genet 149:2039–2056
27. van Zeeland AA (1996) Molecular dosimetry 40. Komatsuda T, Maxim P, Senthil N et al
of chemical mutagens. Relationship between (2004) High-density AFLP map of nonbrittle
DNA adduct formation and genetic changes rachis 1 (btr1) and 2 (btr2) genes in barley
analyzed at the molecular level. Mutat Res (Hordeum vulgare L.). Theor Appl Genet
353:123–150 109:986–995
41. Pasini L, Stile MR, Puja E et al (2008) The animals. Nat Protoc 1:2465–2477.
integration of mutant loci affecting maize doi:10.1038/nprot.2006.329
endosperm development in a dense genetic 55. Till BJ, Reynolds SH, Greene EA et al
map using an AFLP-based procedure. Mol (2003) Large-scale discovery of induced
Breed 22:527–541 point mutations with high-throughput
42. Rashid M, Liu R-H, Jin W et al (2009) TILLING. Genome Res 13:524–530.
Genomic diversity among Basmati rice (Oryza doi:10.1101/gr.977903
sativa L) mutants obtained through Co-60 56. Jankowicz-Cieslak J, Huynh OA, Bado S et al
gamma radiations using AFLP markers. Afr J (2011) Reverse-genetics by TILLING expands
Biotechnol 8:6777–6783 through the plant kingdom. Emir J Food Agric
43. Wienholds E, Schulte-Merker S, Walderich B 23:290–300
et al (2002) Target-selected inactivation of the 57. Till BJ, Burtner C, Comai L et al (2004)
zebrafish rag1 gene. Science 297:99–102 Mismatch cleavage by single-strand specific
44. Oleykowski CA, Mullins CRB, Godwin AK nucleases. Nucleic Acids Res 32:2632–2641,
et al (1998) Mutation detection using a novel 32/8/2632 [pii]10.1093/nar/gkh599
plant endonuclease. Nucleic Acids Res 58. Triques K, Piednoir E, Dalmais M et al (2008)
26:4597–4602 Mutation detection using ENDO1: application
45. McCallum CM, Comai L, Greene EA et al to disease diagnostics in humans and TILLING
(2000) Targeting Induced Local Lesions IN and Eco-TILLING in plants. BMC Mol Biol
Genomes (TILLING) for plant functional 9:42. doi:10.1186/1471-2199-9-42
genomics. Plant Physiol 123:439–442 59. Stephenson P, Baker D, Girin T et al (2010) A
46. Caldwell D, McCallum N, Shaw P et al (2004) rich TILLING resource for studying gene
A structured mutant population for forward function in Brassica rapa. BMC Plant Biol
and reverse genetics in Barley (Hordeum vul- 10:62. doi:10.1186/1471-2229-10-62
gare L.). Plant J 40:143–150 60. Ramos ML, Huntley JJ, Maleki SJ et al (2009)
47. Slade AJ, Knauf VC (2005) TILLING moves Identification and characterization of a hypoal-
beyond functional genomics into crop lergenic ortholog of Ara h 2.01. Plant Mol
improvement. Transgenic Res 14:109–115 Biol 69:325–335. doi:10.1007/
48. Till B, Reynolds S, Weil C et al (2004) s11103-008-9428-z
Discovery of induced point mutations in maize 61. Slade AJ, Fuerstenberg SI, Loeffler D et al
genes by TILLING. BMC Plant Biol (2005) A reverse genetic, nontransgenic
4:1471–2229 approach to wheat crop improvement by
49. Xin Z, Li Wang M, Barkley N et al (2008) TILLING. Nat Biotechnol 23:75–81.
Applying genotyping (TILLING) and pheno- doi:10.1038/nbt1043
typing analyses to elucidate gene function in a 62. Blomstedt CK, Gleadow RM, O'Donnell N
chemically induced sorghum mutant popula- et al (2012) A combined biochemical screen
tion. BMC Plant Biol 8:103. and TILLING approach identifies mutations
doi:10.1186/1471-2229-8-103 in Sorghum bicolor L. Moench resulting in
50. Cordeiro G, Eliott FG, Henry RJ (2006) An acyanogenic forage production. Plant
optimized ecotilling protocol for polyploids or Biotechnol J 10:54–66. doi:10.1111/j.
pooled samples using a capillary electrophore- 1467-7652.2011.00646.x
sis system. Anal Biochem 355:145–147 63. Till BJ, Reynolds SH, Weil C et al (2004)
51. Domon E, Saito A, Takeda K (2002) Discovery of induced point mutations in maize
Comparison of the waxy locus sequence from a genes by TILLING. BMC Plant Biol 4:12.
non-waxy strain and two waxy mutants of doi:10.1186/1471-2229-4-12
spontaneous and artificial origins in barley. 64. Cooper JL, Till BJ, Laport RG et al (2008)
Genes Genet Syst 77:351–359 TILLING to detect induced mutations in soy-
52. Szantai E, Ronai Z, Szilagyi A et al (2005) bean. BMC Plant Biol 8:9. doi:10.1186/
Haplotyping by capillary electrophoresis. 1471-2229-8-9
J Chromatogr A 1079:41–49 65. Till BJ, Cooper J, Tai TH et al (2007)
53. Tsai H, Howell T, Nitcher R et al (2011) Discovery of chemically induced mutations in
Discovery of rare mutations in populations: rice by TILLING. BMC Plant Biol 7:19.
TILLING by sequencing. Plant Physiol doi:10.1186/1471-2229-7-19
156:1257–1268. doi:10.1104/pp. 110.169748 66. Marroni F, Pinosio S, Di Centa E et al (2011)
54. Till BJ, Zerr T, Comai L et al (2006) A proto- Large-scale detection of rare variants via
col for TILLING and Ecotilling in plants and pooled multiplexed next-generation sequenc-
ing: towards next-generation Ecotilling. Plant reveals both conserved and novel features of
J 67:736–745. doi:10.1111/j.1365-313X. starch metabolism. Plant Physiol 154:643–
2011.04627.x 655. doi:10.1104/pp. 110.161844
67. Till BJ, Zerr T, Bowers E et al (2006) High- 71. Cross MJ, Waters DL, Lee LS et al (2008)
throughput discovery of rare human nucleotide Endonucleolytic mutation analysis by internal
polymorphisms by Ecotilling. Nucleic Acids Res labeling (EMAIL). Electrophoresis 29:1291–
34:e99, 34/13/e99 [pii]10.1093/nar/gkl479 1301. doi:10.1002/elps.200700452
68. Till BJ, Jankowicz-Cieslak J, Sagi L et al 72. Wang TL, Uauy C, Robson F et al (2012)
(2010) Discovery of nucleotide polymor- TILLING in extremis. Plant Biotechnol J
phisms in the Musa gene pool by Ecotilling. 10:761–772. doi:10.1111/j.1467-7652.
Theor Appl Genet 121:1381–1389. 2012.00708.x
doi:10.1007/s00122-010-1395-5 73. Zerr T, Henikoff S (2005) Automated band
69. Botticella E, Sestili F, Hernandez-Lopez A mapping in electrophoretic gel images using
et al (2011) High resolution melting analysis background information. Nucleic Acids Res
for the detection of EMS induced mutations in 33(9):2806–2812, 33/9/2806 [pii]10.1093/
wheat SBEIIa genes. BMC Plant Biol 11:156. nar/gki580
doi:10.1186/1471-2229-11-156 74. Abramoff MD, Magalhael PJ, Ram SJ (2004)
70. Vriet C, Welham T, Brachmann A et al (2010) Image processing with ImageJ. Biophotonics
A suite of Lotus japonicus starch mutants International 11:36–42
Chapter 9
The Quantitative Real-Time Polymerase Chain Reaction

for the Analysis of Plant Gene Expression
Timothy L. Fitzgerald and Richard B. McQualter
Abstract
The quantitative real-time polymerase chain reaction is used to simultaneously amplify and quantify a
targeted DNA molecule. It can be used to determine exact copy number of a molecule within a sample and/
or to compare the quantity of a molecule between samples. When combined with reverse transcription, it
is a powerful tool for the analysis of gene expression, and it is widely used for this purpose in plant species.
Here we provide an introduction to fundamental concepts relevant for the analysis of gene expression in
plants using this technique and a protocol for quantification of the relative expression of a sucrose phos-
phate synthase gene along the maturation gradient of a sugarcane leaf.
Key words Quantitative real-time PCR, Gene expression, RNA, cDNA, Thermocycler, Probe
1 Introduction
1.1 Quantitative The quantitative real-time PCR method (abbreviated variously,

Real-Time PCR e.g., qRT-PCR, RT-qPCR, or qPCR) extends the use of the
Technology polymerase chain reaction [1]. During qPCR, reagents are incor-
porated into the PCR reaction such that fluorescence is emitted
upon production of each double-stranded product (amplicon).
The increase in concentration of an amplicon is assessed after every
PCR cycle (in “real time”), by measuring the quantity of fluores-
cence emitted within the reaction. The starting concentration of a
target molecule can be assessed by analysis of the number of PCR
cycles taken to reach a set fluorescence level (referred to as the
“cycle threshold” or CT) (Fig. 1). The first published report of
qPCR was in 1992 [2], while the first commercially available qPCR
apparatus (the 7700 Sequence Detection System, Applied
Biosystems) was released in 1996. Subsequently qPCR has grown
to become a standard tool for molecular research. Currently qPCR
instruments from several companies are available, using PCR tube
(e.g., the Qiagen Rotor-Gene Q), 96-well PCR plate (e.g., the
97
98 Timothy L. Fitzgerald and Richard B. McQualter
Fig. 1 An example qPCR reaction (red line) plotted on a linear curve (a) and a logarithmic curve (b). Here the
cycle threshold (CT) is set at 0.35 (green line). The exponential phase of the reaction occurs between cycles 16
and 22. The reaction enters a “linear” phase (cycles 22–28) followed by a “plateau” phase (after cycle 28)
Agilent Mx3000P), and 384-well PCR plate (e.g., the Applied

Biosystems ViiA 7) formats.
Several fluorescence technologies are used for qPCR. Broadly,
these fall into categories of double-stranded DNA (dsDNA)-
binding fluorescent dyes and fluorescent molecular probes.
dsDNA-binding dyes bind to amplicons formed during qPCR and
fluoresce upon binding [3]. Binding and fluorescence occur with
any double-stranded product; it is not dependent on amplification
of a specific target. Therefore nonspecific amplification is problem-
atic for qPCR using dsDNA-binding dyes. SYBR green is the most
widely used dsDNA-binding dye for qPCR, although others
qPCR for Analysis of Plant Gene Expression 99
are available (e.g., EvaGreen, BioTium) that may have superior

performance [4].
Dual-labeled probes [5] (e.g., TaqMan probes, Applied
Biosystems) are the most commonly used fluorescent molecular
probes for qPCR. These are oligonucleotides with a fluorophore
attached to one end of the molecule and a fluorescence quencher
attached to the other. A probe is designed with sequence comple-
mentary to a region internal to a target amplicon. During qPCR
cycling the probe anneals to the target region and is then degraded
by the 5′ nuclease activity of DNA polymerase. This separates the
fluorophore from the quencher molecule, producing fluorescence.
Thus, dual-labeled probes require amplification of a specific target
sequence to produce fluorescence. Other probe-based technolo-
gies are also used for qPCR including “LightCycler” hybridization
probes [6] and “LUX” fluorogenic hairpin probes [7]. While the
specifics of these technologies differ, they are similar to dual-labeled
probes in that they produce fluorescence upon binding to a specific
target sequence.
qPCR has application in genotyping [8] and absolute quantifica-
tion of nucleic acid concentration for clinical purposes, for example
to study viral load [9] and to quantify cancer cell markers [10].
However, qPCR is most widely used for the analysis of gene
expression.
1.2 Applying qPCR to For qPCR-based gene expression analysis (henceforth simply
the Analysis of Plant qPCR), reverse transcription of RNA is first performed to produce
Gene Expression cDNA, and then a gene target is amplified by PCR using cDNA as
a template [1]. Although qPCR is widely considered the “gold
standard” for gene expression analysis [11], conversely, the lack of
standardization amongst published qPCR-based experiments has
long been noted [12]. In response, several attempts have been
made to devise the criteria for appropriate qPCR; the most well
known is perhaps the “MIQE guidelines” (Minimum Information
for Publication of Quantitative Real-Time PCR Experiments)
[13]. Additionally, “The Plant Cell” has published useful articles
dealing with effective qPCR experimental protocols [14] and
statistical analysis [15]. The reader is encouraged to familiarize
themselves with these articles in order to gain a solid understanding
of the numerous variables and potential pitfalls that require nego-
tiation for successful qPCR. However, fundamental considerations
for qPCR to assess plant gene expression are described as follows.
1.3 Assay Design An ideal qPCR assay is specific to its target and possesses amplifica-
Consideration tion efficiency close to 100 % (i.e., a doubling of target amplicon
concentration after each PCR cycle) during the exponential phase of
the reaction [1]. To help achieve this, numerous guidelines for
qPCR assay design have been prepared by researchers and commercial
companies. A summary of recommendations is provided as follows.
Primer design (for use in both dsDNA-binding dye-based and

probe-based assays): (1) An amplicon size between 75 and 200 bp
(shorter amplicons are generally more efficient); (2) GC content of
30–80 % for the amplicon and each primer (ideally 40–60 %; regions
with higher GC content can be difficult to amplify due to high DNA
stability); (3) primer lengths of 20–30 bp (this facilitates primer
design with appropriate annealing temperature and specificity); (4)
primer annealing temperatures of 55–65 °C (for optimal amplifica-
tion efficiency); (5) no stretches of greater than four identical nucle-
otides (stretches of identical nucleotides can induce nonspecific
binding); and (6) no more than two Gs and Cs in the last five nucle-
otides at the 3′ end of the primers (high GC content at the 3′ end
can induce nonspecific primer binding). Dual-labeled (e.g., TaqMan)
probe design: (1) No 5′ guanosine residue (a 5′ guanosine partially
quenches the fluorescence from the 5′ reporter dye); (2) no stretches
of greater than four identical nucleotides; and (3) annealing
temperature of 10 °C higher than primer annealing temperature
(this helps ensure that probes are bound prior to amplification).
Online design tools and commercial software packages are
available allowing a researcher to design their own qPCR
assays. Sigma-Aldrich’s OligoArchitectOnline (http://www.sig-
maaldrich.com/life-science/custom-oligos/dna-probes/product-
lines/probe-design-services.html) is a comprehensive online tool
allowing for design of dsDNA dye-based assays as well as assays
using all common commercial fluorescent probes; the tool is freely
available upon registration. For probe-based assays, some manufac-
turers (including Applied Biosystems and Sigma-Aldrich) offer
complementary custom assay design services. Applied Biosystems
guarantees the performance of their custom TaqMan assays, which
is reassuring given the relatively high cost of qPCR probes.
Additionally, predesigned and optimized qPCR assays for the anal-
ysis of plant gene expression are becoming increasingly available.
RTPrimerDB ([16]; www.rtprimerdb.org) is a freely accessible
online repository of qPCR assays. A moderate number of assays for
the assessment of plant gene expression are currently available here,
and the resource is expanding. Applied Biosystems has a catalogue
of predesigned and guaranteed TaqMan qPCR assays, including
assays for several plant species (http://www.invitrogen.com/site/
us/en/home/Products-and-Services/Applications/PCR/real-
time-pcr/real-time-pcr-assays/taqman-gene-expression.html).
1.4 Biological Biological variability within experimental groups must be accounted

Variability for when conducting qPCR analysis to accurately assess gene expres-
Consideration sion. Pooling samples pre- or post-RNA extraction can allow for
approximation of mean expression levels within a group but will not
facilitate assessment of interindividual variation. RNA extraction from
individual biological replicates for experimental groups allows assess-
ment of interindividual variation, and a minimum of three individual
biological samples is frequently recommended [14].
1.5 Sampling and When sampling for qPCR analysis, an important consideration is
Storage Consideration that plant gene expression is highly responsive to environmental
changes. Therefore, wherever possible, environmental differences
should be restricted to any being studied. For example, expression
of many genes follows circadian patterns [17], and sampling should
be performed at the same time of the day to exclude this effect. It
is also important to understand that sampling of live plant tissue
constitutes wounding, and a transcriptomic response will rapidly
ensue [16]. Snap freezing immediately upon harvest is helpful to
reduce the transcriptional impact of the sampling process. Once
harvested, samples must be maintained in a manner that will
preserve integrity of the transcriptome until processing; storage at
−80 °C is routinely used for this purpose. Additionally, commercial
reagents such as “RNAlater” (Invitrogen) are available.
1.6 Ribonuclease RNA is more susceptible than DNA to nuclease-mediated degra-

Contamination dation, primarily due to the presence of the ribonucleotide 2′
Consideration hydroxyl group [18]. RNA is rapidly degraded by ribonucleases
(RNases), and RNA degradation can have a substantial effect on
the results of qPCR analysis [19]. RNases are present on non-
sterile surfaces and in non-sterile solutions and in high concentra-
tions in human skin and hair secretions [20]. Therefore, care must
be taken to ensure that RNase contamination is not introduced at
any stage during RNA extraction or cDNA synthesis. Prepackaged
RNase-free plasticware and solutions are ideal for use during RNA
extraction and cDNA synthesis. If laboratory-prepared equipment
and/or solutions are to be used, treatment with diethylpyrocar-
bonate (DEPC) prior to autoclaving removes RNase contamination
[21]. Additionally, bleach or products such as “RNase Away”
(Invitrogen) can be used to remove RNases from surfaces of labo-
ratory bench space and equipment. The integrity of the final RNA
product should be assessed before use in qPCR analysis. Common
methods to assess RNA integrity include analysis using the Agilent
Bioanalyzer to obtain an “RNA Integrity Number” (RIN) [19]
and 3′:5′ transcript integrity assays [22]. If using the Agilent
Bioanalyzer, settings optimized for the analysis of plant RNA
(which features specific RNA banding patterns) should be selected.
1.7 Genomic DNA Carryover of genomic DNA into extracted RNA can cause erroneous
Contamination results in qPCR due to amplification of genomic DNA correspond-
Consideration ing to a target transcript. Modern kits for RNA extraction exclude
most DNA. However, commercial RNase-free DNase reagents
(e.g., RNase-free DNase I, New England Biolabs) can be used to
remove trace amounts of DNA from RNA samples. Additionally,
some cDNA synthesis kits incorporate components to remove
DNA (e.g., QuantiTect Reverse Transcription Kit, Qiagen).
A method to verify the absence of genomic DNA should be incor-
porated into qPCR. A common method to check for genomic
DNA contamination is to design qPCR primers flanking an intron;
PCR products from genomic DNA will be larger and detectable

either by visualization using gel electrophoresis or “melt-curve”
analysis [22] which is a standard feature of modern qPCR appara-
tus. However, design of primers flanking an intron is not possible
in all circumstances (e.g., when targeting an intronless gene). As an
alternative, amplification using qPCR primers can be attempted
using an aliquot of each RNA sample; successful amplification indi-
cates the presence of genomic DNA contamination [23].
1.8 PCR Product/ PCR products and plasmid preparations containing target gene
Plasmid sequence are a potential source of contamination for qPCR. It is
Contamination advisable to establish protocols to avoid PCR product/plasmid
Consideration contamination in any molecular laboratory, including discrete
workspace for pre-PCR and post-PCR/plasmid work [24].
Additionally, to identify potential contamination, a “no-template
control” (NTC) reaction that contains all components excluding
the cDNA template should be included for all qPCR primers.
Amplification in the NTC is indicative of PCR product/plasmid
contamination.
1.9 Technical Sources of technical variation in qPCR include cDNA synthesis

Replication and the qPCR reaction itself. cDNA synthesis can be performed
Consideration using a range of commercially available kits. Furthermore, two
oligonucleotide types are commonly used to facilitate cDNA syn-
thesis, “random hexamers” and “Oligo dT.” The specific kit and
oligonucleotide used can affect cDNA composition; therefore,
these should remain standard for the preparation of all cDNA sam-
ples [25]. Ideally, replicate cDNA samples should be prepared for
all RNA samples [14]. However, this adds significantly to the cost
and size of an experiment and therefore may be difficult for large-
scale studies, and variation in cDNA synthesis is indirectly captured
by the use of biological replicates. To account for technical varia-
tion between individual qPCR reactions, it is recommended to run
multiple replicate reactions. Strictly speaking, each independent
well position within a qPCR plate is a variable, and therefore ran-
domization of samples within wells is statistically ideal. Given that
this is highly impractical and within-plate variation in modern
qPCR apparatus is very low [15] it is not common practice.
However, for large experiments performed over multiple qPCR
plates, approaches to account for plate-to-plate variation (which
can be more significant) have been devised (e.g., [26]).
1.10 Normalization Two forms of qPCR normalization are used, the “comparative CT”
Consideration method (relative quantification) and absolute quantification [1].
For relative quantification a gene or genes are chosen as reference
genes. These genes are intended to have expression that is stable
across experimental groups. Under this assumption, the expression
of target genes can be assessed relative to this stable reference.
While conceptually simple, the identification of suitable reference

genes and the accurate normalization of the expression of target
genes to these genes are less trivial.
Often so-called housekeeping genes, which are expressed across
all tissue types and developmental stages [27], are used as “generic”
reference genes for relative quantification. However the level of
expression of such genes can vary substantially, and thus they should
not be considered generically appropriate as references [28].
Numerous publications exist identifying reference genes for specific
plant species and, in some cases, particular experimental conditions
(e.g., [29–33]). However, it is becoming accepted that the selection
of a reference gene should be based upon an assessment of its stabil-
ity within a specific experiment [34]. The use of multiple reference
genes in conjunction may facilitate more accurate normalization
using relative quantification, and methods to identify the most
appropriate set of reference genes are available [35].
Another important consideration when using relative quantifi-
cation is that the amplification efficiency of reference and target
genes may differ. Since amplification efficiency will affect the
number of cycles taken for fluorescence from a gene to reach a
threshold, differences will bias the assessment of relative expression
based purely on CT. The Pfaffl method [36] can be used to account
for differences in efficiency of reference and target genes when
using relative quantification.
Absolute quantification is less frequently used for qPCR
analysis of gene expression. Absolute quantification relies upon the
production of a standard curve of CT values from qPCR analysis of
serially diluted template molecules. By comparing the CT value
from qPCR of a sample to the standard curve, the absolute number
of target molecules in the sample can be determined. Upon
accurate determination of the total cDNA concentration in the
sample, the concentration of the target molecule can be assessed
[37]. Although it requires standard curve production for all targets
and accurate quantification of cDNA concentration in all samples,
absolute quantification eliminates issues of non-constitutive expres-
sion of reference genes and differences in amplification efficiencies
between target and reference genes. An optimized method for
absolute quantification using qPCR to assess plant gene expression
has been published recently [38].
1.11 Multiplex qPCR The use of fluorescent probes specific to individual gene targets
Analysis Consideration provides the option of multiplexing qPCR [1]. By labeling indi-
vidual probes using dyes with unique fluorescence spectra, qPCR
can be performed for these targets simultaneously. The choice of
fluorescent dyes for probes to be multiplexed is critical as some
dyes have significant overlap in terms of fluorescence spectra that
can lead to “cross talk” (i.e., a proportion of the fluorescence from
one dye will be detected by the channel targeting another) [39].
Life Technologies’ “Fluorescence Spectraviewer” tool (http://www.

invitrogen.com/site/us/en/home/support/Research-Tools/
Fluorescence-SpectraViewer.html) can be used to determine
whether specific commercial dye combinations are suitable for
multiplexing. Modern qPCR apparatus accommodate multiplex-
ing of at least three individual fluorescent probe-based assays; the
maximum number of reactions that can be multiplexed depends
upon the number of unique fluorescence detection channels avail-
able in a given qPCR instrument. Multiplex PCR can be advanta-
geous as it reduces the number of individual reactions required for
an experiment as well as allows for robust between-reaction nor-
malization by the multiplexing of a reference gene/s with a gene
or genes of interest. However, it is associated with additional tech-
nical challenges.
When multiplexing qPCR it is important to ensure that the
component reactions do not interact as cross-reactivity will lead to
altered reaction efficiency. Regions of sequence complementarity
between primers, probes, and amplicons of individual assays (which
are likely to lead to cross-reactivity) can be identified using nucleo-
tide sequence alignment tools (e.g., edialign, http://emboss.
bioinformatics.nl/cgi-bin/emboss/edialign). The relative expres-
sion of genes targeted by component assays is another important
consideration for multiplex qPCR. If the expression of individual
targets differs substantially, the majority of the generic qPCR
reagents may be consumed by amplification of the highly expressed
target/s, which will reduce efficiency of amplification of the lowly
expressed target/s. To overcome this issue “primer limiting” can
be performed for one or more of the component reactions [39].
In order to primer limit, the effect of decreasing primer
concentrations for one or more of the component reactions of a
multiplex qPCR assay is assessed. The lowest concentration of
primers that does not decrease amplification efficiency is identified
and used in the multiplex assay. Reducing primer concentrations
reduces the length of the linear phase of a component reaction and
thereby reduces the amount of reagents incorporated into the reac-
tion (and the maximum fluorescence level). However, providing
that reaction efficiency is not altered this will not affect qPCR anal-
ysis. In some cases it may be expected that one target within a
multiplex reaction will be consistently much more highly expressed
than others across all samples. In such a situation primer limiting
may only be necessary for the highly expressed target. However,
when multiplexing qPCR for targets where expression may vary
substantially across samples it is useful to perform primer limiting
for all targets.
1.12 Data Analysis Modern qPCR apparatus feature “onboard” software for data analy-
Consideration sis. However, such software is often based upon generic assumptions
that may not be appropriate for a specific assay (e.g., analysis may not
consider amplification efficiencies of individual genes) [26]. A large

volume of third-party software is available to assist with qPCR
analysis; http://www.gene-quantification.de/download.html is an
excellent repository of such software. LinRegPCR [40] is a useful
package for calculating reaction efficiencies and provides visual out-
put of the efficiency curves of all gene targets in a given dataset.
qBasePLUS [26] is a comprehensive commercial program for qPCR
data analysis that allows normalization with multiple reference genes,
incorporates amplification efficiencies for individual gene targets, and
features an algorithm to correct for between-run variability. qBaseP-
LUS also incorporates an algorithm that selects the optimal combi-
nation of genes to use for normalization purposes where data from
multiple potential reference genes is obtained.
After analysis, qPCR data is routinely presented as mean and
standard error values, highlighting significantly different data
points at one or multiple confidence levels.
1.13 The Future of Rapid advances in genomic technologies are facilitating the analysis
Quantitative PCR for of gene expression on an increasingly large scale. Genome-wide
the Analysis of Plant assessment of plant gene expression by transcriptome sequencing
Gene Expression [41] will become routine as sequencing costs continue to decrease.
Nevertheless, there will always be a need for the study of the
expression of a specific gene or a subset of genes, with the highest
degree of accuracy and in the most time and/or cost-efficient man-
ner possible. qPCR is highly effective for assessment of the expression
of small-to-moderate number of genes in small-to-very-large num-
ber of samples.
Instruments for qPCR analysis are continuously being refined,
and qPCR apparatus currently available provide more flexibility,
cost-effectiveness, and efficiency than ever before. Additionally, a
range of apparatus is available with varying capabilities and within
various price ranges, allowing researchers to select equipment most
suitable for their specific needs. “Digital PCR” [42], a new genera-
tion of technology for quantitative PCR analysis, has recently been
commercialized (e.g., the QX100 Droplet Digital PCR system, Bio-
Rad). In digital PCR analysis, the reaction is partitioned into a very
large number of nano- or picoliter chambers. The presence/absence
of a specific PCR amplicon is then called in each chamber, allowing
for highly accurate assessment of amplicon concentration within a
sample. Digital PCR offers higher sensitivity and accuracy for quan-
titative PCR than real-time PCR [42], and as digital PCR technology
is refined and reduces in cost it may replace real-time quantitative
PCR as the method of choice for quantitative PCR analysis. However,
in some form, quantitative PCR for highly accurate and sensitive
analysis of gene expression is likely to persist for many years.
An example protocol for a qPCR assay using Bio-Rad reagents
is provided as follows. The protocol evaluates the expression
pattern of a sucrose phosphate synthase (SPS) B gene along the
maturation gradient of a sugarcane leaf.
2 Materials
2.1 RNA Extraction 1. Aurum Total RNA Fatty and Fibrous Tissue Kit (Cat # 732-
6830, Bio-Rad, Gladesville, NSW, Australia).
3. Liquid nitrogen.
4. Aluminum foil.
2.2 cDNA Synthesis 1. iScript™cDNA Synthesis Kit containing 5× iScript reaction

mix, nuclease-free water, iScript reverse transcriptase.
2. RNA template (100 fg to 1 μg total RNA) (see Note 1).
3. Thermocycler (e.g., C1000 Thermal Cycler—Bio-Rad,
Gladesville, NSW, Australia).
4. Pipette tips, aerosol barrier tips (see Note 2).
5. Nuclease-free tubes (0.2 ml thin-wall tubes).
2.3 Quantitative PCR 1. SSoFast EvaGreen Supermix (Bio-Rad, Gladesville, NSW,

Australia).
2. Nuclease-free water.
3. Primers (see Note 3):
Name Nucleotide sequence 5′–3′ Purpose

SPS-F GTGCTCATCAGTGTGCATGGTCTTGTTC Target
SPS-R CGAGTGAAGAGGTCCACCCTGTACACTC Target
CUL-F TAGGACAATCGATCTGGAGGAGGGATG Reference
CUL-R AGAGCTGCTGCGAGTAGTCGTGTGG Reference
LUG-F AACTCATTTGGGGGAGCTGAACAGACAG Reference
LUG-R CCTGGTGTATGAGTGGAAGGTGTCGAG Reference
4. Real-time PCR machine (e.g., Bio-Rad CFX96 Real-Time

PCR System).
5. Software for analysis of real-time PCR data (e.g., Bio-Rad CFX
Manager).
6. Pipette tips, aerosol barrier tips.
7. 1.5 mL microfuge tubes.
8. 96 well PCR plates (Cat # HSP9665, Bio-Rad, Gladesville,
NSW, Australia).
9. cDNA template.
3 Methods
3.1 Primer and 1. Download the sequence with accession number JN584485,
Amplicon Design which encodes the SPS B gene from sugarcane, from NCBI
(http://www.ncbi.nlm.nih.gov/).
2. Use the online Primer3 program (http://frodo.wi.mit.edu/)
or a proprietary program like VectorNTI to design primers to
the target sequences. Leave all settings at default except the
following: set product size range as 75–200; ensure that Primer
Tm Opt is set to 60 °C.
3. For each primer set identified above, copy the region that will
be amplified by your PCR primers and include about 50 nucle-
otides upstream and downstream. Paste the sequence into the
DNA Folding Form of mFold (http://mfold.rna.albany.
edu/?q = mfold/dna-folding-form) (see Note 4).
4. Enter a sequence name if desired.
5. Set the folding temperature to the Tm value predicted by
Primer3.
6. Set ionic conditions to those which will be present in your
PCR reaction. If these are unknown, set [Na+] to 50 mM and
[Mg++] to 1.5 mM. Make sure that the “mM” button is
selected. Leave all other parameters at the default setting.
7. Select “Fold DNA.”
8. Select one of the graphical views in the output, and determine
if either the forward or the reverse primer anneals to part of the
template containing secondary structure. If either primer does,
repeat the procedure for alternative primer sets until an appro-
priate set can be found (Fig. 2, see Note 5).
3.2 RNA Extraction Work quickly with the material used for RNA extractions. Freeze
in liquid nitrogen as soon as possible.
1. Remove a partially expanded leaf, containing immature tissue
at the leaf base and fully mature tissue towards the leaf tip,
from a sugarcane plant.
Fig. 2 Nucleotide sequence of sugarcane sucrose phosphate synthase B adjacent

to primer binding
Fig. 3 Positions at which developing sugarcane leaf should be sectioned
2. Transversely section the leaf into four equal pieces according to

Fig. 3. Quickly cut each section into 1 cm lengths, then wrap
in aluminum foil, and snap freeze in liquid nitrogen.
3. Extract RNA from 100 mg of the leaf tissue using an Aurum
Total RNA Fatty and Fibrous Tissue Kit according to the
detailed protocol contained in the kit. The protocol includes a
DNase treatment step to remove contaminating genomic DNA.
4. Measure the RNA yield for each sample with a Nanodrop spec-
trophotometer according to the manufacturer’s instructions.
5. Store eluted RNA at −80 °C or use immediately.
3.3 cDNA Synthesis 1. To a nuclease-free 1.5 mL microfuge tube, on ice, add the
following components: 4 μL of 5× iScript reverse transcription
supermix, 1 μg of high-quality RNA from leaf sections 1
through 4 (S1, S2, S3, S4) (see Note 6), and nuclease-free
water sufficient to make a final volume of 20 μL.
2. Mix the contents of the tubes, and spin briefly in a microcen-
trifuge to bring the contents to the bottom of the tube.
3. Transfer the contents of each tube to a nuclease-free 0.2 mL
PCR tube, and place in a thermocycler.
4. Generate cDNA from the RNA template by incubating the
reaction in a thermocycler as follows: 5 min at 25 °C, 30 min
at 42 °C, and 5 min at 85 °C.
5. Store cDNA at −20 or −80 °C until use, and dilute 1 in 5 (v/v)
in nuclease-free water prior to use in the qPCR reaction.
3.4 Identify Optimal 1. Prepare a master mix as follows, sufficient for 17 reactions per
Tm for Primers primer set to be tested. This will provide sufficient master mix
for duplicate reactions at eight separate temperatures and
excess for pipetting losses:
Volume per Master mix

Reagent reaction (μL) (×18) (μL)
10 μM forward primer (SPS-F) 0.8 13.6
10 μM reverse primer (SPS-R) 0.8 13.6
cDNA (Subheading 3.3, step 5) 1.0 17.0
SSoFast EvaGreen Supermix 10.0 170.0
Nuclease-free water 7.4 125.8
Fig. 4 (a) Thermocycling parameters for gradient PCR. (b) Amplification chart of SPS gradient PCR color coded
for annealing temperature
2. Prepare a separate NTC for each primer set, substituting

nuclease-free water for the cDNA.
3. Aliquot 20 μL of master mix to each of 16 PCR tubes, for each
primer set tested, with an additional tube to include the NTC.
4. Place in thermocycler (CFX96 Real-Time System), and cycle as
follows (see also Fig. 4a):
Activate at 95 °C for 30 s.
Denature at 95 °C for 5 s; anneal at 55–70 °C for 5 s; plate read;
and repeat 39 times.
5. Include a melt curve analysis using the default settings (e.g.,
65–90 °C, increments of 0.5 °C for 5 s each increment).
6. Using the CFX Manager software (see Note 7) identify the
annealing temperature for each primer set at which the cycle
threshold (CT or Cq) value is smallest and the slope of the curve
is steepest and gives the highest RFU value (see Note 8).
7. Analyze the melting curve to ensure that PCR products are
specific (Fig. 4b, see Note 9).
8. Retain some of the PCR products showing a single specific
peak in the melt curve for serial dilution in the next section.
3.5 Test Dynamic 1. Add 1 μL of PCR product (retained from Subheading 3.3) to
Range of Assay 999 μL of nuclease-free water to give a 1 × 10−3 dilution.
2. From the 1 × 10−3 dilution create a tenfold serial dilution of
your template down to 1 × 10−9 dilution.
3. Prepare a master mix as follows sufficient for 30 reactions. Mix
thoroughly and spin briefly to collect contents at the bottom
of the tube:
Reagent Volume per reaction(μL) Master mix (×30) (μL)

10 μM forward primer (SPS-F) 0.8 24
10 μM reverse primer (SPS-R) 0.8 24
Template (Subheading 3.2, step 5) 1.0 Add in subsequent step
SSoFast EvaGreen Supermix 10.0 300
Nuclease-free water 7.4 222
4. Label eight microfuge tubes “10−3” through to “10−9.” Label

a ninth tube “NTC” for the no-template control. Aliquot
62.7 μL of master mix into each labeled tube.
5. Add 3.3 μL of each serial dilution to the correspondingly
labeled microfuge tube.
6. Add 3.3 μL of nuclease-free water to the tube labeled “NTC.”
7. Mix all tubes thoroughly, and spin briefly to collect contents at
the bottom of the tube.
8. Subdivide each tube into three replicates by aliquoting 20 μL
into each of the three PCR tubes.
9. Place in thermocycler, and cycle as follows:
Denature at 95 °C for 5 s; anneal at the optimal Tm (determined
in Subheading 3.3) for 5 s; plate read; and repeat 39 times.
11. Observe the amplification chart and standard curve (Fig. 5).
The efficiency (E) should be between 90 and 110 % with an R2
value greater than 0.98.
12. Choose standards that cover the range of Ct values expected in
your gene study (normally between 20 and 30 cycles).
Fig. 5 (a) Amplification chart of serial dilution of SPS template. (b) Standard curve showing efficiency value and
R 2 value
3.6 Gene 1. Prepare master mix A for each target gene (Cullin (CUL),
Expression Study Leunig (LUG), SPS):

Reagent reaction (μL) A (×16) (μL)
10 μM forward primer 0.8 12.8
10 μM reverse primer 0.8 12.8
Nuclease-free water 7.4 118.4
2. Prepare master mix B for each template (S1, S2, S3, S4, NTC):

Reagent reaction (μL) B (×10)
Template (Subheading 3.2, step 5) 1.0 10.0
SSoFast EvaGreen Supermix 10.0 100
3. Aliquot 11 μL of master mix A and 9 μL of master mix B to

each well as appropriate, according to the plate layout in Fig. 6a.
4. Place in thermocycler, and cycle as follows:
Denature at 95 °C for 5 s; anneal at the optimal Tm (determined
in Subheading 3.3) for 5 s; plate read; and repeat 39 times.
Fig. 6 (a) Plate layout for the SPS gene expression study. (b) Target stability values calculated by the CFX
Manager software for reference genes LUG and CUL
6. In CFX Manager observe the Cq values for the reference genes

(CUL, LUG). The variation on the Cq values should not be
more than 2.
7. Select the “Gene Expression” tab.
8. In the right-hand panel under “mode:” select Normalized
expression (ΔΔCq) from the pull-down menu. This normalizes
the data using the measured expression level of one or more
reference genes (targets) as a normalization factor.
9. Select the “Experiment Settings” button.
10. Under the “Reference” heading select the reference genes by
checking the boxes next to “CUL” and “LUG.” Under the
“Show Chart” heading select the target gene by checking the
box next to “SPS.” Enter the reaction efficiency values
(Subheading 3.6, step 9) under the heading Efficiency (%) if
known; otherwise leave at 100.
11. Select the samples tab. Under the “Control” heading select the
check box next to the sample you wish to use as the control
(e.g., S1). Select “OK.”
12. Select the “Target Stability Value” button.
13. The mean CV value should be less than 0.25, and the mean M
value should be less than 0.5 (Fig. 6b). Select “OK.”
14. Export the data for publication.
4 Notes
1. PCR is highly sensitive to even small amounts of cross con-

tamination. Pipette tips containing a barrier to aerosols and
certified DNase and RNase free should be used at all times.
2. Plant tissue used for total RNA extraction should be snap frozen
in liquid nitrogen immediately upon harvesting. Various RNA
extraction kits provide very-good-quality RNA template for
qPCR analysis including the Aurum Total RNA Fatty and
Fibrous Tissue Pack (Bio-Rad Laboratories, Inc) and the
Agilent Plant RNA Isolation Mini Kit (Agilent Stratagene).
3. The target gene used in this example is sugarcane SPS B
(Accession JN584485). The two reference genes are sugarcane
homologues of two of the reference genes described by Manoli
[1] and encode CUL and LUG. These reference genes exhibit
high expression stability across different tissue types and exper-
imental conditions.
4. It is important to design primers in regions of the template that
do not contain stable secondary structures as primers are less
able to bind to the template and this will affect the efficiency of
the reaction. Hence, check the template for secondary struc-
tures in mFold.
5. Proprietary software is available which follow all the guidelines
specified for PCR design (e.g., Beacon Designer—Premier
Biosoft).
6. RNA should be of high purity and integrity. Impurities in the
RNA sample can inhibit cDNA synthesis and the PCR reaction
and hence introduce biases in the results. Purity of the RNA
should be measured spectrophotometrically. An OD260/280
ratio of 1.8–2.0 indicates good-quality RNA. Integrity of the
RNA can be measured on an agarose gel or on a microfluidics-
based electrophoresis system. Degraded RNA should not be
used for qPCR.
7. Refer to the CFX Manager manual for details of how to set up
runs and analyze the results (http://www.bio-rad.com/web-
root/web/pdf/lsr/literature/Bulletin_10021337.pdf).
8. This is the optimal annealing temperature for your primer set
under these reaction conditions and gives the most efficient
amplification. When using multiple target and reference genes
in an assay, choose an annealing temperature which is the best
average optimal for all.
9. Products containing nonspecific amplification will show more
than one peak or a peak with the wrong melting temperature.
If an annealing temperature cannot be found where nonspecific

product is not present, new primers will need to be designed
for that template. When analyzing multiple targets it is best to
choose a Tm that is optimal for all primer sets to be used.
Acknowledgements
We wish to acknowledge the Australian Research Council and the

Grains Research and Development Corporation for Funding and
Dr Rosanne Casu (CSIRO Plant Industry, Australia) for critical
reading.
References
1. VanGuilder H, Vrana K, Freeman W (2008) 11. Derveaux S, Vandesompele J, Hellemans
Twenty-five years of quantitative PCR for gene J (2010) How to do successful gene expression
expression analysis. Biotechniques 44:619–626 analysis using real-time PCR. Methods 50:
2. Higuchi R, Dollinger G, Walsh P et al (1992) 227–230
Simultaneous amplification and detection of 12. Bustin S, Nolan T (2004) Pitfalls of quantita-
specific DNA sequences. Biotechnology 10: tive real-time reverse-transcription polymerase
413–417 chain reaction. J Biomol Tech 15:155–166
3. Rasmussen R, Morrison T, Herrmann M et al 13. Bustin S, Benes V, Garson J et al (2009) The
(1998) Quantitative PCR by continuous fluo- MIQE guidelines: minimum information for
rescence monitoring of a double strand DNA publication of quantitative real-time PCR
specific binding dye. Biochemica 2:8–11 experiments. Clin Chem 55:611–622
4. Eischeid A (2011) SYTO dyes and EvaGreen 14. Udvardi M, Czechowski T, Scheible W-R
outperform SYBR Green in real-time PCR. (2008) Eleven golden rules of quantitative
BMC Res Notes 4:263 RT-PCR. Plant Cell 20:1736–1737
5. Livak K, Flood S, Marmaro J (1995) 15. Rieu I, Powers S (2009) Real-time quantitative
Oligonucleotides with fluorescent dyes at RT-PCR: design, calculations, and statistics.
opposite ends provide a quenched probe Plant Cell 21:1031–1033
system useful for detecting PCR product and 16. Reymond P, Weber H, Damond M et al (2000)
nucleic acid hybridization. Genome Res 4: Differential gene expression in response to
357–362 mechanical wounding and insect feeding in
6. Wittwer C, Ririe K, Andrew R et al (1997) The Arabidopsis. Plant Cell 12:707–719
LightCycler™: a microvolume multisample 17. Mcclung C (2006) Plant circadian rhythms.
fluorimeter with rapid temperature control. Plant Cell 18:792–803
Biotechniques 22:176–181 18. Li Y, Breaker R (1999) Kinetics of RNA degra-
7. Nazarenko I, Lowe B, Darfler M et al (2002) dation by specific base catalysis of transesterifi-
Multiplex quantitative PCR using self- cation involving the 2’-hydroxyl group. J Am
quenched primers labeled with a single fluoro- Chem Soc 121:5364–5372
phore. Nucleic Acids Res 30:e37 19. Fleige S, Pfaffl M (2006) RNA integrity and
8. Giancola S, Mckhann H, Bérard A et al the effect on the real-time qRT-PCR perfor-
(2006) Utilization of the three high-throughput mance. Mol Aspects Med 27:126–139
SNP genotyping methods, the GOOD assay, 20. Probst J, Brechtel S, Scheel B (2006)
Amplifluor and TaqMan, in diploid and poly- Characterization of the ribonuclease activity on
ploid plants. Theor Appl Genet 112:1115–1124 the skin surface. Genet Vaccines Ther 4:4
9. Gallinella G, Bonvicini F, Filippone C et al 21. Gilman M (2002) Preparation of cytoplasmic
(2004) Calibrated real-time PCR for evalua- RNA from tissue culture cells, Current proto-
tion of Parvovirus B19 viral load. Clin Chem cols in molecular biology. Wiley, New York
50:759–762 22. Oshima Y, Fujimura A (2003) Analysis of 3’/5’
10. Bernard P, Wittwer C (2002) Real-time PCR ratio of actin and Glyceraldehyde-3-Phosphate
technology for cancer diagnostics. Clin Chem Dehydrogenase (GAPDH). Genome Informatics
48:1178–1185 14:472–473
23. Tavares L, Alves P, Ferreira R et al (2011) 32. Løvdal T, Lillo C (2009) Reference gene selec-
Comparison of different methods for DNA-free tion for quantitative real-time PCR normaliza-
RNA isolation from SK-N-MC neuroblastoma. tion in tomato subjected to nitrogen, cold, and
BMC Res Notes 4:3 light stress. Anal Biochem 387:238–242
24. Aslanzadeh J (2004) Preventing PCR amplifi- 33. Li Q-F, Sun S, Yuan D-Y et al (2010) Validation
cation carryover contamination in a clinical of candidate reference genes for the accurate
laboratory. Ann Clin Lab Sci 34:389–396 normalization of real-time quantitative RT-PCR
25. Ståhlberg A, Kubista M, Pfaffl M (2004) data in rice during seed development. Plant
Comparison of reverse transcriptases in Mol Biol Rep 28:49–57
gene expression analysis. Clin Chem 50: 34. Gutierrez L, Mauriat M, Pelloux J (2008)
1678–1680 Towards a systematic validation of references in
26. Hellemans J, Mortier G, De Paepe A et al real-time RT-PCR. Plant Cell 20:1734–1735
(2007) qBase relative quantification framework 35. Vandesompelem J, De Preterm K, Pattynm F
and software for management and automated et al. (2002) Accurate normalization of real-
analysis of real-time quantitative PCR data. time quantitative RT-PCR data by geometric
Genome Biol 8:R19 averaging of multiple internal control genes.
27. Butte A, Dzau V, Glueck S (2001) Further Genome Biol 3:research0034
defining housekeeping, or “maintenance”, 36. Pfaffl M (2001) A new mathematical model for
genes—focus on “A compendium of gene relative quantification in real-time RT–PCR.
expression in normal human tissues”. Physiol Nucleic Acids Res 29:e45
Genomics 7:95–96 37. Whelan J, Russell N, Whelan M (2003)
28. Radonić A, Thulke S, Mackay I et al (2004) A method for the absolute quantification of
Guideline to reference gene selection for quan- cDNA using real-time PCR. J Immunol
titative real-time PCR. Biochem Biophys Res Methods 278:261–269
Commun 313:856–862 38. Lu Y, Xie L, Chen J (2012) A novel procedure
29. Jain M, Nijhawan A, Tyagi A et al (2006) for absolute real-time quantification of gene
Validation of housekeeping genes as internal expression patterns. Plant Methods 8:9
control for studying gene expression in rice by 39. Gunson R, Bennett S, Maclean A et al (2008)
quantitative real-time PCR. Biochem Biophys Using multiplex real time PCR in order to
Res Commun 345:646–651 streamline a routine diagnostic service. J Clin
30. Nicot N, Hausman J-F, Hoffmann L et al Virol 43:372–375
(2005) Housekeeping gene selection for 40. Ramakers C, Ruijter J, Deprez R et al (2003)
real-time RT-PCR normalization in potato Assumption-free analysis of quantitative real-
during biotic and abiotic stress. J Exp Bot 56: time polymerase chain reaction (PCR) data.
2907–2914 Neurosci Lett 339:62–66
31. Czechowski T, Stitt M, Altmann T et al (2005) 41. Wang Z, Gerstein M, Snyder M (2009) RNA-
Genome-wide identification and testing of Seq: a revolutionary tool for transcriptomics.
superior reference genes for transcript normal- Nat Rev Genet 10:57–63
ization in Arabidopsis. Plant Physiol 139: 42. Baker M (2012) Digital PCR hits its stride. Nat
5–17 Methods 9:541–544
Chapter 10
Cloning of DNA Fragments: Ligation Reactions

in Agarose Gel
Agnelo Furtado
Abstract
Ligation reactions to ligate a desired DNA fragment into a vector can be challenging to beginners and
especially if the amount of the insert is limiting. Although additives known as crowding agents, such as
PEG 8000, added to the ligation mixes can increase the success one has with ligation reactions, in practice
the amount of insert used in the ligation can determine the success or the failure of the ligation reaction.
The method described here, which uses insert DNA in gel slice added directly into the ligation reaction,
has two benefits: (a) using agarose as the crowding agent and (b) reducing steps of insert purification. The
use of rapid ligation buffer and incubation of the ligation reaction at room temperature greatly increase the
efficiency of the ligation reaction even for blunt-ended ligation.
Key words Rapid ligation, DNA, Agarose, Gel slice, Cloning
1 Introduction
Ligation of DNA fragments into a desired vector is an essential step

in the cloning of DNA in bacteria. Success with ligation reactions
depends on using fresh and appropriately stored reagents such as
ligase and ATP and appropriate conditions for ligations such as the
temperature for the ligation reaction. In addition, the amount of
vector and the molar ratio of insert to vector can be crucial to suc-
cessful ligation reaction. In practice however, the step of ligating
DNA fragments into a suitable vector can be challenging especially
if the DNA fragment or the vector is in limiting amounts and in
low concentration. Both DNA insert and vector may require enzy-
matic manipulations with several rounds of electrophoresis on aga-
rose gels and purification, with consequent loss in their amounts
during the purification steps. Using a larger amount of insert or
vector to account for loss during the manipulation and purification
does not always help as the amount of DNA lost during purifica-
tion steps can be unpredictable. The procedure described here is
adapted from a published method of performing the ligation reac-
117
118 Agnelo Furtado
tion in gel slices [1] but with crucial modifications to increase the
efficiency of ligations even with very low amounts of insert DNA,
both for sticky or blunt-end ligations.
2 Materials
1. Low melting point agarose (NuSieve agarose, FMC Bio

Products, ME, USA).
2. 0.5 M Ethylenediaminetetraacetic acid (EDTA): EDTA will
not go completely into solution until the pH is adjusted to
about 8.0. For a 500 mL stock solution of 0.5 M EDTA, weigh
out 93.05 g EDTA disodium salt (FW = 372.2). Dissolve in
400 mL distilled water, and adjust the pH to 8.0 with NaOH.
Adjust the final volume to 500 mL with distilled water.
3. 50× Tris–acetate–EDTA (TAE) buffer: Take 242 g Tris base
(FW = 121.14) and dissolve in approximately 750 mL distilled
water. Carefully add 57.1 mL glacial acid acid and 100 mL of
0.5 M EDTA (pH 8.0), and adjust the final volume to 1 L.
The pH of this buffer is not adjusted and should be about 8.5.
This stock solution can be stored at room temperature.
4. 1× TAE buffer chilled: Take 20 mL of 50× TAE buffer and
dilute to 1 L with distilled water. Store in a refrigerator at 4 °C.
5. JM109 competent cells (cat # L2001, Promega, USA).
6. 2× Rapid Ligation buffer (product # C6711, Promega, USA).
7. 1–3 U/μL T4 DNA ligase (Promega, USA).
8. 0.2 mL PCR tubes.
9. Thermocycler.
10. Handheld long-wave UV transilluminator.
11. Glass plate with black background (a black plastic stick-on can
be placed on one side of the glass plate).
13. Electrophoresis apparatus.
14. 6× gel loading buffer: 0.25 % bromophenol blue, 0.25 %
xylene cyanol FF, and 15 % Ficoll (Type 400; Pharmacia) in
distilled water.
15. SOC medium, 0.5 % yeast extract, 2 % tryptone, 10 mM NaCl,
2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glu-
cose. Sterilize the glucose solution by passing it through a
0.2 μm filter. Sterilize the rest of the ingredients, and cool
down after which sterilized glucose solution is added. SOC
medium can be stored at room temperature in small aliquots
and is stable for several years at −20 °C.
DNA Ligations in Agarose Gel 119
3 Method
1. Prepare molten 1 % low-melting-agarose gel in 1× TAE buffer.

Cool the agarose to 40 °C by cooling the bottle containing the
molten agarose under tap water.
2. Cast the gel at 4 °C as follows. Place a gel tray with comb in a
4 °C fridge or in a cold room, and pour the molten agarose
that was cooled to 40 °C. Let the gel set for 1 h (see Note 1).
3. Prepare the electrophoresis apparatus as follows. Place the tray
containing the gel into an electrophoresis tank, and fill both
the chambers with chilled 1× TAE buffer.
4. Prepare the DNA samples as follows. Mix each DNA sample
with twice the required amounts of 6× gel loading buffer
(see Note 2).
5. Apply appropriate voltage, and resolve the DNA (see Note 3).
6. After the electrophoresis run, stain the gel in ethidium bro-
mide for 45 min (see Note 4).
7. Observe the DNA using a handheld UV (long UV wavelength)
to avoid damage to the DNA by UV light (see Note 5).
8. Cut out the necessary bands as follows. Using the handheld UV
cut out the gel slice containing the DNA and place flat on the
glass plate. The DNA, if loaded properly with double the 6× gel
loading buffer, should be at the bottom end of the gel slice.
Trim out parts of the gel slice that have no DNA and discard.
Soak up any buffer around the required gel piece using a clean
tissue paper. The gel slice containing the stained DNA should be
used for cloning. Collect the trimmed gel slice in a PCR tube.
9. Prepare the ligation mix as follows, and keep on ice. For a
single 10 μL ligation reaction containing 4 μL of vector plus
insert volume, take 5 μL of 2× rapid ligation buffer plus 1 μL
of ligase.
10. Prepare the DNA contained in the gel slices as follows for the
ligation reaction. If both the vector and insert are resolved in a
low-melting gel then treat them as follows (see Note 6).
11. Using a thermocycler melt the gel slices containing the vector
and insert at 72 °C for 1 min, and then reduce the temperature
at 37 °C (see Note 7).
12. In a separate PCR tube, kept at 37 °C in a thermocycler, add the
molten gel containing the vector and insert DNA, 1 and 3 μL,
respectively, and mix well by pipetting in and out several times.
13. Take the mixed molten gel containing the vector, and insert
and add to the chilled ligation mix. Immediately mix by pipet-
ting in and out several times, and then place on ice for 5 min.
120 Agnelo Furtado
14. Incubate the ligation reaction overnight at room temperature.

15. The next day carry out the transformation of chemically com-
petent cells as follows. Take at least 40 μL. The competent cells
stored at −70 °C can be thawed by placing the tube/s on ice.
For each transformation, aliquot 40 μL of competent cells into
Eppendorf tubes, and place in ice for 10 min. Using a thermo-
cycler remelt the ligation reaction (containing the vector and
insert in gel) at 72 °C for 1 min, and then cool down to 37 °C
(the gel does not set at 37 °C). Then take 4 μL and add to
40 μL of competent cells as follows. Add the molten ligation
mix gently into the chilled competent cells, and then mix by
pipetting in and out several times. Place the tube back on ice
for at least 30 min before carrying out the heat shock treat-
ment (see Note 8).
16. Carry out bacterial transformation by heat shock treatment as
follows. Place the tubes containing the cells and ligation reac-
tion into a 42 °C water bath for 45 s and then immediately on
ice.
17. After 5 min add 700 μL of SOC medium pre-warmed to 37 °C,
and gently mix the contents by inverting the tubes two or
three times.
18. Incubate the tubes for 2–3 h at 37 °C with constant shaking.
19. Spread 100 and 200 μL of the transformed cells on separate
LB plates containing appropriate antibiotics.
20. Incubate at 37 °C for 16 h for the colonies to grow.
21. Screen the colonies for the successful ligations using a PCR
screen to test for the insert ligated into the vector (these steps
are not explained here).
4 Notes
1. The 1 % low-melt gel will not set firmly if kept at room tem-
perature. It must be set at 4 °C.
2. Use of twice the amount of 6× gel loading buffer is necessary
so that the DNA sample mixed with the loading dye settles
neatly at the bottom of each well. This is critical to obtain a
single band of DNA in the gel slice to be cut out—see Note 8.
3. The temperature of the gel should not go over 45–55 °C. If
this happens replace the electrophoresis running buffer with
chilled buffer.
4. The low-melting gel is very fragile and must be handled with
care. Prepare the stain (ethidium bromide in 1× TAE buffer) in
an appropriate plastic container (do not use a communal con-
tainer to avoid breakage of the gel), and place the gel tray
DNA Ligations in Agarose Gel 121
containing the gel in container with staining solution. Do not

place the gel without the gel tray because it will be difficult to
lift the gel out of the staining solution. Stain the gel for at least
45 min so that the DNA bands can be easily observed using a
handheld UV source (long UV wavelength).
5. Damaged or single-stranded cut DNA is not optimal for clon-
ing and leads to a low frequency of successful clones. For
observations, the gel can be placed on a glass plate with a black
background (black paper stuck on the other side of the glass
plate). The black background helps in observing the ethidium
bromide-stained DNA.
6. If either the vector or the insert is not resolved in an agarose
gel then the ligation mix should contain the vector or the insert
plus ligation buffer plus ligase.
7. The gel does not set at 37 °C.
8. Do not use electro-competent cells when using gel-containing
DNA as this will lead to poor transformation efficiencies.
Reference
1. Struhl K (2001) Subcloning of DNA fragments, Wiley, New York. doi:10.1002/0471142727.

Current protocols in molecular biology. mb0316s13
Chapter 11
Rapid Cloning of Genes and Promoters

for Functional Analyses
Peer M. Schenk
Abstract
Next-generation sequencing has resulted in a massive flow of new information predicting the existence of
many new genes, their putative promoters, as well as long and small noncoding RNA. However, this is cur-
rently largely unmatched by functional studies. A cost-effective and high-throughput cloning system for
PCR products and synthetic sequences was therefore developed to allow the rapid evaluation of coding and
noncoding sequences in functional expression and reporter assays. Unlike traditional cloning approaches
that involve subcloning or a special recipient vector and special flanking sequences, this protocol describes a
rapid and cost-effective method for the direct insertion into the vector of choice. Restriction enzymes are
only needed once to prepare the vector, which is blunt ended and dephosphorylated, and can then serve as
the recipient vector for many hundreds of sequences to be tested. Examples are provided of how this
method can be used to rapidly reveal functionality of regulatory genes, promoters, and microRNAs.
Key words Functional assays, Functional genomics, Gene mining, Library construction, Next-
generation sequencing, Rapid cloning, Transient expression
1 Introduction
Next-generation sequencing adds to rapidly growing databases of

predicted genes and their regulatory sequences, including noncod-
ing small and long RNA [1–3]. However, functional studies to
reveal the roles of these genes, promoters, and noncoding sequences
are typically time consuming, partly because of a lack of cost-
effective high-throughput cloning procedures coupled to suitable
functional assays. High-throughput cloning systems (e.g., the
Gateway system) require special primers for PCR and a matching
vector that includes matching flanking sequences to allow recom-
bination [4]. Apart from the high costs, the flanking sequences
may interfere with functional studies (e.g., when making constructs
for fusion proteins or detailed mutational analyses).
Here, a rapid cloning protocol is described for PCR products,
or synthetic sequences, that allows direct cloning into any vector of
123
124 Peer M. Schenk
destination. It is based on our previously published method for

rapid cloning of genes and promoters [5]. PCR products or syn-
thetic sequences are simply phosphorylated and then ligated into a
blunt-ended, dephosphorylated vector for functional assays. The
time required from source DNA to recombinant DNA in a vector
for functional assays is less than 48 h. It is best suitable for high-
throughput cloning procedures or the generation of libraries where
a large number of sequences need to be cloned into the same vec-
tor. The suitability of vectors used depends on the functional assay
used (see Notes 1–3).
2 Materials
Materials required include a plasmid for functional assays as the

recipient vector for sequences to be tested (see Note 4).
1. Blunt-end restriction enzymes.
3. DNA polymerase I Klenow fragment.
4. dNTPs, 10 mM.
5. Agarose.
6. Electrophoresis unit to resolve DNA.
7. Qiaquick gel extraction kit (Qiagen, USA).
8. Shrimp alkaline phosphatase (Roche, USA).
9. Expand High Fidelity PCR System or Expand Long Template
PCR System (Roche, USA).
10. Qiaquick PCR Purification Kit (Qiagen, USA).
11. Expand High Fidelity PCR System (Roche, USA).
12. Thermocycler.
13. Polynucleotide kinase, 10 U/μL (Roche, USA).
14. Kinase buffer, 10×, 50 mM Tris–Cl, pH 7.5, 10 mM MgCl2,
5 mM DTT.
15. Rapid DNA ligation kit (Roche, USA).
16. DNA dilution buffer (Roche, USA).
17. T4 DNA ligation buffer, 2× (Roche, USA).
18. T4 DNA ligase (Roche, USA).
19. Competent Escherichia coli cells (OneShot Top10, Invitrogen,
USA).
21. LB medium: To prepare 1,000 ml, take 10 g bacto-tryptone
plus 5 g bacto-yeast extract and 10 g NaCl. Add 600 ml of
Rapid Cloning for Functional Analyses 125
distilled water, and dissolve contents. Adjust the final volume

to 1,000 ml with distilled water.
22. LB agar medium: To prepare 1,000 ml, take 10 g bacto-
tryptone plus 5 g bacto-yeast extract and 10 g NaCl. Add
600 ml of distilled water, and dissolve contents. Add 15 g of
agar, and adjust the final volume to 1,000 ml with distilled
water. Autoclave the medium, and pour in 30 ml Petri plates to
set.
23. Petri dishes.
24. Shaker (200 rpm).
25. Incubator, 37 °C.
26. REDTaq DNA polymerase (Sigma-Aldrich, USA).
27. Toothpicks.
3 Methods
3.1 Vector 1. Cut the vector with a restriction enzyme at the required site of
Preparation integration (see Note 6).
(See Note 5) 2. If a restriction enzyme was used that leaves 5′ overhangs, fill in
subsequently with nucleotides using Klenow fragment (works
in any buffer used for restriction enzymes) by adding the fol-
lowing to the reaction tube and incubate for 15–20 min at
room temperature
1/100 volume 10 mM dNTPs
1 U/μg DNA polymerase Klenow fragment
3. Apply digested vector DNA into a wide slot of a DNA agarose

gel for electrophoresis (see Note 7).
4. Excise vector fragment of the expected size from the gel and
purify.
5. Dephosphorylate vector fragment by adding the following to a
reaction tube:
45 μL Vector fragment
5 μL 10× Shrimp alkaline phosphatase buffer
4U Shrimp alkaline phosphatase for each μg vector
DNA (use more if vector is larger than 5 kb)
And incubate for 1 h at 37 °C followed by heat inactivation

for 15 min at 65 °C.
6. Purify DNA (Qiaquick PCR Purification Kit or ethanol
precipitation). This step is optional but is recommended.
126 Peer M. Schenk
3.2 Generation 1. Add the following into a PCR reaction tube (use a master mix
of DNA Fragments for a large number of reactions):
by PCR (See Note 8)
42.7 μL H2O
5 μL 10× reaction buffer
1 μL 10 mM dNTPs
0.4 μL Primer A (100 μM)
0.4 μL Primer B (100 μM)
0.4 μL Expand High Fidelity PCR System or Expand Long
Template PCR System (for fragments >8 kb)
0.1 μL Template DNA
50 μL
2. Incubate in a thermocycler
2 min 94 °C
20 s 94 °C
30 s 55 °C (or higher depending on
primer design)
1 min 72 °C (add 1 min for each 1,000 bp;
use 68 °C for products >3 kb)
Repeat the above
three steps 35 times
7 min 72 °C and then hold at 4 °C
3. Apply PCR products (all 50 μL) into a wide slot of a DNA

agarose gel for electrophoresis.
4. Excise PCR fragment of the expected size from the gel, and
purify using Qiaquick Gel Extraction Kit.
3.3 Phosphorylate 5′ 1. Add the following into a reaction tube (use a master mix for a
Ends of PCR Products large number of reactions):
or Synthetic DNA
(See Note 9) 1–5 μg PCR product
2 μL Polynucleotide kinase (10 U/μL; Roche)
2 μL 10× Kinase buffer (50 mM Tris–Cl pH 7.5;
10 mM MgCl2; 5 mM DTT)
0.2 μL 10 mM ATP (thaw on ice, and store aliquots
at −20 °C)
H2O up to 20 μL
20 μL
2. Incubate for 1 h at 37 °C.

3. Purify DNA using the Qiagen PCR purification kit or ethanol
precipitation. This step is optional but is recommended.
3.4 Ligation 1. Add the following into a reaction tube:

and Transformation
(See Note 10) 8 μL Vector and insert mixture
2 μL 5× DNA dilution buffer
Mix, then add
10 μL 2× T4 DNA ligation buffer mix, then add
1 μL T4 DNA ligase
2. Incubate for 5 min at room temperature, and subsequently

place on ice.
3. Thaw competent E. coli cells on ice.
4. Add carefully 7 μL of the ligation mix to the cells (do not
pipette up and down), and leave for 30 min on ice.
5. Heat-shock cells for 45 s in a 42 °C water bath, and transfer
immediately for 2–3 min on ice.
6. Add 250 μL of pre-warmed (37 °C) LB medium, and incubate
for 45–60 min on a shaker (200 rpm) at 37 °C.
7. Plate out cells on Petri dishes containing LB agar with a
selectable marker, and incubate upside down at 37 °C
overnight.
3.5 Screening 1. Add the following to a PCR tube (use a master mix):
for Positive Clones
(See Note 11) 2 μL 10× REDTaq reaction buffer (Sigma)
0.4 μL 10 mM dNTPs
0.15 μL Primer 1 (e.g., primer within cloned PCR product)
0.15 μL Primer 2 (e.g., primer within flanking vector region)
1 μL REDTaq DNA polymerase (Sigma)
16.3 μL H2O
20 μL
2. Pick a colony with a toothpick, dip first onto a master plate with
a number grid containing LB and the selectable marker, and
then dip shortly into the PCR reaction mix. Incubate master
plate at 37 °C.
128 Peer M. Schenk
3. Incubate PCR tubes in a thermocycler:
2 min 94 °C
20 s 94 °C
30 s 55 °C (or higher depending on
primer design)
1 min 72 °C (add 1 min for each 1,000 bp)
Repeat the above three
steps 35 times
7 min 72 °C and then hold at 4 °C
4. Apply PCR products onto a DNA agarose gel for electrophore-

sis, and check for the bands with the expected size (see Note 12).
5. Inoculate liquid LB cultures containing the selectable marker
with positive clones from master plate (colonies may not be
visible yet), and incubate on shaker at 37 °C overnight.
6. Prepare plasmid DNA from liquid bacterial cultures, and confirm
the presence and correct orientation of cloned PCR products by
test-cutting with restriction enzymes and/or sequencing.
4 Notes
1. Functional assay for testing promoters: This assay requires the

replacement of the promoter in a promoter–reporter gene
construct with the sequences to be tested for promoter activity.
For example, the cauliflower mosaic virus 35S promoter that is
fused to the GFP reporter gene can be replaced with sequences
to be evaluated [7, 9]. Following the cloning of putative pro-
moter sequences the functional assay may consist of a transient
transformation assay using agroinfiltration in Nicotiana ben-
thamiana [10], DNA bombardment [11], or protoplasts [12].
For quantification of the reporter gene activity, fluorometric or
biochemical assays can be used [13, 14] or qRT-PCR with an
internal standard.
2. Functional assays for testing transcription factors and promot-
ers: This assay is suitable to test regulatory genes, such as those
encoding transcription factors. Activation of a promoter–
reporter construct can be tested by adding candidate genes
encoding a transcription factors that may activate the promoter
(Fig. 1). For example, reporter plants containing the Arabidopsis
PDF1.2 promoter fused to the GUS reporter gene [15] can be
bombarded with a construct designed to constitutively express
putative transcription factor sequences (e.g., ERF1; Fig. 1).
Activation of the reporter gene can be qualitatively determined
Testing transcription factors

Testing microRNAs and targets
and promoters
Candidate gene Precursor of

35S encoding a TF 35S candidate
e.g. ERF1 microRNA
Candidate Reporter Candidate

Reporter gene
promoter 35S gene microRNA
e.g. GUS
e.g PDF1.2 e.g. GFP target
1-3 days
Agroinfiltrated N. benthamina
plants
Bombarded
transgenic
indicator plants
Fig. 1 Examples of functional assays to test candidate sequences for promoters, transcription factor-encoding
genes, microRNAs, and microRNA targets. Left: Assay to test interaction of a transcription factor with a
promoter. Agroinfiltration can be used for this or (as shown in the picture) particle bombardment of transgenic
reporter plants expressing a reporter gene under the control of a specific promoter (that is not wound induc-
ible). Blue spots indicate promoter activation. Right: Assay to test interaction of microRNA and target sequence
using co-agroinfiltration. The lack of GFP expression indicates microRNA/target interactions
(e.g., XGluc staining to visualize GUS expression) or by

fluorescence microscopy (e.g., GFP expression). Alternatively
biochemical assays (e.g., MUG assay for GUS quantification)
or qRT-PCR can be used to quantify reporter gene transcript
levels. The latter requires the use of an internal standard for
normalization, such as another gene co-expressed in the
reporter construct (e.g., BAR gene), as different amounts of
reporter plasmid would lead to different expression levels.
130 Peer M. Schenk
Alternatively, agroinfiltration in N. benthamiana [10] or

protoplast transformation can be used [12]. Instead of testing
candidate transcription factor-encoding genes, a certain tran-
scription factor can also be used to test a number of candidate
promoters.
3. Functional assays for testing microRNA and other transacting
regulatory sequences and their targets: Small noncoding RNA
sequences, such as microRNAs, may inhibit or augment expres-
sion of a gene by binding to its transcript [16]. This assay is
similar to the transcription factor/promoter assay described
above. Activation of a microRNA target–reporter construct
can be tested by adding candidate microRNA precursors giv-
ing rise to mature microRNA that may bind to the target gene
(Fig. 1). Again, agroinfiltration in N. benthamiana [10], DNA
bombardment [11], or protoplasts [12] can be used for this
assay. Instead of testing candidate microRNA precursors, cer-
tain microRNA can also be used to test a number of candidate
target sequences [17].
4. The plasmid for use could be a promoter–reporter construct
using a plant gene expression cassette, such as pBI221
(35S:GUS; [6, 7]). Genes and promoters are typically cloned
by PCR, requiring template DNA from the source organism.
Alternatively, synthetic DNA can be used for smaller gene/
promoter sequences or for constructs testing small RNAs,
independent of the availability of source DNA. Some sequences
can also be synthesized by using overlapping primers followed
by primer extension [8]. It should be noted that the reagents
and enzymes described here are suggestions only. Other
reagents and enzymes can be used if they follow the different
steps shown below.
5. This step prepares the recipient vector by cutting with a restric-
tion enzyme leaving blunt ends. To prevent the vector from
autoligation the 5′ phosphates are removed. This is important
to maximize cloning efficiency. Ideally a large amount of this
vector is prepared once which can then be used to produce
clones of many different sequences to be tested.
6. If a library is prepared or the vector will be used more than once,
use a large amount of vector (>10 μg). Use 5–10 U enzyme for
each μg DNA (more if phage DNA is used) and incubate for
90–120 min at the required temperature (usually 37 °C).
Restriction enzymes leaving blunt ends are preferred; otherwise
Klenow fragment can be used to fill in overhanging 5′ends.
7. Allow enough time for good separation from other bands, e.g.,
undigested or partially digested bands.
8. The DNA fragments of interest can be amplified from another
vector, a library, genomic DNA, or cDNA. To ensure specific-
ity, only very small amounts (0.01–1 ng) of template DNA
should be used. Primers should be designed with annealing

temperatures of at least 60 °C, preferably with one or two G/C
at the 3′ end, and should be checked for possible loop and
primer dimer formations. The use of a proofreading enzyme
for the amplification is recommended to generate products
with blunt ends and to reduce errors during PCR. Special
enzymes need to be used for the amplification of very large
fragments (5–30 kb).
9. PCR products and most synthetic DNA lack a phosphate at
their 5′ ends. This needs to be added in the following step.
Alternatively, if phosphorylated primers were used for the
PCR, this step is not required.
10. Vector and DNA fragments to be tested are ligated in this step
and subsequently transformed to chemically competent E. coli
cells. The following is a rapid ligation protocol, but other pro-
tocols using ligation at 16 °C for several hours or overnight
can also be used. Use only a small amount of vector (e.g., 200–
500 ng) and much more insert (up to ten times more insert
than vector can be used).
11. Bacterial colonies are screened in this step to see whether they
contain the new construct. Therefore a small portion of the
bacteria from each colony are transferred into a PCR reaction
mix. Primers are used for this step that will allow the detection
and correct orientation of the cloned PCR product in the vec-
tor by its size. Typically a primer that was used to amplify the
PCR product in combination with a primer that binds to the
flanking vector sequence is best. If the vector dephosphoryla-
tion step was carried out properly, screening of 5–10 colonies
is usually sufficient.
12. Caution: Weak bands of the right size may be caused by con-
taminating plasmid DNA from the ligation mix remnant on
the LB plates.
Acknowledgement
This work was supported by the Australian Research Council

(DP1094749 and DP110104354). I am grateful to Drs. Shazia
Iram, Matthew Timmins, and Amar Pandey for useful discussions.
References
1. Shendure J, Ji H (2008) Next-generation 3. Wu C, MacLeod I, Su AI (2013) BioGPS and

DNA sequencing. Nat Biotechnol 26: MyGene. info: organizing online, gene-cen-
1135–1145 tric information. Nucleic Acid Res 41:
2. Miller JR, Koren S, Sutton G (2010) Assembly D561–D565
algorithms for next-generation sequencing 4. Curtis MD, Grossniklaus U (2003) A gateway
data. Genomics 95:315–327 cloning vector set for high-throughput
132 Peer M. Schenk
functional analysis of genes in planta. Plant 11. Sanford JC (2006) Biolistic plant transformation.
Physiol 133:462–469 Physiol Plant 79:206–209
5. Schenk PM, Vickers CE, Manners JM (2003) 12. Pietrzak M, Shillito RD, Hohn T et al (1986)
Rapid cloning of novel genes and promoters Expression in plants of two bacterial antibiotic
for functional analyses in transgenic cells. resistance genes after protoplast transformation
Transgenics 4:151–156 with a new plant expression vector. Nucleic
6. Mitsuhara I, Ugaki M, Hirochika H et al Acid Res 14:5857–5868
(1996) Efficient promoter cassettes for 13. Remans T, Schenk PM, Manners JM et al
enhanced expression of foreign genes in dicot- (1999) A protocol for the fluorometric quanti-
yledonous and monocotyledonous plants. fication of mGFP5-ER and sGFP (S65T) in
Plant Cell Physiol 37:49–59 transgenic plants. Plant Mol Biol Rep 17:
7. Schenk PM, Elliott AR, Manners JM (1998) 385–395
Assessment of transient gene expression in 14. Jefferson RA (1987) Assaying chimeric genes
plant tissues using the green fluorescent pro- in plants: the GUS gene fusion system. Plant
tein as a reference. Plant Mol Biol Rep 6: Mol Biol Rep 5:387–405
313–322 15. Manners JM, Penninckx IA, Vermaere K et al
8. Ho SN, Hunt HD, Horton RM et al (1989) (1998) The promoter of the plant defensin
Site-directed mutagenesis by overlap extension gene PDF1.2 from Arabidopsis is systemically
using the polymerase chain reaction. Gene 77: activated by fungal pathogens and responds to
51–59 methyl jasmonate but not to salicylic acid.
9. Odell JT, Nagy F, Chua N-H (1985) Plant Mol Biol 38:1071–1080
Identification of DNA sequences required for 16. Jones-Rhoades MW, Bartel DP, Bartel B
activity of the cauliflower mosaic virus 35S pro- (2006) MicroRNAs and their regulatory roles
moter. Nature 313:810–812 in plants. Annu Rev Plant Biol 57:19–53
10. Yang Y, Li R, Qi M (2001) In vivo analysis of 17. Schenk P, Iram S, Carroll B et al (2012) WIPO
plant promoters and transcription factors by Patent No. WO/2012/048385. World
agroinfiltration of tobacco leaves. Plant J 22: Intellectual Property Organization, Geneva,
543–551 Switzerland
Chapter 12
Genome Walking
Frances M. Shapter and Daniel L.E. Waters
Abstract
Genome walking is a method for determining the DNA sequence of unknown genomic regions flanking a
region of known DNA sequence. The Genome walking has the potential to capture 6–7 kb of sequence in
a single round. Ideal for identifying gene promoter regions where only the coding region. Genome walk-
ing also has significant utility for capturing homologous genes in new species when there are areas in the
target gene with strong sequence conservation to the characterized species. The increasing use of next-
generation sequencing technologies will see the principles of genome walking adapted to in silico methods.
However, for smaller projects, PCR-based genome walking will remain an efficient method of character-
izing unknown flanking sequence.
Key words Genome walking, Gene characterization, Polyploidy, Wild crop relatives, Homologues,
Sequence conservation
1 Introduction
The term genome walking (GW) describes genome sequencing

originating from an area of known sequence into unknown flank-
ing regions. While the scope of the method continues to evolve,
this is traditionally a PCR-based protocol. The power of genome
walking is that it enables PCR amplification, and hence sequenc-
ing, of regions of DNA where only the sense or the antisense
primer sequence is known. The method can be utilized wherever
there is a region of known sequence which can support the devel-
opment of a sequence-specific primer (SSP). GW has been success-
fully utilized in a wide range of plants, animals, fungi, bacteria, and
viral strains for both genomic and organellar/plastid genome anal-
ysis [1]. By the use of universal or consensus primers designed
from the sequence of closely related organisms in place of SSP,
applications can be broadened to target organisms/genes previously
uncharacterized in the target species [2–4].
133
134 Frances M. Shapter and Daniel L.E. Waters
The GW protocol is based on using a restriction enzyme (RE)

digest of genomic DNA, followed by ligation of a known oligomer
or linker to the end/s of the digested DNA fragments and creation
of a GW library which can be used as an ongoing resource. PCR
amplification using an aliquot of the GW library as template is then
undertaken using a primer designed to the known sequence and a
primer that hybridizes to the ligated oligomer [4–6]. The specificity
of the method has been improved by using an optimized generic
primer system in conjunction with a second round of nested PCR
amplification [7]. GW kits (www.bdbiosciences.com; www.clontech.
com; www.sigmaaldrich.com; http://www.biost.com/en/Apagene
Kits-Gold.aspx, last accessed 28/09/12) provide simple, cost-
effective, and optimized protocols. These come with a selection of
RE which can be supplemented to develop a broader library base for
amplification.
A precursor to the GW method was the isolation and charac-
terization of DNA contiguous to known genes, specifically target-
ing non-transcribed control elements, using recombinant plasmid
banks and hybridization [8]. Although not yet referred to as GW,
the basic methodology was reported by the late 1980s [9–11].
By 1993 it had evolved to a unidirectional protocol, single specific
primer-polymerase chain reaction [5, 6] or panhandle PCR [1]. By
1995, bidirectional GW walking was standard and the nested PCR
system was advocated and incorporated into kits to improve speci-
ficity [7]. Further modifications which expand its application are
still being developed [12–15].
Increasing use of next-generation sequencing (NGS) technol-
ogies and associated bioinformatics has enabled application of the
key GW principles in silico. De novo-assembled NGS data derived
from an individual organism can be used in conjunction with either
reference-guided assembly software or standard alignment pro-
grams such as Clustal W. A known region of gene sequence (from the
species under investigation or homologous sequence from closely
related organism) is used to pinpoint the surrounding unknown
sequence within the de novo assembly [16]. Due to the power of
NGS and de novo assembly software, these de novo assemblies,
even with minimal genome coverage, can be very informative. As
with traditional GW, the power of this approach is that only a small
seed of DNA sequence is required to identify whole genes or
regions in a previously uncharacterized genome.
2 Materials
The following materials and methods are applicable to standard kit

form nested PCR-based GW. While there are many methods which
start from first principles [5, 7] and modified methods (see refer-
ences listed throughout Subheading 1), the method described here
Genome Walking 135
is a standard protocol. As with any RE- and/or PCR-based method,

the quality and purity of all reagents, especially DNA, are critical
for maximizing specificity. The most expensive component of these
techniques is the researcher’s time. While having the skills to
prepare all the required reagents is preferable, the time to set up
and troubleshoot (e.g., contamination, concentration errors) the
protocol is significant and expensive compared to the relatively low
cost of using a pre-manufactured kit with an optimized protocol
and standardized components.
Some reagents pose a serious health risk, so ensure that all
associated Material Safety Data Sheets (MSDS) are understood
and the recommended safety precautions are taken. Ensure that all
reagents are disposed of in accordance with the manufacturer’s
recommendations and local environmental protection laws.
2.1 Kit Options 1. Select an appropriate kit that accounts for the target distance
to be walked and the specificity of known sequence primer.
2. Examples include:
(a) www.bdbiosciences.com
(b) www.clontech.com
(c) www.sigmaaldrich.com
(d) http://www.biost.com/en/ApageneKits-Gold.aspx
2.2 DNA Extraction 1. An optimized DNA extraction kit appropriate for the tissue
type and species (see Note 1).
2. Deionized purified water, e.g., Milli-Q or equivalent.
3. Water bath and thermometer.
4. Liquid nitrogen, mortar and pestle.
2.3 GW Library 1. GW kits come with a set of restriction enzymes and their
Preparation appropriate buffers. Additional libraries can be constructed
by purchasing alternative REs and their required buffers
(see Notes 2 and 3).
3. For checking the quality of the DNA and its digestion:
(a) Agarose (see Note 4).
(b) Tris–borate–EDTA (TBE) buffer, 0.5×.
(c) DNA stain, ethidium bromide or equivalent.
(d) Gel loading buffer (see Note 5).
(e) Appropriate DNA size markers.
4. Buffered phenol (see Note 6).
5. Chloroform (see Note 7).
6. 10 μg/μl Glycogen.
7. 3 M Sodium acetate, pH 4.5.
8. 95 % lab-grade ethanol.
9. Ethanol 80 % v/v with distilled water.
10. TE buffer 0.1E: 10 mM Tris–HCl, pH 7.5, 0.1 mM EDTA.
11. TE buffer (10 mM Tris–HCl, pH 7.5, 1.0 mM EDTA).
12. Incubator and/or PCR thermal cycler.
2.4 Primer Design 1. PCR primer design software (see Notes 8 and 9).
2.5 PCR 1. Optimal polymerase based on kit requirements, one is usually

recommended.
2. PCR buffer, 10× (polymerase specific).
3. dNTP mix, 10 mM of each dATP, dGTP, dCTP, and dTTP.
5. SSPs.
6. Thermal cycler.
7. For amplicon screening post PCR:
(a) Agarose (see Note 10).
(b) 0.5× TBE buffer.
(c) Ethidium bromide or equivalent DNA stain.
(d) Loading buffer (see Note 5).
(e) Ladder of appropriate DNA size markers (see Note 11).
8. Optional (see Note 12):
(a) Glycerol, 50 % v/v in distilled water (see Note 13).
(b) Dimethyl sulfoxide (DMSO).
(c) Bovine serum albumin (BSA).
(d) Additional PCR enhancers available commercially.
2.6 Amplicon 1. In the authors’ experience, even with the increased specificity
Selection and of nested PCR, the secondary PCR rarely provides a perfectly
Sequencing clean single band at gel visualization prior to sequencing.
Therefore a commercial gel extraction kit (see Note 14)
allows size selection of target bands (size- and band
strength-based selection) from amongst multiple bands and
smearing.
2. Sequencing reagents (ABI, USA).
3. If direct sequencing of PCR amplicons fails, follow recommen-
dations (see Note 15) provided with both GW and cloning kits.
Genome Walking 137
3 Methods
This is a generic method based on the authors’ experience after

following the BD Genome Walker™ Universal Kit User Manual—
Catalogue Number: 638904 (see Note 16).
3.1 Sample Tracking 1. Devise an appropriate labelling system from extraction of the
DNA through to sequencing and alignment. GW is easily
confounded by labelling errors, and because of the lack of speci-
ficity in the first round (and often second round) of PCR, sam-
pling errors are impossible to detect until the sequence is
recovered. If working with multiple samples from closely related
species or target genes, the sequence differences can be limited to
single-nucleotide polymorphisms (SNPs). As the GW libraries
can be used repeatedly over long time periods, labels clearly linked
with the production record of each library, and its associated DNA
extraction, is a good option: for example, each tube labelled
Lb#p#_#=Labbook number and page number_sample number.
3.2 Primer Design 1. Design parameters should adhere to those recommended by

in Conserved/Known the manufacturer’s guidelines. For optimal specificity, nested
Sequence SSP should be designed so that the first and second PCR
products can be clearly visualized and differentiated on an
agarose gel (see Notes 17 and 18).
2. Some recommended primer design software is listed in Note 8.
3. When designing nested SSPs, ensure that the REs used in the
kits do not have restriction sites within or between the SSPs.
3.3 Selection of 1. Prior to beginning laboratory work, it is advisable to map the REs
Additional Restriction and SSPs against all known DNA sequence for the target region
Enzymes for GW (Note 19). This includes the known sequence and any sequence
Library Construction which occurs downstream of the unknown region or homolo-
gous sequence from a closely related species [1]. This facilitates
prediction of approximate fragment size post PCR and also high-
lights RE with restriction sites that are too close to the SSP site to
generate PCR products of a useful size. Where the latter occurs,
it is inefficient to create an RE GW library for that target region
and SSP set. However, if multiple regions are unknown, the GW
library may have utility with other SSPs. Replacement of an RE of
poor utility with a RE which utilizes a different cut site (Note 2)
is an option (Note 20).
3.4 RE Digestion 1. Check the quality of purified DNA by visualizing ~100 ng on

(Single Genomic a 0.5 % agarose gel with reference to an appropriate size marker.
Template) Genomic DNA should be larger than 50 kb with minimal
smearing (indicating shearing) (see Note 21).
2. Select tube size appropriate to the kit, and label clearly.
3. Combine the genomic DNA, RE, RE buffer, and deionized

water strictly following the manufacturer’s recommended
volumes and including the positive control provided with the kit.
4. Mix gently by inverting the tube (to avoid any shearing of
DNA) (see Note 22).
5. Incubate at specified temperature for the recommended time
6. Check digestion efficiency by loading approximately 100 ng of
digested DNA on a 0.7 % agarose gel and an equivalent amount
of undigested genomic DNA in adjacent wells. Run for 80 min
at a voltage appropriate for the gel electrophoresis apparatus
(see Note 25).
7. Switch off the power pack, remove the gel from the gel electro-
phoresis apparatus, and stain and destain the gel (if required).
8. Visualize and record image (see Note 22).
3.5 Purification Steps 1–8 must be carried out in a fume hood (see Note 26).
of Digested DNA 1. Add an equal volume of phenol to the digested DNA. Seal tube
(See Note 24) carefully (see Note 6).
2. Vortex slowly for 5–10 s.
3. Centrifuge in a bench top microfuge at ~18,000 × g for
3–5 min to separate aqueous and organic phases.
4. Transfer the aqueous (upper) phase into a fresh tube, and discard
the organic layer as hazardous waste.
5. Add an equal volume of chloroform (see Note 7).
6. Slow vortex for 5–10 s.
7. Centrifuge in a bench top microfuge at ~18,000 × g for
3–5 min to separate aqueous and organic phases.
8. Transfer the aqueous (upper) phase into a fresh tube, and
discard the organic layer as hazardous waste.
9. Add a double volume of ice-cold 95 % ethanol plus a 1/10
volume of 3 M NaAc (pH 4.5) (see Note 27) and 20 μg of
glycogen (see Note 28).
10. Vortex slowly for 5–10 s.
11. Centrifuge in a bench top microfuge at ~18,000 × g for 10 min.
12. Decant supernatant, and wash pellet in 100 μL of ice-cold
80 % ethanol.
13. Centrifuge in a bench top microfuge at ~18,000 × g for 5 min.
14. Supernatant, and air-dry the pellet (see Note 29).
15. Dissolve pellet in 20 μL of TE buffer (10/0.1, pH 7.5), and
vortex slowly for 5–10 s.
16. Quantify the concentration of DNA.
Genome Walking 139
3.6 Adapter Ligation 1. In individual labelled tubes, mix recommended volumes of

(Note That Volumes each digested and purified genomic DNA, kit supplied adapter,
Should Be as per 10× ligation buffer, and DNA ligase.
Manufacturer’s 2. Incubate at specified temperature/time. Do not use an approx-
Instructions) imate temperature.
3. Stop reactions in accordance with manufacturer’s instructions
(e.g., incubate at 70 °C for 5 min).
4. Dilute as recommended using TE buffer (10/1, pH 7.5), and
vortex slowly for 5–10 s.
5. Store at −4 °C.
3.7 PCR to Sequence 1. All kits recommend an optimized PCR mixture and thermal
Identification cycler program which should be followed for the first attempt
at GW (see Note 30).
2. The choice of polymerase and length of the target amplicon
may affect the PCR conditions and should be accounted for
when following the GW kit guidelines.
3. For each target sequence (all four libraries and a positive and
negative control supplied with the kit) undertake the primary
round of PCR (as per manufacturer’s recommended reaction
mixture and PCR conditions) using the outer SSP and generic
primers (see Note 31).
4. The resultant primary PCR amplicons should be visualized on
an agarose gel (see Note 10) against a size marker to confirm
that the positive control shows the expected banding pattern
and the negative control excludes contamination (Fig. 1)
(see Note 32).
5. Dilute 1 μl of primary PCR product with 49 μL of deionized
water. Vortex and use as DNA template for secondary PCR.
6. Perform the secondary PCR, as per manufacturer’s instruc-
tions for reaction mixture and PCR conditions, using the inner
nested SSP and generic primers. Use the diluted primary PCR
product as template (except for negative control), and include
positive and negative controls.
7. Post-secondary PCR amplicons should be visualized on an aga-
rose gel (see Note 10) against a size marker to ensure that the
positive control shows the expected banding pattern and the
negative control excludes contamination (see Notes 33 and 34).
8. If no clear bands are visible, repeat the PCR for an additional
four cycles and repeat visualization.
9. Record image, and determine primary target bands for
sequencing (see Note 33).
10. Excise target bands from the gel, and purify as per manufac-
turer’s instructions (Fig. 2) (see Note 14).
Fig. 1 Agarose visualization of primary and secondary rounds of GW for three

target fragments. Marker: L—GeneRulerTM 1 Kb DNA Ladder, GW library
templates: D—DraI, E—EcoRV, P—PvuII, S—StuI. C—Positive control supplied
with kit. Numbers indicate the bands targeted for gel extraction. Bands 1, 2, 4, 6,
7, 10, 11, and 12 would be targeted for initial sequencing and the remainder gel
extracted and stored in case none of the selected bands acceptable DNA
sequence data
11. Label and store secondary gel-extracted target bands (Fig. 2).
These can be screened for utility if sequencing of the initial
target bands fails or the targeted band’s sequence is an
artifact.
12. Direct Sanger sequence the purified PCR products in a one-
eighth Big Dye Terminator reaction [3] using the inner nested
SSP primer as a sequencing primer. This may provide sufficient
sequence to confirm that the amplicon is the desired target
sequence or the full sequence has been captured.
13. In polyploid species or where direct sequencing is unsuccess-
ful, the amplicon can be cloned prior to sequencing (see Notes
35–37).
14. GW-derived sequence should be aligned with known sequence
flanking the target region, ideally with an overlap of at least
Genome Walking 141
Fig. 2 Agarose gel image of GW amplicons numbered in Fig. 1 post gel extraction and
purification for quantification prior to sequencing. Direct sequencing of a subset of
these fragments resulted in the following: Extraction 1—multiple template sequenc-
ing signal for 913 bp with no usuable sequence. Extractions 2, 4, and 7—good
quality target sequence up to 983 bp. Extraction 6—short read of target sequence.
Extraction 10—622 bp of target sequence. Extraction 11—sequencing failed
100 bp, to confirm authenticity of the acquired sequence

(see Notes 38–46).
15. In the event of GW capturing only part of the target sequence,
new SSP primers (outer and inner) can be designed at the ter-
minal end of the acquired GW sequence and the GW walking
PCR protocol applied to the remaining three GW libraries to
extend the read. This strategy can be applied repeatedly. For
each additional round of GW, simply exclude the GW walking
library (i.e., DRA1, PVU11) from which the sequence was
derived, as the location of the RE sites is what has theoretically
limited the size of the amplicon.
4 Notes
1. The Qiagen (http://www.qiagen.com) range of DNA extrac-

tion kits is recommended. DNA extraction—see Chapters 1 and
2 for an alternative detailed materials and method.
2. Different GW kits may have specific requirements for the
ligation step such as blunt-end REs.
3. All REs have specific buffer requirements, and therefore the
buffers may not be interchangeable with buffers in the kits.
4. The agarose concentration in gels should be in line with the

expected fragment size. For genomic DNA and post-digestion
visualization, use 0.7 %.
5. Simple gel loading buffer: 595 μL 1× TBE + 800 μL 50 %
glycerol + 5 μL bromophenol blue.
6. Use phenol in a fume hood, and dispose of waste correctly.
Pink color indicates that phenol has expired (oxidized). When
pipetting phenol, look through the side of the bottle to ensure
that the tip of the pipette is well below the aqueous phase
(on top) to avoid drawing the aqueous phase into the tip. Make
sure that tube tops are secure before mixing to avoid leakage.
7. Use chloroform in a fume hood, and dispose of waste correctly.
Keep working solutions protected from UV light, e.g. wrap foil
around aliquot containers.
8. Examples of primer design software:
(a) Exemplar of Online Freeware—Primer 3 [17] (http://
primer3. sourceforge.net/releases.php last accessed
18/9/12).
(b) Exemplar of Primer Software—Primer Premier (http://
www.premierbiosoft.com/primerdesign/index.html, last
accessed 18/9/12), free trial version available. Advantages:
Multifunctional, auto or manual design, sequence edit
capabilities, and comparatively inexpensive.
(c) Exemplar of Package software—Clone Manager
Professional (http://www.scied.com/pr_cmpro.htm, last
accessed 18/9/12). Free demonstration version available.
Advantages: Becomes an information database as well as
design tool, has restriction enzyme mapping for fragment
predictions for additional RE selection, multi-sequence
template primer design capabilities, and graphic capabili-
ties for figure construction and ideal for new species where
sequence conservation is inferred from related species.
9. Refer to chapter on PCR for more information regarding
primer design parameters.
10. Concentration of the agarose gel should be in line with the
expected fragment size being visualized. For post PCR visual-
ization 1.5 % is usually adequate.
11. A 1 kb ladder is common. However, a ladder which has the
majority of size fragments within the expected size range is
preferred, noting that large fragments may occur in some GW
walking libraries.
12. PCR additives, such as DMSO and glycerol, may improve the
specificity of GW for some target regions.
13. Take care with volume accuracy when pipetting glycerol as it
adheres to the outside and inside of pipette tips.
Genome Walking 143
14. The Qiagen (http://www.qiagen.com) gel extraction kit is

recommended.
15. For gel electrophoresis and gel extraction of amplicons prior to
cloning, Tris–acetate–EDTA (TAE) buffer instead of TBE is
recommended. In addition, exposure to UV light should be
minimized if amplicons are to be cloned. Reconditioning PCR
[18] can also be performed prior to cloning to reduce the
likelihood of heteroduplex formation confounding sequence
characterization through creation of artificial haplotypes.
16. Troubleshooting guides are included with every kit and should
be read prior to commencing and again in the event of the GW
failing to capture the target sequence.
17. If the predicted size difference between the first- and second-
round PCR products is large enough to be quantified by
agarose gel ladder comparison (i.e., the number of base pairs
between two generic primers added to the difference between
the two SSP primers), this will provide a strong indicator as to
which bands are target sequence as opposed to artifacts.
18. While following the manufacturer’s guideline with regard to
having non-overlapping nested primers wherever possible, the
authors have had satisfactory results when using overlapping
nested SSPs.
19. Any software which enables the creation of a restriction map
against known sequence is suitable for selecting additional or
alternative REs.
20. Where target sequence is not acquired using the standard kit
GW libraries, additional REs may improve the outcome.
21. Pipette genomic DNA very gently with a wide-bore pipette tip
without mixing as this can mechanically shear otherwise high-
quality DNA.
22. Optimal GW follows complete RE digestion with minimal
shearing of DNA. However, the authors have achieved positive
results when some shearing of the genomic DNA was apparent
post DNA extraction.
23. Depending on the enzyme, RE digests can be temperature and
time sensitive—do not approximate either to achieve complete
digestion.
24. Long-range GW by using a partial digestion and size selection
for longer GW library fragments has been reported [12].
25. A good starting voltage for gel electrophoresis is 5 V for every
centimeter between the positive and negative electrodes.
26. All reagents should be prepared at the correct temperature,
and appropriate waste disposal containers should be accessible
before commencing any protocol.
27. Accurate pH is important. Check pH of stock supplies of

reagents before each use as pH may change over time.
28. Glycogen stocks should be stored in −20 °C freezer.
29. Air-drying can take 1–2 h, a Speedivac 40 °C for 5 min.
30. The authors have successfully undertaken GW reactions using
half the volumes recommended in the BD Universal Walking
Kit, with all components adjusted to ensure that the recom-
mended concentrations are unchanged.
31. Mineral oil to seal PCRs is not required if good-quality airtight
PCR tubes are used.
32. Even where the initial PCR appears to have failed to produce
any clean bands, the authors recommend continuing to the
second round of amplification if the positive control has
worked. In some cases the initial PCR does not generate
enough of the target template to be visualized on the agarose
gel. However, the increased specificity of the second round
may capture the target amplicon.
33. When visualizing amplicons which are to be subsequently
cloned, minimize their time of exposure to UV light.
34. Reconditioning PCR [18] can be performed prior to cloning
to reduce the likelihood of heteroduplex formation confound-
ing sequence characterization through the creation of artificial
haplotypes.
35. The authors have obtained the best cloning results with gel
slice cloning. Briefly, amplicons are visualized on a 1 % low-melt
agarose gel and the individual PCR product bands of interest
excised immediately prior to ligation into the vector. The gel
slice is melted in a thermocycler at 72 °C for 1 min and then
held at 37 °C. Three microliters of molten gel are included in
the standard ligation reaction mix of the pGEM-T Easy Vector
II System (Promega Corporation, Madison, USA) following
the manufacturer’s instructions [3].
36. For improved reliability of sequencing cloned DNA, target
clones are first amplified using the Templiphi System (GE
Healthcare) as per the manufacturer’s instructions. Sanger
sequencing is undertaken using standard Big Dye Terminator
V3.1 one-eighth sequencing reactions using 5 ml of diluted
Templiphi mix as template [3].
37. For detailed cloning methods [19], and/or purchase a cloning
kit such as pGEM®-T Easy (http://www.promega.com/prod-
ucts/pcr/pcr-cloning/pgem_t-easy-vector-systems/) and fol-
low manufacturer’s instructions.
38. SNPs may occur between individuals of the same species or
even within individuals and may not indicate an error.
Genome Walking 145
This applies particularly to polyploid species where one or

more copies of any given gene may be present.
39. Transposable elements can confound the alignment to reference
sequence when they occur close to the known region. They can
be the cause of GW sequence aligning for a short distance and
then homology abruptly ceasing [3]. Many transposable elements
have been sequenced and are shared between closely related
species. A simple BLAST search (http://blast.ncbi.nlm.nih.
gov/Blast.cgi?PROGRAM=blastn&BLAST_
SPEC=WGS&BLAST_PROGRAMS=megaBlast&PAGE_
TYPE=BlastSearch ) of GW-derived sequence is useful for
identifying this and other anomalies.
40. All sequence determined through GW should be subsequently
validated. By designing PCR primers which capture both the
original known sequence and the GW-derived flanking region
in a single amplicon, the GW fragment will be validated
by direct sequencing of the derived PCR product when the
sequence conforms to GW fragment sequence.
References
1. Jones DH, Winistorfer SC (1993) Genome the leu2 gene on yeast chromosome III. Gene
walking with 2- to 4-kb steps using panhandle 5:111–126
PCR. Genome Res 2:197–203 9. Ochman H, Gerber AS, Hartl DL (1988)
2. McIntosh SR, Pacey-Millar T, Henry RJ (2005) Genetic approaches of an inverse polymerase
A universal protocol for identification of cereals. chain reaction. Genetics 120:621–623
J Cereal Sci 41:37–46 10. Triglia T, Peterson MG, Kemp DJ (1988)
3. Shapter FM, Eggler P, Lee LS et al (2009) A procedure for in vitro amplification of DNA
Variation in Granule Bound Starch Synthase I segments that lie outside the boundaries of
(GBSSI) loci amongst Australian wild cereal known sequences. Nucleic Acids Res 16: 81–86
relatives (Poaceae). J Cereal Sci 49:4–11 11. Silver J, Keerikatte V (1989) Novel use of
4. Grivet D, Heinze B, Vendramin GG et al polymerase chain reaction to amplify cellular
(2001) Genome walking with consensus DNA adjacent to an integrated provirus. J Virol
primers: application to the large single copy 63:1924–1928
region of chloroplast DNA. Mol Ecol Notes 12. Rishi AS, Nelson ND, Goyal A (2004) Genome
1:345–349 walking of large fragments: an improved
5. Shymala V, Ames GF-L (1993) Single specific method. J Biotechnol 111:9–15
primer—polymerase chain reaction (SSP-PCR) 13. Taheri A, Robinson SJ, Parkin I, Gruber MY
and genome walking. In: White BA (ed) PCR et al (2012) Revised selection criteria for candi-
protocols current methods and applications, date restriction enzymes in genome walking.
vol 15, Methods in molecular biology. Humana PLoS One 7:e35117
Press Incorporated, Totowa, NJ, pp 339–348 14. Leoni C, Gallerani R, Ceci LR (2008)
6. Shymala V, Ames GF-L (1990) Genome walk- A genome walking strategy for the identification
ing by single specific primer—polymerase chain of eukaryotic nucleotide sequences adjacent to
reaction (SSP-PCR). Gene 84:1–8 known regions. Biotechniques 44:229–235
7. Siebert PD, Chenchik A, Kellogg DE et al 15. Ji J, Braam J (2010) Restriction site extension
(1995) An improved PCR method for walking PCR: a novel method for high-throughput
in cloned genomic DNA. Nucleic Acids Res characterisation of tagged DNA fragments and
23:1087–1088 genome walking. PLoS One 5:e10577
8. Chinault AC, Carbon J (1979) Overlap hybrid- 16. Malory S, Shapter FM, Elphinstone MS,
isation screening: isolation and characterisation Chivers IH, Henry RJ (2011) Characterising
of overlapping DNA fragments surrounding homologues of crop domestication genes in
poorly described wild relatives by high- 18. Thompson JR, Marcelino LA, Polz MF (2002)
throughput sequencing of whole genomes. Heteroduplexes in mixed-template amplifica-
Plant Biotechnol J 9:1131–1140 tions: formation, consequence and elimination
17. Rozen S, Skaletsky HJ (2000) Primer3 on the by ‘reconditioning PCR’. Nucleic Acids Res
WWW for general users and for biologist 30:2083–2088
programmers. In: Krawetz S, Misener S (eds) 19. Sambrook J, Fritsch EF, Maniatis T (1987)
Bioinformatics methods and protocols, Methods Molecular cloning: A laboratory manual, 2nd
in molecular biology. Humana Press, Totowa, edn. Cold Spring Harbor Laboratory Press,
NJ, pp 365–386 Cold Spring Harbor, NY
Chapter 13
Functional Analysis by Protein Biochemistry

Louis M.T. Bradbury
Abstract
To date a number of cereal genomes are fully sequenced and more are near completion. The information
within these genomes will be of most use to scientists when every gene has been functionally characterized
leading to the complete annotation of these genomes. This chapter describes how functional characteriza-
tion of plant proteins can be achieved via in vitro or in vivo methods. The first section of this chapter
describes the use of Escherichia coli as a host for expression of plant genes, followed by purification and in
vitro characterization of the resultant enzyme. The second section of this chapter details the methods
involved in transient gene expression in Zea mays leaf protoplasts for in vivo functional characterization of
protein localization.
Key words Protein expression, Protein purification, Enzyme assay, Protoplast isolation, Protoplast
transformation, Protein localization
1 Introduction
With increasing numbers of cereal genome sequences becoming

available it is desirable to obtain accurate annotations for every
gene in these genomes. Complete annotation of a genome allows
for a better understanding of all aspects of cereal biology including
metabolism, growth, development, and also yield and will allow for
effective approaches toward metabolic engineering within plants
[1]. Currently, genomes are annotated bioinformatically, via
homology with functionally characterized genes from other organ-
isms. While extremely useful, homology based genome annotation
can only correctly assign a function to a gene if the function of its
homologs are known. Additionally, homology to genes in distantly
related organisms is a poor predictor of gene function, often
leading to incorrectly annotated genes. These incorrect annota-
tions are then further propagated to new genomes as they are
sequenced. Accurate annotation of genes requires the functional
characterization of each gene product either in vitro or in vivo,
preferably both. Determining the subcellular localization of a
147
148 Louis M.T. Bradbury
protein is an important part of functional analysis. If an enzyme is

localized in a subcellular compartment that does not contain its
putative substrate, it is highly likely the annotation of this enzyme
is incorrect. Likewise, before attempting to engineer a metabolic
pathway into an organism it is essential to ensure that the enzymes
involved are co-localized with their respective substrates.
The two main approaches to characterizing the function of a
protein involve analysis of gene knockouts or recombinant expres-
sion (often over-expression) of the gene. In both of these cases,
observation of the resultant phenotype (in vivo analysis) can be
used to determine gene function. In the latter case subsequent
purification and use of the gene product in an enzyme assay to
determine its catalytic activity (in vitro analysis) can be used to
identify gene function. Ideally both an in vitro and in vivo approach
should be used to characterize a gene. The expression of a gene,
for the subsequent purification and use of the gene product in
vitro, can be undertaken via a few methods such as using cell-free
systems [2] or expression in a host organism like Escherichia coli
[3] or yeast. Of these approaches E. coli or yeast are most com-
monly used as they are easy to transform and culture, and are well-
characterized organisms. Typical in vivo approaches include stable
or transient over-expression of a gene in a plant followed by phe-
notypic analysis [4], using a plant gene to complement a knockout
of the homologous E. coli or yeast gene and restore the wild-type
phenotype [5] or the expression of a plant gene in E. coli (often
along with other non-native genes) to generate new metabolites
that are not naturally found in E. coli [6].
This chapter discusses two experimental approaches to func-
tional analysis by gene expression: (1) expression of a histidine
tagged (His-tag) plant gene in E. coli, purification of the recombi-
nant enzyme product, and characterization of its activity using an
in vitro assay and (2) transient over-expression of a gene in Zea
mays leaf protoplasts and characterization of its subcellular local-
ization. In the second approach the monocot Z. mays is used for
isolation of protoplasts as these cells are more likely to reflect those
of the cereal host than would those of a dicotyledonous plant.
However, careful consideration should be taken as to whether leaf
tissue from a C4 plant is the best choice for your gene of interest.
2 Materials
2.1 Bacterial Growth 1. E. coli strain transformed with a plasmid containing the gene of
and Gene Induction interest fused to a tag under the control of an appropriate pro-
moter. In the example given, the E. coli strain is BL21, the
promoter is an IPTG inducible T7 promoter and the gene of
interest is fused to a His-tag.
Functional Analysis by Protein Biochemistry 149
2. Isopropyl β-D-1-thiogalactopyranoside (IPTG).

3. Lauria Broth (LB), 200 mL per culture (see Note 1).
4. Temperature-controlled shaker.
5. Temperature-controlled centrifuge (capable of spinning
200 mL at 4,000 × g and 5 mL at 10,000 × g).
6. Liquid nitrogen and a −80 °C storage freezer.
2.2 Protein 1. Sonicator (200 W).

Purification 2. Nickel resin (Ni-resin) beads (Qiagen, Catalog # 30430).
3. Nickel resin (Ni-resin) column (Pierce Scientific product#
29920).
4. Lysis buffer: 50 mM NaH2PO4, 300 mM NaCl, 10 mM imid-
azole, pH to 8 with NaOH.
5. Wash buffer: 50 mM NaH2PO4, 300 mM NaCl, 20 mM imid-
azole, pH to 8 with NaOH.
6. Elution buffer: 50 mM NaH2PO4, 300 mM NaCl, 250 mM
imidazole, pH to 8 with NaOH.
7. Enzyme storage buffer: 50 mM potassium phosphate, HEPES,
MES or Glycine Buffer, at a pH near that of your predicted opti-
mal, containing 10 % glycerol and 20 mM β-mercaptoethanol.
8. De-salting column, e.g., PD-10 Column (GE Healthcare).
2.3 Enzyme Assay 1. Various buffers covering a wide pH range (e.g., HEPES, MES
or Glycine Buffers).
2. Assay buffer, 50 mM CAPSO buffer pH 9.5) (see Note 2); To
prepare 20 mL, dissolve 2.37 g of CAPSO (Sigma catalog #
C2278) in 10 mL of distilled water. Adjust pH to 9.5 with
KOH and make up to 20 mL with distilled water.
3. Additional components of assay:
– An enzyme stabilizer (in this case β-mercaptoethanol).
– Any required co-factors (NAD+).
– Substrate (γ-aminobutyraldehyde).
4. Spectrophotometer.
2.4 Protoplast 1. Use 10–25 Z. mays cultivar B73 seedlings, grown for 10 days
Isolation, in vermiculite (can be with or without light to generate chlo-
Transformation, roplasts or etioplasts respectively). Watered with tap water only
and Visualization (see Note 3).
2. Plasmid containing gene of interest under the control of a 35S
promoter and Kozak sequence just before the start codon. The
gene must be fused to GFP to allow visualization of subcellular
location (see Note 4). A set of marker control genes fused to
fluorescent protein sequences is also desirable to correctly

identify subcellular location [7, 8].
3. Solution A: 10 mM CaCl2, 0.6 M mannitol, 20 mM MES
(pH 5.7) autoclave. Store at room temperature.
4. Solution B: Just before use, make a 50 mL solution containing
1 % cellulase (500 mg Onozuka R10 from Trichoderma viri-
dae, Sigma), 0.3 % pectinase (160 mg pectinase from Rhizopus
sp., Sigma), 18 μL β-mercaptoethanol, and 0.05 % Bovine
Serum Albumin (BSA) topped up to 50 mL with solution A
(see Note 5).
5. Solution C: 15 mM MgCl2, 0.1 % MES, pH 5.5, 0.5 M man-
nitol, autoclave and store at room temperature.
6. Solution D: To 6 mL of a 0.1 M Ca(NO3)2 solution add 0.91 g
of mannitol (to make 0.5 M mannitol), dissolve this first then
add 4 g of PEG6000 (to make a 40 % solution of PEG) (see
Note 6). Dissolve this solution by microwaving for 6 s, gently
mixing, microwaving for another 6 s then gently mixing again.
7. A sterile 1 L Büchner flask with stopper.
8. Vacuum source.
9. Double-sided razor blades (see Note 7).
10. Cutting board.
11. Shaking incubator.
12. Nylon filter mesh, 60 μm.
13. Falcon tubes, 50 mL.
14. Centrifuge.
15. Sterile cut 1 mL pipette tips (need roughly 1 mm hole).
16. Round bottom polystyrene tubes, ~13 mL (see Note 8).
17. Glass-bottom 24-well plate.
18. Inverted confocal microscope, DMI16000B (Leica
Microsystems CMS, Germany) equipped with a 488 nm laser
for excitation of GFP and filters to detect chlorophyll fluores-
cence between 644 and 696 nm and GFP fluorescence between
500 and 539 nm. Other filters may be required for the detec-
tion of other fluorescent proteins such as RFP. A water immer-
sion objective lens (63×).
3 Methods
3.1 Bacterial Growth 1. Inoculate 5 mL of LB (containing an appropriate antibiotic for

and Gene Induction selection of your plasmid) with E. coli BL21 (transformed with
a plasmid containing a His-tag fused gene of interest, under
the control of an inducible T7 promoter) and grow, shaking
(200 RPM) at 37 °C overnight.
2. The following day, inoculate 200 mL LB (see Note 1) (con-

taining an appropriate antibiotic) with 2 mL of the overnight
culture and grow, shaking (200 RPM) at 37 °C until the opti-
cal density at a wavelength of 600 nm (OD600) is between 0.6
and 1.0.
3. Induce gene expression by adding 0.1 mM of IPTG to the
culture medium. Shake the culture at room temperature for
4 h (see Note 9).
4. Harvest cells by centrifugation (4,000 × g, 4 °C for 10 min)
remove the supernatant and flash freeze the pellet in liquid
nitrogen before storing at −80 °C (see Note 10).
3.2 Protein Kits, such as the QIAexpressionist™ (upon which, the protocol
Purification below is based), are available and provide detailed reliable
procedures for protein purification. This section will, therefore,
briefly provide purification details while focusing on important
considerations of protein purification and implications for enzyme
activity. The following steps should be performed between 0 °C
and 10 °C unless otherwise stated.
1. Thaw the bacterial pellet on ice for 15 min.
2. Resuspend the pellet in 3 mL lysis buffer per gram of pellet,
add 1 mg of lysozyme per mL and incubate on ice for 30 min.
3. Sonicate the cell suspension (six 10 s pulses at 200 W, cooling
the sample on ice for 10 s between each pulse) (see Note 11).
The cells should become slightly less opaque during sonication
(see Note 12).
4. Centrifuge at 10,000 × g, 4 °C for 20 min, retain the superna-
tant after transferring it to a new tube (see Note 13).
5. Add nickel-resin beads (1 mL per 4 mL of supernatant) and
gently mix (200 rpm on a shaker) at 4 °C for 1 h.
6. Apply the nickel-resin–supernatant mix to a column, allow the
supernatant to pass through the column, wash the column
with 8 mL of wash buffer. Discard flow through.
7. Elute the protein from the resin by washing with 2 mL of elu-
tion buffer. Collect the flow through (see Note 14).
8. Equilibrate a desalting column with your chosen enzyme stor-
age buffer containing 10 % glycerol and 20 mM β-mercaptoethanol
and apply the protein–elution buffer solution (from the previ-
ous step) to the equilibrated de-salting column (see Note 15).
9. Aliquot into 20 μL fractions (depending on your require-
ments), freeze in liquid nitrogen and store at −80 °C until it is
time to perform the assay.
3.3 Enzyme Assay The pH and chemical composition of the buffer used in the assay and
the incubation time and temperature of the assay will vary depending
on the enzyme being studied. Additionally, the analysis method
chosen to follow the reaction will vary depending on the nature of the
enzymatic reaction. In the example described below NAD+ is used as
a co-factor in the conversion of the substrate (γ-aminobutyraldehyde)
to the product (γ-aminobutyric acid) generating NADH in the
process. This provides an easy means of following the chemical
reaction as NADH absorbs strongly at 340 nm while NAD+ does
not. The production of γ-aminobutyric acid can, therefore, be
measured indirectly by the production of NADH [3].
1. Prepare 50 mM buffers of differing pH using HEPES (pH 6.8–
8.2), MES (pH 5.5–6.7), or CAPSO (pH 8.9–10.3) or glycine
buffers (pH 8.8–10.6).
2. Add the following to the buffers above to generate 1 mL buffer
solutions (see Note 16) containing 20 mM β-mercaptoethanol,
2 mM NAD+, with 10 μg of enzyme (in this case betaine alde-
hyde dehydrogenase 1 or 2—BAD1 or BAD2) and 5 mM
γ-aminobutyraldehyde and monitor the change in absorbance
at 340 nm over time. By maintaining constant enzyme and
substrate concentrations the optimal pH for maximum reac-
tion velocity can be determined.
3. Using the buffer and pH that give optimal reaction velocity,
perform a series of reactions as above but differing in substrate
concentration in an exponential manner.
4. Plot substrate concentration against the initial velocity of each
reaction, use excess substrate concentration to determine the
maximal velocity of the reaction (i.e., the point at which
increasing the substrate concentration no longer significantly
increases the reaction velocity). The substrate concentration
that gives half the maximal velocity is known as the Michaelis–
Menten constant (Km) of the reaction (Fig. 1).
5. Kcat (a measure of substrate turnover rate) is calculated by
dividing the maximal velocity (Vmax, in mol/s) by the concen-
tration of enzyme sites (mol) in the assay.
6. These two values (Km and Kcat) give a sense of how biologically
relevant the reaction is. The lower the Km value and the higher
the Kcat/Km the more likely this is a true substrate for the
enzyme in vitro, especially if the substrate is found in the cell at
levels equivalent to that of the Km.
3.4 Protoplast The following protocol is modified from [9, 10] and is identical to
Isolation, that used in [4, 6, 11]:
Transformation,
1. Harvest the middle part of the second leaf from 10 to 25 dark or
and Visualization light grown Z. mays B73 10 day old seedlings. Slice leaves per-
pendicularly with a razor blade to generate 1 mm thick slices.
2. Mix the 1 mm leaf slices together with 50 mL of Solution B in a
clean and sterile Büchner flask. Vacuum infiltrate the leaves with
solution B by placing the stopper on the flask and applying a
Fig. 1 Determination of enzyme kinetics. (a) Plotting product formed (y-axis)

versus time (x-axis) allows determination of the velocity (v) of a reaction at a set
enzyme and substrate concentration. This plot should be repeated numerous
times to determine the reaction velocity for different substrate concentrations.
(b) Plotting the velocity of a reaction (y-axis) versus the substrate concentration
(x-axis) allows determination of the maximum velocity (Vmax) of a reaction at a set
enzyme concentration. The Km is the substrate concentration at which half the
maximal velocity is achieved
vacuum about four times for about 5 s, gently shaking between

each vacuum application. Do this until the leaves turn dark green.
3. Incubate the sample with gentle shaking at 25 °C for 2 h in the
dark.
4. While the sample is incubating, make solution D and place
your plasmids (10 μL of 1 μg/μL in EB buffer) on ice ready for
later steps.
5. After 2 h take the leaf solution out of the incubator and swirl
by hand for 3–5 min (see Note 17).
6. Filter the solution through a 60 μm nylon filter mesh into a
50 mL falcon tube and centrifuge at 20 °C and 60 × g for
5–10 min.
7. Very carefully, pour off the supernatant, resuspend the pellet in
50 mL of solution A, and gently mix. Centrifuge at 20 °C and
60 × g for 5–10 min. Repeat this step another two times.
8. Again, gently pour off the supernatant before resuspending the
pellet in 35 mL of solution A. Gently mix.
9. Using cut 1 mL pipette tips, transfer 1 mL of the solution from
the falcon tube to polystyrene tubes (use one tube for each
plasmid you plan to express) (see Note 18). If your protein
localizes to a location other than the chloroplast you will need
to co-transform with control proteins fused to a different fluo-
rescent protein (e.g., RFP) that are known to localize to these
locations, e.g., [7, 8].
10. Centrifuge the solution in the polystyrene tubes at 20 °C and
60 × g for 5 min.
11. Discard 850 μL of the supernatant and gently shake the
remaining protoplast solution.
12. While gently shaking the protoplasts add 10 μL (i.e., 10 μg) of
your ice-cold plasmid and 500 μL of solution D (see Note 19).
13. Stop shaking the protoplasts and add 4.5 mL of solution C.
14. Incubate at room temperature for 20 min, mix and then cen-
trifuge at 20 °C and 60 × g for 5 min.
15. Remove the supernatant, wash by adding 5 mL of solution A,
gently mix, then centrifuge at 20 °C and 60 × g for 5 min, again
remove the supernatant.
16. Add 1 mL of solution A, gently mix, and (using the cut 1 mL
pipette tips) transfer the solution to a well in the glass-bottom
24-well plate.
17. Cover the top with a paper towel (to diffuse the light) and
incubate overnight at 20 °C with a light intensity of 50 μmol/
m2/s.
18. The following day the protoplasts can be observed using a
DMI6000B inverted confocal microscope or similar system
using a water immersion objective (63×).
19. A 488 nm argon laser is used as the excitation wavelength of
GFP and chlorophyll. The chloroplast auto-fluorescence is
detected between 664 and 696 nm, and the GFP fluorescence
is detected between 500 and 539 nm.
20. Observations should be confirmed by recording the emission
spectrum of the signal by wavelength scanning (lambda scan)
between 500 and 600 nm with a 3 nm detection window.
Fig. 2 Transient expression of Z. mays phytoene synthase 1 (ZmPSY1) fused to green fluorescent protein (GFP)
in Z. mays B73 leaf protoplasts. GFP—Fluorescence from the ZmPSY1-GFP fusion protein localizing to chloro-
plasts, Chl—Chlorophyll autofluorescence, MERGED—GFP and CHL images overlaid, confirming chloroplast
localization of the ZmPSY-GFP fusion protein, BRIGHT FIELD—regular light microscope image showing the
transformed protoplast is undamaged. Figure modified from [11]
21. LAS AF software (Leica Microsystems CMS, Germany) or sim-

ilar systems can be used for image acquisition. Images are
obtained by combining several confocal Z-planes.
22. Overlap between GFP and chlorophyll fluorescence is indica-
tive of a protein that is targeted to the chloroplast (e.g., Fig. 2,
modified from [11]).
23. Co-transformation with plasmids encoding RFP fused protein
standards of known subcellular localization should be used to
identify targeting to other subcellular locations, e.g., [7, 8].
4 Notes
1. Culture volume can be decreased or increased depending on

the level of protein expression and solubility.
2. The assay buffer and components thereof will vary depending
on the requirements of your enzyme (e.g., optimal pH, co-
factors). As a guide aim for physiological pH, i.e., values
around 7 to 8. Lower or higher concentrations of buffers can
also be used. Try to avoid the use of buffers that contain func-
tional groups similar to those acted upon by your enzyme (i.e.,
functional groups of your substrate or product).
3. Do not grow plants in soil and do not use fertilizer.
4. GFP must be fused to the end of the gene that does not con-
tain the putative targeting peptide otherwise the protein tar-
geting sequence will not function correctly leading to erroneous
results.
5. This solution must be made fresh, the source of cellulose and
pectinase can cause variation in results, however, the following
sources of cellulose can also be used; Onozuka R-10 derived
from Trichoderma viridae, Phytotechnology Laboratories and
Onozuka R-10, Research Products International Corp.
6. This solution must be made in the order described otherwise it

will not dissolve.
7. Amazon.com is a good source of Merkur Super double-sided
razor blades.
8. Plastics other than polystyrene can cause the protoplasts to
stick to the walls of the tube.
9. Incubating the culture at 18 °C overnight (instead of 4 h at
room temperature) may increase protein solubility. The use of
different culture medium (e.g., Terrific Broth) can help
increase protein solubility. Some genes may need to be re-
coded to optimize for expression in a prokaryotic host. Vector
systems are also available that can provide significantly higher
expression levels of selected proteins [12] .
10. In vivo analysis of enzyme function can be undertaken at this
stage if the substrate of the enzyme can be produced within
E. coli. This could be undertaken by engineering a new path-
way into E. coli or by gene knockout and complementation
approaches. For example see [6, 13].
11. Try to reduce the amount of foam formed by keeping the soni-
cator tip well below the surface of the cell suspension.
12. Sonication should break the DNA and RNA into small pieces
reducing the viscosity of the solution enough to pipette. If the
solution is too viscous RNase A and DNase 1 can be added
after sonication. Crude E. coli lysate can be used in an in vitro
enzyme assay if no competing endogenous enzymes are pres-
ent in E. coli and if no enzyme kinetics are required (e.g., [14]).
If the crude lysate is to be used in assays directly, lysozyme and
imidazole should be omitted and an appropriate buffer and pH
should be used.
13. A portion of this sample can be analyzed by SDS-gel electro-
phoresis to determine how soluble the protein is. If solubility
is low see Notes 9 and 10.
14. A sample of this can be used to determine purity via SDS-gel
electrophoresis.
15. A Bradford assay can be performed to determine the concen-
tration of your protein at this point. If your enzyme precipi-
tates (solution appears cloudy) at any point in the above steps
you will need to repeat the protein purification with modifi-
cations to the buffer that caused the precipitation. Salt con-
centration is usually the cause of precipitation (either too
much or too little). As a guide, use potassium (from 40 to
200 mM is the physiological level in most plants [15] and a
good starting point) rather than sodium based buffers and
avoid pH values near the pI of the protein. If protein is still
precipitating, try using up to 0.5 M glycine betaine hydrate
in the buffer. Ultimately a different organism may be required

as the source of the protein if none of the above prevent pro-
tein precipitation; however, this is only likely to work if the
amino acid sequence differs significantly.
16. Smaller assays volumes are often used, e.g., [16].
17. If fewer leaves were used shake harder.
18. You will have a lot of protoplast solution left over, if you wish,
you can use a small amount of this to check the integrity of
your protoplasts under a light microscope. The rest can be
discarded.
19. Do not add more than 10 μL, make sure that your plasmid
stock concentration is 1 μg/μL or greater.
Acknowledgements
I would like to thank Dr. Maria Shumskaya for her guidance in the
procedures of protoplast isolation and transformation. Many
thanks to Dr. Abby Cuttriss and Dr. Rémi Zallot for their com-
ments and thanks to Prof. Eleanore Wurtzel and Dr. Maria
Shumskaya for use of their protoplast images.
References
1. Bradbury LMT, Niehaus TD, Hanson AD Physiol 160:204–214. doi:10.1104/pp.
(2012) Comparative genomics approaches to 112.198556
understanding and manipulating plant metab- 7. Avisar D, Prokhnevsky AI, Makarova KS et al
olism. Curr Opin Biotechnol. doi:10.1016/ (2008) Is required for rapid trafficking of
j.copbio.2012.07.005 Golgi stacks, peroxisomes, and mitochondria
2. Katzen F, Chang G, Kudlicki W (2005) The in leaf cells of nicotiana benthamiana. Plant
past, present and future of cell-free protein Physiol 146:1098–1108
synthesis. Trends Biotechnol 23:150–156 8. Zhang Y, Su J, Duan S, Ao Y et al (2011) A
3. Bradbury LMT, Gillies SA, Brushett DJ et al highly efficient rice green tissue protoplast sys-
(2008) Inactivation of an aminoaldehyde tem for transient gene expression and studying
dehydrogenase is responsible for fragrance in light/chloroplast-related processes. Plant
rice. Plant Mol Biol 68:439–449 Methods 7:30
4. Bradbury LMT, Shumskaya M, Tzfadia O et al 9. Sheen J (1991) Molecular mechanisms under-
(2012) Lycopene cyclase paralog CruP pro- lying the differential expression of maize pyru-
tects against reactive oxygen species in oxy- vate, orthophosphate dikinase genes. Plant
genic photosynthetic organisms. PNAS Cell 3:225–245
109:E1888–E1897 10. van Bokhoven H, Verver J, Wellink J et al
5. Herrero S, González E, Gillikin JW et al (1993) Protoplasts transiently expressing the
(2011) Identification and characterization of a 200K coding sequence of cowpea mosaic virus
pyridoxal reductase involved in the vitamin B6 B-RNA support replication of M-RNA. J Gen
salvage pathway in Arabidopsis. Plant Mol Biol Virol 74:2233–2241
76:157–169 11. Shumskaya M, Bradbury LMT, Monaco RR
6. Quinlan RF, Shumskaya M, Bradbury LMT et al (2012) Plastid localization of a key carot-
et al (2012) Synergistic interactions between enoid enzyme is altered by isozyme, allelic
carotene ring hydroxylases drive lutein forma- variation and activity. Plant Cell 24(9):
tion in plant carotenoid biosynthesis. Plant 3725–41
12. Suzuki M, Zhang J, Liu M et al (2005) Single biosynthesis, prolamellar body formation, and
protein production in living cells facilitated by photomorphogenesis. Plant Cell 14:321–332
an mRNA interferase. Mol Cell 18:253–261 15. Wang Y, Wu WH (2010) Plant sensing and
13. Jeanguenin L, Lara-Nunez A, Pribat A et al signaling in response to K+-deficiency. Mol
(2010) Moonlighting glutamate formimino- Plant 3:280–287
transferases can functionally replace 16. Ranocha P, Bourgis F, Ziemak MJ et al (2000)
5-formyltetrahydrofolate cycloligase. J Biol Characterization and functional expression of
Chem 285:41557–41566 cDNAs encoding methionine-sensitive and-
14. Park H, Kreunen SS, Cuttriss AJ, Dellapenna insensitive homocysteine S-methyltransferases
D et al (2002) Identification of the carotenoid from Arabidopsis. J Biol Chem 275:
isomerase provides insight into carotenoid 5962–15968
Chapter 14
Genomic Southern Blot Analysis

Leigh Gebbie
Abstract
This chapter describes a detailed protocol for genomic Southern blot analysis which can be used to
detect transgene or endogenous gene sequences in cereal genomes. The protocol follows a standard
approach that has been shown to generate high-quality results: size fractionation of genomic DNA; cap-
illary transfer to a nylon membrane; hybridization with a digoxigenin-labelled probe; and detection
using a chemiluminescent-based system. High sensitivity and limited background are key to successful
Southern blots. The critical steps in this protocol are complete digestion of the right quantity of DNA,
careful handling of the membrane to avoid unnecessary background, and optimization of probe concen-
tration and temperatures during the hybridization step. Detailed instructions on how to successfully
master these techniques are provided.
Key words Southern blot, Genomic DNA, Digoxigenin-labelling, Hybridization, Chemiluminescent

detection, Background, Sensitivity
1 Introduction
Southern blotting and the associated hybridization techniques

were first described by E.M. Southern in 1975 [1] and the stan-
dard protocol was republished in the first volume of Nature pro-
tocols in 2006 [2]. It became a routinely used method in
molecular studies to detect a specific DNA sequence in a DNA
sample. The development of this technique made it possible to
obtain information about the physical organization of single and
multicopy sequences in the complex genome of any organism for
the first time. Today, many of its applications for analyzing plas-
mid constructs have been superseded by new techniques such as
Sanger sequencing and PCR. The availability of complete
genome sequences and bioinformatics tools has also made it pos-
sible to determine endogenous gene copy number and analyze
related sequences using “in silico” Southerns. Recently, Real-
time quantitative PCR has been developed as a tool for estimat-
ing transgene copy number even in complex genomes [3].
159
160 Leigh Gebbie
However, genomic Southern blots are still a relatively effective,

cheap, and simple way of estimating gene copy number and
genome structure. Indeed, Southern blots showing transgene
copy number profiles of individual lines may still be required by
the bodies regulating the release of genetically modified crops
(e.g., US environmental protection agency, Office of the Gene
Technology Regulator in Australia). They are still particularly
relevant for studies of cereals, whose genomes are often very
large and/or complex and may not have been fully sequenced
(for some relatively recent examples see [4–7].
The genomic Southern Blot procedure involves four major
steps: restriction digestion of genomic DNA (gDNA) and electro-
phoresis, transfer to membrane, hybridization, and detection. In
the first step, high-quality gDNA is cleaved into various sized frag-
ments by restriction digestion, for example a six base cutter will
produce fragments with a mean size of 46 (4,096 bp). The amount
of DNA needs to be sufficient to detect a single copy gene and
depends on the genome size of the organism but is also limited by
the amount that can be physically loaded and run on an agarose gel
and further depends on the sensitivity of the detection technique.
The choice of restriction enzyme will also vary depending on the
target but complete digestion is crucial for successful interpreta-
tion of the final banding patterns. For plant DNA, enzymes which
are sensitive to methylation should be avoided. The fragmented
DNA is then highly separated by electrophoresis. Next the DNA is
depurinated and denatured and permanently transferred to a mem-
brane support (either nitrocellulose or nylon but usually nylon
these days) by capillary transfer or other methods such a dry blot-
ting or vacuum transfer. The sequence of interest can then be
detected by molecular hybridization with a labelled probe. The
temperature, salt and formamide concentration during hybridiza-
tion and the temperature of the post-hybridization washes affect
the stringency of the interaction between the probe and gDNA.
High sensitivity and low background are key to successful Southern
blots especially for plants. Many researchers are filled with dread by
the idea of doing a genomic Southern and it is true that each step
in the procedure may require careful optimization by trial and
error. However once a successful protocol is established for your
system, they can become a routine technique producing high-
quality and reproducible results.
The protocol described here follows a very standard approach
using capillary blotting to a positively charged nylon membrane
and then hybridization with digoxigenin (DIG)-labelled probes,
which combined with chemiluminescent detection, can be very
sensitive [8]. Roche reports that a DIG-labelled PCR probe can
detect 0.10–0.03 pg of DNA in a human gDNA sample (3 × 109 bp)
[9]. Non-radioactive probes also have the obvious advantage of
being safer and simpler to produce and use than their radiolabelled
Genomic Southern Blot Analysis 161
counterparts and DIG-labelled probes can be stored for up to a

year at −20 °C and reused numerous times. During chemilumines-
cent detection, which is commonly used for Western analysis of
proteins, a light signal is produced on the site of the hybridized
probe. The light signal can be recorded on X-ray films or using
state-of-art imaging equipment, requiring only very short expo-
sure times. Chemiluminescent detection is a three-step process. In
the first step, membranes are treated with Blocking Reagent to
prevent nonspecific binding of antibody to the membrane. Then,
membranes are incubated with a dilution of Anti-Digoxigenin, Fab
fragments, which are conjugated to alkaline phosphatase. In the
third step, the membrane carrying the hybridized probe and bound
antibody conjugate is reacted with a chemiluminescent substrate
and exposed.
One critical factor for a high-quality Southern result with
DIG-labelling, which cannot be stressed enough, is that extreme
care is needed when handling the membrane before and after blot-
ting; this will significantly reduce the risk of any background. We
have also tried to include other tips for success in the extensive
notes section. Much of the protocol described here and some of
the notes can also be found in the “DIG application to filter hybrid-
ization” manual which can be downloaded as separate chapters on
different topics from the Roche Web site (www.roche-applied-
science.com) [9]. This manual includes details on many different
applications of DIG labelling, very detailed protocols for Southern
blotting and other blotting methods, comparisons between the
different strategies and products available, examples and excellent
troubleshooting tables.
2 Materials
Prepare all solutions with ultrapure DNAse-free water and analytical

grade reagents.
2.1 Electrophoresis 1. 0.5 M Ethylenediamine tetraacetic acid (EDTA); for a 500 ml

Components stock solution of 0.5 M EDTA, weigh out 93.05 g EDTA diso-
dium salt (FW = 372.2). Dissolve in 400 ml water and adjust
the pH to 8 with NaOH (see Note 1), make up to a final vol-
ume of 500 ml.
2. 50× Tris acetate–EDTA buffer ( TAE); Dissolve 242 g Tris-
base in water, adding 57.1 ml glacial acetic acid and 100 ml of
0.5 M EDTA (pH 8.0) solution, and make up to 1 l. This stock
solution can be diluted 50:1 with water to make a 1× working
solution. This 1× solution will contain 40 mM Tris, 20 mM
acetic acid, and 1 mM EDTA.
162 Leigh Gebbie
3. Electrophoresis grade Agarose (Sigma).

4. Ethidium bromide or other nucleic acid stain such as SYBR
green (Sigma) or Gel Green/Red (Biotium).
5. DNA Molecular Weight Marker (Promega, USA).
6. DIG-Labelled DNA Molecular Weight Marker (Roche, USA):
various size ranges available, will depend on target.
7. Gel loading buffer (Promega, USA).
8. Small gel tank and large gel tank (Bio-Rad, USA): Sub-Cell
GT model 192 is good and it is 29 × 40 × 9 cm.
9. Gel combs; 1.5 mm thick and with wells as wide as possible
while still accommodating the number of samples that needs to
be run on one gel.
2.2 Genomic DNA 1. NanoDrop or other spectrophotometer.

Restriction Digests 2. Tris–EDTA buffer (TE); 10 mM Tris, 1 mM EDTA. To make
a 100 ml solution of 1× TE Buffer, use1 ml of 1 M Tris–HCl,
pH 8.0 and 0.2 ml of 0.5 M EDTA and make up to 100 ml
with water.
3. Restriction Enzymes, buffer and Bovine Serum Albumin (BSA)
(New England Biolabs or Promega).
4. 100 % Ethanol.
5. 70 % Ethanol, v/v in distilled water.
6. 3.0 M Sodium acetate solution, pH 5.2; Weigh out 204.12 g
of sodium acetate trihydrate (FW 136.08) for a 500 ml solu-
tion; Adjust pH to 5.2 using glacial acetic acid.
2.3 Capillary 1. Platform, gel tray from sub-cell tank is perfect.

Transfer of DNA 2. Large tray or dish.
to Membrane
3. Positively Charged Nylon Membranes (Roche11 417 240
001, see Note 2).
4. Filter paper, 3MM (Whatman, see Note 3).
5. Paper towel.
6. Plastic sheet (transparency sheet or other convenient plastic
sheet).
7. Glass plate.
8. Weight (200–500 g).
9. Depurination buffer; 0.25 M HCl: Add 25 ml of 10 M HCL
to 1 l (+975 ml) of water, store at room temperature (RT) for
1 month.
10. Denaturation buffer; 1.5 M NaCl and 0.5 M NaOH. Weight
out 87.66 g NaCl and 20 g NaOH and dissolve in 1 l of water,
store RT 3 months.
11. Neutralization buffer; 1.5 M NaCl and 0.5 M Tris-base. Weigh

out 87.66 g NaCl and 60.50 g Tris-base and dissolve in water,
adjust pH to 7.5 with concentrated HCl, make up to 1 l, store
RT for 3 months.
12. SSC, 20×; 3.0 M NaCl and 0.3 M Tri-sodium citrate. Weigh
out 175.3 g NaCl and 88.2 g of Tri-sodium citrate and dis-
solve in water, ph to 7 with HCl, make up to 1 l (see Note 4).
2.4 Probe Generation 1. PCR DIG Probe synthesis kit (Roche, USA cat number
11636090910).
Regents included: Enzyme mix, Expand High Fidelity, 10×
PCR DIG probe synthesis mix, 10× PCR buffer with MgCl2,
10× dNTP stock solution, Control template, human tPA
Control PCR primer mix, and human tPA.
2. Template DNA, i.e., the partially purified DNA containing the
sequence to be labelled. Use either: Plasmid DNA 10–100 pg
(optimal amount 10 pg).
3. Genomic DNA, 1–50 ng (optimal amount 10 ng).
4. PCR primers that amplify the sequence to be labelled;
0.1–1 μM solution of upstream primer and 0.1–1 μM solution
of downstream primer.
5. Thin-walled PCR tubes.
6. Thermal cycler with gradient capability.
2.5 Hybridization 1. DIG Easy Hyb buffer; 500 ml ready-to-use, RNase- and DNase-
free (Roche catalogue number 11 603 558 001) or 6 × 100 ml
granules (Roche catalogue number 11 796 895 001).
2. 10 % SDS stock solution (w/v); Dissolve 100 g of SDS in 1 l
of water (see Note 5).
3. Low-stringency wash buffer; 2× SSC + 0.1 % SDS. Measure
100 ml of 20× SSC and 10 ml of 10 % SDS, make up to 1 l
with water, make fresh.
4. High-stringency wash buffer; 0.5× SSC + 0.1 % SDS. Measure
25 ml of 20× SSC and 10 ml of 10 % SDS, make up to 1 l with
water, make fresh.
5. Water bath.
6. Hybridization oven and bottles or Hybridization Bags (Roche,
USA, catalogue number 11 666 649 001) or zip-lock bags.
2.6 Detection 1. Shaking platform.

2. Maleic acid buffer; 0.1 M Maleic Acid; 0.15 M NaCl. Dissolve
11.61 g Maleic Acid and 8.77 g NaCl in water, pH to 7.5 with
NaOH pellets (approx 16.5 g), make up to 1 l. Autoclave.
Store at RT.
164 Leigh Gebbie
3. Wash buffer; Maleic acid buffer plus 0.3 % Tween-20.

Resuspend 3 ml of Tween-20 in 1 l of Maleic acid buffer. Make
fresh.
4. Blocking solution; 3 % skim milk powder in Maleic acid buffer.
Weigh out 3 g skim milk powder per 100 ml of maleic acid
buffer, (150–200 ml per membrane) warm in microwave until
milk powder dissolves and then cool before use. Or use DIG
Wash and Block Buffer Set (Roche, USA, catalogue number
11 585 762 001).
5. Detection buffer; 0.1 M Tris-base, 0.1 M NaCl. Dissolve
12.11 g Tris-base and 5.84 g NaCl in water, pH to 9.5 with
HCl and make up to 1 l.
6. Anti-DIG-alkaline phosphatase; enzyme-conjugated antibody
(Roche, USA, catalogue number 11 093 274 001).
7. Chemiluminescent substrate CDP-Star (Roche, USA cata-
logue number 12 041 677 001 or see Note 6).
8. Two transparency sheets or other plastic that can be overlaid
and sealed well.
9. Small piece of blotting paper.
10. Lumi-Film Chemiluminescent Detection Film: (Roche, USA,
catalogue number 11 666 916 001) or other similar film and
X-ray film developer or image analysis equipment such as the
Bio-Rad Molecular imager ChemiDoc XRS + system.
11. Stripping buffer; 0.2 M NaOH containing 0.1 % sodium
dodecyl sulfate (SDS). Dissolve 8 g of NaOH in 10 ml of 10 %
SDS and water and make up to 1 l.
3 Methods
3.1 gDNA Quality 1. Start with pure, RNA-free genomic DNA (gDNA) samples
Control and Test extracted using a CTAB protocol or gDNA isolation kit.
Digests Quantify the gDNA on a NanoDrop spectrophotometer or
other and adjust the concentration to 1 μg/μL with TE buffer
pH 8 (see Note 7).
2. Run a 2 μl aliquot on a 0.7–0.8 % agarose gel to confirm con-
centration and DNA integrity, i.e., that it has not been sheared
or degraded (see Note 8). High molecular weight DNA should
run as a tight band at approximately 40 kb (Fig. 1).
3. Run test digests of an aliquot of the DNA with possible
enzymes that you intend to use for the Southern (Table 1 and
see Note 9).
4. Add 3 μL of 6× loading buffer to digests. Also include an uncut
control of each sample (2 μL aliquot diluted in 20 μL water
Fig. 1 Restriction digest of maize genomic DNA. 10 μg of genomic DNA was fully
digested with BstXI and run on a 1 % agarose gel. Adapted from Vorwerk,
S. Wizard Genomic DNA Purification Kit and the Isolation of Plant Genomic DNA.
[Internet] 2001. Available from: http://www.promega.com/resources/articles/
pubhub/enotes/wizard-genomic-dna-purification-kit-and-the-isolation-of-
plant-genomic-dna/
Table 1
A typical test restriction enzyme digest (see Note 10)
Reagent Volume (μl)

DNA (1 μg/μl) 2
Buffer (10×) 2
Enzyme (10 U/μl) 1
Water 15
Total volume 20
Incubate at 37 °C for 3 h or overnight
166 Leigh Gebbie
Table 2
A typical digest setup for a genomic Southern
Reagent Volume (μl)

DNA (1 μg/μl) 10
Buffer (10×) 10
Enzyme (10 U/μl) 5
Water 75
Total volume 100
plus 3 μL l loading dye). Run on a 0.7–0.8 % agarose gel at

80–90 V until the loading dye reaches the end of the gel. Fully
digested plant gDNA should appear as a smear (Fig. 1),
(see Note 11).
3.2 DNA Digests 1. Fully digest an appropriate amount of gDNA (see Note 12)
and Running the Gel with selected Restriction enzymes in a large volume (Table 2,
see Note 13), overnight at 37 °C.
2. Verify that the DNA is fully digested with a 5 μl aliquot of the
digest on a 0.7–0.8 agarose gel as in step 4, Subheading 3.1.
3. Precipitate the DNA with 1/10th volume of 3 M sodium ace-
tate and 2× volume 100 % Ethanol and wash with 70 % etha-
nol, make sure all ethanol is removed and resuspend in an
appropriate volume of water for the chosen well size (see Note
15), usually 30–50 μl. Add loading dye to the samples.
4. Prepare a large 0.7–0.8 % agarose gel (see Note 14). Load sam-
ples, unlabelled size marker and 5 μl of a DIG-labelled DNA
Molecular Weight Marker. Run the gel at ~40 V until the DNA
bands are well separated. To assess the quality of the target
DNA, stain the gel and take a photo next to a ruler.
3.3 Capillary 1. Submerge the gel in 0.25 M HCl, with shaking at RT, until
Transfer of the DNA the bromophenol blue marker changes from blue to yellow
to a Membrane (see Note 15).
2. Rinse the gel with sterile, double-distilled water.
3. Submerge the gel in Denaturation Solution for 2 × 15 min at
RT, with gentle shaking.
4. Rinse the gel with sterile, double-distilled water.
5. Submerge the gel in Neutralization Solution for 2 × 15 min at
RT, with gentle shaking.
6. Equilibrate the gel for at least 10 min in 20× SSC.
7. Set up the blot transfer as shown in Fig. 2, avoiding the forma-
tion of air bubbles, as follows:
Fig. 2 Diagram showing setup for capillary transfer of gDNA from an agarose gel to a nylon membrane
Step 1: Make a wick by folding a large piece of Whatman 3MM

paper (or cheaper blotting paper) in three, soaking it in
20× SSC, and placing it atop a support (glass plate or
upside down gel tray) resting in a shallow reservoir of 20×
SSC so that only the ends are immersed in the buffer.
Step 2: Cut out three pieces of 3MM paper exactly the same
size as the gel, soak them in buffer and place them in the
center of the “bridge.”
Step 3: Place the gel atop the soaked sheets of 3MM paper.
Roll a sterile pipette over the sandwich to remove all air
bubbles that formed between the gel and paper.
Step 4: Place a plastic frame cut out to the size of the gel to
prevent short-circuiting, which can occur if the top layers
accidently come in contact with the wet bottom layers.
Step 5: Cut a piece of Positively Charged Nylon Membrane to
the size of the gel (see Note 16).
Step 6: Place the dry membrane on the DNA-containing sur-
face of the gel. Use a pipette to eliminate air bubbles as
above.
Step 7: Complete the blot assembly by adding three sheets of
dry Whatman 3MM paper (cut to the size of the gel), a
stack of paper towels (15 cm), a glass plate, and a 200–
500 g weight.
Step 8: Allow the blot to transfer overnight (24 h) in Transfer
Buffer (20× SSC).
8. Fix the DNA to the blot:
Either Place the membrane (DNA side facing up) on Whatman
3MM paper that has been soaked in 2× SSC. Expose the wet
membrane to UV light, cross-link with Stratalinker 120 mJ.
Rinse the membrane briefly in sterile, double-distilled water.
Allow membrane to air-dry, or wash the membrane briefly in
2× SSC. Or Bake the membrane either: at 120 °C for 30 min, or
at 80 °C for 2 h, to fix the DNA to the blot. Use the membrane
immediately or store the dry blot (between two sheets of
Whatman 3MM paper in a sealed bag) at 4 °C.
168 Leigh Gebbie
Table 3
Standard reaction mix for DIG-labelling a PCR product
DIG-labelled DIG-labelled tPA

experimental Unlabelled control probe Final
Reagent probe control probe (see Note 18) concentration
Sterile, repurified H2O Variable volume Variable 29.25 μl –
volume
PCR buffer with MgCl2 5 μl 5 μl 5 μl 1×
(see Note 18),
10 × conc.
PCR DIG mix 5 μl – 5 μl 1×; 200 μM
10× conc. dNTPs
dNTP stock solution, – 5 μl – 200 μM dNTPs
10× conc.
Upstream and downstream Variable volume Variable 5 μl 0.1–1 μM each
primers volume primer
Enzyme mix, 0.75 μl 0.75 μl 0.75 μl 2.6 units total
expand high fidelity enzyme
Template DNA Variable volume Variable 5 μl 10 ng genomic
volume or 10 pg
plasmid DNA
Total reaction volume 50 μl 50 μl 50 μl
3.4 Production 1. Prior to DIG-labelling optimize the conditions for amplifica-

of DIG-Labelled tion of your target DNA (see Note 17). A standard reaction is
Probes by PCR shown in Table 3.
Mix tubes well and centrifuge briefly to collect the sample at
the bottom of the tube.
Place the tubes in a thermal cycler and start PCR using the
optimal conditions.
The conditions below in Table 4 are a good starting point.
2. Use 5 μL of each reaction mixture to test the results of the
reaction by running it on an agarose gel along with a DNA
molecular weight marker and nucleic acid stain (see Note 18).
Examine the bands on the gel. If the labelling reaction
was successful both the labelled experimental probe and the
unlabelled control probe are clearly visible. The unlabelled
control probe will be of the predicted size whereas the DIG-
labelled probe will migrate more slowly (i.e., appear larger)
than the unlabelled probe due to the presence of DIG (Fig. 3).
The nucleic acid staining of the labelled probe should be
equal or somewhat less than the unlabelled probe due to the
presence of DIG (see Note 19).
Table 4
A typical PCR reaction for DID-labelling a PCR product
Temperature
(°C) Time Cycle number
Initial denaturation 95 2 min –
Denaturation 95 30 s 30
Annealing 60 30 s
Elongation 72 30 s per Kb
of product
Final elongation 72 7 min –
Fig. 3 DIG-labelling of PCR probes. The DIG-labelled DNA runs more slowly than
the non-labelled product
3.5 Hybridization of 1. Prehybridization of the blot with Dig easy Hyb buffer (see
DIG-Labelled Probes Note 20).
to a Southern Blot Step 1: Determine the appropriate hybridization temperature
according to the characteristics of your probe, target, and
hybridization buffer. Use the following calculation to
determine the optimal hybridization temperature in Dig
Easy Hyb buffer:
170 Leigh Gebbie
Use these equations (see Note 21) to calculate the

optimal hybridization temperature (Thyb) for DNA:DNA
hybrids in DIG Easy Hyb.
Tm = 49.82 + 0.41 (% G + C) – 600/l
Thyb = Tm – (20° to 25 °C)
Where:
Tm = melting point of probe-target hybrid
(% G + C) = % of G and C residues in probe sequence
Thyb = Optimal temperature for hybridization of probe
to target in DIG Easy Hyb
l = length of hybrid in base pairs
Step 2: Determine how much DIG Easy Hyb you will need for
the procedures below. For every 100 cm2 (e.g.,
10 cm × 10 cm) of membrane, you will need: 10 ml of DIG
Easy Hyb for the prehybridization step, and 3.5 ml of DIG
Easy Hyb for the hybridization step.
Place the correct amount of DIG Easy Hyb in a sterile
plastic tube, then place the tube in a water bath set at the
correct hybridization temperature. If using a hybridization
oven also warm it up to the correct temperature.
Step 3: Place the blot into a hybridization bag or bottle, (see
Note 22).
Add the appropriate amount of pre-warmed DIG Easy
Hyb to the bag or bottle (10 ml per 100 cm2). Place the
hybridization bag flat on the bottom of a rotating water
bath and place weights on the corners of the bag (but not
touching the blot) to secure it. Or place the bottle in the
oven on rotation. Incubate the blot for at least 30 min at
the correct hybridization temperature. Make sure the
membrane is agitated (bath) or rotated (oven) during this
prehybridization step so that the blot is constantly covered
in solution, (see Note 23).
2. Hybridization of the blot with the DIG-labelled DNA probe
Step 1: From your estimate of the amount of labelled probe
you made, determine how much DIG-labelled probe you
need for hybridization. Roche recommends using at least
25 ng random primed labelled probe, or 2 μl PCR-labelled
probe per ml hybridization buffer for detecting single-copy
genes in human genomic DNA (see Note 24).
Step 2: Prepare the hybridization solution as follows:
Add the appropriate amount of labelled probe to 50 µl
of water in a microcentrifuge tube. Place the tube into a
boiling water bath or thermal cycler for 5 min to denature
the probe. Chill the probe quickly on ice.
Table 5
Guideline for determining high-stringency wash temperature
Homology to target GC-content Buffer Temperature

80–100 % Average (40 %) 0.5× SSC + 0.1 % SDS 65 °C, if probe is >100 bp <65 °C,
if probe is short (100 bp or less)
<80 % Average (40 %) 0.5× SSC + 0.1 % SDS Approx. 60 °C
80–100 % High (50 %) 0.1× SSC + 0.1 % SDS 68 °C
Immediately add the denatured probe to a tube con-

taining the appropriate amount of prewarmed DIG Easy
Hyb (3.5 ml per 100 cm2) and mix by inversion to form
the hybridization solution.
Step 3: Add the hybridization solution to the blot as follows:
Cut open the sealed hybridization bag or undo the lid
of the bottle and pour out the prehybridization buffer.
Immediately add hybridization solution containing DIG-
labelled probe to the bag or bottle. Seal and incubate blot
with probe for 6–16 h (overnight) at the appropriate
hybridization temperature with gentle agitation or rota-
tion as before, (see Note 25).
3. Washes
Step 1: Carefully pour off the hybridization solution and
remove membrane to a suitable sized container. Meanwhile
heat the oven or water bath or preheat the high-stringency
wash solution to the appropriate temperature for the high-
stringency washes as determined below. Wash 2 × 5 min in
Low-Stringency Buffer (2× SSC containing 0.1 % SDS) at
room temperature with shaking, (see Note 26).
Step 2: The correct High-Stringency Buffer and wash tempera-
ture depend on the probe and target. A guideline for calculat-
ing the correct temperature is given in Table 5 (see Note 27).
Incubate the blot 2 × 15 min with preheated High-
Stringency Buffer at the correct wash temperature with
shaking or rotating in the oven. Either air-dry and store
the blot at 4 °C or continue immediately with detection
steps
3.6 Detection 1. Wash the blot 1 × 5 min at RT in Wash buffer (maleic acid buf-
fer + 0.3 % Tween-20) on a shaking platform or similar
(see Note 28).
2. Add blocking solution the membrane and incubate for 2 h at
RT with agitation making sure that the blot is covered by solu-
tion at all times.
3. Centrifuge Anti-Digoxigenin-AP for 5 min at 10,000 rpm in a
microfuge in the original vial prior to each use, and pipette the
172 Leigh Gebbie
necessary amount carefully from the surface. Dilute Anti-

Digoxigenin-AP 1:10 000 (75 mU/ml) in Blocking solution.
Incubate the membrane for 30 min only in Antibody solution
4. Wash membrane 3× 10 min in Wash buffer
5. Equilibrate membrane in detection buffer for 5 min
6. Using gloves, add the CDP-Star chemiluminescent substrate
to the blot:
Place the membrane (DNA side facing up) inside a develop-
ment folder (acetate sheets), hybridization bag, or other tightly
sealable envelope-like plastic container. Do not wrap mem-
brane in plastic wrap, which cannot be tightly sealed. For every
100 cm2 of membrane, apply 1 ml of CDP-Star, dropwise,
over the surface of the blot until the entire surface is evenly
soaked. As you are applying the substrate, immediately cover
the dampened part of the membrane with the second side of
the container so the substrate is spread evenly over the mem-
brane (see Note 29). Do not let air bubbles form between the
membrane and the upper surface of the container. Incubate
membrane for 5 min at room temperature. Squeeze excess liq-
uid out of the container, blot with blotting paper, and seal the
sides of the container close to the membrane.
7. Expose the sealed envelope (containing the membrane) at RT
to X-ray film until the desired signal is achieved or view with an
image documentation apparatus capable of measuring chemi-
luminescence (e.g., Bio-Rad Molecular imager ChemiDoc
XRS + system) (see Note 30).
3.7 Stripping 1. As long as the blot has never dried out during the entire
DIG-Labelled DNA procedure it can be stripped and reprobed multiple times with
Probe After no loss of signal. Rinse the membrane thoroughly in water for
Chemiluminescent 1 min
Detection 2. Wash membrane 2 × 15 min at 37 °C in Stripping Buffer.
3. Rinse membrane 2× SSC 5 min
4. Store the membrane wet in 2× SSC at 4 °C until needed or
reprobe.
4 Notes
1. EDTA will not go completely into solution until the pH is

adjusted to about 8.
2. The DIG Southern protocol has been optimized using Roche
positively charged nylon membranes and it really does seem to
work best with this brand, we observed less background than
with other similar products.
3. Although Whatman 3MM paper is expensive, make sure it is

used for the blotting paper which is in direct contact with the
membrane. Other cheaper paper will fray when wet so that
fibers stick to the membrane which may cause background.
Cheaper blotting paper can be used for the wick.
4. SSC is needed for the transfer and for washes so it is better to
make at least 2 l.
5. Wear a dust protection mask when weighing out SDS.
6. If you do not have access to equipment for imaging chemilu-
minescence then, although much less sensitive, colorimetric
detection is an option, use NBT/BCIP Ready-to-Use Tablets
(Roche Catalogue number 11697471001) following the
manufacturer’s instructions.
7. gDNA should remain more stable in TE buffer at pH 8 than
Millipore water which generally has a lower pH. When working
with gDNA, always use the largest tip possible and snip off the
ends of the pipette tips to prevent the DNA from being sheared
and keep the average size in excess of 80–100 kb (this is only
necessary until the DNA has been digested with restriction
enzymes) and never vortex. To ensure gDNA is fully resus-
pended before use, leave at 4 °C overnight for and mix gently
before use. If still not resuspended incubate at 55 °C. In general
store at −20 with minimal freezing–thawing.
8. For gDNA quality control, an aliquot must be run on a gel,
even if high OD readings and 260/280 ratios of ~ 1.8 are
obtained on the NanoDrop, the DNA could still be sheared or
contain RNA because the optical density measured is simply
that of nucleic acids.
9. The choice of enzyme depends on many factors. Firstly six-
base cutters are usually more appropriate: because any particu-
lar sequence of four bases occurs more frequently by chance
than one of six bases, four-base cutters cleave more frequently
than six-base cutters, and therefore generate, on average,
smaller restriction fragments. Next, make sure that the
enzyme’s restriction site is not prone to cytosine methylation.
Plant DNA is highly methylated, so for successful mapping in
plants, choose enzymes that either do not contain a CpG dinu-
cleotide in their recognition site (e.g., XbaI, EcoRI, BamHI,
and BgIII). For transgene copy number, if possible, choose an
enzyme that cuts once in your vector but not in the region
which will be used a probe, this way tandem insertions will still
be identified; an enzyme which cuts twice in the vector will
give a small diagnostic band. For endogenous gene copy num-
ber, use a selection of different enzymes but ones which do not
cut inside the gene will make it easier to interpret the final
band patterns.
174 Leigh Gebbie
10. For some restriction enzymes, the addition of BSA is recom-

mended, see manufacturer’s instructions.
11. DNA should be free of contaminants, such as phenol, chloro-
form, ethanol, detergents, or high salt concentrations, as these
may interfere with restriction endonuclease activity. If DNA is
not fully digested try adding more enzyme and leaving for lon-
ger, try different enzymes, try cleaning up the DNA by phe-
nol–chloroform extraction and precipitation or using a kit.
12. The amount of DNA that must be loaded depends on the rela-
tive abundance of the target sequence to which hybridization
will take place. According to Roche, the DIG-System can
detect 0.03 pg (chemiluminescent detection) or 0.1 pg (colo-
rimetric detection) homologous DNA in a Southern blot for-
mat on a nylon membrane. In theory, this corresponds to the
detection of a single-copy gene in <1 μg of human (3 × 109)
gDNA. So, for example, for wheat (17 × 109) or barley
(5 × 109), the genomes of which are approximately 5 and 1.6
times larger than that of human, respectively, in theory a sin-
gle copy gene could be detected in 5 μg of gDNA. However
in practice, DNA will be “lost” throughout the procedure, for
example during precipitation after the digestion or by exces-
sive depurination later on, and the hybridization conditions
may not be as perfect and those used by Roche so the amount
should be increased. Most researchers use 10–15 μg, basically
the largest amount that can be successfully fully digested and
nicely run on a gel. If enough gDNA is available a test blot
using 5, 10 and 15 or 20 μg could be run. But also note that
Roche suggest only running a maximum of 10 μg because if
there is too much DNA, the probe may hybridize with
degraded products.
13. More enzyme can be added but its volume should not exceed
1/10th of the total volume or the glycerol component may
inhibit digestion. If the gDNA is not fully cut after an over-
night incubation, try first to add more enzyme and leave for
longer or precipitate the DNA and redo the digest with fresh
enzyme, also see Note 12.
14. TAE gels will give better band resolution than TBE gels but
make sure that the electrophoresis tank is self-circulating.
Wider wells will also give better band resolution but if the wells
are too wide the signal intensity will decrease (i.e., be spread
across a wider band), also a compromise must be made between
well size and the number of samples which must be run on the
same gel. Make the gel as thin as possible but thick enough
for the chosen-well size to accommodate 30–50 μl of sample.
Do not put ethidium bromide or other stain in the gel or the
running buffer, as it can cause uneven background, instead the
DNA can be visualized after electrophoresis by staining. Do

not expose the gel to UV for long period of times.
15. Do not exceed 20 min for plant DNA. This treatment is unnec-
essary if the bands are <15 kb. Handle the gel with care as it is
very easy to break it during the washes and transfer setup.
16. To reduce background, always handle the nylon membrane
extremely carefully throughout the entire procedure. Always
wear gloves and only touch the very edges on the membrane.
Do not pick it up with forceps except by the very edges. Also
be very careful with the unused membrane when cutting out
your piece, do not handle it or touch it with anything.
17. We usually only optimize the annealing step of the PCR cycle
using a temperature gradient but the MgCl2 concentration
may also need to be optimized and the concentration adjusted
up or down in the final reaction. The DIG-labelled tPA control
is included in the kit but it is not really useful for plant
studies.
18. Store the remainder at −20 °C until it use, PCR-generated
probes can be stored at −20 °C for 1 year. They are very pure
and can be used directly in the hybridization reaction. No
clean up step is required.
19. If a low yield of DIG-labelled probe is observed make sure the
PCR parameters (cycling conditions, template concentration,
primer sequence, primer concentration) were optimized for
each template and primer set in the absence of DIG-dUTP
before attempting DIG incorporation. Or reduce the concen-
tration of DIG-dUTP in the reaction. This is especially impor-
tant for long templates. According to Roche, as a general rule
the 1:3 ratio of DIG-dUTP–dTTP in the mix works well for
probes up to 1 kb. However some short (<1 kb) probes (espe-
cially those with high GC content) will label better with a 1:6
ratio. Therefore, initial labelling experiments for each new
<1 kb probe should be performed with both ratios of labelled
to unlabelled nucleotide. You can easily create a labelling mix-
ture with a 1:6 ratio by mixing equal parts of PCR DIG Probe
Synthesis Mix (vial 2) (1:3 ratio) and dNTP shock solution
(vial 4) (no DIG-dUTP). Label >3 kb probes with even lower
concentrations of DIG-dUTP (from a high of 1:6 to a low of
1:10) and use the Expand Long Template System in place of
the Expand High Fidelity System supplied in the PCR kit.
20. Do not allow the membrane to dry at any time during prehy-
bridization, hybridization, or detection. If the membrane dries
or sticks to a second membrane (e.g., during simultaneous
processing of blots), the assay will have high background.
Exception: The membranes can be air-dried after the last high-
stringency wash and stored at 4 °C for later analysis. However,
a stored membrane cannot later be stripped and reprobed.
176 Leigh Gebbie
21. For example: if you are using DIG Easy Hyb and your target is
mammalian DNA containing 40 % GC sequences, the optimal
hybridization temperature should be 42 °C. We have found
that this temp works well for most applications in plants.
However the formula is true for probes with a 40 % GC con-
tent and 80–100 % homology to target. For sequences that are
<80 % homologous, the Thyb will be lower than that calcu-
lated above (approx. 1.4 °C lower per 1 % mismatch) and must
be determined empirically.
22. The prehybridization and hybridization steps can also be per-
formed in almost any container that can be tightly sealed, such
as temperature resistant plastic or glass boxes, petri dishes,
roller bottles, or sealable plastic bags. The container must be
sealed during the procedure to prevent the hybridization buf-
fer from releasing NH4 and changing the pH of the incuba-
tions. If using a bag: heat seal closely around the blot, to reduce
the dimensions of the bag and minimize the amount of prehy-
bridization solution, hybridization solution, and probe needed.
Remove air bubbles. Once filled with buffer the bag should
look slightly puffy when sealed. If using a bottle roll the blot in
the correct orientation so that there is no overlap and place the
bottle in the oven in the direction that ensures that as it turns
the blot flattens out and becomes stuck to the sides of the
bottle rather than rolling up more into a tighter cigar. You will
also need to balance the bottles.
23. The membrane can prehybridize for several hours or even lon-
ger without harm.
24. Too much probe will lead to high background on the blot.
2 μl/ml of buffer appears to work well in most cases but the
optimal concentration that does not produce non-specific
background can be determined empirically using serial dilu-
tions of the probe in mock hybridizations (i.e., hybridization
to naked membranes).
25. To avoid background it is very important to first add the dena-
tured probe to buffer and then commence agitation or rota-
tion immediately so that the probe is never in contact with one
spot on the membrane for too long. If high sensitivity is not
required, the incubation can be shortened. Most hybridiza-
tions will be complete after 6 h.
26. In this and the following steps, the amount of buffer depends
upon the size of the tray you are using. For each step, be sure
the membrane is completely covered with solution. The
hybridization solution can be saved in a tube at –20 °C for
future use and can be reused 3–5 times.
27. It may be necessary to determine the exact temperature empir-
ically. For cereal genomes with high GC content, 68 °C is
probably ideal.
28. The amount of buffer required will depend on the size of the
blot and size of the dish it is in to ensure that the blot remains
covered with solution at all times.
29. Correct application of the substrate quickly and evenly all over
the surface of the blot is crucial for a background-free Southern.
If necessary, wash the substrate off with water, wash the blot in
wash buffer and detection buffer and start again.
30. Exposure times can vary greatly, make a first exposure from
5 min to 15 min and then adjust the time depending on the
signal intensity. Repeat exposures can be made up to 2 days
after the addition of substrate.
References
1. Southern EM (1975) Detection of specific 6. Luo S, Peng J, Kunpeng L et al (2011)
sequences among DNA fragments separated by Contrasting evolutionary patterns of the Rp1
Gel-electrophoresis. J Mol Biol 98:503 resistance gene family in different species of
2. Southern E (2006) Southern blotting. Nat poaceae. Mol Bio Evol 28:313–325
Protoc 1:518–525 7. Yao Q, Cong L, Chang JL et al (2006) Low
3. Casu RE, Selivanova A, Perroux JM (2012) copy number gene transfer and stable expres-
High-throughput assessment of transgene copy sion in a commercial wheat cultivar via particle
number in sugarcane using real-time quantita- bombardment. J Exp Bot 57:3737–3746
tive PCR. Plant Cell Rep 31:167–177 8. McCabe MS, Power JB, de Latt AMM et al
4. Bartlett JG, Alves SC, Smedley M et al (2008) (1997) Detection of single-copy genes in
High-throughput Agrobacterium-mediated DNA from transgenic plants by nonradioactive
barley transformation. Plant Methods 4:22 southern blot analysis. Mol Biotechnol
5. Knox AK, Dhillon T, Cheng H et al (2010) 7:79–84
CBF gene copy number variation at Frost 9. Eisel D, Grunewald-Janho S, Hloch P et al.
Resistance-2 is associated with levels of freezing (2008) DIG Application Manual for Filter
tolerance in temperate-climate cereals. Theor Hybridization, R.A.S. Roche Diagnostics GmbH,
Appl Genet 121:21–35 Editor. Impressum, Mannheim, Germany
Chapter 15
Northern Hybridization: A Proficient Method

for Detection of Small RNAs and MicroRNAs
Shazia Iram
Abstract
The significance of small RNAs, being an important part of the cellular machinery, is undeniable. Several
techniques have been employed for detection of specific small RNAs. Among these techniques northern
hybridization is the most popular due to its universal application to RNAs of various sizes. The general
procedure involves separation of denatured RNA through gel electrophoresis and subsequent transfer and
fixing to a membrane. RNA on the membrane is then detected using suitable labelled oligo-probes. Here
we describe a method for detection of specific small RNAs, from an RNA pool, using sequence homology
based oligonucleotide DNA or RNA probes.
Key words Small RNAs, microRNAs, RNAi, Northern hybridization, PAGE, Radiolabelled probes
1 Introduction
The science of small RNAs has achieved added significance due to

their regulatory roles in gene expression. Establishment of proto-
cols for detecting small RNAs has led to increased importance to
the already known technique of northern hybridization. Northern
hybridization first used in 1977 [1] was an enormous achievement
in the field of RNA study. The advantages of this technique which
make it superior to other methods of RNA detection are its ability
to successfully detect a range of different sizes of RNA and addi-
tionally, it also provides an estimate of size of a specific RNA.
Northern hybridization is the most fundamental and widely used
small RNA detection assay. The technique has been improved and
improvised with time [2, 3]. Synthetic DNA or RNA oligonucle-
otide probes are used for reliable detection of small RNAs through
northern blots [4]. Recent work reveals methods for successful
detection of RNA species as small as 14 nucleotides from bacterial
RNAs [5]. As a safer and environment friendly option, northern
179
180 Shazia Iram
blot technology is now being employed for the detection of

small RNAs (~15–40 bases) using non-radioactive DIG-labelled
oligonucleotide probes as well [6].
A general small RNA northern hybridization starts by successful
isolation of intact RNA from tissues or cell culture. For high
abundance small RNAs, total RNA preparations could be used but
enrichment of small RNAs is recommended for rare small RNAs.
The isolated RNA is denatured and fractionated through electro-
phoresis on a Polyacrylamide gel. It is then transferred through
electro-blotting to a solid support and UV cross-linked to the sur-
face of the membrane. The membrane, with RNA attached to the
surface, is then blocked to avoid nonspecific binding and treated
with a radioactively labelled oligonucleotide probe. The membrane
is then washed and exposed to a phosphor screen or an X-ray film
overnight and signals are detected by phosphor-imaging or autora-
diography, respectively.
This chapter focuses on the detailed protocol for small RNA
detection through northern hybridization. A brief introduction
of an alternative method for use of non-radioactive DIG-labelled
oligonucleotide probes have also been given at the end of this
chapter. This method provides a safe and environmentally friendly
option for precautious users.
2 Materials
2.1 Polyacrylamide 1. DEPC (diethylpyrocarbonate)-treated H2O: DEPC treatment

Gel Components is used for removal of RNase contamination from water. DEPC
works by modifying −NH, −SH, and −OH groups from pro-
teins. Add 1 mL of DEPC to 1 L of distilled H2O. Stir for
15 min and let sit at room temperature for 2 h. Autoclave the
H2O and cool to room temperature prior to use (see Note 1).
2. 40%Acrylamide stock solution (19:1): To prepare 40 % (19:1)
acrylamide stock solution mix 38 % (w/v) of electrophoresis
grade acrylamide with 2 % (w/v) of bisacrylamide. For 500 mL
of stock preparation take 190 g of Acrylamide and 10 g of
bisacrylamide and dissolve in DEPC treated H2O to make final
volume of 500 mL. Filter solution with a 0.45-µm filter and
store in dark bottle at 4 °C (see Note 2).
3. Formamide/dye loading buffer: To prepare 10 mL of a 2× dye
solution mix 9.5 mL (95 %) of deionized formamide with
140 µL of deionized DEPC treated water. Add 360 µL of
0.5 M EDTA, pH 8.0 (18 %). To the 10 mL solution add
0.025 % (w/v) SDS, 0.025 % (w/v) bromophenol blue and
0.025 % (w/v) of xylene cyanol FF. Store in aliquots at −20 °C
(see Note 3).
Northern Blot Analysis-Small/MicroRNA’s 181
4. Pre-stained RNA markers for visibility on both gel and membrane

are extremely useful in northern hybridization experiments.
“DynaMarker® prestain Marker for small RNA plus” can be used
for small RNA detection through northern blotting.
5. TBE gel electrophoresis buffer: For a 10×stock add 1 M
(121.1 g/L) Tris base, 1 M (61.8 g/L) Boric acid, and 0.02 M
EDTA (7.4 g/L), mix and store at room temperature. Use
50 mL of 10× stock solution in 1 L of deionised DEPC treated
H2O to make 0.5× TBE gel running buffer.
6. Electrophoresis grade Urea (see Note 4).
7. 10 % Ammonium persulfate: Prepare 10 % (w/v) solution by
dissolving 1 g ammonium persulfate in 10 mL of H2O. Store at
−20 °C (see Note 5).
8. Gel staining solution: ethidium bromide 4 µg/mL in 0.5×
TBE (see Note 6).
9. Electrophoresis grade N, N, N′, N′-Tetramethylethylenediamine
(TEMED) (see Note 7).
2.2 Gel Running and 1. Vertical Polyacrylamide gel electrophoresis apparatus:

Transfer Equipment BIORAD Mini-PROTEAN® II Electrophoresis Cell, Gel size
7 cm (L) × 8 cm (W), Includes casting stand with gasket
(Biorad, USA).
2. Glass plates: inner 7.3 cm × 10.2 cm, outer 8.3 cm × 10.2 cm
with 1.5 mm thick spacers and 1.5 mm × 9 wells comb.
3. Semi-dry electrophoretic transfer apparatus: BIORAD
Trans-Blot® SD Semi-Dry Electrophoretic Transfer Cell
(Bio-Rad, USA).
4. A power supply with constant current function: BIORAD
PowerPacTM 300 power supply 200/240 V (Biorad, USA).
5. Positively charged nylon membrane: Hybond-N+ positively
charged Nylon membrane, pore size 0.45 µm Code Number:
RPN203B (GE Healthcare, USA, see Note 8).
6. UV cross-linker: Stratalinker® UV Crosslinker Model 2400
(Stratagene, USA).
7. Whatman 3MM chromatography paper (four sheets, cut
according to the size of gel).
2.3 RNA Blotting 1. 20× SSC stock solution; Prepare by mixing 175.3 g of sodium
Components for chloride (NaCl), and 88.3 g of trisodium citrate
Radioactive Detection (Na3C6H5O7 × 2H2O) in 800 mL of DEPC-treated H2O.
Adjust pH to 7.0 and make volume up to 1 L. Autoclave and
store at room temperature for up to 1–2 years.
2. Prepare 1 L of 100× Denhardt′s solution by mixing 20 g poly-
vinylpyrrolidone, 20 g of bovine serum albumin (Type V),
182 Shazia Iram
20 g of Ficoll-400 and 5 mL of 0.5 M EDTA (pH 8.0) in

H2O. Store a working stock at 4 °C. The solution could be
stored up to 1 year at −20 °C (see Note 9).
3. UltraPureTM Salmon sperm sheared DNA solution from
InvitrogenTM with a stock concentration of 10 mg/mL (see
Note 10).
4. For prehybridization solution mix 12.5 mL of 20× SSC (5×)
solution, 1.5 mL of Denhardt′s solution (3×) and 35 mL of
10 % SDS (7 %). Warm solution to 50 °C before use. Denature
5 mg (500 µL) salmon sperm DNA by boiling for 5 min for
50 mL of prehybridization solution and add to warm solution
(see Note 11).
5. Prepare probe by kinasing 5′ hydroxyl group of DNA or
RNA oligoprobe with [γ-32P] ATP using T4 polynucleotide
kinase.
10 μM oligoprobe 2 μL
[γ- P] ATP (7000 Ci/mmole; 160 μCi/μL)
32
2 μL
10× T4 Polynucleotide kinase Buffer 2 μL
T4 Polynucleotide kinase 1 μL
dH2O 13 μL
20 μL
Incubate reaction for 1 h at 37 °C. Add 50 μL of water and clean

the reaction for removal of unincorporated radioactive label. We
use illustra MicroSpin G-25 columns from GE HealthcareTM
following the manufacturer protocol. The expected percentage
of incorporated label after purification is ~75 %.
6. Prepare wash solution for post hybridization washing of mem-
brane. Two different wash solutions are used for this purpose.
Wash buffer I is a non-stringent buffer. To prepare 200 mL of
this buffer add 30 mL of 20× SSC (3× final concentration) and
100 mL of 10 % SDS (5 % final concentration) to 70 mL of
DEPC-treated H2O. Wash buffer II is a stringent membrane
washing buffer and 200 mL buffer is prepared by mixing
10 mL of 20× SSC (1× final concentration) and 20 mL of 10 %
SDS (final concentration 1 %) to 170 mL of DEPC-treated
H2O. Keep the wash buffers warm at 50 °C until needed
(see Note 12).
7. Hybridization oven with a rotating rack for glass hybridization
bottles.
8. Glass hybridization bottles.
9. Phosphor screen and Phosphor-imaging equipment.
3 Methods
3.1 Preparing 1. Assemble equipment for preparation of gel. Clean glass plates
15 % Denaturing before use and remove any dried acrylamide residues by wash-
Polyacrylamide Gel ing with water and cleaning with ethanol (see Note 13).
2. Place spacers on the inside edges of the large plate and cover
with the small plate keeping the cleaned surface on the inner
side. Arrange plate sandwich on casting stand with gasket and
secure with clamps, completely sealing edges to avoid any
leakage. Prepare the gel by mixing following components,
for 10 mL for 20 mL
40 % (19:1) Acrylamide stock solution 3.5 mL 7 mL
5× TBE buffer 2 mL 4 mL
DEPC-treated H2O 100 μL 200 μL
Urea 4.5 g 9g
Mix and keep at 37 °C with shaking for 10–15 min. This will
help to dissolve the large amount of urea in solution. After
urea is dissolved allow solution to cool down to room
temperature.
3. Add 50 µL 10 % ammonium per sulfate (APS), mix the solu-
tion and add 6 µL of N, N, N′, N′-tetramethylethylenediamine
(TEMED). After adding TEMED the solution will polymerize
very quickly so keep pouring syringe or tip ready before adding
TEMED.
4. Use 5 mL pipette tip to pour a small gel. Carefully pour the gel
at one corner of the plate in a slow and steady stream to avoid
any air bubbles. Stop pouring when the solution reaches upper
edge of the small plate. Carefully insert comb between the two
plates, avoiding any air bubbles. If air bubbles form around the
wells then take out comb and insert it again. Leave gel at room
temperature for 20–25 min. Make sure the gel is completely
polymerized before removing from casting gasket.
3.2 Running the Gel 1. Remove comb very carefully from the polymerized gel making
sure that the wells remain intact. Incomplete polymerization
could lead to deformed wells.
2. Remove plates with gel from the casting gasket and place in
electrophoresis tank with small plate facing inwards. Fill tank
with 0.5× TBE buffer making sure that both upper and
lower ends of the gel are in contact with the buffer to allow
184 Shazia Iram
flow of current. Using a tip wash the wells with running buffer.
Make sure to remove any residues of Urea, Acrylamide and
bubbles from wells. Also check lower edge of the gel for
removal of any air bubbles. These bubbles could interfere with
proper running of the gel.
3. Close the lid and attach electrodes. Pre-run gel at 40 mA for
60 min. Pre-running removes excess per sulfate and warms up
the gel for better resolution of bands (see Note 14).
4. To prepare RNA samples dissolve 10–50 µg of total RNA or
10–15 µg of enriched small RNA in ~20 µL DEPC H2O. Add
equal volume of 2× dye loading buffer. Heat samples at 80 °C
for 5–10 min and quick spin for 30 s. Wash the wells one more
time to remove any excess urea and load the samples in wells.
Load a pre-stained or appropriately labelled small RNA marker
for size reference (see Note 15).
5. Run the gel at 30 mA for 20–25 min for homogenous entry of
RNA in the gel. After initial slow run increase current to 40 mA
and run the gel for 1–1.5 h or until bromophenol Blue (lower
dye band) just gets out of the gel and xylene cyanol (upper dye
band) is in the middle of gel.
6. Turn off power supply and carefully remove plates with gel
from electrophoresis tank. Very gently remove small plate and
transfer gel to ethidium bromide staining solution. Keep the
gel in the staining solution for 5–10 min on gentle shaking.
View gel in UV light to see tRNA and 5S rRNA bands at ~80
nt and 120 nt respectively. Staining and visualization before
transfer to membrane helps to confirm quality and integrity of
RNA. It also acts as a visual loading control. Keep a record of
the gel by taking an image and saving it for future reference.
3.3 Transfer of RNA 1. Cut nylon membrane marginally larger than the size of gel.
to the Membrane Make an indentation on one edge to keep track of the mem-
brane orientation. The membrane could also be marked with a
pencil to later identify the side of membrane with RNA bound
to it. Cut four sheets of Whatman 3MM chromatography
paper according to the size of membrane. Soak the membrane
and the 3MM paper sheets in 0.5× TBE.
2. To assemble for transfer layer three pre-soaked Whatman
sheets on the lower positive end of transfer plate. Put wet
membrane on top of the sheets with marked side facing
upwards. Carefully place the gel on top of membrane making
sure that no air bubbles are trapped between layers. Place the
last buffer soaked Whatman sheet on top of gel (see Fig. 1).
Carefully close and secure the top lid. Transfer RNA to the
membrane at constant voltage (20 V). Transfer time for a small
gel will be 30–35 min. Larger gels might require extra time
(additional 10–15 min) for maximum transfer (see Note 16).
Gel
Whatman 3MM
Nylon chromatography
membrane sheets
Fig. 1 Sequence of layers for electrophoretic transfer of RNA to Nylon membrane
3. Disassemble apparatus after transfer is complete. Carefully

remove the gel and membrane. Visualize gel to make sure
that RNA has been transferred completely to membrane.
The tRNA and 5S rRNA bands should not be visible after a
successful transfer.
4. Briefly air-dry the membrane and cover it in Saran wrap. Place
the membrane in UV cross-linking chamber with RNA side
facing upwards. UV cross-link the RNA to membrane in
Stratalinker® at an energy of 1200 mJ using 254 nm short wave
UV light source (see Note 17).
5. After UV cross-linking, remove the Saran wrap and proceed
for hybridization (see Note 18).
3.4 Hybridization 1. Roll and place the membrane in glass hybridization bottle with
and Scanning RNA facing towards interior of the bottle for proper exposure
to probe. Use an appropriate sized bottle and avoid any over-
laps as they could block hybridization.
2. Preset the hybridization oven at 50 °C. Add denatured salmon
sperm DNA to warm prehybridization solution (50 °C).
Pour this solution in the glass bottle with the membrane in
it. Put the bottle in rotating rack in the hybridization oven
and leave for at least 2 h. The prehybridization could also be
carried out overnight.
3. After prehybridization, heat the probe to 85 °C for 5 min.
Quickly add probe to the blot in prehybridization solution.
Return the bottle to rotating rack in the hybridization oven
and leave overnight at 50 °C (see Note 19).
4. After hybridization remove solution from the tube and keep it
in a properly labelled glass bottle (see Note 20).
5. Add pre-warmed Wash Buffer I to the tube and leave in the
rotating rack for 30 min at 50 °C. Discard the buffer after first
wash and add pre-warmed Wash Buffer II. Keep the
hybridization bottle in oven at rotation and leave for 20–30 min
at 50 °C. Discard wash buffers in radioactive waste.
6. Semidry the membrane in air and cover in Saran wrap.
7. Expose blot to the phosphor screen or X-ray film for few hours
or overnight.
8. Different exposure times are required for varied probes depend-
ing on amount of RNA and efficient labelling of the probe.
186 Shazia Iram
9. Check image on phosphor-imager or develop X-ray film if

using autoradiography approach.
3.5 Membrane 1. The membrane could be washed for removal of bound RNA
Stripping for probe for re-probing with a different probe. For this boil 200–
Re-probing 250 mL of 0.1 % SDS in a microwave. Place membrane, RNA
side up, in a tray. Pour the boiling SDS solution over mem-
brane. Keep the tray on gentle shaking for 20–25 min. Discard
SDS in radioactive waste and repeat the boiled SDS wash for
one more time. After this partially dry the membrane and seal
in Saran wrap. Expose the blot to phosphor-imager to check
for successful stripping. This technique could also be used for
stripping Southern blots.
3.6 Non-radioactive DIG labelling has been employed as an alternative method for
Detection of Small/ non-radioactive northern hybridization. Commercially available
microRNAs Through kits are used for this purpose. Our experience shows that the non-
Northern Hybridization radioactive kits show better signals with autoradiographic
detection as compared to detection through chemiluminescence
detectors.
4 Notes
1. DEPC is a suspected carcinogen. Appropriate precautions, like

wearing gloves and handling in fume hood, must be taken while
working with DEPC. It can react with RNA so removal of DEPC
from water through autoclaving is necessary prior to use.
2. Acrylamide is a potent neurotoxin and is absorbed through
skin. Wearing gloves and face mask while handling is recom-
mended. For safety reasons we use ready prepared 40 % solu-
tion of Acrylamide/bis-acrylamide (19:1) from
SIGMA-ALDRICH®.
3. We use Ambion® Gel Loading Buffer II (Denaturing PAGE).
4. Urea solutions should be stored carefully and old solutions
should not be used.
5. Ammonium persulfate forms oxygen free radicals in water.
Acrylamide and bis-acrylamide polymerize to form a gel matrix
because of these free radicals.
6. Ethidium bromide is a potent mutagen. Wearing protective lab
coat and nitrile gloves is recommended while handling ethid-
ium bromide.
7. TEMED is highly flammable and corrosive. May cause skin
rash or burns. Keep in a well-ventilated and cold place.
8. This is a positively charged membrane with high sensitivity
in DNA and RNA blotting. Binding capacity of up to
600 µg/cm2. Recommended for use with both radioactive
and non-radioactive chemiluminescence and chemifluores-

cence detection systems. The membrane is stable for up to
3 years when stored in a bag at room temperature in a clean
dry atmosphere.
9. This solution is a mixture of high molecular weight polymers
and is used as a blocking agent.
10. This solution is used to block the membrane for nonspecific
binding of probe. The DNA is sheared to an average size of
≤2,000 bp.
11. Prehybridization solution should be prepared fresh before
use. The salmon sperm DNA could also be quick chilled on
ice, after boiling, before adding to the prehybridization
solution.
12. The wash solutions tend to precipitate due to high salt and
SDS concentration. Warming solutions up to 50 °C dissolves
the precipitates.
13. When using new plates rinse them with soap and water. Clean
with ethanol and dry. Treatment of inner side of smaller
plate with a siliconizing agent is also recommended for easy
separation of small plate from the gel prior to staining and
transfer.
14. An aluminum plate at the back of the glass plates is recom-
mended for even distribution of heat through the gel. This
helps in better and more uniform mobility of samples.
15. Along with pre-stained markers, radiolabelled RNA size refer-
ence markers are also used in northern hybridization.
16. Do not over run transfer apparatus as it tends to heat up by
extensive running. If longer transfer time is required
(more than 1 h) transfer could be carried out in a cold
room at 4 °C.
17. UV cross-linking works by forming covalent bond between
uracil of RNA (thymine of DNA) and the amino group of
nylon membrane. This bond results in linking of RNA or DNA
to the membrane.
18. At this step the membrane covered in Saran wrap could be
stored at 4 °C for later use.
19. For detection of low concentration small RNAs hybridization
stringency could be lowered by decreasing the temperature to
42 °C. Temperature lower than 42 °C might result in increased
background signal.
20. This hybridization solution could be reused (preferably one
reuse) depending on the incorporation of radioactivity. When
reusing heat the probe to 60 °C and add to the membrane in
glass tube after prehybridization.
188 Shazia Iram
Acknowledgement
I would like to thank Prof. Peer Schenk, University of Queensland,

Australia for the recommendation.
References
1. Alwin JC, Kemp DJ, Stark GR (1977) Method 4. Henderson GS, Conary JT, Davidson JM, Stewart
for detection of specific RNA in agarose gels by SJ, House FS, McCurley TL (1991) A reliable
transfer to diazobenzyloxymethyl-paper and method for northern blot analysis using synthetic
hybridization with DNA probes. Proc Natl oligonucleotide probes. Biotechniques 10:190–197
Acad Sci U S A 74:5350–5354 5. Beckmann BM, Grünweller A, Weber MH, And
2. Pall GS, Hamilton AJ (2008) Improved north- Hartmann RK (2010) Northern blot detection of
ern blot method for enhanced detection of small endogenous small RNAs (approximately14 nt) in
RNA. Nat Protoc 3:1077–1084 bacterial total RNA extracts. Nucleic Acids Res
3. Koscianska E, Starega-Roslan J, Czubala K, 38:e147
Krzyzosiak WJ (2011) High-resolution north- 6. Kim SW, Li Z, Moore PS, Monaghan AP, Chang
ern blot for a reliable analysis of microRNAs and Y, Nichols M, John B (2010) A sensitive non-
their precursors. ScientificWorldJournal radioactive northern blot method to detect
5:102–117 small RNAs. Nucleic Acids Res 38:e98
Chapter 16
Protein Blotting Protocol for Beginners

Lars A. Petrasovits
Abstract
The transfer and immobilization of biological macromolecules onto solid nitrocellulose or nylon
(polyvinylidene difluoride (PVDF)) membranes subsequently followed by specific detection is referred to
as blotting. DNA blots are called Southerns after the inventor of the technique, Edwin Southern. By anal-
ogy, RNA blots are referred to as northerns and protein blots as westerns [1]. With few exceptions, west-
ern blotting involves five steps, namely, sample collection, preparation, separation, immobilization, and
detection. In this chapter, protocols for the entire process from sample collection to detection are described.
Key words Protein extraction, Trizol, SDS-PAGE, Electrophoretic transfer, Immunodetection
1 Introduction
1.1 Sample Proteins are subject to a plethora of posttranscriptional and

Collection posttranslational chemical modifications and therefore, speed is of
and Preparation the essence when samples are harvested. The most common
procedures involve snap-freezing in a liquid nitrogen or ethanol–dry
ice bath. Alternatively, immediate sample processing may be employed
in order to minimize the introduction of experimental error.
The first step is usually disruption of solid samples. This is
achieved mechanically by blending, grinding, sonification, or enzy-
matic digestion in a suitable lysis buffer depending on the purpose
of the analysis. Lysis buffers can vary in their composition but usu-
ally contain a buffer such as MOPS, HEPES, or Tris-buffered
saline (TBS), metal-chelates such as EDTA or EGTA, detergents
(denaturants) such as SDS, Triton X-100, Nonidet-P40 or deoxy-
cholate, and reducing agents such as β-mercaptoethanol or dithio-
threitol. Additionally, protease inhibitors or chaotropic agents may
be present to aid in cell disruption. There are several lysis buffer
preparations commercially available, such as Invitrogen’s Trizol®
and Sigma’s TRI Reagent® that allow for multiple macromolecular
species to be extracted from the same sample [2]. The next step is
189
190 Lars A. Petrasovits
Table 1
Gel strength and approximate separation capacity
Gel percentage (%) Size range (kDA)

8 25–200
10 15–100
12.5 10–70
15 12–45
20 4–40
the removal of cellular debris and other contaminants from the

sample. This is usually achieved by filtration, centrifugation, dialy-
sis, and/or precipitation of proteins. After this, a buffer compatible
with the separation system (Sample loading buffer) is added to the
sample. It is often desirable to carry out sample preparation at low
temperatures and minimize sample handling to avoid artifacts.
Prepared samples can be stored at below −20 °C.
1.2 Separation To most common method of separation of proteins is poly-

acrylamide gel electrophoresis (PAGE) [3]. Separation is achieved
based on size and charge of a given protein. In contrast to nucleic
acids that have a net negative charge per nucleotide base, proteins
are not charge-uniform. This is important when native (without
reductants or detergents) PAGE of highly basic proteins such as
histones is attempted. The inclusion of SDS serves two purposes:
disruption of secondary (α-helices and β-pleated sheets), tertiary
(electrostatic, but not disulfide bonds that are reduced), and
quaternary (three-dimensional monomer assembly) protein
structure and coating of the primary structure to provide a net
negative charge, so that proteins will move to the positively
charged electrode. In SDS-PAGE, proteins migrate through the
gel at a rate inversely proportional to their size. The pore size of
gels determines the size range of proteins that can be separated
and is dependent on acrylamide plus cross-linker (N,N-
methylenebisacrylamide) concentration (Table 1).
Since acrylamide is a powerful cumulative neurotoxin, it is
NOT recommended that this should be attempted by a complete
novice! Readymade gels can be purchased, for example Nu-Page™
from Invitrogen or Mini-Protean™ from Bio-Rad. Commercially
supplied gels are guaranteed to perform consistently, both within
the same batch or between batches and are cheaper to use than
homemade gels. Both types have been successfully used in our
laboratory; however, gels and electrophoresis equipment are not
compatible or interchangeable due to differences in buffer systems
and physical size of the gels.
Protein Blotting 191
Fig. 1 A polyacrylamide gel showing proteins resolved by electrophoresis and

then stained
Pre-electrophoretic steps are the setting up of the gel cells and

sample loading: readymade gels are removed from packaging,
combs and tape removed, and the wells thoroughly rinsed with
water followed by running buffer (typically 25 mM Tris, 192 mM
glycine, pH 8.3 plus 0.1 % SDS for SDS-PAGE). The sample may
be boiled for 5 min before loading. Molecular weight standards
and a known positive and negative control should be included.
It is important to read the manufacturer’s instructions to deter-
mine the gel capacity, typically around 10 μg of protein per well.
Sample concentrations may be determined using Lowry or
Bradford assays or can be done by measuring A280. Each method
has intrinsic flaws, so that perhaps the best method to ensure con-
centration uniformity across multiple samples is to run them on a
gel, staining with Coomassie Blue or similar and adjusting concen-
trations based on the intensity of multiple protein bands (Fig. 1).
For most gels, run times are around 30 min at 100–200 V or
until the loading has migrated to the bottom of the gel. The gel is
then removed from its cast and may be rinsed in blotting buffer for
several minutes.
1.3 Transfer Transfer of proteins from the gel onto the membrane is carried
and Immobilization out in an electric field and follows the same principle as
electrophoresis. SDS-coated proteins are negatively charged and
migrate towards the anode accordingly. The difference is that
membrane and gel are in direct contact and the membrane stops
proteins from further travel. Gel and membrane are sandwiched
between filter paper and sponges (sponge–paper–gel–membrane–
paper–sponge) and submerged in transfer buffer so that the gel
faces the cathode. There are several different transfer buffers to
choose from and some consideration needs to be given as to their
suitability: High pH buffers (e.g. 10 mM NaHCO3, 3 mM

Na2CO3, 20 % methanol, pH 9.9) improve binding of proteins to
positively charged membranes [4]. Some protocols recommend
addition of 20 % methanol but this is not necessary if PVDF
membranes are used. Methanol reduces pore size of gels making
transfer of large proteins more difficult [5]. In contrast to
nitrocellulose, PVDF membranes require pre-wetting with
methanol or ethanol followed by equilibration in transfer buffer.
Also, presence of SDS in the buffer increases elution efficiency of
proteins from gels but reduces their binding efficiency to the
membrane, increases ionic strength of the transfer buffer and may
precipitate from solution at low temperature [6].
1.4 Detection When native PAGE is employed as a separation method, detection

of a protein of interest may be achieved by activity or cofactor
binding assays [7]. However, the majority of proteins are denatured
and reduced after being subjected to SDS-PAGE and therefore do
not retain biological activity. The most common method of
detection is by immunological means involving the use of specific
antisera raised against the protein of interest. Since antibodies are
proteins, they will bind to the membranes nonspecifically. This is
overcome by the use of blocking agents, and the most commonly
used ones are bovine serum albumin and skim milk powder. After
blocking, the membrane is incubated with the primary antibody
specific to the protein of interest, typically a rabbit or mouse
immunoglobulin (IgG). Many antisera are now commercially
available and are commonly used at a 1:1,000 dilution. After
removal of excess/unbound primary antibody, a secondary
antibody against the primary antibody conjugated to a reporter
system such as immunogold, horseradish peroxidase (HRP), or
alkaline phosphatase (AP) is added. Again, unbound antibodies are
removed and detection is achieved either through the use of
chromogenic or chemiluminescent substrates. Secondary antibody/
detection kits are commercially available, e.g., Invitrogen’s Western
Breeze® or Amersham’s ECL Plus™ kits.
2 Materials
2.1 Sample 1. Liquid Nitrogen.

Collection 2. Trizol.
and Preparation
3. Chloroform.
Using Trizol®
4. Isopropyl alcohol.
5. 75 % Ethanol v/v in DEPC-treated water.
6. RNase-free water or 0.5 % SDS solution; To prepare RNase-
free water, draw water into RNase-free glass bottles.
Add diethylpyrocarbonate (DEPC) to 0.01 % (v/v). Incubate

overnight at room temperature and autoclave. The SDS solu-
tion must be prepared using DEPC-treated autoclaved water.
7. 100 % Ethanol.
8. 0.1 M Sodium citrate in 10 % ethanol (v/v in distilled water).
9. 0.3 M Guanidine hydrochloride in 95 % ethanol.
10. 1 % SDS or Sample buffer (32 mM Tris–HCl, pH 6.8, 1 %
(w/v) SDS, 12.5 % (v/v) glycerol, 0.005 % (w/v) Bromophenol
Blue, 2.5 % (v/v) 350 mM DTT (added fresh).
2.2 Separation of 1. Electrophoresis tank.

Proteins by SDS-PAGE 2. Electrophoresis module; Bio-Rad Mini-PROTEAN® Tetra cell
equipment (cat #s 165-8000 and 165-800, Bio-Rad, USA).
3. Power pack.
4. Precast gels; Mini-PROTEAN® precast gels (Bio-Rad, USA).
5. Buffer dam (if only one gel is run).
6. Running buffer (700 mL: 25 mM Tris-base, 192 mM glycine,
0.1 % (w/v) SDS, pH 8.3).
7. Samples (1× sample buffer: 32 mM Tris–HCl, pH 6.8, 1 %
(w/v) SDS, 12.5 % (v/v) glycerol, 0.005 % (w/v) Bromophenol
Blue, 2.5 % (v/v) 350 mM DTT (added fresh).
8. Protein size marker.
9. Bio-Safe Coomassie G-250 stain (Bio-Rad, cat.#161-0786).
2.3 Electrophoretic 1. Electrophoresis tank; Bio-Rad Mini Trans-Blot Electrophoretic

Transfer and Transfer Cell (Cat # 170-3930, Bio-Rad, USA).
Immobilization 2. Power pack.
3. Gel, equilibrated in transfer buffer.
4. Transfer buffer (25 mM Tris-base, 192 mM glycine, 0.1 %
(w/v) SDS, pH 8.3).
5. PVDF membrane.
6. Gel holder cassette, fiber pads, filter paper, electrode module.
7. Blue cooling unit, frozen.
8. Magnetic stirrer and flea.
2.4 Detection Using 1. Western Breeze Kit (Invitrogen, cat #s WB7104, WB7106,
Western Breeze® and WB7106).
2. Blotted membrane.
3. Primary antibody.
4. Sterile distilled water.
5. Clean dishes.
6. Forceps for handling membranes.

7. Orbital shaker, set to 1 rev/min.
8. X-ray film, dark room, and film development chemicals.
9. Autoradiography cassette (Kodak X-OMAT AR or equivalent).
3 Method
3.1 Sample Caution: When working with TRIZOL Reagent use gloves and
Collection eye protection (shield, safety goggles). Avoid contact with skin or
and Preparation clothing. Use in a chemical fume hood. Avoid breathing vapor.
Using Trizol® TRIZOL® (Invitrogen Cat. No. 15596-026) is a registered
trademark of Molecular Research Center, Inc. A recipe for Trizol is
provided (Table 2).
Unless otherwise stated, the procedure is carried out at
15–30 °C, and reagents are at 15–30 °C.
1. Grind Tissue under Liquid Nitrogen with a mortar and pestle
until a fine powder is obtained.
2. Using a cold spatula, weigh out up to 100 mg of frozen tissue
powder into 10 volumes of Trizol (see Notes 1–3).
3. Incubate for at least 5 min at room temperature (RT), then
centrifuge for 5 min at 12,000 × g. Transfer supernatant to a
fresh tube.
4. Add 0.2 volumes of chloroform and shake vigorously for 15 s
and incubate for 2–3 min (see Note 4).
5. Remove the aqueous phase (ca. 60 % of total volume) contain-
ing RNA. The RNA is precipitated with 0.5 volumes
Table 2
Homemade recipe for 1 L of Trizol
Final
Reagents Volume/mass concentration
Acid Phenol 380 mL 38 %
Guanidine thiocyanate 94.53 g 0.8 M
Ammonium thiocyanate 30.45 g 0.4 M
Sodium acetate, pH 5.0 33.4 mL of 3 M stock 0.1 M
Glycerol 50 mL 5%
RNase-free water Adjust final
volume to 1 L
Source: http://ipmb.sinica.edu.tw/microarray/newprotocol/TRI.pdf
Isopropanol per volume Trizol, centrifugation at 12,000 × g,

4 °C and stored under 75 % ethanol at ≤20 °C.
6. Add 0.3 volumes ethanol per volume Trizol used for homog-
enization to the organic phase. Mix samples by inversion, incu-
bate at RT for 3 min and centrifuge at <2,000 × g at 4 °C.
Remove supernatant to a fresh tube (see Note 5). The pellet
contains DNA and is washed twice in 0.1 M sodium citrate in
10 % ethanol followed by one wash in 75 % ethanol. The dried
pellet is resuspended in 8 mM NaOH and is suitable for PCR.
7. Add 1.5 volumes of isopropanol to the phenol–ethanol super-
natant. Mix and incubate at RT for 10 min, then centrifuge for
10 min at 12,000 × g at 4 °C. Discard supernatant.
8. Wash the pellet three times in 0.3 M Guanidine hydrochloride
in 95 % ethanol. For each wash, 2 volumes of wash solution are
used for 20 min at RT and the pellet recovered by centrifuga-
tion at 7,500 × g at 4 °C.
9. Remove supernatant and dry the pellet under vacuum for
5 min, then resuspend in 1 % SDS or sample loading buffer.
3.2 Separation of 1. Heat samples at 95 °C for 5 min. Allow to cool.

Proteins by SDS-PAGE 2. Remove gel(s) from sealed pouch.
(See Note 6)
3. Remove gel comb and tape at the bottom of the gel (see Note 7).
4. Rinse wells with distilled water several times.
5. Assemble the electrophoresis module by inserting the gels into
the clamping frame with the short plate facing inwards. If one
gel is used, insert a buffer dam. Ensure that gels sit snugly
against the green gasket. Fasten clamps into place (see Note 8).
6. Insert electrophoresis module into tank.
7. Fill the inner chamber with running buffer and flush out wells.
8. Add the remaining running buffer to the tank (outer
chamber).
9. Load samples into wells.
10. Shut tank lid and plug leads into power pack (see Note 9).
11. Run gels at 200 V constant for ca. 30 min or until the dye
reaches the bottom.
12. Turn power pack off and remove gel cassettes.
13. Break cassettes open and carefully remove gels (see Note 10).
14. Rinse the gel for 5 min in three changes of water if staining or
running buffer for blotting.
15. Assemble Blotting apparatus OR stain gel: Add staining solu-
tion and incubate for 1 h. Destain gel against several changes
of water (see Fig. 1).
3.3 Electrophoretic 1. Pre-wet the PVDF membrane in ethanol for 1 min, then soak
Transfer and in transfer buffer for 5 min (see Note 12).
Immobilization 2. Open gel holder cassette and place dark side down in transfer
(See Note 11) buffer. Layer fiber pad, filter paper, gel, equilibrated membrane,
filter paper, and the second filter pad on top of the dark side of
the cassette. Ensure removal of air bubbles between gel and
membrane. Close the gel holder cassette (see Notes 13 and 14).
3. Fill tank with transfer buffer and add stirrer flea.
4. Slot the gel holder into the electrode module and insert imme-
diately into the electrophoresis tank.
5. Add the blue cooling unit and place the tank on a magnetic
stirrer (see Note 15).
6. Run the transfer at 100 V constant for 1 h or at 30 V constant
overnight.
7. Turn the power pack off and disassemble electrode module.
Wash the membrane twice in 20 mL of distilled water.
3.4 Detection 1. Ensure membrane is wet. A dried out PVDF membrane

Using Western requires immersion in ethanol for 1 min, followed by two
Breeze® (See Note 16) 5 min washes in distilled water (see Note 17).
2. Incubate the membrane in 10 mL/60 cm2 membrane of block-
ing solution with shaking. The solution is prepared by mixing
2 mL of Blocker/Diluent A with 3 mL of Blocker/Diluent B
and 5 mL of distilled water. The incubation time can be varied
from 30 min to overnight.
3. Wash the membrane twice with 20 mL of distilled water for
5 min.
4. Incubate the membrane in primary antibody solution for at
least 1 h with shaking. The solution is prepared by mixing
2 mL of Blocker/Diluent A with 1 mL of Blocker/Diluent B
and 7 mL of distilled water. The primary antibody is diluted
initially at 1:1,000 or as recommended by the supplier
(see Note 18).
5. Wash the membrane for 5 min against 20 mL of 1× antibody
wash solution. The solution is supplied as a 16× concentrate.
Repeat three times.
6. Incubate the membrane with 10 mL secondary antibody solu-
tion for at least 30 min. The secondary antibody solution
contains an anti-rabbit AP-conjugated IgG (see Note 19).
7. Repeat step 5.
8. Rinse the membrane for 2 min with 20 mL of distilled water.
Repeat twice.
9. Place membrane on a transparency plastic sheet or Glad-wrap
(see Note 20).
Fig. 2 X-ray radiograph of specific proteins by The Western Breeze® Kit

(Chemiluminescent Western Blot Immunodetection kit). Proteins were first
resolved by polyacrylamide gel electrophoresis
10. Overlay 1–2.5 mL of Chemiluminescent Substrate Solution

onto the membrane and incubate for at least 5 min.
11. Wrap membrane and expose to X-ray film.
12. Develop film after exposure times between a few seconds and
30 min (see Note 21, Fig. 2).
4 Notes
1. A cold spatula prevents tissue from sticking to it. This is easily

achieved by dipping the spatula in liquid nitrogen for about 10 s.
2. For best results, a sample-to-solvent ratio of 1:10 is required.
3. If RNA and DNA are not required, a shortcut may be used
where frozen homogenate is directly extracted into sample
loading buffer.
4. If the phases do not separate, add another 0.2 volumes of
CHCl3 and repeat.
5. The supernatant is ca. 0.8 volumes of the volume of Trizol
used for homogenization. Proteins are precipitated with 1.5
volumes of isopropanol. This may exceed the volume of one
Eppendorf tube.
6. The following protocol describes SDS-PAGE using Bio-Rad
Mini-PROTEAN® Tetra cell equipment (catalogue numbers
165-8000 and 165-8001, Bulletin number 10007296) and
Mini-PROTEAN® precast gels (Bulletin number 1658100).
Instruction manuals can be readily obtained through www.biorad.
com or by contacting local company representatives/agencies.
Prospective users should thoroughly familiarize themselves with
the equipment and instructions before attempting to do experi-
mental work.
7. Electrophoresis will not work, if the tape is not removed.
8. If the gels do not fit snugly, current leakage will occur and
electrophoresis will not work.
9. Check red goes with red and black with blacks

10. Insert the supplied tool into the breaking spots marked on the
gel cassette. The short plate will come off but the gel may stick
to it. Therefore, care must be taken.
11. The protocol described here is for intended for use with the
Bio-Rad Mini Trans-Blot Electrophoretic Transfer Cell
(Catalogue number 170-3930). The instruction manual
M1703930 must be consulted prior to use of the equipment.
The transfer buffer is the same as for electrophoresis but should
be cooled.
12. PVDF membranes require pre-wetting with either methanol
or ethanol for ca. 1 min. Failure to pre-wet will result in poor
transfer of proteins.
13. The gel can be transferred onto filter paper for additional sup-
port. This is particularly useful for low-percentage gels.
14. If bubbles are present, these will prevent transfer of protein.
Remove them by rolling a 10 mL test tube or Pasteur pipette
over the membrane.
15. If a heater/stirrer plate is used, make sure the heater is turned
off and the plate is cool before putting the tank on it.
16. In the following, a detection protocol is described using the
Western Breeze® Chemiluminescent Western Blot
Immunodetection kit (Invitrogen, catalogue numbers WB7104,
WB7106, and WB7106). This kit is easy to use as all solutions are
supplied in concentrated form and sensitivity is greatly improved
compared to the similar chromogenic immunodetection system
based on BCIP/NBT by the same name. The composition of the
individual components is proprietary, but reference is made to
the blocking component being casein. This suggests that the kit
is not suitable for analysis of phospho-proteins with phospho-
specific antibodies.
17. This step is not necessary, if the membrane is used immediately
after blotting.
18. Optimization can be done using dot blots, if required.
19. The choice of secondary antibody must be made when order-
ing the kit.
20. Glad-wrap (Saran wrap in the USA) can be used but static
charge needs to be removed by spraying it with 70 % ethanol
and drying.
21. An initial exposure time of 1–3 min is recommended. This can
be shortened or expanded as required.
References
1. Burnette WN (1981) “Western Blotting”: proteins from sodium docecyl sulphate-

Electrophoretic Transfer of Proteins from polyacrylamide gels to nitrocellulose. Anal
Sodium Dodecyl Sulphate-Polyacrylamide Gels Biochem 150:403–407
to Unmodified Nitrocellulose and Radiographic 5. Gershoni JM, Palade GE (1983) Protein blot-
Detection with Antibody and Radioiodinated ting: Principles and applications. Anal Biochem
Protein A. Anal Biochem 112:195–203 131:1–15
2. Chomczynski P (1993) A Reagent for Single-Step 6. Perides G, Plagens U, Traub P (1986)
Simultaneous Isolation of RNA, DNA and Protein transfer from fixed, stained and
Proteins from Cell and Tissue Samples. dried polyacrylamide gels and immunoblot
Biotechniques 15:532–537 with Protein A- gold. Anal Biochem
3. Laemmli UK (1970) Cleavage of structural pro- 152:94–99
teins during assembly of the head of bacterio- 7. Lantz MS, Ciborowski P (1994) Zymographic
phage T4. Nature 227:680–685 techniques for detection and characterization of
4. Szewcyzyk B, Kozloff LM (1985) A method for microbial proteases. Methods Enzymol
the efficient of blotting of strongly basic 235:563–594
Chapter 17
Genetic Transformation of Wheat via Particle

Bombardment
Caroline A. Sparks and Huw D. Jones
Abstract
Since its first invention in the late 1980s the particle gun has evolved from a basic gunpowder driven
machine firing tungsten particles to one more refined which uses helium gas as the propellant to launch
alternative heavy metal particles such as gold and silver. The simple principle is that DNA-coated micro-
scopic particles (microcarriers) are accelerated at high speed by helium gas within a vacuum and travel
at such a velocity as to penetrate target cells. However, the process itself involves a range of parameters
which are open to variation: microparticle type and size, gun settings (rupture pressure, target distance,
vacuum drawn, etc.), preparation of components (e.g., gold coating), and preparation of plant tissues.
Here is presented a method optimized for transformation of wheat immature embryos using the Bio-
Rad PDS-1000/He particle gun to deliver gold particles coated with a gene of interest and the select-
able marker gene bar at 650 psi rupture pressure. Following bombardment, various tissue culture phases
are used to encourage embryogenic callus formation and regeneration of plantlets and subsequent selec-
tion using glufosinate ammonium causes suppression of non-transformed tissues, thus assisting the
detection of transformed plants. This protocol has been used successfully to generate transgenic plants
for a wide range of wheat varieties, both spring and winter bread wheats (T. aestivum L.) and durum
wheats (T. turgidum L.).
Key words Wheat, Particle gun, Biolistics, Transformation, Immature embryo, Transgenic plants
1 Introduction
The ability to alter the genome of a plant in a precise and

predictable manner is a powerful research tool for functional
genomics and is fast becoming a key element in the process of
commercial varietal improvement. A key component of the
genetic modification of crop plants is a robust transformation
protocol. Wheat was among the last of the major crops to be
transformed with the first fertile transgenic plants being reported
using particle bombardment nearly 20 years ago and
Agrobacterium transformations becoming routine a few years
later [1–6]. However, there remains considerable debate about
the respective advantages and disadvantages of these alternative
201
202 Caroline A. Sparks and Huw D. Jones
DNA-delivery methods. There are numerous reports that claim

transformation using Agrobacterium tumefaciens tends to give
events with single or low transgene copy number with simple
insertion patterns. However, it is also well accepted that unwanted
“plasmid backbone” (i.e., non T-DNA) sequences are also often
integrated into the host genome. In addition, there is a report of
Agrobacterium chromosomal DNA also being inserted along
with the intended T-DNA [7]. In contrast, it is reported that
transformation via biolistics results in multi-copy events with
more complex insertion patterns. However, this conclusion has
been disputed [8] and can be reduced by using shorter linearized
fragments of DNA rather than circular plasmids [9] which simul-
taneously removes the possibility of plasmid backbone being
incorporated into the insertion [10]. These issues become par-
ticularly important when the events in question are intended for
commercialization and in this case, regardless of the method of
transformation, it is common to generate several tens of indepen-
dent events and screen these for simple, single copy insertions
that do not interrupt a native gene or generate other unintended
effects. For wheat, regardless of the method of transformation,
the procedure can be conveniently divided into two parts: those
steps that ensure effective DNA transfer and integration into the
plant nuclear genome and those that allow the regeneration and
selection of viable adult plants from the transformed cells. We
present here two linked chapters. This chapter provides a detailed
protocol for the transformation of wheat using the Bio-Rad PDS-
1000/He particle bombardment device to deliver DNA-coated
gold powder to freshly isolated immature embryos. The induc-
tion of embryogenic callus, the regeneration and selection steps
are described to produce young, fertile wheat plants in 12–16
weeks. Seeds that have inherited the introduced DNA from the
primary transgenic plants can be collected after a further 4–5
months. The adjoining linked chapter describes a protocol for
Agrobacterium transformation.
2 Materials
2.1 Donor Plants and 1. Wheat seeds (Triticum aestivum L.) var. Cadenza (see Note 1)
Surface Sterilization are sown on a fortnightly basis to provide a regular supply of
of Immature Seeds good quality donor material which is essential for reliable trans-
formation efficiencies. Plants are grown 5 per 21 cm pot
[Nursery Trades (Lea Valley) Ltd., UK] in Rothamsted
Prescription mix soil (see Note 2) in controlled environment
rooms with 18°C day/15°C night temperatures and a 16 h
photoperiod provided by banks of 400 W hydrargyrum quartz
iodide (HQI) lamps (Osram Ltd., UK) generating a light
intensity of ~700 μmol/m2/s photosynthetically active radia-
tion (PAR) at the pot surface. Relative humidity is maintained
Wheat Transformation by Particle Bombardment 203
at 50–70 %. Pests and disease are kept to a minimum by good

housekeeping practices but Amblyseius caliginosus [Nursery
Trades (Lea Valley) Ltd., UK] is used routinely to control thrips
and the fungicide Talius (DuPont (U.K.) Ltd, UK) is sprayed
as a mildew preventative when plants are approximately 4 weeks
old. Pots are initially top watered by hand then watered via a
flood-bench automated watering system. Plants are stripped to
leave the 5 strongest tillers when the plants are 5–6 weeks old.
2. Sterilizing agents: 70 % (v/v) aqueous ethanol, 10 % (v/v)
aqueous bleach (see Note 3) and sterile, distilled water.
2.2 Media All chemicals are from Sigma-Aldrich unless otherwise stated and
tissue culture tested or analytical grade chemicals are used. For all
stock solutions and media use polished water with a purity of
18.2 MΩ/cm. Sterilization is carried out by autoclaving at 121 °C
for 15 min or filter sterilization using a 0.22 μm syringe filter
(Sartorius Stedim UK Ltd., UK) or, for larger volumes, MediaKap
filters (Medicell International Ltd., UK). Stock solutions are stored
at 4 °C for 1–2 months or frozen at −20 °C for up to a year provided
no freezing–thawing has occurred (see Note 4).
The following stock solutions of the basal salt mixtures, amino
acids, and vitamins are required to make the stock plant culture
media (see Subheading 2.2, items 7–8).
1. MS macrosalts (×10): 16.5 g/L NH4NO3, 19.0 g/L KNO3,
3.7 g/L MgSO4 ⋅ 7H2O, 1.7 g/L KH2PO4, 4.4 g/L CaCl2 ⋅
2H2O (see Note 5). Sterilize by autoclaving and store at 4 °C.
2. L7 macrosalts (×10): 2.5 g/L NH4NO3, 15.0 g/L KNO3,
3.5 g/L MgSO4⋅7H2O, 2.0 g/L KH2PO4, 4.5 g/L
CaCl2⋅2H2O (see Note 5). Sterilize by autoclaving and store at
4 °C.
3. L microsalts (×1,000): 17.05 g/L MnSO4⋅H2O (see Note 6),
7.5 g/L ZnSO4⋅7H2O, 5.0 g/L H3BO3, 0.75 g/L KI,
0.25 g/L Na2MoO4⋅2H2O, 0.025 g/L CuSO4⋅5H2O,
0.025 g/L CoCl2⋅6H2O. Sterilize by autoclaving and store at
4 °C.
4. 3AA amino acids (×25): 18.75 g/L L-glutamine (see Note 7),
3.75 g/L L-proline, 2.5 g/L L-asparagine. Store at −20 °C in
40 mL aliquots.
5. MS vitamins (– glycine) (×1,000): 500 mg/L pyridoxine HCl,
500 mg/L nicotinic acid, 100 mg/L thiamine HCl. Prepare
100 mL volume, filter-sterilize, and store at 4 °C.
6. L vitamins/inositol (×200): 40.0 g/L myo-inositol, 2.0 g/L
thiamine HCl, 0.2 g/L nicotinic acid, 0.2 g/L pyridoxine
HCl, 0.2 g/L pantothenic acid (hemi-calcium salt), 0.2 g/L
ascorbic acid. Prepare 100 mL volume, filter-sterilize, and

store at −20 °C in 40 mL aliquots.
The following plant culture stock media are prepared from
stock solutions (see Subheading 2.2, items 1–6) at 2× concen-
tration to allow mixing 1:1 with double strength Agargel for
preparation of final solidified media plates.
7. MSS 3AA/2 9%S (×2): 200 mL/L MS macrosalts, 2 mL/L L
microsalts, 2 mL/L MS vitamins (– glycine), 40 mL 3AA solu-
tion, 20 mL/L ferrous sulfate chelate solution (×100),
200 mg/L myo-inositol, 180 g/L sucrose. Adjust pH to 5.7
with 5 M NaOH or KOH, filter-sterilize, and store at 4 °C (see
Notes 8 and 9).
8. R (×2): 200 mL/L L7 macrosalts, 2 mL/L L microsalts,
10 mL/L L vitamins/inositol, 20 mL/L ferrous sulfate che-
late solution (×100), 60 g/L maltose. Adjust pH to 5.7 with
5 M NaOH or KOH, filter-sterilize, and store at 4 °C (see
Note 9).
9. Agargel (×2): 10 g/L in water. Prepare in 400 mL volumes
and sterilize by autoclaving. Store at room temperature and
melt in a microwave prior to use (see Note 10).
Supplements are prepared and aliquotted into appropriate
amounts for storage. These additions are introduced to media
just prior to pouring plates.
10. 2,4-Dichlorophenoxyacetic acid (2,4-D): Prepare at 1 mg/
mL, initially dissolving in ethanol then adding distilled water
to volume. Filter-sterilize and store at 4 °C.
11. Silver nitrate (AgNO3): Prepare at 20 mg/mL in distilled
water. Filter-sterilize and store at −20 °C in the dark (see
Note 11).
12. Copper sulfate (CuSO4 ⋅ 5H2O): Prepare at 25 mg/mL
(100 mM) in distilled water. Filter-sterilize and store at 4 °C.
13. Zeatin (mixed isomers): Prepare at 10 mg/mL, initially dis-
solving in 1 M HCl and adding distilled water to volume.
Filter-sterilize and store at −20 °C.
14. Glufosinate ammonium (PPT) (Greyhound Chromatography
and Allied Chemicals, UK): Prepare at 10 mg/mL in distilled
water. Filter-sterilize and store at −20 °C.
To prepare the final culture media for plates, stock media
(see Subheading 2.2 items 7–8) are mixed 1:1 with double
strength Agargel (see Subheading 2.2, item 9) for solidifica-
tion, adding supplements (see Subheading 2.2 items 10–14)
before pouring (see Note 12).
15. Induction medium: Mix an equal quantity of MSS 3AA/2 9%S
(×2) with melted Agargel (×2). Add 0.5 mg/L 2,4-D and
10 mg/L AgNO3 (see Note 11). Pour into 9 cm Petri dishes
(~28 mL/dish).
16. Regeneration medium: Mix an equal quantity of R (×2) with

melted Agargel (×2). Add 5 mg/L zeatin, 0.1 mg/L 2,4-D,
and 25 mg/L CuSO4 (see Note 13). Pour into 9 cm Petri
dishes (~28 mL/dish).
17. Selection medium (1): Mix an equal quantity of R (×2) with
melted Agargel (×2). Add 5 mg/L zeatin and 4 mg/L PPT.
Pour into 9 cm Petri dishes (~28 mL/dish).
melted Agargel (×2). Add 4 mg/L PPT. Pour into GA-7
Magenta vessels (Sigma-Aldrich) (~60 mL/vessel).
2.3 Materials for 1. Gold particles: 0.6 μm (submicron) gold powder (Bio-Rad
Particle Bombardment Laboratories, UK) (see Note 14).
2. Spermidine (free base): Prepare a 1 M solution by dissolving
1 g spermidine powder in 6.89 mL sterile distilled water.
Aliquot into 50 μl volumes and store immediately at −80 °C.
For the working stock, dilute an aliquot of 1 M spermidine
with sterile distilled water to give 0.1 M, aliquot into 25 μl
volumes and store immediately at −20 °C (see Note 15).
3. Calcium chloride (CaCl2⋅2H2O): Prepare at 2.5 M by dissolv-
ing 3.67 g in 10 mL distilled water. Filter-sterilize, aliquot into
55 μl volumes, and store at −20 °C.
4. Plasmid DNA: 1 mg/mL in sterile distilled water or sterile TE
buffer (pH 8.0) prepared using Qiagen Maxi-prep kit (Qiagen
Ltd, UK) or similar. Store in 20 μl aliquots at −20 °C (see
Notes 16–18).
5. Sterilizing agents: 100 % ethanol and 10 % (v/v) aqueous
Savlon® (Novartis Consumer Healthcare UK Ltd, UK).
6. 650 psi rupture discs (see Note 19), macrocarriers, macrocar-
rier holders, stopping screens (all Bio-Rad Laboratories, UK).
3 Methods
The following method has been optimized for transformation of

immature embryos which are the most responsive of the limited
range of explants with regeneration potential in wheat (see Note 20).
3.1 Collection and Wheat ears are collected from plants in controlled environment
Surface Sterilization donor rooms (see Subheading 2.1) at 12–16 days post anthesis
of Immature Seeds (see Note 21). Separate the immature seeds from the surrounding
panicles (see Note 22, Fig. 1a) and surface-sterilize by rinsing in
70 % (v/v) aqueous ethanol for 3–5 min, followed by 10 min in
10 % (v/v) aqueous bleach with occasional gentle shaking. Rinse
liberally with sterile distilled water several times then drain to leave
the surface-sterilized seeds moist but not immersed in water
(see Note 23).
Fig. 1 Isolation of immature embryos for bombardment. (a) Immature seeds are separated from the panicles
of the two outer spikelets. (b) An isolated wheat immature embryo. (c) The embryo axis is removed and the
embryos plated scutellum-side uppermost in the central target area of a Petri dish of Induction medium ready
for bombardment. Scale bar = 1 mm approximately
3.2 Isolation Isolate the immature embryo from the seed, removing the embryo
of Immature Embryos axis to prevent precocious germination (see Note 24). The embryos
should be 0.5–1.5 mm in length and translucent in appearance
(see Note 25, Fig. 1b). Once the axis has been removed, place it
scutellum-side uppermost onto Induction medium in a 9 cm Petri
dish plating 30 embryos per plate in the central 2 cm diameter target
area (see Note 26, Fig. 1c). Incubate at 22–23 °C in the dark for 1–2
days’ pre-culture prior to bombardment (see Note 27).
3.3 Preparation Gold powder is initially washed, resuspended fully in water, and
of Gold Particles aliquotted into small volumes for storage. Individual aliquots are
then coated with DNA just prior to bombardment.
Prepare gold particle stocks as follows. see below:
1. Weigh 20 mg 0.6 μm gold particles (see Note 28) into a sterile
Eppendorf tube. Add 1 mL 100 % ethanol and sonicate for
2 min. Centrifuge in a microfuge at top speed for 3 s and
remove the supernatant. Repeat the ethanol wash twice more.
2. After removing the final ethanol supernatant, add 1 mL sterile
distilled water, sonicate for 2 min and centrifuge in a microfuge
at top speed for 3 s. Remove the supernatant and repeat the
sterile distilled water wash once more.
3. Resuspend the gold particles in 1 mL sterile distilled water by
vortexing. Aliquot 50 μl amounts into sterile 1.5 mL Eppendorf
tubes, vortexing between taking each aliquot to ensure an
equal distribution of particles. Store at −20 °C.
The following steps for coating of gold particles with plasmid
DNA should be carried out on ice in a sterile environment
immediately prior to bombardment:
4. Defrost a 50 μl aliquot of prepared gold particles
(see Subheading 3.3, steps 1–3, Note 29). Sonicate for 1 min
to resuspend the particles fully (see Note 30).
5. Add up to 5 μl plasmid DNA (1 mg/mL) (see Notes 17, 18,

31 and 32). Vortex for a few seconds to fully mix the DNA
with the particles.
6. In the cap of the Eppendorf tube, mix 50 μl 2.5 M Calcium
chloride and 20 μl 0.1 M spermidine. Close the lid carefully to
avoid displacing the mixture then tap the tube down and imme-
diately vortex to mix all the components together (see Note 33).
7. Centrifuge in a microfuge at full speed for 3–5 s. Remove the
supernatant promptly and discard.
8. Resuspend the gold pellet gradually in 150 μl 100 % ethanol,
scraping the sides of the tube with the pipette tip and working
the pellet back into solution (see Note 34). Vortex briefly then
centrifuge in a microfuge at top speed for 3–5 s to pellet the
gold. Remove the supernatant promptly.
9. Resuspend in a final volume of 85 μl 100 % ethanol (see Note 35).
If bombardment is not to be carried out immediately, seal the
tube with Parafilm® (Fisher Scientific, UK) to prevent evapora-
tion of ethanol and store the particles on ice (see Note 36).
3.4 Operation The method describes DNA delivery using the Bio-Rad PDS-
of PDS-1000/He 1000/He particle gun according to manufacturer’s instructions.
Particle gun This is a high pressure device using compressed helium gas which
accelerates particles to high velocity: appropriate safety precautions
should be taken when operating this equipment.
Carry out the following steps to prepare the particle gun
components:
1. The following settings are used as standard for this procedure
(see Note 37): 2.5 cm gap (distance between rupture disc and
macrocarrier), 5.5 cm target distance (distance between stop-
ping screen and target plate), 0.8 cm stopping plate aperture
(distance between macrocarrier and stopping screen), 28–29″
Hg vacuum, 5.0 vacuum flow rate, 4.5 vacuum vent rate.
2. Prior to operation of the gun, surface sterilize all equipment
and component parts using 90 % (v/v) aqueous ethanol. Spray
out the gun chamber, microcarrier launch assembly, rupture
disc retaining cap, target shelf, and red plastic seating tool and
allow the ethanol to evaporate completely.
3. Dip the macrocarriers, macrocarrier holders, stopping screens,
and rupture discs in 100 % ethanol and place on a mesh rack to
allow the ethanol to evaporate completely (see Note 38). Once
dried, place the macrocarrier holders in sterile Petri dishes and
mount a macrocarrier into each one using the seating tool to
fix it under the rim (see Note 39).
4. Briefly vortex the DNA-coated gold particles (see Subheading
3.3, steps 4–9), take a 5 μl aliquot and drop centrally onto a
Fig. 2 PDS/1000-He particle gun component parts. (a) Inverting the macrocarrier holder containing a macro-
carrier with DNA-coated gold particles over a stopping screen within the fixed nest of the microcarrier launch
assembly. (b) Indented mesh pattern on a macrocarrier left by the stopping screen after a successful shot.
(c) Burst rupture disc being removed from the rupture disc retaining cap following a shot
macrocarrier in its holder (see Note 40). Leave on a non-vibrating

surface and allow the ethanol to evaporate slowly until a fine
film of dried gold remains (see Note 41). Use the prepared mac-
rocarriers as soon as possible after drying (see Note 42).
5. Open the valve on the helium cylinder and turn the regulator
adjusting screw to give ~200 psi higher delivery pressure than
the rupture disc to be used (see Note 43).
Carry out the following steps for the assembly of particle
gun components.
6. Load a rupture disc into the rupture disc retaining cap making
sure that the disc is seated securely in the recess at the base.
Screw the retaining cap onto the gas acceleration tube and
tighten firmly using the mini torque wrench (see Note 44,
Fig. 3).
7. Place a stopping screen into the fixed nest onto the stopping
screen support (see Note 45). Invert a macrocarrier holder
with macrocarrier loaded with DNA-coated gold and place
above the stopping screen on the top rim of the fixed nest; the
macrocarrier should be positioned such that the gold particles
are facing down towards the stopping screen (see Fig. 2a). Keep
the macrocarrier holder in place using the retaining ring.
Mount the whole microcarrier launch assembly into the gun
chamber using the second shelf from the top for a gap of
2.5 cm (see Subheading 3.4, step 1, Fig. 3).
8. Place a Petri dish containing a sample on the target shelf and
remove the lid. Mount the target shelf on the fourth shelf from
the top to give a target distance of 5.5 cm (see Subheading 3.4,
step 1, Fig. 3). Close the chamber door.
Carry out the following steps to fire the particle gun.
9. Draw a vacuum of 28–29″ Hg in the gun chamber (see Note 46).
Once reached, switch the vacuum control switch to the “Hold”
position (see Note 47).
Fig. 3 Interior of the PDS/1000-He particle gun chamber showing assembled

component parts prior to a shot
10. Press and hold the Fire switch which allows helium to enter the
gas acceleration tube. Observe the helium pressure gauge and
note at what pressure the rupture disc bursts; it should burst
within 10 % of the rupture pressure specified, i.e., 650 psi
(see Note 48).
11. Release the Fire switch immediately after the shot and set the
vacuum control switch to “Vent” (middle position) to release
the vacuum from the chamber (see Note 49).
Carry out the following steps to disassemble the particle
gun components:
12. Remove the sample, replace the lid, and set aside.
13. Remove the microcarrier launch assembly. Unscrew the retain-
ing ring, remove the macrocarrier holder, and place into 100 %
ethanol to re-sterilize. Remove the macrocarrier which has
been released from the holder and discard (see Note 50,
Fig. 2b). Remove the stopping screen and place in 100 % etha-
nol to re-sterilize.
14. Using the mini torque wrench, loosen the rupture disc retain-
ing cap then unscrew fully by hand. Remove the burst rupture
disc and discard (see Note 51, Fig. 2c).
15. Repeat the assembly/disassembly process for further shots
(see Subheading 3.4, steps 6–15) including one or more con-
trol shots with gold not coated with DNA (see Subheading 3.3
steps 4–9, Notes 32 and 52).
Carry out the following steps to complete the bombardment:
16. Once all experimental plates have been bombarded, close the
main valve on the helium cylinder and release the regulator
adjusting screw. Draw a vacuum in the chamber of ~10″ Hg

such that the Fire switch illuminates. Press and release the Fire
switch several times until the pressure is drained from the regu-
lator as shown by reducing pressure on the regulator gauge.
Turn off the vacuum pump and gun.
17. Drain 100 % ethanol from the macrocarrier holders and stop-
ping screens, rinse in water, and immerse in 10 % (v/v) aque-
ous Savlon®. Sonicate for 5–10 min to shear any remaining
DNA and so prevent any carry over to subsequent
experiments.
18. Spray out the gun chamber with 90 % ethanol and clean all
components, paying particular attention to wiping round the
rupture disc retaining cap and gas acceleration tube connec-
tions to remove any residual plastic left from the rupture discs.
3.5 Tissue Culture Once bombarded, the embryos need to pass through various tissue
and Selection culture phases to induce embryogenic callus from which plantlets
of Immature can be regenerated. In order to preferentially select transformed
Embryos Following tissues, the appropriate herbicide or antibiotic for the selectable
Bombardment marker gene is included in the media during the later stages and
only plantlets surviving selection are potted to soil for analysis.
Steps for the induction of embryogenic callus:
1. Following bombardment, spread the embryos more evenly
across the medium dividing between three plates of Induction
medium, i.e., 10 per plate (see Note 53).
2. Incubate in the dark at 22–23 °C for 3–4 weeks
(see Notes 54–56).
Steps for the regeneration of plantlets.
3. After 3–4 weeks of dark culture the embryos should have
formed embryogenic calli. Transfer responsive calli to
Regeneration medium to initiate regeneration from the somatic
embryos. Calli should be transferred whole and not broken up
at this stage.
4. Incubate the cultures again at 22–23 °C but now in the light
for 3–4 weeks (see Notes 54 and 55, Fig. 4b).
Steps for the Selection of transformants.
5. First selection: Once good shoots are developing from the
calli, transfer them to Selection medium (1) (see Notes 57–
59). If the regenerating calli are large they should be distrib-
uted between a number of dishes to prevent subsequent
over-crowding. Calli should still be maintained as one piece at
this stage unless they fall apart naturally in which case sections
from the same initial callus should be kept together in order to
track possible clonal material (see Note 60). Incubate for 3–4
weeks at 22–23 °C in the light (see Notes 54 and 55).
Fig. 4 Growth and development of transformed wheat plants. (a) Transient expression of the DsRed reporter
gene driven by the maize Ubiquitin promoter + intron [11] in an immature embryo 4 days after bombardment.
(b) Embryogenic callus after 2 week’s culture on Regeneration medium in the light. (c) Plantlets surviving or
succumbing to selection on Selection medium (2) in a Magenta vessel. (d) Confirmed transgenic plants in GM
containment glasshouse showing normal development and fertility. Scale bar = 1 mm approximately
6. Second selection: After 3–4 weeks the effect of selection on the

cultures should be apparent; some bleaching of leaves will have
occurred and roots may be stunted (see Note 59). Any plant-
lets which remain green with reasonable root structures should
be transferred to Selection medium (2) in MagentaTM vessels
for expansion of leaves and roots, placing four to six plantlets
per MagentaTM (see Note 61). At this stage it should be possi-
ble to divide calli, separating out individual plantlets, but these
should be labelled as possible clones (see Note 60). Incubate
for a further 3–4 weeks at 22–23 °C in the light.
Steps for transferring putative transgenic plants to soil and
analysis.
7. Following the second round of selection, transformed plantlets
should be fairly obvious in the MagentaTM vessels as those
which are green and strong with developed root systems (see
Fig. 4c). Remove the plantlets from the MagentaTM vessel,
rinsing the roots with water to remove Agargel if necessary,
and pot into 8 cm square pots containing moistened
Rothamsted prescription mix soil (see Notes 2 and 61).
8. Place the pots in a propagator for 1–2 weeks to create a humid
environment for the plantlets to become established (see Note
62) and grow in a suitable GM containment glasshouse
(see Note 63).
9. After 2–3 weeks plants should be sufficiently strong to take a
leaf sample for genomic DNA extraction and analysis by PCR.
10. Re-pot confirmed positive transgenic plants to soil in 13 cm
diameter pots (see Note 2) and grow to maturity in a GM con-
tainment glasshouse (see Note 63). Transformed plants usually
have no morphological differences to control plants apart from
the occasional effects of somaclonal variation from tissue
culture: they are generally normal, fertile plants with good
seed set (see Fig. 4d).
4 Notes
1. Although this protocol is typically used for the bread wheat

variety Cadenza it can be applied to other wheat varieties but
efficiencies may be affected. Over 30 different elite wheat gen-
otypes have been transformed at Rothamsted with some mea-
sure of success.
2. Rothamsted prescription mix soil contains: 75 % fine grade
peat, 12 % screened sterilized loam, 10 % 6 mm screened lime-
free grit, 3 % medium vermiculite, 2 kg Osmocote Plus/m3
(slow-release fertilizer, 15 N/11 P/13 K plus micronutrients),
0.5 kg PG mix/m3 (14 N/16 P/18 K granular fertilizer plus
micronutrients) from Petersfield Products, UK.
3. Ordinary commercial thin bleach can be used which generally
has a sodium hypochlorite content of 4–6 %.
4. Some salts may come out of solution in cold storage so check
the solutions and shake before use to resuspend fully if
necessary.
5. CaCl2 ⋅ 2H2O should be dissolved in water prior to addition to
the other components.
6. MnSO4⋅H2O is the most commonly available form of this salt
but if a different hydrated state is used, the amount to add
must be calculated to reflect this.
7. L-glutamine can be difficult to dissolve. If this is the case, dis-
solve separately at pH 9.0 prior to mixing with the other
components.
8. Although this transformation protocol describes methods
most suitable for bread wheat, durum wheat (Triticum turgi-
dum L.) can also be transformed using this system but with the
notable variation that sucrose is adjusted to 4.5 % in the MSS
3AA/2 9%S induction medium for embryogenic callus
formation.
9. The osmolarity of stock media should be within the ranges:
MSS 3AA/2 9%S (×2) 800–1,100 mOsM and R (×2)
270–300 mOsM.
10. When preparing Agargel it should be shaken before and after
autoclaving to ensure even setting which makes subsequent re-
melting in a microwave easier. Following microwaving, always
cool the gelling agent to approximately 50 °C prior to combin-
ing with the media solutions.
11. Silver nitrate acts as stress inducing agent in the initial induction
phase to promote embryogenesis. It is light sensitive so stocks
and any media containing it should be stored in the dark.
12. Ideally plates should be poured and used as fresh as possible
yet should be allowed to incubate for a few days at room tem-
perature to check for contamination. If stored at 4 °C they can

be kept for 2–3 weeks.
13. Copper sulfate acts as a stress-inducing agent in the regenera-
tion phase to promote shooting and can be used in the range
12.5–25 mg/L (50–100 μM). If regeneration is good,
12.5 mg/L may be sufficient as the cultures can become too
leafy at 25 mg/L.
14. Although tungsten powder was commonly used with original
biolistics equipment, the inert metal gold is now the preferred
microcarrier. Different particle sizes are available but small,
uniform submicron gold particles (average 0.6 μm diameter)
have been found to be best for the small cell size of wheat.
15. Spermidine solutions are hygroscopic, oxidizable, and deami-
nate with time and consequently should be maintained below
−20 °C (preferably at −80 °C) and fresh stocks made regularly.
Once thawed any unused aliquots should be discarded.
16. The plasmid can carry one or more gene cassettes. Although
pUC-based vectors are commonly used, binary vectors used
for Agrobacterium-mediated transformation can also be intro-
duced successfully using particle bombardment. Another alter-
native is to bombard the gene cassette(s) as an isolated DNA
fragment and so remove the plasmid backbone which generally
carries an antibiotic resistance gene for selection in E. coli,
often regarded as undesirable.
17. A selectable marker gene must also be incorporated either on
the same plasmid as the gene(s) of interest or as a separate plas-
mid which is co-precipitated onto the gold. The selectable
marker gene allows selection of transformed tissues, examples
being the bar gene (as described in this chapter) which confers
resistance to glufosinate ammonium-based broad spectrum
herbicides such as Basta®, Challenge®, Liberty®, Harvest®, etc.,
or nptII which confers resistance to the antibiotics geneticin
disulfate (G418), kanamycin, neomycin etc.
18. A reporter gene can also be included, e.g., UidA, GFP, or
DsRed to monitor transient and/or stable transformation. As
is the case for the selectable marker gene, this can either be on
the same plasmid as the gene of interest or on a different plas-
mid which is co-bombarded.
19. Rupture discs are available from Bio-Rad Laboratories as 450,
650, 900, 1,100, 1,350, 1,550, 1,800, 2,000, and 2,200 psi.
A range of rupture pressures should be assessed when optimiz-
ing any system; for wheat 650 psi generally gives the best, most
consistent results but 450 or 900 psi could also be used.
20. Immature inflorescences are an alternative target tissue which
are also responsive in tissue culture and can therefore be trans-
formed. However modifications may need to be made to the
media for best results and efficiencies are generally lower.
21. Immature seeds are at about the right stage when they have a
whitish bloom on the seed surface and the endosperm is just
solidified but not too hard. A few spikelets can be opened at
the time of ear collection to determine whether the seeds are at
the correct stage.
22. Generally only the outer caryopses of each spikelet are used
and none are taken from the tip or base of the ear due to asyn-
chronous seed development.
23. Ideally surface-sterilized seeds should be used the same day.
If material needs to be collected in advance it is better to store
whole ears at 4 °C with the stems in water prior to removing
the seeds; however, it is not recommended to store these lon-
ger than overnight.
24. The immature scutellum is the callus-forming tissue; if the
embryo axis is left intact it will be prone to germinate on the
culture medium thereby preventing callus formation. A prac-
tised hand can cut off the embryo axis through the seed coat,
leaving a hole through which the scutellum can be removed.
25. Embryos in the size range 0.5–1.5 mm are ideal for transfor-
mation via particle bombardment which is slightly smaller than
the size advised for Agrobacterium-mediated transformation.
Larger embryos may respond if they are still translucent. The
size of the embryos is not quite as critical if being used to
monitor transient transformation only.
26. Using the gun parameters described, the gold particles typi-
cally target a central circular area of ~2 cm diameter, and there-
fore to maximize transformation the isolated scutella are
located in this region.
27. Embryos are incubated prior to bombardment to allow them
to recover from the isolation procedure and also because pre-
plasmolysis of cells on the high sucrose medium may increase
their ability to withstand bombardment. Experiments to assess
the effect of pre-culture have shown that the optimum time for
incubation is 1–2 days; transformation is possible after longer
periods of pre-incubation (e.g., 4 days) but efficiencies will be
reduced.
28. Gold can be prepared at a final concentration of 40 mg/mL if
desired (as recommended in the PDS-1000/He manual) but
20 mg/mL has been found to be just as effective for DNA
delivery. If prepared at 40 mg/mL, it could give the choice of
being used at this concentration or each aliquot diluted by half
with sterile distilled water prior to gold coating.
29. 50 μl starting volume of gold will be sufficient for approxi-
mately 10–12 shots. The volume of gold and other compo-
nents can be scaled up or down according to the number of
shots required.
30. Sonication should resuspend the gold and disrupt any clumps
but it should not be sonicated for too long as this may lead to
particle agglomeration.
31. The amount of plasmid DNA added should not exceed 5 μg
per 50 μl gold as excess DNA can cause clumping of particles.
If co-precipitating plasmids, calculate equimolar amounts and
use a total of 5 μg DNA. Commonly for co-bombardment of a
plasmid of interest and a selectable marker plasmid, a 1.5:1
ratio is used to skew for the gene of interest; plants which sur-
vive selection will then have a higher probability of having the
gene of interest if containing the marker gene.
32. A gold preparation without DNA should also be prepared at
the same time to act as a control.
33. The process of precipitation of DNA onto the gold is very rapid.
The calcium chloride and spermidine help to stabilize, precipi-
tate, and bind the DNA to the gold but are mixed first to ensure
an even coating, otherwise clumping of particles may occur.
34. The DNA-coated gold suspension needs to be as smooth as
possible so it is essential that the particles are resuspended fully
at this stage without clumps. Scraping with the pipette tip and
repeatedly drawing up and expelling the solution is more effec-
tive than vortexing. If the gold appears to be very clumped it is
preferable to discard the preparation and start again, checking
carefully the amount and concentration of DNA added.
35. The solution should not be aspirated too much during this
resuspension step as the ethanol will evaporate and increase the
final concentration of particles and may also lead to insufficient
volume for the shots required.
36. Ideally the coated particles should be prepared and used as
soon as possible but if a number of different treatments are
prepared, seal and store the tubes on ice prior to loading onto
the macrocarriers.
37. These settings have been optimized for bombardment of wheat
immature embryos. Adjustments may need to be made for
alternative species or explants.
38. Rupture discs are composed of laminate layers of plastic which
may separate if soaked in ethanol for extended periods; as a con-
sequence they should only be dipped briefly in ethanol to
sterilize.
39. The macrocarrier must fit completely under the rim of the
holder as any gaps will allow the escape of helium. If not
secured correctly, the macrocarrier will not be released from
the holder and hit the stopping screen with the required pres-
sure to release the gold particles with expected velocity.
40. In order to ensure that the particles are fully resuspended and
equal amounts are placed on each macrocarrier it is important
to vortex the gold preparation between taking each sample.
41. Vibration may cause gold particles to clump so the macrocarri-
ers within their Petri dishes should be placed outside of the
flow hood on a non-vibrating surface. The macrocarriers can
be examined microscopically prior to use to monitor the spread
and quality of particles, discarding any on which the gold is
unsatisfactory.
42. Macrocarriers should be used quite soon after the ethanol has
evaporated so only prepare a few macrocarriers at a time.
43. The regulator must allow sufficient helium through the system
to build up and burst the rupture disc: setting the regulator to
~200 psi higher than the rupture disc to be used should be
suitable.
44. If the retaining cap is not firmly tightened the rupture disc may
become dislodged which means the gun may fail to fire or fires
at a lower than expected pressure.
45. If the stopping screen is omitted the released macrocarrier will
pass through the hole in the fixed nest straight onto the target
tissue, creating rather a mess and potentially contaminating the
plate.
46. By creating a vacuum in the chamber there is less air resistance
which allows the gold particles to maintain high speed follow-
ing release from the macrocarrier. 26–30″ Hg is the vacuum
range recommended for plants by the manufacturer; in this
protocol 28–29″ Hg is routinely drawn.
47. The “Fire” switch should illuminate once the vacuum reaches
~5″ Hg.
48. A metering valve is present on the solenoid valve assembly to
regulate the rate of fill of the gas acceleration tube. It should
take ~12–15 s to build to bursting pressure. When the rupture
disc bursts the macrocarrier is released from its holder onto the
stopping screen thus dispersing the particles onto the target
tissue. The actual pressure at which the rupture disc bursts
should be monitored to confirm a successful shot has occurred.
49. If the Fire switch is released too early no further helium will be
discharged and the rupture disc will not burst. To abort a shot
prior to the rupture disc bursting, release the Fire switch and
set the vacuum switch to Vent.
50. A good mesh indentation should be apparent on the
macrocarrier from its contact with the stopping screen if the
shot has worked correctly.
51. If the rupture disc is not in the retaining cap it may still be
attached to the gas acceleration tube inside the gun. The disc
must be removed otherwise it will interfere with further shots.
52. Control plates should be included in experiments to allow

monitoring of callus formation and regeneration following
bombardment. One or more plates of embryos should be
bombarded with gold but without DNA such that the embryos
have identical treatment but for the presence of DNA.
53. The embryos are spread across different media plates to reduce
competition for nutrients and allow for growth.
54. Cultures are incubated in a controlled environment room at
22–23 °C. Cool white fluorescent tubes generate lighting lev-
els of ~250 μmol/m2/s photosynthetically active radiation
(PAR) for a 12 h photoperiod. Where dark culture is required,
solid trays are covered with foil.
55. Each tissue culture phase can take 3–5 weeks; cultures should
be monitored and with experience it will be possible to deter-
mine when it is most appropriate to move to the next medium.
56. In order to aid optimization of transformation protocols a
reporter gene can be included to act as a visual marker of trans-
formation success (see Note 18). pAHC25 [11] is a conve-
nient plasmid to use having both the selectable marker cassette
(bar) but also a cassette containing the β-Glucuronidase gene
(UidA). Some embryos can be sacrificed several days post-
bombardment and assayed for transient gus activity [12] to
determine the effectiveness of the bombardment process.
Alternative reporter genes also exist which do not require a
destructive assay and therefore have the advantage that they
can be used to monitor viable tissues in culture over a longer
period, e.g., GFP or DsRed (see Fig. 4a and Acknowledgements)
57. Calli from control plates (no DNA) should be transferred to
Selection media without PPT but some calli should also be put
on Selection media including PPT to demonstrate the effec-
tiveness of the selection.
58. “High lid” Petri dishes can be used at this stage by using
upturned Petri dish bases as lids; this creates more space for
shoots to develop.
59. Glufosinate ammonium (PPT) is used for selection of plants
transformed with the bar gene. 4 mg/L PPT used in the
Selection media described should effectively terminate
growth of non-transformed tissues although this may not be
fully obvious until after the second round of selection.
The control plates and Magentas will give a good indication
of how well the selection is working. If too many non-trans-
formed escapes are identified, 6 mg/L PPT could be used
subsequently to provide more stringent selection pressure.
60. Any plantlets originating from the same callus piece should be
regarded as clonal until demonstrated otherwise.
61. A plant generated from a control plate bombarded with gold

but without DNA and subsequently grown on media without
plant selection should also be transferred and potted up to act
as a negative control which has been through the same experi-
mental conditions.
62. Plantlets derived from tissue culture have little or no waxy cuti-
cle so require a humid environment initially to protect them
from desiccation whilst the cuticle forms.
63. GM glasshouse conditions are maintained at 18–20 °C day
and 14–16 °C night temperatures with a 16-h photoperiod
provided by natural light supplemented with banks of SonT
400 W sodium lamps (Osram Ltd., UK) generating a light
intensity of 400–1,000 μmol/m2/s photosynthetically active
radiation (PAR).
Acknowledgements
Rothamsted Research receives strategic funding from the

Biotechnological and Biological Sciences Research Council
(BBSRC). Thanks go to Ann Blechl (USDA-ARS, USA) and Jorge
Dubcovsky (UC Davis, USA) for providing the DsRed reporter
gene construct for our wheat transformation studies.
References
1. Blechl AE, Jones HD (2009) Transgenic ciens chromosomal DNA into plants. Nat
Applications in Wheat Improvement. In: Biotech 26:1015–1017
Carver BF (ed) Wheat: Science and Trade. 8. Altpeter F, Baisakh N, Beachy R et al (2005)
Wiley-Blackwell, Iowa, pp 397–435 Particle bombardment and the genetic
2. Jones HD, Doherty A, Wu H (2005) Review enhancement of crops: myths and realities.
of Methodologies and a Protocol for the Mol Breeding 15:305–327
Agrobacterium-mediated transformation of 9. Fu X, Duc LT, Fontana S et al (2000) Linear
wheat. Plant Methods 1:5 transgene constructs lacking vector backbone
3. Jones HD (2005) Wheat transformation: sequences generate low-copy-number trans-
Current technology and applications to grain genic plants with simple integration patterns.
development and composition. J Cereal Sci Transgen Res 9:11–19
41:137–147 10. Gadaleta A, Giancaspro A, Blechl AE et al
4. Harwood WA (2012) Advances and remaining (2008) A transgenic durum wheat line that is
challenges in the transformation of barley and free of marker genes and expresses 1Dy10.
wheat. J Exp Bot 63:1791–1798 J Cereal Sci 48:439–445
5. Shrawat AK, Loerz H (2006) Agrobacterium- 11. Christensen AH, Quail PH (1996) Ubiquitin
mediated transformation of cereals: a promis- promoter-based vectors for high-level expres-
ing approach crossing barriers. Plant Biotech J sion of selectable and/or screenable marker
4:575–603 genes in monocotyledonous plants. Transgen
6. Vasil IK (2007) Molecular genetic improve- Res 5:213–218
ment of cereals: transgenic wheat (Triticum 12. Jefferson RA, Kavanagh TA, Bevan MW
aesitvum L.). Plant Cell Rep 26:1133–1154 (1987) Beta-glucuronidase (Gus) as a sensitive
7. Ulker B, Li Y, Rosso MG et al (2008) T-DNA– and versatile gene fusion marker in plants.
mediated transfer of Agrobacterium tumefa- J Cell Biochem 13:3901–3907
Chapter 18
Sorghum Genetic Transformation by Particle Bombardment

Guoquan Liu, Bradley C. Campbell, and Ian D. Godwin
Abstract
Particle bombardment transformation describes the acceleration of high-velocity microparticles coated
with exotic genes through the plant-protective cell walls, in order for the introduced genes to be integrated
into the host genome. This technique has proven to be an effective and versatile approach towards plant
genetic modification in preceding decades. Particle bombardment has been successfully applied to cereals
including rice, maize, wheat, barley, and sorghum. Historically, sorghum has been considered as one of the
most recalcitrant major crops with regard to successful genetic transformation; however, tremendous
progress has been made in recent years. Transformation efficiency by particle bombardment has now
improved from approximately 1 % to in excess of 20 % utilizing an optimized tissue culture and DNA
delivery system. The protocol described in this chapter routinely generates transformants at 10–25 % effi-
ciency within sorghum genotype Tx430. The process generally takes 11–16 weeks from initiation of imma-
ture embryos to planting of transformants. This protocol covers the operation of both the Bio-Rad
PDS-1000/He System and particle inflow gun. Three factors are crucial to an efficient particle bombard-
ment transformation system: (1) an efficient tissue culture system, (2) a highly efficient DNA delivery
system, and (3) an effective selection strategy.
Key words Particle bombardment, Immature embryo, Tissue culture, Sorghum, Genetic transforma-
tion, Biotechnology, Selective marker, Reporter gene, Promoter
1 Introduction
Sorghum is the fifth most important cereal crop in the world in

terms of total production (www.fao.org). It is used for human food
in semiarid areas especially in Africa and for livestock feed or bio-
fuel in developed countries such as Australia and the USA. As the
global population continues to increase and extreme weather
events reduce agricultural production, the food supply in the world
is under threat and confronted with challenges [1]. Therefore,
improving crop yield and combating climate change have become
increasingly important issues for scientists and politicians.
Biotechnology, especially genetic transformation, plays an
important role in improving cereal’s agronomic traits including grain
yield, grain quality, disease resistance, and drought resistance [1].
219
220 Guoquan Liu et al.
Particle bombardment and Agrobacterium-mediated transformation

are two widely utilized technologies to transfer target genes into
plant cells, which enable foreign genes to integrate into the host
nucleus and the subsequently transformed cells to develop into
plantlets through tissue culture and selection [2]. As a result,
new agronomic traits are able to be expressed in transformants by
genetic transformation.
In comparison to Agrobacterium-mediated transformation,
the advantage of particle bombardment is that it is useful for a
broader genotype range, whereas Agrobacterium-mediated trans-
formation is confined to only a few tolerant model lines [3, 4].
Additionally, particle bombardment transformation has no biologi-
cal constraints, which allows targeting of diverse tissues and pro-
vides a more convenient approach to study transient gene expression
and gene function [5–9]. The reported drawbacks of this technology
include the insertion of multiple copies of transgenes leading to
complex rearrangement and/or recombination which can cause
gene instability and silencing [10, 11].
However, recent studies have shown that such disadvantages
can be overcome [12–16]. Single-copy insertion events have been
enhanced up to 46 % by using 2.5 ng DNA per bombardment
[12]. Particle bombardment has resulted in stable gene expression
amongst transgenic progenies in rice, maize, wheat, barley, and
sorghum [13–17]. Co-transformation has been conducted to
selectively remove selective marker genes from transgenic proge-
nies if necessary [5, 16, 18–20].
The first successful transgenic sorghum plants were obtained
through particle bombardment in 1993 [21] and Agrobacterium-
mediated transformation in 2000 [22]. Significant progress has
been made in sorghum genetic transformation. Transformation
efficiency was improved to 8.3 % through the use of Agrobacterium
with immature embryos subjected to heat treatment at 43 °C
for 3 min [23]. Recently, sorghum transformation efficiency has
been enhanced to 20.7 % by particle bombardment utilizing an
optimized tissue culture and DNA delivery system [16]. This
chapter focuses on the efficient particle bombardment transforma-
tion of sorghum.
There are two popular gene guns available for particle bom-
bardment transformation. One is the Biolistic PDS 1000/He sys-
tem that is commercially made by the company Bio-Rad (www.
bio-rad.com), and the other one is a nonproprietary device known
as the particle inflow gun (PIG) [6, 24] (Fig. 1). Technically, the
two DNA guns use the same mechanism. However, the Bio-Rad
Biolistic system is much more expressive and allows more precise
control than PIG. The operations of both devices have been
described in this chapter.
Sorghum Transformation by Particle Bombardment 221
Fig. 1 Gene guns: (a) Biolistic PDS 1000/He; (b) particle inflow gun (PIG)
2 Materials
2.1 Sorghum Growth 1. Temperature-controlled physical containment glasshouse

and Seed Disinfection (18–28 °C) or field (see Note 1).
Requirements 2. Pots, potting mix, fertilizers, watering facility, and benches.
3. One sorghum inbred line, Tx430 (see Note 2).
4. Immature seeds in order to obtain immature embryos (IEs)
(see Note 3).
5. Commercial bleach which contains 4 % (m/v) sodium hypo-
chlorite (see Note 4).
6. Surfactant Tween 20.
7. Ethanol, 70 % (v/v) in sterile distilled water.
8. Calcium nitrite (Ca(NO3)2) 1 M stock solution.
9. Sterilized water.
10. Platform shaker.
2.2 Basic Equipment 1. Tissue culture room with temperature control (27 ± 1 °C) and
and Reagents for fluorescent lights with a luminescence of approximately
Tissue Culture 100 µmol/s/m2 (16 h/day).
2. Autoclave.
3. Petri dishes (90 × 25 mm, 90 × 15 mm).
4. Laminar airflow.
5. pH meter.
6. Autoclavable glassware 50, 100, 250, 500, 1,000 mL.
7. Balance (d = 0.01 g; d = 0.1 mg).
8. Sterile forceps with fine-point tips.
9. Surgical blades (size 11, 23, or 24).
10. Parafilm.
11. Filter papers (90, 70 mm, Whatman®).
12. Purified water (Millipore Milli-Q® water).
13. Ethanol, 70, 90, and 100 %.
14. Potassium hydroxide (KOH) stock solution: 1 M and 5 M.
1 M sodium hydroxide (NaOH), and 1 M hydrochloric acid
(HCl).
15. 1 M sodium hydroxide (NaOH).
16. 1 M hydrochloric acid (HCl).
17. Copper sulphate (CuSO4) stock solution: 1 mM and filter
sterilized.
2.3 Stock Solutions

of Plant Hormone for
Sorghum Tissue
Culture (Table 1)
Table 1
Stock solutions of plant hormone for sorghum tissue culture
Stock solution 2,4-D BAP IAA IBA NAA
2,4-Dichloro- 6-Benzyl- Indole-acetic Indole- α-Naphthalene

Full name phenoxyacetic acid aminopurine acid butyric acid acetic acid
Molecular weight 221.0 225.3 175.2 203.2 186.2
(g/mol)
Powder storage RT RT −0 °C 2–8 °C RT
Solution storage 0–5 °C 0–5 °C 0–5 °C 0–5 °C 0–5 °C
Solvent EtOH/1 M 1 M KOH EtOH/1 M EtOH/1 M 1 M NaOH
NaOH NaOH NaOH
Diluent Water Water Water Water Water
Sterilization CA F F F F
Stock 1.0 1.0 1.0 1.0 1.0
concentration
(mg/mL)
Working 0.01–5.0 0.1–5.0 0.01–3.0 0.1–10.0 0.1–10.0
concentration
(mg/L)
CA co-autoclave with other media components, F filter sterilization (32 mm syringe filter with 0.2 μm Supor®
Membrane)
2.4 Media for 1. MS medium: MS (Murashige and Skoog 1962) [25] powder
Sorghum Tissue with Gamborg vitamins, 30 g/L sucrose, and 8 g/L agar (see
Culture Note 5).
2. Callus induction medium (CIM): MS medium with 1 g/L
L-proline, 1 g/L L-asparagine, 1 g/L potassium dihydrogen-
phosphate (KH2PO4), 1 µM CuSO4, and 1 mg/L 2,4-D.
3. Regeneration medium: MS medium with 1 mg/L BAP,
1 mg/L IAA, and 1 µM CuSO4.
4. Rooting medium: MS medium with 1 mg/L NAA, 1 mg/L
IAA, 1 mg/L IBA, and 1 µM CuSO4.
5. Selective regeneration medium: Regeneration medium with
30 mg/L geneticin (G418) (disulfate salt solution, Sigma) (see
Note 6).
6. Selective rooting medium: Rooting medium with 30 mg/L G418.
7. Osmotic medium: MS medium supplemented with 0.2 M
D-sorbitol and 0.2 M D-mannitol.
2.5 Basic Equipment 1. Biolistic PDS 1000/He (Bio-Rad) or PIG system (Fig. 1a, b ),
for Particle both including vacuum pump, and high-pressure helium
Bombardment tank.
2. Microcarrier holder, microcarrier, rupture disks (900, 1,100,
or 1,300 psi, Bio-Rad), and stopping screens for PDS 1000/
He system.
3. Sterilized syringe filter, and sterilized baffle for PIG system.
4. Vortex shaker.
5. Microfuge tubes 1.5 and 2.0 mL.
6. Bench top centrifuge.
7. Pipettes: 2, 10, 20, 200, 1,000, and 5,000 µL and their respec-
tive tips.
8. Refrigerator (4 °C), and freezers (−20 and −80 °C).
2.6 Reagents for 1. 0.6 μm gold particles (see Note 7).

Particle Bombardment 2. Stock solution: 2.5 M calcium chloride (CaCl2) (filter steril-
ized). It can be stored at −20 °C for up to 2 years.
3. Ethanol, 70 and 100 %.
4. 0.1 M spermidine. Make a fresh solution per round of bom-
bardment (2 μL spermidine in 125 μL sterilized water).
5. Glycerol, 50 and 80 % (sterilized).
6. Plasmids of target and selective maker genes, 1 μg/μL
(see Note 8).
2.7 Genetic 1. Reporter gene (see Note 9).

Materials for Particle 2. Selective marker gene (see Note 10).
Bombardment
3. Target gene (see Note 11).
Transformation
4. Gene promoter (see Note 12).

5. Gene terminator nopaline synthase (NOS).
3 Methods
3.1 Growing Healthy 1. Fill 20 L pots with a standard potting/nutrient mix (2/3–3/4
Sorghum Plants in filled).
Glasshouse 2. Add fertilizers to the soil and mix: for example, 30 g/pot of
dolomite, 10 g/pot of superphosphate, 10 g Osmocote®/pot.
3. Sow four to six sorghum seeds/pot. It is recommended that
these seedlings are then “thinned” to a maximum of three
seedlings in each pot.
4. After germination has taken place, wait at least 2 weeks before
applying additional fertilizers.
5. Water plants daily. Sorghum is well known to be drought toler-
ant, but supplementary watering helps sorghum stay in healthy
and vigorous condition.
6. Sorghum suffers from acute Ca2+ deficiency when grown in pots
in a glasshouse environment. Symptoms typically manifest as leaf
splitting perpendicular to the lateral vein of leaves, and severe
symptoms are demonstrated when the leaf apical meristem begins
to curl and die (necrosis). To ameliorate the symptoms, it is nec-
essary to apply a foliar spray of Ca(NO3)2 at least once/week for
about 1–2 months. A stock of 1 M Ca(NO3)2 can be made and
then dilute ten times in spray bottle (see Note 13).
7. Apply slow-release fertilizer once per month, e.g., 5 g
Osmocote®/pot.
8. Pest and disease should be monitored weekly and kept under
control; otherwise, unhealthy immature seeds can lead to con-
tamination and reduce the efficiencies of both tissue culture
and transformation.
3.2 Harvesting 1. Closely monitor sorghum flowering (anther emergence)

of Sorghum Immature (see Note 14).
Seeds 2. Select healthy sorghum panicles 12–15 days after pollination.
3. Collect appropriate immature seeds from panicles (see Note 15).
3.3 Disinfection 1. Soak collected immature seeds in 70 % ethanol and shake at

of Immature Seeds 200 rpm for 5 min.
2. Rinse seeds with sterilized water once within a laminar airflow.
3. Soak seeds in a solution of 100 % commercial bleach with three
to five drops of Tween20 added.
4. Shake at 200 rpm for 10 min.
5. Rinse seeds at least five times with sterilized water until bleach
is completely washed away.
6. Place seeds into an aseptic Petri dish in the laminar airflow and
allow drying for 20–30 min.
3.4 Preparing Target 1. Isolate immature embryos utilizing forceps and surgical blade
Tissue for Particle within the laminar airflow (see Note 16).
Bombardment 2. Place immature embryos with the scutellum side up on callus
induction media (maximum 25 immature embryos per
90 × 15 mm Petri dish).
3. Seal plates with paraflim.
4. Keep immature embryos in the dark at 26–28 °C to allow
callus formation.
5. After 9–11 days in the dark, immature embryos are ready for
particle bombardment transformation.
6. Select immature embryos which have formed compact, globu-
lar, white embryogenic callus.
7. Place 6 to 8 immature embryos onto the center of Petri dish
filled with osmotic medium for 2–3 h before bombardment.
3.5 Preparation 1. Weigh out 50 mg of gold (0.6 μm diameter) into a 1.5 mL

of Gold Particles microfuge tube.
2. Add 1 mL of 100 % ethanol.
3. Vortex thoroughly for 5 min.
4. Stand for 15 min.
5. Pellet gold at 13,000 rpm for 10 s in bench top centrifuge.
6. Remove ethanol, wash particles three times in 1 mL sterilized
water, vortex for 1 min, allow to stand for 1 min, then pellet in
the bench top centrifuge at 13,000 rpm for 10 s, and finally
remove the supernatant.
7. Resuspend particles in 1 mL of sterilized 50 % glycerol. The
concentration of gold particles is 50 mg/mL.
8. Dispense 50 μL aliquots into 1.5 microfuge tubes. One aliquot
is generally used for 6 bombardments (aliquots can be stored
at −20 °C up to 6 months).
3.6 Coating Gold Perform the following procedure under sterile conditions in a lam-
Particles with DNA for inar airflow, and keep tubes on ice.
Six Bombardments 1. Vortex one 50 μL aliquot of gold particles thoroughly (homog-
enize completely, leave no visual clumps).
2. Add 10 μL of 1 μg/μL plasmid DNA containing selective
marker and target genes (for co-bombardment, 5 μg of plas-
mid with selective gene and 5 μg of plasmid with target gene).
3. Vortex for 1–2 min.

4. It is important to add CaCl2 and 0.1 M spermidine while gold
particles are still suspended (have these pre-drawn up in two
pipettors ready for addition of solutions).
5. Add 50 μL of 2.5 M CaCl2.
6. Add 20 μL of 0.1 M spermidine.
7. Vortex the mixed solution for 1–2 min.
8. Precipitate for 5 min on ice.
9. Pellet for 10 s at 3,000 rpm in a bench top centrifuge.
10. Remove the supernatant.
11. Add 130 μL of 70 % ethanol.
12. Vortex for 1–2 min.
13. Precipitate for 5 min on ice.
14. Pellet for 10 s at 3,000 rpm in a bench top centrifuge.
15. Remove the supernatant.
16. Add 35 μL of 100 % ethanol (analytical grade) and resuspend
by vortexing.
17. Visually confirm dispersal, and immediately apply 5 μL of
suspension to the center of syringe filter for each shot of
the PIG.
18. Or visually confirm dispersal, and immediately apply 5 μL of
suspension to the center of the macrocarrier and spread evenly.
Allow to dry for Biolistic® PDS-1000/He particle delivery
system.
3.7 Bombardment 1. Sterilize the gene shot gun chamber with 70 % ethanol.
Utilizing PDS-1000/He 2. Sterilize the macrocarrier holders, macrocarriers, rupture disks
Particle Delivery (such as 1,100 or 1,300 psi disks), stopping screens, and mac-
System (Fig. 1a) rocarrier insertion tools by submersion in 70 % ethanol (soak
for 30 min, and then air-dry in the laminar airflow).
3. Place the macrocarrier into the holder, and ensure that it is
fully inserted using the prescribed tool.
4. Place the rupture disk into the holder, screw into place, and
tighten with a wrench.
5. Place the stopping screen into the bottom of the projectile
assembly. Place the macrocarrier holder containing gold-
coated DNA carrier (which is prepared from Subheading 3.6)
into the assembly, with the gold side facing the stopping screen
and screw on top.
6. Slide the assembly onto the selected shelf of the PDS-1000/
He (usually top shelf).
7. Place one Petri dish with target tissues (which is prepared from
Subheading 3.4) for bombardment onto the selected shelf.
8. Close the door, and turn on the vacuum switch.
9. Ensure that the helium valve is adjusted to approximately
100 psi above rupture disk pressure.
10. When vacuum reaches 28 psi, flip the switch to hold and hold
down the fire switch until the disk ruptures.
11. Release the vacuum.
12. Remove the bombarded tissue plate, the spent macrocarrier,
and rupture disk.
13. Reload and repeat the procedure from steps 3 to 12 for the
next bombardment.
14. Once all shots are completed, close the bottom knob on the
helium tank to stop releasing helium to the tubes.
15. Flick the fire switch a number of times to release the residual
helium in the tubes.
16. Turn off the PDS-1000/He.
17. Turn off the vacuum pump.
18. Clean the chamber and the laminar airflow with 70 % ethanol.
3.8 Bombardment 1. Set up the PIG in a laminar airflow.

Utilizing the PIG 2. Spray the chamber with 70 % ethanol inside and outside. Allow
Delivery System enough time to dry before shooting (normally 1–2 h).
(Fig. 1b) 3. Turn on the vacuum pump.
4. Open the knob on the helium tank to allow the gas to flow out
of the cylinder.
5. Open the second knob on the helium tank, and adjust helium
pressure to the desired level (for example 1,000 kPa for
sorghum).
6. Turn the helium valve situated on top of the PIG one full turn
to open the valve at the optimal aperture.
7. Adjust and make sure that the timer for each shot is set to
0.05 s.
8. Mix the particle-coated DNA (which is prepared from
Subheading 3.6). Add 5.0 μL of the suspension to the center
of the syringe filter. Screw filter into the top of the vacuum
chamber.
9. Place one Petri dish with target tissues (which is prepared from
Subheading 3.4) under a baffle in the chamber at the certain
level, and close the chamber door. The distance from the filter
holder to the target cells is set at 18.5 cm for sorghum. Ensure
that the vacuum release valve to the chamber is closed.
10. Open the vacuum valve to draw a vacuum in the chamber. Wait
until the pressure gets to −90 kPa, and then close the valve.
11. Flick the firing switch to allow shot of helium to flow through the
filter, and shoot the particle-coated DNA into target tissues.
12. Open the vacuum-release valve to release vacuum.
13. Open the door of the chamber. Remove the baffle, take out the
Petri dish, and cover it with the Petri dish lid.
14. Repeat steps from 8 to 13 for each plate which is required to
be transformed with the same plasmid(s). Separate sterilized
baffles and filters are required if different plasmid(s) or target
gene(s) are used.
15. When all bombardment is complete, all baffles and filters
should be washed and autoclaved to be prepared for the next
experiment.
16. Close the bottom knob on the helium tank to stop releasing
helium to the tubes.
17. Flick the firing switch a number of times to release residual
helium from tubes.
18. Close the helium valve one full turn.
19. Close the vacuum-release valve to the chamber.
20. Turn off the vacuum pump.
21. Switch off the PIG system.
22. Clean the chamber and the laminar airflow with 70 % ethanol.
3.9 Post- 1. Keep bombarded immature embryos in osmotic medium for

bombardment Recovery 3–4 h in the dark after bombardment.
2. Subculture immature embryos onto CIM.
3. Recover bombarded immature embryos on CIM at 27 ± 1 °C
in the dark for 3 days.
3.10 Post- 1. Subculture IEs from CIM onto selective regeneration medium,
bombardment Selection and continue subculturing fortnightly until plantlets grow at
least 3 cm long.
2. Subculture individual plantlet onto selective rooting medium
(one plantlet per plate).
3. Keep plantlets on selective rooting medium for 3–4 weeks
without additional subculture (see Note 17).
3.11 Hardening 1. Open lids of Petri dishes to allow plantlets have exposure to air.
Off and Potting 2. Add sterilized water daily onto Petri dishes to cover selective
Out Plantlets rooting medium.
3. Keep plantlets in tissue culture room for 2–4 days.

4. Carefully extract plantlets from rooting medium, and rinse off
excess medium with water (non-sterile) around the roots.
5. Transfer transgenic plantlets into a physical containment glass-
house with temperature control (18–28 °C).
6. Plant 2 to 3 transgenic plantlets in one 20 L pot filled with
potting mix.
7. Tag individual plantlets.
3.12 Analysis The analysis of putative transgenic plants is not described in this
of Putative chapter, but it is necessary to confirm the existence of transformed
Transgenic Plants gene(s) in putative transgenic plants (see Note 18).
3.13 Flow Chart

of Sorghum Particle
Bombardment
Transformation
(Table 2)
Table 2
Flow chart of sorghum particle bombardment transformation
Main activity Steps Time

Growing sorghum plants Sowing sorghum seeds in pots 1–3 h
Growing plants 60–90 days
Harvesting immature seeds 1–2 h
Initiation of immature embryos Seed disinfection 1–2 h
(IEs) IE isolation 1–2 h
Incubating IEs in the dark to form callus 7–11 days
Particle bombardment Incubating IEs on osmotic medium 2–3 h
Particle bombardment 1–2 h
IEs stay on osmotic medium 3–4 h
IEs recover on callus induction medium 3–4 days
Selection of putative transgenes IEs on selective regeneration medium 21–42 days
IEs on selective rooting medium 21–35 days
Potting out putative transgenic Hardening off putative transgenic plantlets 2–4 days
plantlets Washing off medium around the roots 1h
Potting out putative transgenic plantlets in glasshouse 1h
4 Notes
1. Immature embryos produced from glasshouse-grown plants

are more reliable than those from field-grown plants because
of temperature control in the glasshouse particularly in the
winter season. However, no significant difference has been
observed between immature embryos from the glasshouses
and field sites in summer season. The important environmental
factor is minimum daily temperature. For field-grown plants, if
the minimum temperature falls below 18 °C, the callus induc-
tion rate will decrease dramatically for some sorghum geno-
types such as SA281 (data not shown).
2. Tx430 is the most successful sorghum line for tissue culture
and transformation in our laboratory. We also obtained trans-
formants from sorghum genotypes SA281 and 91419R, but
the transformation efficiencies of SA281 and 91419R are much
lower than that of Tx430 (data not shown).
3. In cereals, immature embryos have been demonstrated to be
the most productive and widely used explant source to develop
embryogenic callus [26]. Transgenic plants have been obtained
utilizing particle bombardment from cereal immature embryos
of maize, rice, wheat, barley, sorghum, and peal millet [12, 13,
17, 20, 27]. In general, sorghum immature seeds are collected
12–15 days after anther emergence when the endosperm is
milky and soft.
4. The active component of commercial bleach, sodium hypo-
chlorite, may decrease in effectiveness after prolonged usage,
leading to reduced success in disinfection of the seed surface.
It is recommended to use a fresh bottle monthly.
5. All media are based on MS medium with a pH adjusted to 5.7
and autoclaved at 121 °C for 15 min. 2,4-Dichlorophenoxyacetic
(2,4-D) is added to medium before autoclaving. The other
plant growth regulators and CuSO4 are sterilized with 0.2 μm
filter and added to media post autoclaving.
6. In general, the appropriate selection concentration is variable
depending on species and genotype. Therefore, a kill curve
experiment is crucial to determine the most suitable concentra-
tion of selection agent. The ideal selection concentration would
be just able to prevent non-transgenic cells from developing shoots
or plantlets. If the selective agent concentration is too high in
the medium, it may kill transgenic cells as well. In contrast, if
the selective agent concentration is too low, it may allow non-
transgenic cells to escape from the selection.
7. The standard particles used for plant transformation are tung-
sten and gold particles; however, gold particles are more suit-
able and stable for plant cells than tungsten particles [28].
Moreover, 0.6 μm gold particles cause less damage to embryo-

genic callus than 1.0 μm gold particles; therefore, 0.6 μm gold
particles are more suitable for particle bombardment [29].
8. The amount of DNA used per bombardment has an impact on
the copy number of the inserted gene in transgenic plants [13].
9. A reporter gene is usually used for plant genetic transformation
to indicate whether the plasmid vector has been integrated into
the host genome and expressed by the host cells. Reporter genes
are particularly useful for evaluating gene expression patterns and
levels under different promoters and consequently allowing
optimization of parameters for the DNA delivery system. Cells
containing an ideal reporter gene should be easily distinguishable
from non-transformed cells and allow straightforward detection
by assay. The genes β-glucuronidase (gus) and green fluorescent
protein (gfp) are commonly used as reporter genes for plant
genetic transformation.
10. Selection of transgenic events requires the incorporation of a
selective marker gene, either in a separate plasmid or adjacent to
the target gene, in order to discriminate between transgenic
and non-transgenic cells, especially at the early in vitro stage.
Selectable markers usually confer transgenic cells with resistance
to antibiotics, herbicides, or metabolic inhibitors. For example,
the hygromycin phosphotransferase (hpt) gene, which enables
transformed cells to be resistant to the antibiotic hygromycin,
has been an efficient selectable marker for sorghum, rice, and
maize transformation [27, 30–32]. Another antibiotic resis-
tance gene, neomycin phosphotransferase (nptII) gene, confers
resistance to the transgenic cells to the aminoglycoside antibiot-
ics including kanamycin and neomycin and has been widely
used to obtain transgenic cereals [15, 16, 33].
11. Target gene(s) can be incorporated into a vector either singu-
larly or polycistronically. As mentioned earlier, the target gene
can be combined into a vector with a selective gene as well.
The use of two or more plasmids together for bombardment is
known as co-transformation.
12. A gene promoter has important implications for the strength
and location of gene expression in target tissues. For example,
the ubiquitin promoter is generally a stronger promoter than
CaMV35 in sorghum transformation [34]. It is reported that
the α-kafirin promoter specifically directs gene expression in
sorghum grain [35].
13. During the winter season, once day length is less than 12 h,
sorghum does not suffer from calcium deficiency as much as it
does in summer. In addition, sorghum normally does not show
any symptoms of calcium deficiency when grown in field con-
ditions irrespective of the season. However, plants show some
calcium deficiency when grown in pots. The symptoms vary

according to sorghum genotype. For example, Tx430 suffers
from calcium deficiency less than SA281.
14. In general, anther emergence begins from the top and pro-
gresses to the bottom of the panicle over a period of 5–7 days.
15. From one panicle, not all seeds are at optimal stage to form
callus because seeds in different position usually do not flower
on the same day.
16. Immature embryo sizes differ according to sorghum genotype
and environmental growth conditions. Normally, a range of
sizes is suitable to generate embryogenic callus. According to
experiments on SA281 in our lab, an immature embryo length
less than 1.1 mm indicates that the embryo is too young
and vulnerable to damage; immature embryo with a length
more than 2.2 usually indicates that the embryo is too old.
An immature embryo length between 1.1 and 2.2 is suitable to
form callus.
17. In general, it is not necessary to subculture plantlets on selec-
tive rooting medium. However, some transgenic plantlets are
reluctant to grow roots; in this case, a further subculture
onto new selective rooting medium is required.
18. If the reporter gene gfp or gus is used, GFP observation or
GUS staining can be performed to detect the presence of the
reporter genes. PCR screening and/or Southern hybridization
are widely utilized to confirm the existence of transformed
genes in host genomic DNA.
Acknowledgements
We are thankful to the Australian Research Council (ARC) and

Pacific Seeds Ltd. Pty. for funding the Linkage project LP0883808.
We are grateful to Sharon Beth Williams, Siti Atiqah Zainul Alam,
Azelah Mustapha, and Yue Sun for their efforts during the editing
process.
References
1. Varshney RK, Bansal KC, Aggarwal PK et al formation of plants: the role of host. Biol Plant
(2011) Agricultural biotechnology for crop 53:201–212
improvement in a variable climate: hope or 4. Altpeter F, Niranjan B, Beachy R et al (2005)
hype? Trends Plant Sci 16:363–371 Particle bombardment and the genetic
2. Vain P (2007) Thirty years of plant transforma- enhancement of crops: myths and realities. Mol
tion technology development. Plant Biotechnol Breed 15:305–327
J 5:221–229 5. Elghabi Z, Ruf S, Bock R (2011) Biolistic co-
3. Karami O, Esna-Ashari M, Kurdistani GK et al transformation of the nuclear and plastid
(2009) Agrobacterium-mediated genetic trans- genomes. Plant J 67:941–948
6. Vain P, Keen N, Murillo J et al (1993) elite Chinese rice cultivars with genes conferring
Development of the particle inflow gun. Plant resistance to bacterial blight and sap-sucking insect
Cell Tissue Organ Cult 33:237–246 pests. Planta 208:552–563
7. Hagio T, Blowers AD, Earle ED (1991) Stable 21. Casas AM, Kononowicz AK, Zehr UB et al
transformation of sorghum cell-cultures after (1993) Transgenic sorghum plants via micro-
bombardment with DNA-coated microprojec- projectile bombardment. Proc Natl Acad Sci U
tiles. Plant Cell Rep 10:260–264 S A 90:11212–11216
8. Birch RG, Franks T (1991) Development and 22. Zhao ZY, Cai T, Taqliani L et al (2000)
optimization of microprojectile systems for Agrobacterium-mediated sorghum transforma-
plant genetic-transformation. Aust J Plant tion. Plant Mol Biol 44:789–798
Physiol 18:453–469 23. Gurel S, Gurel E, Kaur R et al (2009) Efficient,
9. Rech EL, Vianna GR, Aragao FJL (2008) reproducible Agrobacterium-mediated transfor-
High-efficiency transformation by biolistics of mation of sorghum using heat treatment of
soybean, common bean and cotton transgenic immature embryos. Plant Cell Rep 28:429–444
plants. Nat Protoc 3:410–418 24. Finer JJ, Vain P, Jones MW et al (1992)
10. Emani C, Sunilkumar G, Rathore KS (2002) Development of the particle inflow gun for
Transgene silencing and reactivation in sor- DNA delivery to plant-cells. Plant Cell Rep
ghum. Plant Sci 162:181–192 11:323–328
11. Zhu H, Muthukrishnan S, Krishnaveni S et al 25. Murashige T, Skoog F (1962) A revised
(1998) Biolistic transformation of sorghum medium for rapid growth and bioassays with
using a rice chitinase gene. J Genet Breed tobacco tissue cultures. Physiol Plant 15:
52:243–252 473–497
12. Lowe BA, Prakash S, Way M et al (2009) 26. Sticklen MB, Oraby HF (2005) Invited review:
Enhanced single copy integration events in Shoot apical meristem: a sustainable explant for
corn via particle bombardment using low quan- genetic transformation of cereal crops. In Vitro
tities of DNA. Transgenic Res 18:831–840 Cell Dev Biol Plant 41:187–200
13. Yao Q, Cong L, Chang JL et al (2006) Low 27. O’Kennedy MM, Stark HC, Dube N (2011)
copy number gene transfer and stable expres- Biolistic-mediated transformation protocols
sion in a commercial wheat cultivar via par- for maize and pearl millet using pre-cul-
ticle bombardment. J Exp Bot 57: tured immature zygotic embryos and
3737–3746 embryogenic tissue. In: Thorpe TA, Yeung
14. Shou HX, Frame BR, Whitham SA et al (2004) EC (eds) Plant embryo culture: methods
Assessment of transgenic maize events produced by and protocols, vol 710, Methods in molec-
particle bombardment or Agrobacterium- ular biology. Humana Press Inc., Totowa,
mediated transformation. Mol Breed 13:201–208 NJ, pp 343–354
15. Dai SH, Zheng P, Marmey P et al (2001) 28. Russell JA, Roy MK, Sanford JC (1992)
Comparative analysis of transgenic rice plants Physical trauma and tungsten toxicity reduce
obtained by Agrobacterium-mediated transfor- the efficiency of biolistic transformation. Plant
mation and particle bombardment. Mol Breed Physiol 98:1050–1056
7:25–33 29. Frame BR, Zhang H, Cocciolone SM et al (2000)
16. Liu GQ, Godwin ID (2012) Highly efficient Production of transgenic maize from bombarded
sorghum transformation. Plant Cell Rep type II callus: effect of gold particle size and callus
31:999–1007 morphology on transformation efficiency. In
17. Um MO, Park TL, Kim YJ et al (2007) Particle Vitro Cell Dev Biol Plant 36:21–29
bombardment-mediated transformation of 30. Carvalho CHS, Zehr UB, Gunaratna N et al
barley with an Arabidopsis NDPK2 cDNA. (2004) Agrobacterium-mediated transforma-
Plant Biotechnol Rep 1:71–77 tion of sorghum: factors that affect transfor-
18. Wang DX, Zhao Q, Zhu DY et al (2006) Particle- mation efficiency. Genet Mol Biol
bombardment-mediated co-transformation of 27:259–269
maize with a lysine rich protein gene (sb401) from 31. Kumar V, Campbell LM, Rathore KS (2011)
potato. Euphytica 150:75–85 Rapid recovery- and characterization of trans-
19. Hare PD, Chua NH (2002) Excision of select- formants following Agrobacterium-mediated
able marker genes from transgenic plants. Nat T-DNA transfer to sorghum. Plant Cell Tissue
Biotechnol 20:575–580 Organ Cult 104:137–146
20. Tang K, Tinjuangjun P, Xu Y et al (1999) Particle- 32. Vain P, Worland B, Clarke MC (1998)
bombardment-mediated co-transformation of Expression of an engineered cysteine proteinase
inhibitor (Oryzacystatin-I Delta D86) for production of transgenic sorghum (Sorghum

nematode resistance in transgenic rice plants. bicolor) via microparticle bombardment. Plant
Theor Appl Genet 96:266–271 Cell Tissue Organ Cult 75:1–18
33. Howe A, Sato S, Dweikat I (2006) Rapid and 35. Ahmad N, Sant R, Bokan M et al (2012)
reproducible Agrobacterium-mediated transfor- Expression pattern of the alpha-kafirin pro-
mation of sorghum. Plant Cell Rep 25:784–791 moter coupled with a signal peptide from
34. Tadesse Y, Sagi L, Swennen R (2003) Sorghum bicolor L. Moench. J Biomed
Optimisation of transformation conditions and Biotechnol. doi:10.1155/2012/752391
Chapter 19
Genetic Transformation of Wheat via Agrobacterium-Mediated

DNA Delivery
Caroline A. Sparks, Angela Doherty, and Huw D. Jones
Abstract
The method described involves an initial incubation of wheat immature embryos in a liquid culture of
Agrobacterium tumefaciens. The Agrobacterium strain is engineered to contain a binary vector with a gene
of interest and a selectable marker gene placed between the T-DNA borders; the T-DNA is the region
transferred to the plant cells, thus harnessing the bacterium’s natural ability to deliver specific DNA into
host cells. Following the initial inoculation with the Agrobacterium, the embryos are co-cultivated for
several days after which the Agrobacterium is selectively destroyed using an antibiotic. Tissue culture of the
embryos on plant media with a correct balance of hormones allows embryogenic callus formation followed
by regeneration of plantlets, and in the later stages of tissue culture a selectable marker (herbicide) is
included to minimize the incidence of non-transformed plants. This protocol has been used successfully to
generate transformed plants of a wide range of wheat varieties, both spring and winter bread wheats
(T. aestivum L.) and durum wheats (T. turgidum L.).
Key words Wheat, Agrobacterium tumefaciens, Transformation, T-DNA, Cocultivation, Immature

embryo, Transgenic plants
1 Introduction
The ability to alter the genome of a plant in a precise and predict-

able manner is a powerful research tool for functional genomics
and is fast becoming a key element in the process of commercial
varietal improvement. A key component of the genetic modifica-
tion of crop plants is a robust transformation protocol. Wheat was
among the last of the major crops to be transformed with the first
fertile transgenic plants being reported using particle bombard-
ment nearly 20 years ago and Agrobacterium transformations
becoming routine a few years later [1–6]. However, there remains
considerable debate about the respective advantages and disadvan-
tages of these alternative DNA delivery methods. There are numer-
ous reports that claim transformation using Agrobacterium
tumefaciens tends to give events with single or low transgene copy
235
236 Caroline A. Sparks et al.
number with simple insertion patterns. However, it is also well

accepted that unwanted “plasmid backbone” (i.e., non T-DNA)
sequences are also often integrated into the host genome. In addi-
tion, there is a report of Agrobacterium chromosomal DNA also
being inserted along with the intended T-DNA [7]. In contrast, it
is reported that transformation via biolistics results in multi-copy
events with more complex insertion patterns. However, this con-
clusion has been disputed [8] and can be reduced by using shorter
linearized fragments of DNA rather than circular plasmids [9]
which simultaneously removes the possibility of plasmid backbone
being incorporated into the insertion [10]. These issues become
particularly important when the events in question are intended for
commercialization, and in this case, regardless of the method of
transformation, it is common to generate several tens of indepen-
dent events and screen these for simple, single copy insertions that
do not interrupt a native gene or generate other unintended effects.
For wheat, regardless of the method of transformation, the proce-
dure can be conveniently divided into two parts: those steps that
ensure effective DNA transfer and integration into the plant
nuclear genome and those that allow the regeneration and selec-
tion of viable adult plants from the transformed cells. We present
here two linked chapters. This chapter provides a detailed protocol
for the transformation of wheat using Agrobacterium tumefaciens
to transfer T-DNA to cells of freshly isolated immature embryos as
a starting explant. The inoculation, cocultivation, regeneration,
and selection steps are described to produce young, fertile wheat
plants in 12–16 weeks. Seeds that have inherited the introduced
DNA from the primary transgenic plants can be collected after a
further 4–5 months. The adjoining linked chapter describes a pro-
tocol for biolistics transformation.
2 Materials
2.1 Agrobacterium 1. Strain: AGL1 [11] (see Note 1).

tumefaciens Strain 2. Vectors: pAL154 and pAL156 [12] (see Note 2).
and Vectors
2.2 Donor Plants 1. Wheat seeds (Triticum aestivum L.) var. Fielder and Cadenza
and Surface (see Note 3) are sown on a fortnightly basis to provide a regu-
Sterilization of lar supply of good-quality donor material which is essential for
Immature Seeds reliable transformation efficiencies. Plants are grown five per
21 cm pot [Nursery Trades (Lea Valley) Ltd., UK] in
Rothamsted prescription mix soil (see Note 4) in controlled
environment rooms with 18 °C day-15 °C night temperatures
and a 16-h photoperiod provided by banks of 400 W hydrar-
gyrum quartz iodide (HQI) lamps (Osram Ltd., UK) generat-
ing a light intensity of ~700 μmol/m2/s photosynthetically
Wheat Transformation by Agrobacterium 237
active radiation (PAR) at the pot surface. Relative humidity is

maintained at 50–70 %. Pests and disease are kept to a mini-
mum by good housekeeping practices, but Amblyseius caligi-
nosus [Nursery Trades (Lea Valley) Ltd., UK] is used routinely
to control thrips and the fungicide Talius (DuPont (U.K.) Ltd,
UK) is sprayed as a mildew preventative when plants are
approximately 4 weeks old. Pots are initially top watered by
hand and then watered via a flood-bench automated watering
system. Plants are stripped to leave the five strongest tillers
when the plants are 5–6 weeks old.
2. 70 % (v/v) aqueous ethanol.
3. 10 % (v/v) aqueous bleach (see Note 5).
4. Sterile distilled water.
2.3 Media All chemicals are from Sigma-Aldrich unless otherwise stated, and
tissue culture-tested or analytical grade chemicals are used. For all
stock solutions and media use polished water with a purity of
18.2 MΩ/cm. Sterilization is carried out by autoclaving at 121 °C
for 15 min or filter sterilization using a 0.22 μm syringe filter
(Sartorius Stedim UK Ltd., UK) or, for larger volumes, MediaKap
filters (Medicell International Ltd., UK). Stock solutions are stored
at 4 °C for 1–2 months or frozen at −20 °C for up to a year provided
no freeze-thawing has occurred (see Note 6).
Media/components for growth and storage of Agrobacterium
tumefaciens:
1. MG/L [15]: 5 g/L mannitol, 1 g/L L-glutamic acid, 250 mg/L
KH2PO4, 100 mg/L NaCl, 100 mg/L MgSO4. 7H2O, 5 g/L
tryptone (Oxoid Ltd., UK), 2.5 g/L yeast extract (Oxoid Ltd.,
UK). Adjust pH to 7.0 if necessary. Add 15 g/L bactoagar
(DIFCO) for solid medium. Sterilize by autoclaving. Add bio-
tin (see item 2) at 1 μg/L after autoclaving.
2. Biotin: Prepare at 1 mg/100 mL in distilled water. Filter steril-
ize, and store at −20 °C in 0.5 mL aliquots. Add 100 μL biotin
stock to 1 L MG/L medium (see item 1) prior to use.
3. Magnesium sulfate: Prepare at 10 mM. Add 246 mg
MgSO4.7H2O to 100 mL distilled water. Filter sterilize, ali-
quot, and store at −20 °C.
4. Glycerol 80 % (v/v): Add 80 mL glycerol to 20 mL distilled
water. Mix thoroughly and filter sterilize. Store at room
temperature.
The following are stock solutions of the basal salt mixtures,
amino acids, and vitamins that are required to make the stock
plant culture media (see Subheading 2.4).
5. MS macrosalts (×10): 16.5 g/L NH4NO3, 19.0 g/L KNO3,
3.7 g/L MgSO4.7H2O, 1.7 g/L KH2PO4, 4.4 g/L CaCl2.2H2O
(see Note 7). Sterilize by autoclaving and store at 4 °C.
6. L7 macrosalts (×10): 2.5 g/L NH4NO3, 15.0 g/L KNO3,

3.5 g/L MgSO4.7H2O, 2.0 g/L KH2PO4, 4.5 g/L CaCl2.2H2O
(see Note 7). Sterilize by autoclaving and store at 4 °C.
7. L microsalts (×1,000): 17.05 g/L MnSO4.H2O (see Note 8),
7.5 g/L ZnSO4.7H2O, 5.0 g/L H3BO3, 0.75 g/L KI,
0.25 g/L Na2MoO4.2H2O, 0.025 g/L CuSO4.5H2O,
0.025 g/L CoCl2.6H2O. Sterilize by autoclaving and store at
4 °C.
8. 3AA amino acids (×25): 18.75 g/L L-glutamine (see Note 9),
3.75 g/L L-proline, 2.5 g/L L-asparagine. Store at −20 °C in
40 mL aliquots.
9. MS vitamins (−glycine) (×1,000): 500 mg/L pyridoxine HCl,
500 mg/L nicotinic acid, 100 mg/L thiamine HCl. Prepare
100 mL volume, filter sterilize, and store at 4 °C.
10. L vitamins/inositol (×200): 40.0 g/L myo-inositol, 2.0 g/L
thiamine HCl, 0.2 g/L nicotinic acid, 0.2 g/L pyridoxine
HCl, 0.2 g/L pantothenic acid (hemi-calcium salt), 0.2 g/L
ascorbic acid. Prepare 100 mL volume, filter sterilize, and store
at −20 °C in 40 mL aliquots.
2.4 Stock Plant The following stock media are prepared from stock solutions
Culture Media (see Subheading 2.3, items 5–10) at 2× concentrations to allow
mixing 1:1 with double-strength Phytagel or Agargel for
preparation of final solidified media plates.
1. Inoculation/cocultivation medium (×2) [16]: 200 mL/L MS
macrosalts, 2 mL/L L microsalts, 2 mL/L MS vitamins
(−glycine), 20 mL/L ferrous sulfate chelate solution (×100),
3.9 g/L 2-(N-morpholino)ethanesulfonic acid (MES),
1.5 g/L MgCl2, 1 g/L L-glutamine, 200 mg/L myo-inositol,
200 mg/L casein hydrolysate, 80 g/L maltose, 20 g/L glu-
cose. Adjust pH to 5.8 with 5 M NaOH or KOH, sterilize by
autoclaving, and store at 4 °C (see Note 10).
2. MSS 3AA/2 9 %S (×2): 200 mL/L MS macrosalts, 2 mL/L L
microsalts, 2 mL/L MS vitamins (−glycine), 40 mL 3AA solu-
tion, 20 mL/L ferrous sulfate chelate solution (×100),
200 mg/L myo-inositol, 180 g/L sucrose. Adjust pH to 5.7
with 5 M NaOH or KOH, filter sterilize, and store at 4 °C
3. R (×2): 200 mL/L L7 macrosalts, 2 mL/L L microsalts,
10 mL/L L vitamins/inositol, 20 mL/L ferrous sulfate chelate
solution (×100), 60 g/L maltose. Adjust pH to 5.7 with 5 M
NaOH or KOH, filter sterilize, and store at 4 °C (see Note 10).
4. Phytagel (×2): 4 g/L in water. Prepare in 400 mL volumes,
and sterilize by autoclaving. Phytagel is best used directly after
autoclaving but can be stored at room temperature and
remelted in a microwave before use (see Notes 12 and 13).
5. Agargel (×2): 10 g/L in water. Prepare in 400 mL volumes,

and sterilize by autoclaving. Store at room temperature, and
melt in a microwave prior to use (see Note 13).
The following supplements can be prepared and aliquoted into
appropriate amounts for storage. These additions are introduced
to media just prior to pouring plates.
6. Antibiotics (see Note 14):
(a) Carbenicillin: Prepare at 100 mg/mL in distilled water.
Filter sterilize and store at −20 °C.
(b) Kanamycin: Prepare at 50 mg/mL in distilled water. Filter
sterilize and store at −20 °C.
(c) Timentin [Ticarcillin disodium salt:Clavulanic acid 15:1
(Melford Laboratories Ltd., UK)]: Prepare at 320 mg/mL
in distilled water. Filter sterilize and store at −20 °C.
7. Acetosyringone (3,5-dimethoxy-4-hydroxyacetophenone):
Prepare at 10 mg/mL (50 mM) in 70 % (v/v) aqueous ethanol
(see Note 15).
8. Silwet L-77 (Lehle Seeds, USA): Prepare 1 % (v/v) solution by
adding 100 μL Silwet L-77 to 10 mL distilled water. Filter
sterilize and store at 4 °C (see Note 16).
9. 2,4-Dichlorophenoxyacetic acid (2,4-D): Prepare at 1 mg/
mL, initially dissolving in ethanol and then adding distilled
water to volume. Filter sterilize and store at 4 °C.
10. Picloram: Prepare at 5 mg/mL in distilled water, adding a few
drops of NaOH to dissolve if necessary. Filter sterilize and
store at −20 °C.
11. Silver nitrate (AgNO3): Prepare at 20 mg/mL in distilled water.
Filter sterilize and store at −20 °C in the dark (see Note 17).
12. Copper sulphate (CuSO4.5H2O): Prepare at 25 mg/mL
(100 mM) in distilled water. Filter sterilize, and store at 4 °C.
13. Zeatin (mixed isomers): Prepare at 10 mg/mL, initially dis-
solving in 1 M HCl and adding distilled water to volume. Filter
sterilize and store at −20 °C.
14. Glufosinate ammonium (PPT) (Greyhound Chromatography
and Allied Chemicals, UK): Prepare at 10 mg/mL in distilled
water. Filter sterilize and store at −20 °C.
2.5 Final To prepare the final culture media for plates, stock media
Culture Media (see Subheading 2.4, items 1–3) are mixed 1:1 with double-
strength Phytagel or Agargel for solidification (see Subheading 2.4,
items 4–5), adding supplements (see Subheading 2.4, items 6–14)
before pouring (see Note 18). All except the inoculation liquid and
cocultivation medium contain timentin at a final concentration of
160 mg/L to control subsequent growth of Agrobacterium
tumefaciens.
1. Inoculation liquid: Mix an equal quantity of inoculation/

cocultivation medium (×2) with sterile distilled water. Add
400 μM acetosyringone (see Notes 15 and 19).
2. Cocultivation medium: Mix an equal quantity of inoculation/
cocultivation medium (×2) with melted Phytagel (×2). Add
2 mg/L 2,4-D, 2 mg/L picloram, and 400 μM acetosyrin-
gone (see Notes 15 and 19). Pour into 5.5 cm Petri dishes
(~15 mL/dish) (see Note 20).
3. Induction medium: Mix an equal quantity of MSS 3AA/2
9 %S (×2) with melted Agargel (×2). Add 0.5 mg/L 2,4-D,
10 mg/L AgNO3 (see Note 17), and 160 mg/L timentin.
4. Regeneration medium: Mix an equal quantity of R (×2) with
melted Agargel (×2). Add 5 mg/L zeatin, 0.1 mg/L 2,4-D,
25 mg/L CuSO4 (see Note 21), and 160 mg/L timentin.
melted Agargel (×2). Add 5 mg/L zeatin, 4 mg/L PPT, and
160 mg/L timentin. Pour into 9 cm Petri dishes (~28 mL/
dish).
melted Agargel (×2). Add 4 mg/L PPT and 160 mg/L timen-
tin. Pour into GA-7 Magenta vessels (Sigma-Aldrich, UK)
(~60 mL/vessel).
2.6 Other Items 1. Falcon tubes, 50 mL (Falcon, USA).

2. Sterile cryotubes, 1.5 mL (Fisher scientific).
3. Sterile Petri dishes, 5.5 cm and 9 cm.
4. GA-7 MagentaTM vessels (Sigma-Aldrich, UK).
5. Sterile wooden cocktail sticks.
6. Forceps and scalpel with no. 11 blades.
7. Binocular microscope e.g., Olympus SZ40.
8. Shaking incubator.
9. High speed centrifuge.
10. Plastic plant pots, 8 cm square and 13 cm diameter.
3 Methods
3.1 Collection and 1. Collect wheat ears from plants in controlled environment
Surface Sterilization donor rooms (see Subheading 2.2) at 12–16 days post anthesis
of Immature Seeds (see Note 22).
Fig. 1 Wheat donor material and embryo isolation. (a) Immature seeds from an ear of wheat variety Fielder.
(b) Surface-sterilized immature seeds ready for embryo isolation. (c) Isolation of an immature embryo from a
seed with embryo axis removed. Scale bar = 1 mm approximately
2. Separate the immature seeds from the surrounding panicles

(see Note 23, Fig. 1a), and surface sterilize by rinsing in
70 % (v/v) aqueous ethanol for 1 min, followed by 10 min
in 10 % (v/v) aqueous bleach with occasional gentle shaking.
3. Rinse liberally with sterile distilled water several times, and
then drain to leave the surface-sterilized seeds moist but not
immersed in water (see Note 24, Fig. 1b).
3.2 Isolation of 1. Isolate the immature embryo from the seed, removing the
Immature Embryos embryo axis to prevent precocious germination (see Note 25,
Fig. 1c). The embryos should be 0.8–2.0 mm in length and
translucent in appearance (see Note 26).
2. Once the axis has been removed, place it scutellum side upper-
most onto cocultivation medium in a 5.5 cm Petri dish plating
approximately 30–50 embryos per plate. Isolate one plate of
embryos at a time, and carry out inoculation with Agrobacterium
tumefaciens (see Subheading 3.5) before isolating embryos for
the next plate (see Note 27).
3.3 Preparation Prepare standard inoculum glycerol stocks to allow initiation of
of Agrobacterium Agrobacterium liquid cultures for transformation without the need
Standard Inoculum to regrow single colonies on a plate each time.
Glycerol Stocks
1. Streak a plate of MG/L solid medium containing relevant
antibiotics (see Note 28), and incubate at 27–29 °C in the dark
for 2–3 days to grow to single colonies.
2. Pick a single colony on a sterile cocktail stick, and place in
10 mL liquid MG/L medium with appropriate antibiotics
(see Note 28).
3. Incubate in the dark at 27–29 °C, shaking at 250 rpm for ~24–
36 h until the optical density (OD, Abs600) is >1.0.
4. Centrifuge the culture at 4,500 × g for 5 min, discard the

supernatant, and resuspend the pelleted cells in 1 mL ice-cold
10 mM MgSO4.7H2O.
5. Add 3 mL ice-cold, sterile 80 % (v/v) glycerol, mix well, and
aliquot 200 μL into sterile cryotubes. Freeze in liquid nitro-
gen, and store at −80 °C as a glycerol stock or use immediately
to initiate a full-strength culture (see Subheading 3.4).
3.4 Growth and 1. Initiate an Agrobacterium tumefaciens liquid culture, by adding

Preparation of ~200 μL of a standard inoculum glycerol (see Subheading 3.3)
Agrobacterium Cells to 10 mL liquid MG/L with appropriate antibiotics (see Note
for Inoculation 28) in a 50 mL Falcon tube (see Note 29).
2. Prepare as many 10 mL cultures as plates of embryos to be
treated. Incubate in the dark at 27–29 °C, shaking at 250 rpm
for 12–24 h to reach an optical density (Abs600) >1.0.
3. Pellet the Agrobacterium cultures at 4,500 × g for 10 min, and
resuspend each pellet in 4 mL inoculation liquid with 400 μM
acetosyringone (see Notes 15 and 19).
4. Place these cultures back in the incubated shaker for 1–3 h
until required (see Note 30).
3.5 Inoculation 1. Remove the resuspended Agrobacterium from the shaker, add
of Embryos with 60 μL 1 % (v/v) Silwet (final concentration 0.015 %) (see Note
Agrobacterium 16), and pour the whole 4 mL volume over a batch of 30–50
tumefaciens plated embryos (see Notes 31–33, Fig. 2a, b).
2. Incubate for 1 h at room temperature in the dark (see Note 34)
while preparing more embryos for inoculation (see Note 35).
3.6 Cocultivation 1. Remove as much of the Agrobacterium culture as possible

using a pipette (see Note 36). Transfer the embryos to a fresh
plate of cocultivation medium in a 5.5 cm plate, keeping them
scutellum side uppermost.
2. Allow to cocultivate in the dark at 22–23 °C for 3 days
(see Note 37).
3.7 Induction of 1. After 3 days’ cocultivation there should be visible signs of

Embryogenic Callus Agrobacterium growth (Fig. 2c, see Note 38). However, it
should not be allowed to overgrow the embryos as it will cause
damage and therefore inhibit callus induction and regeneration.
2. Transfer the embryos to induction medium which contains
timentin to selectively kill the Agrobacterium and control fur-
ther growth (see Note 39).
3. Incubate in the dark at 22–23 °C for a further 18–25 days
(see Note 37).
Fig. 2 Inoculation with Agrobacterium and results of cocultivation. (a) Pouring Agrobacterium culture over
plated immature embryos. (b) Dropping aliquots of Agrobacterium culture onto individual plated imma-
ture embryos. (c) Growth of Agrobacterium following 3 days’ cocultivation (drop method). (d) Transient
gus expression in immature embryos 6 days after Agrobacterium inoculation. Scale bar = 1 mm
approximately
Fig. 3 Regeneration of transformed wheat plants. (a) Embryogenic callus after 1 week’s culture on regenera-
tion medium in the light. (b) Regenerating calli on selection medium (1) about to be moved to selection
medium (2). (c) Confirmed transgenic plants in GM containment glasshouse awaiting potting to larger pots.
Scale bar = 4 mm approximately
3.8 Regeneration 1. After 3–4 weeks of dark culture the embryos should have
of Plantlets formed embryogenic calli.
2. Transfer responsive calli to regeneration medium to initiate
regeneration from the somatic embryos.
3. Calli should be transferred whole and not broken up at this
stage. Incubate the cultures again at 22–23 °C but now in the
light for 3–4 weeks (see Note 37, Fig. 3a).
3.9 Selection 1. First selection: Once good shoots are developing from the calli,
of Transformants transfer them to selection medium (1) (see Notes 40 and 41).
If the regenerating calli are large they should be distributed
between a number of dishes to prevent subsequent overcrowd-
ing. Calli should still be maintained as one piece at this stage
unless they fall apart naturally in which case sections from the
same initial callus should be kept together in order to track
possible clonal material (see Note 42). Incubate for 3–4 weeks
at 22–23 °C in the light (see Note 37).
2. Second selection: After 3–4 weeks the effect of selection on the
cultures should be apparent; some bleaching of leaves will have
occurred, and roots may be stunted (see Note 43, Fig. 3b).
Any plantlets which remain green with reasonable root structures
should be transferred to selection medium (2) in MagentaTM
vessels for expansion of leaves and roots, placing four to six
plantlets per MagentaTM (see Note 40). At this stage it should
be possible to divide calli, separating out individual plantlets,
but these should be labelled as possible clones (see Note 43).
Incubate for a further 3–4 weeks at 22–23 °C in the light.
3.10 Transfer 1. Following the second round of selection, transformed plantlets

of Putative Transgenic should be fairly obvious in the MagentaTM vessels as those
Plants to Soil which are green and strong with developed root systems.
and Analysis 2. Remove the plantlets from the MagentaTM vessel, rinsing the
roots with water to remove Agargel if necessary, and pot into
8 cm square pots containing moistened Rothamsted prescrip-
tion mix soil (see Notes 4, 42, and 44).
3. Place the pots in a propagator for 1–2 weeks to create a humid
environment for the plantlets to become established
(see Note 45) and grow in a suitable GM containment glass-
house (see Note 46).
4. After 2–3 weeks plants should be sufficiently strong to take a
leaf sample for genomic DNA extraction and analysis by PCR.
Re-pot confirmed positive transgenic plants (Fig. 3c) to soil in
13 cm diameter pots (see Note 4) and grow to maturity in a
GM containment glasshouse.
5. Transformed plants usually have no morphological differences
to control plants apart from the occasional effects of soma-
clonal variation from tissue culture: they are generally normal,

fertile plants with good seed set.
4 Notes
1. AGL1 is a strain engineered to contain the so-called hyperviru-

lent Ti plasmid pTiBo542 which carries additional virulence
genes originating from the Agrobacterium strain A281.
Other Agrobacterium tumefaciens strains, e.g., EHA105, work
equally as well, but the Agrobacterium culture medium and
growth conditions may need to be modified for optimum
performance.
2. The chosen Agrobacterium strain is transformed with a suit-
able binary vector engineered to contain a gene of interest and
selectable marker gene between the T-DNA borders. Vectors
used for optimization of transformation methods commonly
use a reporter gene, e.g., β-glucuronidase (gusA) or GFP, to
visualize transformed cells. The pSoup/pGreen methodology
(see www.pgreen.ac.uk) utilizes a dual-vector system which
arranges the virulence genes on one plasmid (pSoup and deriv-
atives) and the genes to be transferred on a different plasmid
(pGreen and derivatives). pGreen has its own origin of replica-
tion (ori), but the transacting replicase gene (RepA) is present
on the pSoup vector, and consequently both vectors are
required in Agrobacterium for pGreen to replicate. In the cur-
rent chapter, pAL154 is the pSoup derivative carrying the
15 kb Komari fragment from pTiBo542 which contains addi-
tional copies of vir genes (virB, virC, and virG542) [13], and
pAL156 (pGreen derivative) has T-DNA borders surrounding
β-glucuronidase (gusA reporter gene, modified by addition of
an intron in the open reading frame to prevent expression in
Agrobacterium) and the bar gene for plant selection, both of
which are driven by the maize ubiquitin promoter plus first
intron [14] and a nos terminator. pAL155 is an alternative
pSoup derivative which can be paired with pAL156 with no
variation in efficiency.
3. Although this protocol is typically used for the bread wheat
varieties Fielder and Cadenza it can be applied to other wheat
varieties, but efficiencies may be affected.
4. Rothamsted prescription mix soil contains 75 % fine grade
peat, 12 % screened sterilized loam, 10 % 6 mm screened lime-
free grit, 3 % medium vermiculite, 2 kg osmocote plus/m3
(slow-release fertilizer, 15N/11P/13K plus micronutrients),
0.5 kg PG mix/m3 (14N/16P/18K granular fertilizer plus
micronutrients) from Petersfield Products, UK.
5. Ordinary commercial thin bleach can be used which generally

has a sodium hypochlorite content of 4–6 %.
6. Some salts may come out of solution in cold storage so check the
solutions and shake before use if necessary to resuspend fully.
7. CaCl2.2H2O should be dissolved in water prior to addition to
the other components.
8. MnSO4.H2O is the most commonly available form of this salt,
but if a different hydrated state is used, the amount to add
must be calculated to reflect this.
9. L-glutamine can be difficult to dissolve. If this is the case, dis-
solve separately at pH 9.0 prior to mixing with the other
components.
10. The osmolarity of stock media should be within the ranges:
inoculation/cocultivation (×2) 600–700 mOsM, MSS 3AA/2
9 %S (×2) 800–1, 100 mOsM, and R (×2) 270–300 mOsM.
11. Although this transformation protocol describes methods
most suitable for bread wheat, durum wheat (Triticum turgi-
dum L.) can also be transformed using this system but with the
notable variation that sucrose is adjusted to 4.5 % in the MSS
3AA/2 9 %S induction medium for embryogenic callus
formation.
12. Ideally Phytagel should be used directly after autoclaving as it
is not as easy to remelt as Agargel and sets quickly. However, it
can be stored at room temperature and carefully remelted in a
microwave if necessary.
13. When preparing Phytagel and Agargel, they should be shaken
before and after autoclaving to ensure even setting which
makes subsequent remelting in a microwave easier. Following
microwaving, always cool the gelling agents to approximately
50 °C prior to combining with the media solutions.
14. The antibiotics used will depend on the chosen Agrobacterium
strain and the plasmids therein: AGL1 can be selected with
carbenicillin, pAL154 with tetracyclin, and pAL156 with kana-
mycin. However, pGreen-based plasmids will not grow with-
out the presence of pSoup (or derivatives), so it is sufficient to
use kanamycin alone to select for both pAL154 and pAL156.
15. Ideally acetosyringone should be prepared fresh for each
experiment, but if stored at 4 °C it can be kept for about a
week or for several months at −20 °C. It is light sensitive, so
solutions and media containing it should be kept in the dark.
16. Silwet L-77 (also known as Vac-In-Stuff) acts as surfactant to
allow wetting of embryos which facilitates Agrobacterium
adhesion and penetration by the pili. The Silwet solution
should preferably be made fresh for each experiment, but if
stored at 4 °C it can be kept for about a month.
17. Silver nitrate acts as stress-inducing agent in the initial induc-

tion phase to promote embryogenesis. It is light sensitive, so
stocks and any media containing it should be stored in the
dark.
18. Ideally plates should be poured and used as fresh as possible
yet should be allowed to incubate for a few days at room
temperature to check for contamination. If stored at 4 °C they
can be kept for 2–3 weeks.
19. Acetosyringone is used to induce the virulence genes within
the Agrobacterium tumefaciens cells and therefore assist
T-DNA transfer. 200–800 μM acetosyringone can be used in
the inoculation and cocultivation media; higher amounts sup-
posedly improve T-DNA delivery, but this is generally associ-
ated with increased damage to the embryos. A compromise is
necessary therefore to determine which concentration gives
the most suitable results.
20. Small Petri dishes are used for inoculation as they comfortably
hold the 4 mL Agrobacterium culture used for inoculation. If
larger dishes were used, larger culture volumes would need to
be grown.
21. Copper sulfate acts as a stress-inducing agent in the regenera-
tion phase to promote shooting and can be used in the range
12.5–25 mg/L (50–100 μM). If regeneration is good,
12.5 mg/L may be sufficient as the cultures can become too
leafy at 25 mg/L.
22. Immature seeds are at about the right stage when they have a
whitish bloom on the seed surface and the endosperm is just
solidified but not too hard. A few spikelets can be opened at
the time of ear collection to determine whether the seeds are at
the correct stage.
23. Generally only the outer caryopses of each spikelet are used,
and none are taken from the tip or the base of the ear due to
asynchronous seed development.
24. Ideally surface-sterilized seeds should be used on the same day.
If material needs to be collected in advance it is better to store
whole ears at 4 °C with the stems in water prior to removing
the seeds; however, it is not recommended to store these lon-
ger than overnight.
25. The immature scutellum is the callus-forming tissue; if the
embryo axis is left intact it will be prone to germinate on the
culture medium, thereby preventing callus formation. A prac-
tised hand can cut off the embryo axis through the seed coat,
leaving a hole through which the scutellum can be removed.
26. Embryos in the size range 0.8–2.0 mm are ideal for
Agrobacterium-mediated transformation which is slightly
larger than the size advised for transformation via particle

bombardment.
27. Embryos must be freshly isolated for treatment, so one dish at
a time is prepared and the Agrobacterium culture is added as
soon as possible. Various timings of preincubation have shown
that embryos can be left for a maximum of 2 h before treatment
but shorter times improve transformation efficiencies.
28. For the strain/vector combination described, use 200 mg/L
carbenicillin and 100 mg/L kanamycin.
29. 50 mL Falcon tubes (Corning) are used for growing cultures
purely for convenience as they can be readily spun down fol-
lowing growth. Conventional flasks can be used, transferring
to centrifuge tubes for pelleting of Agrobacterium, without
having a marked effect on the result.
30. The Agrobacterium should continue to grow whilst on the
shaker and should be used between 1 and 3 h. Although lon-
ger incubation may still result in transformation, efficiencies
will be reduced.
31. If embryos float off the surface of the medium when the
Agrobacterium culture is poured over, prod them down gently
with a dissection needle to make sure that they remain fully
submerged.
32. Instead of flooding the whole plate with Agrobacterium cul-
ture, individual 10 μL drops can be applied to each embryo for
inoculation. After the hour’s incubation step, slide the embryo
to a different position on the plate, i.e., away from the pool of
Agrobacterium, and continue cocultivation as for embryos
transferred following flooding with Agrobacterium (see Fig. 2b).
33. Control plates should be included in experiments to monitor
callus formation and regeneration, so a plate of embryos
flooded with 4 mL MG/L medium + Silwet L-77 (no
Agrobacterium) should be set up at this stage.
34. Acetosyringone is light sensitive and is present in the
Agrobacterium suspension and cocultivation plates; conse-
quently the incubation step is done in the dark as far as
possible.
35. The incubation period can be between 15 min and 1 h without
undue impact on the result. 1-h incubation is more convenient
as it provides sufficient time to isolate another plate of embryos
ready for the next inoculation treatment.
36. This is an important step: embryos do not like being wet, and
too much Agrobacterium during cocultivation will also cause
damage to the embryos; therefore it is essential to remove as
much of the Agrobacterium culture as possible at this stage.
37. Cultures are incubated in a controlled environment room
at 22–23 °C. Cool white fluorescent tubes generate lighting
levels of ~250 μmol/m2/s PAR for a 12-h photoperiod. Where

dark culture is required, solid trays are covered with foil.
38. In order to aid optimization of transformation protocols a
reporter gene is often included within the T-DNA to act as a
visual marker of transformation. The pAL156 vector described
in this chapter includes the β-glucuronidase (gusA) gene.
Embryos can be sacrificed after cocultivation and assayed for
transient gus activity [17] to determine the effectiveness of the
T-DNA transfer (Fig. 2d). Alternative reporter genes also exist
which do not require a destructive assay and which can be used
to monitor viable tissues in culture over a longer period, e.g.,
GFP.
39. Some Agrobacterium growth is beneficial as it shows it is pres-
ent, but too much overgrowth is not recommended as it is
damaging to the embryos. Growth of the Agrobacteruim needs
to be controlled subsequent to cocultivation therefore all suc-
cessive media contain the antibiotic timentin (ticarcillin diso-
dium salt:clavulanic acid 15:1). Even if the Agrobacterium
appears to be controlled at first it will grow back later on,
so selection pressure is maintained throughout the following
tissue culture steps.
40. Calli from control plates (no Agrobacterium) should be trans-
ferred to selection media without PPT, but timentin should
still be included to act as an appropriate control. Some calli
from control plates should also be put on full selection media
including PPT to demonstrate the effectiveness of the
selection.
41. “High lid” Petri dishes can be used at this stage by using
upturned Petri dish bases as lids; this creates more space for
shoots to develop.
42. Any plantlets originating from the same callus piece should be
regarded as clonal until demonstrated otherwise.
43. Glufosinate ammonium (PPT) is used for selection of plants
transformed with the bar gene. 4 mg/L PPT used in the selec-
tion media described should effectively terminate growth of
non-transformed tissues although this may not be fully obvi-
ous until after the second round of selection. The control
plates and magentas will give a good indication of how well the
selection is working. If too many non-transformed escapes are
identified, 6 mg/L PPT could be used subsequently to provide
more stringent selection pressure.
44. A plant generated from a control plate inoculated without
Agrobacterium and subsequently grown on media without
plant selection should also be potted up to act as a control
which has been through the same experimental conditions but
without Agrobacterium.
45. Plantlets derived from tissue culture have little or no waxy

cuticle and so require a humid environment initially to protect
them from desiccation whilst the cuticle forms.
46. GM glasshouse conditions are maintained at 18–20 °C
day/14–16 °C night temperatures with a 16-h photoperiod
provided by natural light supplemented with banks of SonT
400 W sodium lamps (Osram Ltd., UK) generating a light
intensity of 400–1,000 μmol/m2/s PAR.
Acknowledgements
Rothamsted Research receives strategic funding from the

Biotechnological and Biological Sciences Research Council
(BBSRC).
References
1. Blechl AE, Jones HD (2009) Transgenic appli- transgenic plants with simple integration
cations in wheat improvement. In: Carver BF patterns. Transgenic Res 9:11–19
(ed) Wheat: science and trade. Wiley-Blackwell, 10. Gadaleta A, Giancaspro A, Blechl AE et al
Ames, IA, pp 397–435 (2008) A transgenic durum wheat line that is
2. Jones HD, Doherty A, Wu H (2005) Review free of marker genes and expresses 1Dy10.
of methodologies and a protocol for the J Cereal Sci 48:439–445
Agrobacterium-mediated transformation of 11. Lazo GR, Stein PA, Ludwig RA (1991) A
wheat. Plant Methods 1:5 DNA transformation-competent Arabidopsis
3. Jones HD (2005) Wheat transformation: cur- genomic library in Agrobacterium.
rent technology and applications to grain Biotechnology 9:963–967
development and composition. J Cereal Sci 12. Hellens RP, Edwards EA, Leyland N et al
41:137–147 (2000) pGreen: a versatile and flexible binary
4. Harwood WA (2012) Advances and remaining Ti vector for Agrobacterium-mediated plant
challenges in the transformation of barley and transformation. Plant Mol Biol 42:819–832
wheat. J Exp Bot 63:1791–1798 13. Komari T, Takakura Y, Ueki J et al (2006)
5. Shrawat AK, Loerz H (2006) Agrobacterium- Binary vectors and super-binary vectors.
mediated transformation of cereals: a promis- Methods Mol Biol 343:15–41
ing approach crossing barriers. Plant 14. Christensen AH, Quail PH (1996) Ubiquitin
Biotechnol J 4:575–603 promoter-based vectors for high-level expres-
6. Vasil IK (2007) Molecular genetic improve- sion of selectable and/or screenable marker
ment of cereals: transgenic wheat (Triticum genes in monocotyledonous plants. Transgenic
aesitvum L.). Plant Cell Rep Res 5:213–218
26:1133–1154 15. Garfinkel M, Nester EW (1980) Agrobacterium
7. Ulker B, Li Y, Rosso MG et al (2008) T-DNA- tumefaciens mutants affected in crown gall
mediated transfer of Agrobacterium tumefa- tumorigenesis and octopine catabolism.
ciens chromosomal DNA into plants. Nat J Bacteriol 144:732–743
Biotechnol 26:1015–1017 16. Cheng M, Fry JE, Pang SZ et al (1997)
8. Altpeter F, Baisakh N, Beachy R et al (2005) Genetic transformation of wheat mediated by
Particle bombardment and the genetic Agrobacterium tumefaciens. Plant Physiol
enhancement of crops: myths and realities. 115:971–980
Mol Breed 15:305–327 17. Jefferson RA, Kavanagh TA, Bevan MW
9. Fu X, Duc LT, Fontana S et al (2000) Linear (1987) Beta-glucuronidase (Gus) as a sensitive
transgene constructs lacking vector back- and versatile gene fusion marker in plants.
bone sequences generate low-copy-number J Cell Biochem 13:3901–3907
Chapter 20
A Protocol for High-Throughput Agrobacterium-Mediated

Barley Transformation
Wendy A. Harwood
Abstract
Agrobacterium-mediated transformation of barley is a valuable tool for determining gene function by
over-expression of a gene of interest or by RNAi-based gene silencing. The method is based on the inocu-
lation of immature embryos with Agrobacterium and uses a hygromycin resistance gene to allow selection
of transgenic plants. The protocol described leads to average transformation efficiencies of 25 % meaning
that large numbers of fertile transgenic plants can be produced.
Key words Barley transformation, Agrobacterium tumefaciens, Immature embryo, Hygromycin

resistance gene
1 Introduction
Transformation systems require three key components: firstly a

regenerable target tissue into which the DNA can be introduced,
secondly an efficient method of DNA delivery, and thirdly an effi-
cient method of selecting transformed tissue. In terms of the DNA
delivery system, the development of efficient Agrobacterium-
mediated methods for the cereals has tended to lag behind the
development of methods using direct DNA transfer methods such
as particle bombardment. However, once optimized, Agrobacterium-
mediated methods have usually proved to be more efficient than
particle bombardment as well as offering advantages such as lower
copy numbers and less rearrangements of the introduced DNA [1].
For barley, particle bombardment-mediated transformation was
first reported in 1994 by Wan and Lemaux [2]. The first report of
Agrobacterium-mediated transformation of barley followed in
1997 [3].
The most popular target tissues for barley transformation are
immature embryos. Other target tissues that have been used
include microspores [4] and ovules [5]. Despite the fact that very
251
252 Wendy A. Harwood
efficient Agrobacterium-mediated methods have now been developed

for barley transformation, the protocols are still very genotype
dependent. The model barley variety giving the highest transfor-
mation efficiencies is the spring variety Golden Promise. One of
the key remaining challenges for barley transformation is to develop
an efficient genotype-independent protocol.
A number of different selection systems have been employed in
barley to distinguish transformed from non-transformed tissue.
These include the bar gene conferring resistance to the glufosinate
group of herbicides. The disadvantage of this selection system is
that a few “escape” plants are able to regenerate and grow in the
presence of the selective agent, bialaphos or phosphinothricin
(PPT). When using the hygromycin resistance gene as a selectable
marker, escapes are extremely rare, and for this reason the hygro-
mycin resistance gene is the preferred selectable marker.
In the method described below, many other aspects of the
transformation system have been optimized leading to a simple but
efficient protocol [6]. The method has been successfully trans-
ferred to a number of laboratories worldwide and has been used to
generate many thousands of transgenic barley plants.
2 Materials
2.1 Plant Material To provide a constant supply of immature embryos for transforma-
tion, seeds of the spring barley genotype Golden Promise are sown
at two weekly intervals. The compost contains a 2:2:1 mix of
Levington M3 compost:Perlite:Grit. The mix also contains a slow-
release fertilizer, Osmocote, at the manufacturer’s recommended
concentration. Seeds are sown directly into 5 cm diameter pots,
and once the plants are approximately 20 cm tall, plants are potted
into 13 cm diameter round pots in the same compost mix. Plants
are grown under controlled conditions with 15 °C day and 12 °C
night temperatures, 80 % relative humidity, and light levels of
500 μmol/m2/s at the mature plant canopy level. Light is provided
by metal halide lamps (HQI) supplemented with tungsten bulbs
(see Note 1).
2.2 Media and Stock 1. Bacterial culture medium MG/L, used for Agrobacterium cul-
Solutions ture [7]: 5.0 g/L tryptone, 5.0 g/L mannitol, 2.5 g/L yeast
extract, 1.0 g/L L-glutamic acid, 250 mg/L KH2PO4,
100 mg/L NaCl, 100 mg/L MgSO4.7H2O, and 10 μL biotin
(0.1 mg/L stock). The media is adjusted to pH 7.2 with
NaOH. For the preparation of plates 15 g/L agar is added.
2. Callus induction (CI) medium: 4.3 g/L Murashige and Skoog
plant salt base, 30 g/L maltose, 1.0 g/L casein hydrolysate,
350 mg/L myoinositol, 690 mg/L proline, 1.0 mg/L thiamine
Agrobacterium-Mediated Barley Transformation 253
HCl, 2.5 mg/L dicamba, 1.25 mg/L CuSO4.5H2O, 3.5 g/L

Phytagel. The media is adjusted to pH 5.8 with 0.1N NaOH.
3. Transition (T) medium: 2.7 g/L Murashige and Skoog-modified
plant salt base (without NH4NO3), 20 g/L maltose, 165 mg/L
NH4NO3, 750 mg/L glutamine, 100 mg/L myoinositol,
0.4 mg/L thiamine HCl, 2.5 mg/L 2,4-dichlorophenoxy acetic
acid (2,4-D), 0.1 mg/L 6-benzylaminopurine (BAP),
1.25 mg/L CuSO4.5H2O, 3.5 g/L Phytagel. The pH is adjusted
to 5.8.
4. Regeneration (R) medium: 2.7 g/L Murashige and Skoog-
modified plant salt base (without NH4NO3), 20 g/L maltose,
165 mg/L NH4NO3, 750 mg/L glutamine, 100 mg/L myo-
inositol, 0.4 mg/L thiamine HCl, 3.5 g/L Phytagel. The pH
is adjusted to 5.8.
5. 100× Vitamin stock for callus induction medium: 100 mg/L
thiamine HCl, 35 g/L myoinositol, and 690 mg/L proline.
This stock should be filter sterilized, ready for use, and stored
at 4 °C.
6. 100× Vitamin stock for transition and regeneration medium:
40 mg/L thiamine HCl and 10 g/L myoinositol. This stock
should be filter sterilized, ready for use, and stored at 4 °C.
7. 2.5 mg/L Dicamba stock: Made up in water, filter sterilized,
divided into 1 mL aliquots, and stored frozen.
8. 2.5 mg/mL 2,4-D stock: Made up in 100 % ethanol, and
stored at −20 °C.
9. 1 mg/mL BAP: Stock made up in water with a few drops of
1 M NaOH and stored frozen.
10. 1.25 g/L CuSO4 stock: 125 mg of CuSO4.5H2O dissolved in
a total volume of 100 mL water, filter sterilized, and stored at
4 °C.
11. 50 mg/mL Hygromycin stock: Prepare stock solution, filter
sterilize, divide into 1 mL aliquots, and store frozen.
12. 160 mg/mL Timentin stock: Stock made up in water, divided
into 1 mL aliquots, and stored frozen.
13. 10 % Sodium hypochlorite stock, purchased commercially.
2.3 Agrobacterium 1. Agrobacterium strain AGL1: This strain has been found to be
Strains and Vectors very efficient for barley transformation.
2. pBRACT vectors (www.bract.org): All vectors used contain
the hpt gene conferring hygromycin resistance under a 35s
promoter at the left border (LB). Any other constructs con-
taining the hygromycin gene under an appropriate promoter
should also work well in barley (see Note 3). A range of vec-
tors are available, for example, containing a gus reporter gene
(pBRACT 204), containing a cassette suitable for over-expression

(pBRACT 214), or containing a cassette for RNAi-based gene
silencing (pBRACT 207) (see Note 4).
2.4 Equipment 1. Forceps: Very fine forceps are required for immature embryo
isolation and removal of the embryonic axis.
2. Binocular microscope, for example Leica MZ6, is required for
immature embryo isolation.
3. Filters for sterilization of solutions, 0.22 µm.
4. Sterile Petri dishes, 9 cm.
5. Deep sterile tissue culture dish, 100 × 20 mm.
6. Glass culture tubes (Sigma C-5916).
7. Micropore™ surgical tape.
8. Water bath.
9. Vacuum pump.
3 Methods
3.1 Preparation of 1. Prepare Phytagel in advance at 2× the required concentration

Tissue Culture Media and sterilize by autoclaving (see Note 5).
2. Filter sterilize all other components of the tissue culture media
components. Weigh all components, except those kept as
sterile stocks, and dissolve in half the required final volume so
that they are all at 2× the required concentration.
3. Adjust the pH to 5.8 using 0.1N KOH.
4. Using a vacuum pump filter sterilize the tissue culture media.
5. Once sterilized, warm both the 2× phytagel and the 2× media
to 60 °C in a water bath.
6. Add the required stocks (vitamins, CuSO4, hormones, and
antibiotics) under sterile conditions to the warm media and
mix.
7. Combine together the media and the Phytagel, mix, and then
pour into 9 cm Petri dishes.
8. For regeneration media (R), use deeper sterile tissue culture
dishes to give developing plantlets more space.
3.2 Preparation 1. Use a single colony of Agrobacterium AGL1, containing the

of Agrobacterium appropriate pBract vector, to inoculate 10 mL of MG/L
Standard Inoculum medium containing 25 μg/mL rifampicin and 50 μg/mL
kanamycin.
2. Incubate at 28 °C while shaking at 180 rpm for 40 h.
3. Then add 10 mL of sterile 30 % aqueous glycerol to the bacterial
culture and mix by inverting several times.
Fig. 1 Identification of the correct stage for collection of immature embryos.

(a) Barley spike containing immature embryos of the correct size; (b) sterile
immature grains ready for immature embryo isolation; (c) an intact immature
embryo of the correct size; (d) an immature embryo with the embryonic axis
removed
4. Place aliquots of 400 µL of the standard inoculum into 0.5 mL

Eppendoff tubes and maintain at room temperature for 2 h
mixing by inversion every 30 min.
5. Store the standard inoculums at −80 °C ready for use.
3.3 Isolation 1. Collect barley spikes from donor plants grown under con-
of Barley Immature trolled conditions when the immature embryos are 1.5–2 mm
Embryos in diameter (see Note 6) (Fig. 1a). Before cutting a spike,
check the stage by taking a single immature seed from the
center of the spike and checking the size of the immature
embryo (Fig. 1c).
2. Remove the immature seeds from the spike, and break the
awns off without damaging the seed coat.
3. Place the immature seeds in a screw top jar and sterilize by

firstly washing in 70 % ethanol for 30 s followed by three
washes in sterile distilled water.
4. Perform all sterilization steps in a laminar flow hood. Further
sterilize the immature seeds in a solution of 1:1 diluted sodium
hypochlorite stock solution in water for 4 min. Then rinse with
four washes in sterile distilled water after which the immature
seeds are drained but left wet in the screw top sterile jar (Fig. 1b).
3.4 Isolation All steps in the isolation of immature embryos are also performed
of Immature Embryos in a laminar flow hood under sterile conditions.
and Removal of
1. Place the sterile seeds, approximately 20 at a time, onto a sterile
Embryonic Axis
black tile under a dissecting microscope.
2. Hold the seed firmly by pushing the tips of a pair of fine forceps
into the seed at the end opposite the embryo.
3. Using a second pair of fine forceps expose the immature
embryo by peeling back the seed coat.
4. Remove the embryonic axis using a pinching action with the
fine forceps (see Note 7) (Fig. 1d).
5. After isolation, place each embryo with scutellum side up on
CI medium. Twenty-five embryos are placed on each 9 cm
plate ready for Agrobacterium inoculation. The embryos are
arranged as shown in Fig. 2a and are stored at 23–24 °C in the
dark until inoculation with Agrobacterium.
3.5 Agrobacterium 1. Prepare an overnight Agrobacterium culture by adding one

Preparation, of the prepared standard inoculums to 10 mL of liquid MG/L
Inoculation, and medium without any antibiotics.
Cocultivation 2. Incubate at 28 °C overnight (approximately 20 h), and shake
at 180 rpm. The full-strength Agrobacterium culture is then
used to inoculate the embryos.
3. Using a 200 µL pipette, drop a small volume of Agrobacterium
culture solution onto each embryo so that the surface is
just covered. 200 µL of Agrobacterium culture is enough to
inoculate 25 immature embryos.
4. Once all 25 embryos on a plate have been treated, tilt the plate
to allow any excess Agrobacterium culture to run off the
embryos and to allow the embryos to dry.
5. After a maximum of three plates of 25 embryos are treated
with Agrobacterium, gently remove the embryos from the first
plate and transfer to fresh callus induction medium, scutellum
side down. During the transfer, care is taken not to transfer
excess culture medium with the embryos and if necessary the
embryos are gently dragged across the surface of the medium
to remove excess medium before transferring to a fresh plate.
Fig. 2 The stages of the barley transformation process: (a) Immature embryos arranged ready for inoculation;
(b) embryogenic callus developing from an immature embryo; (c) the initiation of shoots on T medium;
( d) regeneration of transgenic plantlets on R medium; (e) transgenic barley rooting in glass culture tubes;
(f) transgenic barley just after transfer to soil; (g) transgenic barley growing to maturity in the glasshouse
6. Seal the plates with micropore surgical tape and the embryos
co-cultured with the Agrobacterium at 23–24 °C for 3 days.
Immature embryos are usually isolated one day and inoculated
the next day. However it is possible to inoculate the embryos
on the same day as they are isolated without reducing the
transformation efficiency.
3.6 Selection of During all of the selection stages of the transformation process,
Transformed Material hygromycin is added to the relevant media at 50 mg/L. In addition,
the antibiotic ticarcillin with clavulanic acid (otherwise known as
timentin) is also added at 160 mg/L during all selection stages.
During callus induction and transition stages, additional copper
(1.25 mg/L CuSO4.5H2O) is added to CI and T media (see Note 2).
1. After 3 days’ cocultivation, transfer the embryos to fresh CI
plates containing hygromycin as the selective agent and
timentin to remove Agrobacterium (see Note 8). Culture the
embryos scutellum side down at 23–24 °C in the dark for 2
weeks; this step is referred to as selection 1.
2. After 2 weeks, transfer the embryos to fresh selection plates as
above (selection 2) (Fig. 2b). Transfer the entire embryo and
callus derived from it as a single unit and do not split up.
3. After a further 2 weeks, transfer each embryo to a third selection
plate (selection 3) (see Note 9). At this stage the callus from
each embryo may break up, and if so, it should be placed in a

marked area of the plate so that all material derived from a
single embryo can be tracked. The number of embryos per
plate should be reduced as the transformed embryo-derived
callus starts to grow rapidly.
4. After 6 weeks on CI selection medium, transfer the embryo-
derived callus to a transition medium (T), again containing
hygromycin and timentin, for 2 weeks at 24 °C under low
light. Low-light conditions are achieved by placing the plates
under light conditions in a tissue culture room but covering
them with a thin sheet of paper. During this 2-week culture
period transformed lines should become obvious and start to
produce green areas and small shoots (Fig. 2c).
3.7 Regeneration 1. Following the 2 weeks on T medium, transfer the embryo-

of Transgenic Plants derived material one final time to R medium, in deep Petri
dishes, without any growth regulators but still with the same
levels of hygromycin and timentin. Transformed lines will
grow very rapidly at this stage, so the number of line per plate
must be further reduced (Fig. 2d).
2. Once shoots are 2–3 cm in length and roots have formed,
remove the small plantlets from the R plates and transfer to
glass culture tubes containing 12 mL of CI medium but with-
out dicamba or other growth regulators (Fig. 2e). Include
hygromycin and timentin at the same concentrations at this
stage. The plantlets should quickly form a strong root system
in the hygromycin-containing medium. Plants which form
strong roots in hygromycin are always found to be transformed
(see Note 10).
3. Well-rooted plants are gently removed from tubes using long
forceps, and all tissue culture medium is washed from the
roots under a running tap. They are then planted in the barley
compost mix in 5 cm diameter pots (Fig. 2f).
4. Cover trays with propagators for 1 week following transfer to
soil to maintain a higher humidity.
5. Collect leaf samples if required for molecular analysis once
plants are established in soil.
6. Grow the transgenic plants to maturity in a similar way to that
described for the donor plants.
4 Notes
1. The quality of the plants used to harvest immature embryos

for transformation is of key importance to the success of the
method. If the plants are of poor quality or have been sprayed,
for example to control mildew, then the transformation

efficiencies will drop. For this reason care should be taken to
grow the donor plants in clean controlled conditions so that it
is not necessary to spray them.
2. Increasing the level of copper in plant tissue culture media has
long been recognized to improve regeneration. We have found
that adding the additional copper during callus induction as
well as during the transition phase leads to an even greater
benefit with much improved regeneration [6].
3. For selection of transgenic tissue and plants, the hygromycin
resistance gene has been found to be the best selection system
for barley. When including hygromycin in the culture media at
50 mg/L, it is extremely rare for any non-transformed plants
to regenerate. T-DNA transfer starts at the right border and
proceeds to the left border. Therefore it is advisable to have
the selectable marker at the left border and the gene of interest
at the right border so that the gene of interest is transferred
first and the selectable marker second. This means that selected
transformed plants have a greater chance of containing the
gene of interest. In our constructs, the hygromycin gene is
under the control of the 35s promoter. Although this is not a
strong promoter in barley it is fine for driving the hygromycin
selectable marker gene. This leaves stronger promoters, such
as the maize ubiquitin promoter or the rice actin promoter,
available to drive the expression of the cassette containing the
gene or the sequence of interest.
4. The pBRACT vectors are based on pGreen, which is a small,
versatile vector designed for easy manipulation in E. coli with a
high copy number [8]. To enable the small size of pGreen, the
pSa origin of replication required for replication in
Agrobacterium is separated into its two distinct functions. The
replication origin (ori) is present on pGreen, and the trans-
acting replicase gene (RepA) is present on an additional vec-
tor, named pSoup. Both vectors are required in Agrobacterium
for pGreen to replicate.
5. Phytagel will not solidify until the other culture medium com-
ponents are added. For this reason it can be prepared at 2×
concentration in advance, autoclaved, and stored at room
temperature until needed.
6. The optimum size of immature embryos for transformation is
1.5 mm in diameter. If embryos are smaller than this, they are
difficult to handle and are more likely to suffer from over-
growth of Agrobacterium. Embryos larger than 2 mm in
diameter will respond less well in culture and produce less
embryogenic callus. To help identify immature embryos at the
correct stage, the endosperm of the immature seeds should
still be soft and quite liquid in appearance.
7. The easiest way to isolate the immature embryo and remove the
embryonic axis is to carry out this operation in one step, leaving
the exposed immature embryo inside the seed while the axis is
removed. The embryo is exposed by peeling back the seed coat
from the awn end of the seed. Make sure that the seed is placed
on the tile with the groove down so that the immature embryo
will be on the upper surface. Once the embryo is exposed the
embryonic axis can be removed by first pinching off the shoot
axis with the fine forceps and secondly removing the root axis
with a second pinching action. This should leave only the
undamaged scutellum.
8. Using the procedure described, excessive overgrowth of the
immature embryos with Agrobacterium should be avoided.
However, if any embryos are completely overgrown with
Agrobacterium following the cocultivation then they should
be discarded.
9. If callus growth looks good after 4 weeks of selection then it is
possible to omit the final 2 weeks’ selection on CI medium
(selection 3) and transfer to transition medium at this stage. If
in any doubt continue with selection 3 as this is likely to yield
better results.
10. Transformation efficiency is defined as the number of indepen-
dent transformed plants as a percentage of the original number
of immature embryos treated.
References
1. Travella S, Ross SM, Harden J et al (2005) A 5. Holme IB, Brinch-Pedersen H, Lange M et al
comparison of transgenic barley lines produced (2008) Transformation of different barley
by particle bombardment and Agrobacterium- (Hordeum vulgare L.) cultivars by Agrobacterium
mediated techniques. Plant Cell Rep tumefaciens infection of in vitro cultured ovules.
23:780–789 Plant Cell Rep 27:1833–1840
2. Wan Y, Lemaux PG (1994) Generation of large 6. Bartlett JG, Alves SC, Smedley M et al (2008)
numbers of independently transformed fertile High-throughput Agrobacterium-mediated
barley plants. Plant Physiol 104:37–48 barley transformation. Plant Methods 4:22
3. Tingay S, McElroy D, Kalla R et al (1997) 7. Garfinkel M, Nester EW (1980) Agrobacterium
Agrobacterium tumefaciens-mediated barley tumefaciens mutants affected in crown gall tumori-
transformation. Plant J 11:1369–1376 genesis and octopine catabolism. J Bacteriol
4. Shim YS, Pauls KP, Kasha KJ (2009) 144:732–743
Transformation of isolated barley (Hordeum 8. Hellens RP, Edwards EA, Leyland NR et al
vulgare L.) microspores: I. The influence of pre- (2000) pGreen: a versatile and flexible binary Ti
treatments and osmotic treatment on the time vector for Agrobacterium-mediated plant trans-
of DNA synthesis. Genome 52:166–174 formation. Plant Mol Biol 42:819–832
Chapter 21
Agrobacterium-Mediated Transformation:
Rice Transformation
Inez H. Slamet-Loedin, Prabhjit Chadha-Mohanty,
and Lina Torrizo
Abstract
Agrobacterium is a common soil bacterium with natural capacity for trans-kingdom transfer of genetic
information by transferring its T-DNA into the eukaryotic genome. In agricultural plant biotechnology,
combination of non-phytopathogenic strain of Agrobacterium tumefaciens with modified T-DNA and vir-
genes in a binary vector system is the most widely utilized system for genetic improvement in diverse plant
species and for gene function validation. Here we have described a highly efficient A. tumefaciens-mediated
transformation system for indica and japonica rice cultivars based on an immature embryo system.
Key words Agrobacterium, Rice, Transformation, Indica, Immature embryo, Gene transfer
1 Introduction
Functional genomic study and efficient production of transgenic

crops require the establishment of an efficient transformation plat-
form. The two most widely used methods for rice transformation
are Agrobacterium-mediated transformation and particle gun-
mediated DNA delivery [1]. The Agrobacterium-mediated method
generally results in higher transformation efficiency and higher fre-
quency of single intact copy of the transgene [2, 3] with little rear-
rangement as compared to direct DNA delivery methods such as
particle bombardment. Agrobacterium-mediated transformation
has been widely reported in monocots including rice, but finding a
reliable and efficient system for genetic transformation that can be
applied across different major rice varieties remains a challenge.
A mature seed transformation system, which is more convenient
since it is not limited by the availability of immature embryo, is
very efficient for japonica varieties (6.2–50 %) but generally results
in a low transformation frequency for indica cultivars.
261
262 Inez H. Slamet-Loedin et al.
A major advance in rice transformation was reported by Hiei

and Komari [4, 5] using Agrobacterium, describing an efficient
transformation procedure for japonica and indica rice cultivars.
The important factors for efficient rice transformation of immature
embryos of both japonica and indica varieties [5] are use of fresh
healthy embryos and optimization of media compositions. This
chapter describes an improved and reproducible protocol, modi-
fied from the original method of Hiei and Komari for the produc-
tion of transgenic rice plants for a range of indica rice genotypes,
using immature embryos and giving a high transformation effi-
ciency in indica rice. We have established a high-efficiency protocol
for Agrobacterium-mediated transformation, routinely applied for
functional genomic study [6], with efficiency for japonica varieties
in the range of 90–100 % and elite indica variety IR64 in the range
of 25–40 % and applicable to greenhouse-, screenhouse-, and field-
harvested immature embryos. To achieve higher efficiency we
modified the bacterial cell culture density, altered the composition
of the pre-regeneration and regeneration media, and used the
open-source pCAMBIA-based binary vector system (http://www.
cambia.org/daisy/cambialabs/home.htm) in combination with
the LBA 4404 Agrobacterium strain.
2 Materials
Prepare all solutions using ultrapure water (prepared by purifying

RO water through the MQ system of Millipore™ attached with a
0.22 μm Millipore filter) or double-distillated water and analytical
grade reagents. Prepare and store all solutions in a refrigerator
(4–8 °C) unless indicated otherwise. Diligently follow all waste
disposal and biosafety regulations when disposing of waste materi-
als. Conduct bacterial work, transformation, and tissue culture
process in a laminar airflow cabinet to maintain sterility; utilize the
appropriate laminar airflow cabinet as requested by the regulation.
Conduct all media autoclaving at 115 °C for 15 min.
2.1 Agrobacterium The Agrobacterium plate culture medium components are listed in
Culture Component Table 1. Autoclave the three stock solutions separately. Add 25 mL
each of stocks I and II to 450 mL of stock III. Add suitable
antibiotics depending on the antibiotic-resistant gene present in
the binary plasmids and Agrobacterium strain (e.g., spectinomycin
50 mg/L or kanamycin and hygromycin 50 mg/L).
2.2 Other 1. Sterilizing solution component: 70 % ethanol, 1 % sodium hypo-

Components chlorite (containing one to two drops of Tween 20) solution.
2. Platform shaker.
3. Falcon tubes, 50 mL.
4. Stereomicroscope.
Agrobacterium Transformation of Indica Rice 263
Table 1
AB [7] medium for culture of Agrobacterium
Components Amount (g/500 mL) Molarity

Stock I
KH2PO4 30.0 0.22
NaH2PO4 10.0 0.083
Stock II
NH4Cl 10.0 0.187
MgSO4.7H2O 3.0 0.012
KCl 1.5 0.020
CaCl2 0.1 9.0 × 10−4
FeSO4.7H2O 0.025 9.0 × 10−5
Stock III (g per 900 mL)
Glucose 5.0 0.028
Agar 15.0
5. Sterile filer papers.

6. Sterile petri plates.
2.3 Transformation The components of stock solutions used in the different media for
and Tissue Culture rice transformation are shown in Table 2. Table 3 shows the
Medium, Rooting preparation of culture medium coded as A200 for infection medium,
Media Component A201 for cocultivation medium, A202 for resting medium, A203
for selection medium, A204 for the pre-regeneration medium, and
A205 for regeneration medium. Rooting medium is the Murashige
and Skoog medium as presented in Tables 2 and 3. Put about
700 mL of ultrapure water for every liter medium in a beaker with
stirrer. Add the specified amount of stock solutions. Weigh amino
acids, sucrose, and other components separately and add to the
medium. Adjust medium to 1 L. Adjust the pH of the medium as
specified.
2.4 Other Refer to Table 4 for details.

Components
3 Methods
Prepare the culture media and store them in a refrigerator (4 °C)

except for antibiotic stocks which should be stored at −20 °C.
Carry out the Agrobacterium streak culture in a laminar air-down-
flow cabinet and tissue culture in a laminar airflow cabinet to
maintain sterile conditions.
Table 2
Preparation of stock solutions and media for immature embryo transformation
Stock solution (volume) Component Weight Molarity

N6 [8] major 1 (1 L) KNO3 141.5 g 1.40
N6 major 2 (1 L) MgSO4.7H2O 18.5 g 0.075
(NH4)2SO4 46.3 g 0.35
N6 major 3 (1 L) KH2PO4 40 g 0.294
N6 major 4 (1 L) CaCl2.2H2O 16.6 g 0.11
B5 [9] minor 1 (1 L) FeSO4.7H2O 2.785 g 0.01
Na2EDTA.2H2O 3.725 g 0.01
B5 minor 2 (1 L) MnSO4.4H2O 1g 4.4 × 10−3
ZnSO4.7H2O 0.2 g 7.0 × 10−4
H3BO3 0.3 g 4.85 × 10−3
B5 minor 3 (1 L) KI 0.075 g 4.5 × 10−4
B5 minor 4 (1 L) CuSO4.5H2O 0.0025 g 1.0 × 10−5
Na2MoO4.2H2O 0.025 g 1.0 × 10−4
CoCl2.6H2O 0.0025 g 1.05 × 10−5
B5 vitamins (100 mL) Thiamine HCl 200 mg 6.0 × 10−4
Pyridoxine HCl 20 mg 1.0 x10−4
Nicotinic acid 20 mg 1.6 × 10−5
Myoinositol 2,000 mg 0.011
AA [10] macro salts (1 L) CaCl2.2H2O 1.5 g 0.01
MgSO4.7H2O 2.49 g 0.01
NaH2PO4.2H2O 1.7 g 0.01
KCl 29.5 g 0.4
AA micro salts (1 L) CoCl2.6H2O 25 mg 1 × 10−4
CuSO4.5H2O 25 mg 1.0 × 10−4
H3BO3 3,000 mg 0.0485
KI 750 mg 4.5 × 10−3
MnSO4 8.9 g 0.059
Na2MoO4.2H2O 250 mg 1.0 × 10−3
ZnSO4.7H2O 2,000 mg 7.0 × 10−3
AA iron stock (1 L) FeSO.7H2O 2.78 g 0.01
Same as B5 minor 1
Na2EDTA.2H2O 3.73 g 0.01
(continued)
Table 2
(continued)
Stock solution (volume) Component Weight Molarity

Glycine (1 L) (filter sterilize 7.5 g 0.10
and store at −20 °C)
MS [11] 1 (1 L) KNO3 95 g 0.94
NH4NO3 82.5 g 1.03
MS2 (1 L) MgSO4.H2O 37 g 0.267
MnSO4.4H2O 2.23 g 0.01
ZnSO4.7H2O 0.86 g 0.003
CuSO4.5H2O 0.0025 g 1.0 × 10−5
MS3 (1 L) CaCl2.2H2O 44 g 0.3
KI 0.083 g 5 × 10−4
CoCl2.6H2O 0.0025 g 1.0 × 10−5
MS4 (1 L) KH2PO4 17 g 0.125
H3BO3 0.62 g 0.010
Na2MoO4.2H2O 0.025 g 1.0 × 10−4
MS vitamins (100 mL) Nicotinic acid 10 mg 8.1 × 10−5
Pyridoxine HCl 10 mg 4.9 × 10−5
Thiamine HCl 2 mg 6 × 10−6
Glycine 40 mg 5.33 × 10−4
Myoinositol 2,000 mg 0.011
A1. Stock solutions: Components are dissolved in MQ water and stored at 4 °C
3.1 Agrobacterium 1. Three days before immature embryo (IE) transformation,

Culture streak Agrobacterium from glycerol stock onto AB plate
(see Table 1 for preparation) with suitable antibiotics depend-
ing on the plasmid.
2. Incubate Agrobacterium culture in the dark at 28 °C for 2–3
days.
3.2 Panicle 1. Harvest panicles at 8–12 days after anthesis (see Notes 6 and 7).
Harvesting and Dehull developing seeds and put in 50 mL Falcon tubes.
Immature Embryo 2. Add sterilizing solution, and incubate the 50 mL tubes with
Sterilization and constant shaking for 5 min. Rinse at least five times with plenty
Isolation of sterile distilled water.
3. Isolate immature embryos (under a stereomicroscope, if needed).
Table 3
266
Media composition and amount of stock requirement for rice transformation media preparation
Stock solution Amount of stock to take per liter of medium (mL)

A200 A201 A202 A203 A204 A205 MS0
N6 major 1 20 20 20
N6 major 2 10 10 10
N6 major 3 10 10 10
N6 major 4 10 10 10
Inez H. Slamet-Loedin et al.
B5 [8] minor 1 10 10 10 10 10 10
B5 minor 2 10 10 10
B5 minor 3 10 10 10
B5 minor 4 10 10 10
B5 vitamins 1 5 5 5
AA macro salts 100
stock
AA micro salts 1
stock:
AA iron stock 10
Glycine 1
MS1 20 20 20
MS2 10 10 10
MS3 10 10 10
MS4 10 10 10
MS vitamins 5 5 5
Chemical Amount of chemical in mg (mol) to add per liter of medium
L-glutamine 876 (0.006) 6 × 10−3 300 300
−3
Aspartic acid 260 (0.002) 2.0 × 10
Arginine 174 (0.001) 1.0 × 10−3
Casamino acid 500 500 500 500
−3 −3
L-proline 500 (4.3 × 10 ) 500 (4.3 × 10 ) 500 (4.3 × 10−3)
Sucrose 200,000 20,000 (0.058) 30,000 3,000 (0.088)
(0.058) (0.088)
D-glucose 10,000 10,000 (0.056)
(0.056)
Mannitol 36,000 (0.197) 36,000 (0.197)
Maltose 20,000 (0.058) 20,000 (0.058) 30,000 (0.088)
Sorbitol 20,000 (0.11)
Adjust volume to 1 liter
pH 5.2 5.2 5.8 5.8 5.8 5.8 5.8
Agarose type 1 5,500 10,000
Gelrite 5,000 5,000 3,000 2,000
Microwave medium to melt Gelrite
Dispense in
20 mL/tube
See Note 1 See Note 2 See Note 3
Agrobacterium Transformation of Indica Rice
Acetosyringone 100 μM (add 19.62 mg

before use) dissolved in
1 mL DMSO
267
(continued)
Table 3
268
(continued)
Growth regulator Amount to add per liter of medium (mL)—see Note 4

2,4-D 2 1 1
NAA 1 1 1 5 1
BAP 1 0.2 0.2
Kinetin 2 2
Antibiotic Amount to add per liter of medium (mL)—see Note 5
Cefotaxime 1 1 1 1
Inez H. Slamet-Loedin et al.
Carbenicillin 1 1
Hygromycin 0.6 1 1
Dispense 25 mL in 100 × 15 petri dish Dispense 35 mL in 100 × 20 petri dish to solidify
to solidify
Table 4
Other media composition and amount of stock requirement for rice transformation media preparation
Weight (molar Storage

Stock solution (vol) concentration) Preparation temperature
Growth regulators
BAP (10 mL) 10 mg (4.44 × 10−5) Dissolve in 1N NaOH (0.2 mL per 4 °C
10 mg BAP) and complete to volume
with MQ water; filter sterilize
and aliquot in Eppendorf tubes
2,4-D (50 mL) 50 mg (2.26 × 10−4) Dissolve in 1 M KOH (2 mL per 50 mL 4 °C
stock) and complete volume with MQ
water; filter sterilize and aliquot in
Eppendorf tubes
Kinetin (25 mL) 25 mg (1.16 × 10−4) Dissolve in 1N NaOH and complete −20 °C
volume with MQ water; filter sterilize
NAA (20 mL) 20 mg (1.074 × 10−4) Dissolve in 1N NaOH and complete 4 °C
volume with MQ water; filter sterilize
Antibiotics
Carbenicillin (10 mL)1,000 mg Dissolve in MQ water, filter sterilize −20 °C
and aliquot in sterile Eppendorf tubes
Cefotaxime sodium 5,000 mg Dissolve in MQ water, filter sterilize −20 °C
(50 mL) and aliquot in sterile Eppendorf tubes
Hygromycin B Ordered and used Aliquot in sterile Eppendorf tubes 4 °C
directly as
50 mg/L stock
3.3 Immature 1. 1 h prior to infection of IEs, take about one full loop (3 mm
Embryo loop size) of Agrobacterium culture from AB plate and sus-
Transformation: pend in A200 medium contained in a Falcon tube.
Cocultivation 2. Pipet or invert the tube gently several times for even mixing.
Adjust bacterial density to 3 × 109 cfu/mL (OD 0.3). Incubate
the suspension in the dark at 25 °C for 1 h (incubator) prior to
infecting the IEs.
3. Place the IEs with the scutellum side up onto A201 medium.
Drop 5 μL of Agrobacterium suspension to each IE. Incubate
cultures in the dark at 25 °C for 7 days. Place 50 IEs per plate.
3.4 Resting Culture 1. After cocultivation period, place IEs on a sterile filter paper and
and Selection remove elongated shoots with a scalpel.
2. Quick-dry the IEs several times by gently pressing these

between two layers of sterile filter papers (see Note 8).
3. Transfer IEs with the scutellum side up onto A202 resting
medium. Place 16 IEs per petri dish. Incubate under continu-
ous light at 30 °C for 5 days.
4. Transfer IEs onto A203 selection medium and incubate under
continuous light at 30 °C for 10 days; alternatively, each
embryo may be cut into four pieces or more (first selection).
Place eight to ten IEs per plate.
5. Transfer IEs onto fresh A203 medium and incubate under
continuous light at 30 °C for 10 days (second selection).
6. Separate the embryogenic callus from the black callus tissue,
and transfer the embryogenic calli to fresh A203 medium.
Incubate under continuous light at 30 °C for 10 days (third
selection).
3.5 Plant 1. Transfer resistant calli to A204 pre-regeneration medium at

Regeneration 6–8 callus lines per petri dish. Incubate under continuous light
at 30 °C for 10 days.
2. Select proliferating calli with green spots and transfer to A205
regeneration medium. Place four callus lines per petri dish.
Label each regenerable callus line.
3. Carefully select one plantlet from each callus line and inoculate
into a tube containing MS0 rooting medium. Barcode-label
the plant ID on each test tube. Keep the plantlets under con-
tinuous light at 25 °C for 14 days. Keep original petri dishes
with plantlets as backup.
4. If a callus line has not regenerated plants but has small shoots,
transfer these to a fresh A205 medium to allow the shoots to
grow into plantlets. Incubate under continuous light at 30 °C
for 14 days, and once plantlets have developed, transfer to
MS0 for a better rooting for 1–2 weeks.
4 Notes
1. A200 is filter sterilized and stored at 4 °C; add acetosyringone

just before use for transformation.
2. For the rest of the media in solid form (A201–A205), add the
gelling agent prior to autoclaving at 115 °C for 15 min.
3. For A201, add acetosyringone to the autoclaved medium and
maintain at 55 °C prior to dispensing.
4. Likewise, add growth regulators and antibiotics to media and
cool to 55 °C.
5. Dispense solid media in appropriate size of petri dishes and

store at 4 °C.
6. Embryo size at about 1.3–1.8 mm is crucial; a very-small-size
embryo will not survive.
7. Screenhouse-grown material will be a better option for less
occurrence of microbial contamination; however, a healthy
field-grown material has been shown to also result in a good
transformation frequency and manageable contamination.
8. Properly dry the embryos to avoid bacterial overgrowth, but
do not damage the embryo and ensure a quick process to avoid
drying.
Acknowledgement
Establishment of the protocol was supported by USAID grant

number DPPC2004-17. Technical support of F. Montecillo and
facilitation of P. Herve and G. Barry are acknowledged.
References
1. Tyagi AK, Mohanty A (2000) Rice transfor- from traditional rice confers tolerance of
mation for crop improvement and functional phosphorus deficiency. Nature 488:535–539
genomics. Plant Sci 158:1–18 7. Clark DJ, Maaløe O (1967) DNA replication
2. Iyer LM, Kumplata SP, Chandrasekharan MB and the division cycle in Escherichia coli. J Mol
et al (2000) Transgene silencing in monocots. Biol 1:99–112
Plant Mol Biol 43:323–346 8. Chu C-C (1978) The N6 medium and its
3. Hiei Y, Ohta S, Komari T et al (1994) Efficient application to anther culture of cereal crops.
transformation of rice (Oryza sativa L.) mediated In: Proc. Symp. plant tissue culture. Science
by Agrobacterium and sequence analysis of the Press, Peking, pp 43–50
boundaries of the T-DNA. Plant J 6:271–2824 9. Gamborg OL, Miller RA, Ojima K (1968)
4. Hiei Y, Komari T (2006) Improved protocols Plant cell cultures 1, nutrient requirements of
for transformation of indica rice mediated by suspension cultures of soybean root cells. Exp
Agrobacterium tumefaciens. Plant Cell Tissue Cell Res 50:151–158
Organ Cult 85:271–283 10. Toriyama K, Hinata K (1985) Cell suspension
5. Hiei Y, Komari T (2008) Agrobacterium- and protoplast culture in rice. Plant Sci
mediated transformation of rice using imma- 41:179–183
ture embryos or calli induced from mature 11. Murashige T, Skoog F (1962) A revised
seed. Nat Protoc 3:824–834 medium for rapid growth and bio-assays with
6. Gamuyao R, Joong Hyoun Chin JH, Pariasca- tobacco tissue cultures. Physiol Plant
Tanaka J et al (2012) The protein kinase Pstol1 15:473–497
Chapter 22
Agrobacterium-Mediated Transformation of Maize

(Zea mays) Immature Embryos
Hyeyoung Lee and Zhanyuan J. Zhang
Abstract
Agrobacterium tumefaciens-mediated transformation is one of the most efficient and simple gene delivery
systems for genetic improvement and biology studies in maize. This system has become more widely used
by both public and private laboratories. However, transformation efficiencies vary greatly from laboratory
to laboratory for the same genotype. Here, we illustrate our advanced Agrobacterium-mediated transfor-
mation method in Hi-II maize using simple binary vectors. The protocol utilizes immature embryos as
starting explants and the bar gene as a selectable marker coupled with bialaphos as a selective agent. The
protocol offers efficient transformation results with high reproducibility, provided that some experimental
conditions are well controlled. This transformation method, with minor modifications, can be also
employed to transform certain maize inbreds.
Key words Agrobacterium tumefaciens, Hi-II, Maize, Simple binary vectors, bar
1 Introduction
Genetic transformation has become an important tool for biologi-

cal research and genetic improvement in maize. As a natural DNA
delivery vehicle, Agrobacterium is a good choice for introducing
foreign genes into host plants for successful expression. This is
because this delivery tool usually inserts a high percentage of sin-
gle- or low-copy numbers of T-DNA into the host genome with
relatively rare rearrangement.
Routine maize regeneration and Agrobacterium-mediated
transformation were difficult previously because of the recalci-
trance of maize in vitro regeneration and Agrobacterium infection.
Hiei et al. [1] developed a highly efficient Agrobacterium-mediated
transformation method in rice using embryogenic callus and super-
binary vectors containing an extra copy of virB, virC, and virG.
Subsequently Ishida et al. [2] first reported stable transformation
of maize inbred lines (A-188) at a frequency of 5.5 % employing
273
274 Hyeyoung Lee and Zhanyuan J. Zhang
immature embryos and superbinary vectors. Zhao et al. [3–5]

further improved maize transformation by deploying maize Hi-II
immature embryos as a starting explant tissue in combination with
improved infection conditions. These conditions included the use
of the phenolic compound acetosyringone, a low pH medium, and
superbinary vectors to enhance maize transformation. More
recently, the use of the antioxidant, L-cysteine, has made it possible
not only to improve maize Hi-II transformation [5] but also to
transform three inbred lines (B104, B114, and ky21) more effi-
ciently using a simple binary vector system [6]. To further improve
maize transformation, we have previously optimized inoculation
and cocultivation condition by employing the two antioxidants,
L-cysteine and dithiothreitol (DTT), coupled with low-salt media
[7]. Such improvements have allowed maize Hi-II transformation
at over 12 % efficiency without the use of a superbinary vector.
To extend Agrobacterium-mediated transformation methodol-
ogy to maize inbred or elite lines, several attempts have been made
using different target tissues, such as mature embryos [8], imma-
ture embryos [9, 10], and the seedling nodal area from dry seeds
[11]. However, most public laboratories have adopted maize Hi-II
transformation using immature embryos and simple binary vectors
[6, 7]. Here we describe our advanced maize Hi-II transformation
protocol [7] with tips for high-frequency and reproducible trans-
formation results. This protocol, with minor modifications, can be
also used in transformation of certain maize inbred [12].
2 Materials
2.1 Plant Materials Maize Hi-II immature embryos derived from the self-pollinated
ears (F2) of the F1 cross between Hi-II A and Hi-II B are used as
starting material (see Note 1).
2.2 Agrobacterium All semisolid media for agrobacterial growth are solidified with
tumefaciens 15 g/L Bacto agar (Fisher), contained in 100 × 15 petri dishes, and
and Media stored at −4 °C before use.
1. Use A. tumefaciens EHA101 [13] for Hi-II Agrobacterium-
mediated transformation. Strains LBA4404 [14] and AGL1
[15] can also be used.
2. AB salts 20×: 20 g NH4Cl, 6 g MgSO4·7H2O, 3 g KCl, 0.2 g
CaCl2, and 0.05 g FeSO4·7H2O are dissolved in 1 L ddH2O.
This stock solution is filter sterilized and stored at −4 °C.
3. AB buffers 20×: 60 g K2HPO4 and 20 g NaH2PO4 are dis-
solved in 1 L ddH2O. This stock solution is filter sterilized and
stored at −4 °C.
4. Stock C: 250 g glucose is dissolved in 1 L ddH2O. This stock
solution is filter sterilized and stored at −4 °C.
5. 50 mg/mL Kanamycin sulfate stock in ddH2O: This stock

solution is filter sterilized and stored at −20 °C.
6. 25 mg/mL Chloramphenicol stock in 50 % EtOH: This stock
solution is filter sterilized and stored at −20 °C. To dissolve
chloramphenicol in 50 % EtOH, let the chloramphenicol dis-
solve in 100 % EtOH (half of final stock volume) and then
make 1:1 dilution with ddH2O before it is filter sterilized.
7. ABC medium [16]: 880 mL ddH2O and 3.9 g MES with pH
5.6 are mixed well and autoclaved. After autoclaving, AB salts
20× (50 mL/L), AB buffers 20× (50 mL/L), stock C
(20 mL/L), and appropriate antibiotics are added after filter
sterilized.
8. YEP medium [17]: 10 g/L peptone, 5 g/L yeast extract,
5 g/L NaCl, pH 7.0. After autoclaving, the appropriate anti-
biotics are added.
9. #11 razor blade (Fisher).
2.3 Maize All semisolid media are contained in 100 × 15 mm petri dishes and
Transformation are stored at −4 °C before use. The pH of all media except for
inoculation medium was adjusted to 5.8 before autoclaving.
1. 2,4-dichlotophenoxyacetic acid (2,4-D): Dissolve 100 mg of
2,4-D in 2 mL 1N NaOH and adjust the final volume of
100 mL with ddH2O. Store the stock solution at −4 °C (see
Note 2).
2. Bialaphos: Dissolve 200 mg of bialaphos in 40 mL ddH2O.
Filter sterilize the stock and store at −4 °C.
3. Silver nitrate: Dissolve 340 mg of silver nitrate in 40 mL ddH2O.
Filter sterilize the stock and store at −4 °C (see Note 3).
4. Acetosyringone (AS): Dissolve 0.196 g of acetosyringone in
5 mL methanol first. Then add 5 mL ddH2O to make final
volume to 10 mL. Filter sterilize the stock solution and store
at −20 °C in 1 mL aliquots (see Note 4).
5. N6 vitamin (1,000×) [18]: Dissolve 0.1 g glycine, 0.05 g thia-
mine HCl, 0.025 g pyridoxine HCl, and 0.025 g nicotinic
acid in 50 mL of ddH2O. Filter sterilize the stock solution and
store at −4 °C.
6. MS vitamin (1,000×) [19]: Dissolve 5 g myoinositol, 0.025 g
nicotinic acid, 0.005 g thiamin HCl, and 0.025 g pyridoxine
HCl in 50 mL of ddH2O. Filter sterilize this stock solution
and store at −4 °C.
7. Glycine: 100 mg glycine is dissolved in 50 mL ddH2O. Filter
sterilize the stock solution and store at −4 °C.
8. PHI-A, inoculation medium: 2 g/L N6 salts, 68.5 g/L
sucrose, 36 g/L glucose, 0.7 g/L L-proline, 0.5 g/L MES,
1.5 mL/L 2,4-D, 1 mL/L N6 vitamin, pH 5.2. Filter sterilize
this medium and store at −20 °C for up to 2 months. AS is

added right before use.
9. PHI-B, cocultivation medium: 2 g/L N6 salts, 30 g/L
sucrose, 0.7 g/L L-proline, 0.5 g/L MES, 1.5 mL/L 2,4-D
and 5 g/L agar (Sigma-Aldrich), pH 5.8. After autoclaving,
add filter-sterilized 1 mL/L N6 vitamin, 0.1 mL/L silver
nitrate, and 1 mL/L AS. Also add freshly dissolved 0.4 g
L-cysteine and 0.154 g DTT in 10 mL ddH2O.
10. PHI-C, resting medium: 4 g/L N6 salts, 30 g/L sucrose,

0.7 g/L L-proline, 0.5 g/L MES, 1.5 mL/L 2,4-D, and
3 g/L Gelrite (Sigma-Aldrich), pH 5.8. After autoclaving, add
filter-sterilized 1 mL/L N6 vitamin and 0.1 mL/L silver
nitrate. Add freshly dissolved 250 mg/L cefotaxime in 10 mL
ddH2O.
11. PHI-D1, selection I medium: 4 g/L N6 salts, 30 g/L sucrose,
0.7 g/L L-proline, 0.5 g/L MES, 1.5 mL/L 2,4-D and 3 g/L
Gelrite (Sigma-Aldrich), pH 5.8. After autoclaving, add filter-
sterilized 1 mL/L N6 vitamin, 0.1 mL/L silver nitrate, and
0.3 mL bialaphos. Also add freshly dissolved 250 mg/L cefo-
taxime in 10 mL ddH2O.
12. PHI-D2, selection II medium: 4 g/L N6 salts, 30 g/L
sucrose, 0.7 g/L L-proline, 0.5 g/L MES, 1.5 mL/L 2,4-D,
and 3 g/L Gelrite (Sigma-Aldrich), pH 5.8. After autoclaving,
add filter-sterilized 1 mL/L N6 vitamin, 0.1 mL/L silver
nitrate, and 0.6 mL bialaphos. Also add freshly dissolved
250 mg/L cefotaxime in 10 mL ddH2O.
13. PHI-E, maturation medium: 4.3 g/L MS salts, 60 g/L
sucrose, 3 g/L Gelrite (Sigma-Aldrich), pH 5.6. After auto-
claving, add filter-sterilized 1 mL/L MS vitamin, 1 mL/L gly-
cine, and 0.6 mL bialaphos. Also add freshly dissolved
250 mg/L cefotaxime in 10 mL ddH2O.
14. PHI-F, regeneration medium: 2.9 g/L MS salts, 30 g/L
sucrose, 3 g/L Gelrite (Sigma-Aldrich), pH 5.6. After auto-
claving, add filter-sterilized 1 mL/L MS vitamin and 1 mL/L
glycine.
15. Parafilm tape.
3 Methods
3.1 Agrobacterium 1. Streak EHA101 carrying simple binary vector from −80 °C
Culture Initiation stock on ABC medium with appropriate antibiotics. Make
dilute series so that single colonies can develop.
2. Let culture grow for 3 days at 28 °C in darkness (see Note 5).
3. Pick up single colony and streak it on YEP medium containing
appropriate antibiotics, and let culture grow at 20 °C for 3
days in darkness.
3.2 Inoculation 1. Add 5 mL of sterile PHI-A infection medium into 15 mL

Falcon tube.
2. Take about two full loops of EHA101 from YEP plate and
suspend in the tube. Let the pallet sit there for 2–3 min. Shake
the tube to suspend bacterial cells well.
3. Transfer 1 mL of such suspension to spectrophotometer
cuvette, and check the density of the suspension culture at
O.D. 550 and adjust it to OD550 of 0.35 (0.5 × 109 cfu/mL).
4. Shake the re-suspended culture in a shaker at 100 rpm for 4–5 h.
5. Aliquot 1 mL suspension into 1.5 mL sterile micro-centrifuge
tube.
3.3 Embryo Isolation, 1. Remove the husks and silk from ears which are harvested
Inoculation, and 10–13 days post pollination (with embryo size of 1.5 mm).
Cocultivation Insert the forceps from the top end of the ear (see Note 6).
2. Soak fresh Hi-II ears in a sterile 1 L wide-mouth bottle con-
taining about 0.5 L of 30 % commercial bleach with a few
drops of Tween-20 for 20 min (see Note 7).
3. Wash ears three times with plenty of sterile water, and let the
ear stand upright on a sterile 150 × 15 mm petri dish.
4. Remove top half of the kernels of each ear with a #11 razor
blade (see Note 8).
5. Isolate 1.5 mm immature embryos from sterile ear with sterile
spatula, and transfer 50–100 embryos to each tube. Wash the
embryos with PHI-A solution three times to remove debris
and starch.
6. Add the Agrobacterium suspension, allow the tube to stand
for 5 min in the hood, and then pour the whole contents
including all embryos onto the petri plate containing PHI-B,
the cocultivation medium.
7. Draw off the Agrobacterium suspension using a pipette with a
fine tip, spread out the embryos across the plate (so that they
are quite evenly spaced), and place embryos flat face down on
the medium (see Note 9).
8. Seal the plate with parafilm tape and incubate in the dark at
20 °C for 3 days.
3.4 Resting 1. Transfer the embryos to PHI-C, resting medium. Avoid

damaging the embryos.
2. Seal the plate with parafilm and incubate in the dark at 28 °C
for 7 days.
3.5 Selection 1. Transfer the embryos to PHI-D1, selection I medium. Place 25

embryos in each plate, and seal the plate. Incubate the embryos
in the dark at 28 °C during the first 2-week selection.
2. Transfer the calli from PHI-D1, selection I medium, to PHI-D2,

selection II medium. Subculture the calli every 2 weeks onto
the same fresh medium for a total of 2 months.
3. Bulk up the herbicide-resistant calli by growing them on the
same fresh medium for another 2 weeks until the diameter of
the calli is about 1.0 cm. During this stage, each large, fast-
growing Hi-II embryogenic callus can be divided into smaller
calli to select the best-quality Hi-II embryogenic calli (i.e.,
type II calli which are dry, friable, and fast growing) to enhance
selection stringency and/or maintain callus cultures for a pro-
longed period of time.
3.6 Regeneration 1. Transfer opaque calli onto PHI-E, maturation medium, in the
dark at 28 °C for 2–3 weeks to allow the somatic embryos to
mature.
2. Transfer ivory white calli onto PHI-F, regeneration medium,
at 28 °C under 16-h photoperiod until shoot and roots
develop.
3. Transfer each small plantlet to a 25 × 150 mm tube containing
PHI-F, regeneration medium, and grow under the same light
conditions for 2–3 weeks.
4. Transfer the plants to pots with soil mixture in a greenhouse.
4 Notes
1. The quality of ears is the most important factor in Hi-II maize

transformations, given other conditions are well under the con-
trol. High-quality ears contain immature embryos of high vigor
which are capable of tolerating low-salt medium conditions
during the Agrobacterium infection stage. We routinely use
immature embryos derived from Hi-II A × B: F2 ears. In fact,
the Hi-II A × B: F1 ears offer higher embryo vigor than F2 ears,
which leads to a much higher transformation frequency (unpub-
lished) than we have reported previously [7]. Nonetheless, use
of Hi-II A × B: F1 ears requires more extensive labor to make
crosses and more greenhouse space. Consequently, we routinely
use Hi-II A × B: F2 instead of F1 ears.
2. Do not heat the solution while dissolving 2,4-D in NaOH.
3. Silver nitrate is sensitive to light, and therefore the chemical
should be kept in the dark.
4. For dissolving AS, it is recommended to use methanol instead
of dimethyl sulfoxide (DMSO) and store at −20 °C. Use of
methanol will avoid freeze–thaw steps as encountered with the
use of DMSO. This will minimize the reduced potency of AS
resulting from freezing and thawing.
5. Streak EHA101 on ABC medium; the colonies on the agar

plate can be used for up to 1 month when stored at 4 °C.
6. The size of immature embryos, i.e., between 1.5 and 1.8 mm,
is crucial. We found that as the size of the embryo increases
the transformation frequency decreases but the embryos are
more tolerant of the low-salt medium condition (unpub-
lished). Therefore, use of small embryos (less than 1.2 mm)
requires a full-strength salt medium to avoid a high mortality
of the embryos. However, it is much more difficult to isolate
small embryos than large ones. As a result, our most practical
method is to use 1.5 mm embryos combined with low-salt
medium, achieving a high transformation frequency with ease
in embryo isolation.
7. If the maize plants are grown in the field to obtain immature
embryos, the use of 50 % commercial bleach is recommended
for decontamination. Embryos from the field offer higher
transformation frequency than the embryos from the
greenhouse.
8. It is recommended that the kernels be removed from two rows
at a time. This will help to maintain the desired high moisture
and vigor of the embryos in the remaining rows.
9. When the immature embryos are cocultivated on the PHI-B
medium, the embryo should be flat face down and be sure to
check the orientation of the embryos under a dissecting
microscope.
References
1. Hiei Y, Ohta S, Komari T (1994) Efficient dard binary vector system. Plant Physiol
transformation of rice (Oryza sativa L.) medi- 129:13–22
ated by Agrobacterium and sequence analysis 7. Vega JM, Yu W, Kennon AR et al (2008)
of the boundaries of the T-DNA. Plant J Improvement of Agrobacterium-mediated
6:271–282 transformation in Hi-II maize (Zea mays) using
2. Ishida Y, Saito H, Ohta S et al (1996) High standard binary vectors. Plant Cell Rep
efficiency transformation of maize (Zea mays 27:297–305
L.) mediated by Agrobacterium tumefaciens. 8. Huang XQ, Wei ZM (2004) High-frequency
Nat Biotechnol 14:745–750 plant regeneration through callus initiation
3. Zhao ZY, Gu W, Cai T (1999) Methods for from mature embryos of maize (Zea mays L.).
Agrobacterium-mediated transformation. Plant Cell Rep 22:793–800
United States Patent 5,981,840 9. Huang X, Wei Z (2005) Successful
4. Zhao ZY, Gu W, Gai T et al (2001) High Agrobacterium-mediated genetic transforma-
throughput genetic transformation mediated tion of maize elite inbred lines. Plant Cell
by Agrobacterium tumefaciens in maize. Mol Tissue Organ Cult 83:187–200
Breed 8:323–333 10. Frame BR, McMurray JM, Fonger TM et al
5. Zhao ZY, Gu W, Cai T et al (2004) Methods (2006) Improved Agrobacterium-mediated
for Agrobacterium-mediated transformation. transformation of three maize inbred lines
United States Patent 963,096. Pioneer Hi-bred using MS salts. Plant Cell Rep 25:1024–1034
International, Inc., Des Moines, IA 11. Sidorov V, Gilbertson L, Addae P et al (2006)
6. Frame BR, Shou H, Chikwamba RK et al Agrobacterium-mediated transformation of
(2002) Agrobacterium tumefaciens-mediated seedling-derived maize callus. Plant Cell Rep
transformation of maize embryos using a stan- 25:320–328
12. Lee BK, Kennon AR, Chen X et al (2007) 16. Zhang W, Subbarao S, Addae P et al (2003)
Recovery of transgenic events from two highly Cre/lox mediated marker gene excision in
recalcitrant maize (Zea mays L.) genotypes using transgenic maize (Zea may L.) plants. Theor
Agrobacterium-mediated standard–binary-vec- Appl Genet 107:1157–1168
tor transformation. Maydica 52:457–469 17. An G, Ebert PR, Mitra A et al (1988) Binary
13. Hood EE, Helmer GL, Fralcy RT et al (1986) vectors. In: Gelvin SB, Schilperoort RA (eds)
The hypervirulence of Agrobacterium tumefa- Plant molecular biology manual. Kluwer,
ciens A281 is encoded in a region of pTiBo542 Dordrecht, pp 1–19
outside of T-DNA. J Bacteriol 168:1291–1301 18. Chu CC, Wang CC, Sun CS et al (1975)
14. Hoekma A, Hirsch PR, Hooykaas PJJ et al Establishment of an efficient medium for
(1983) Binary vector strategy based on separa- anther culture of rice through comparative
tion of vir- and T-region of the Agrobacterium experiments on the nitrogen source. Sci Sin
tumefaciens Ti-plasmid, Nature 303:179–180 18:659–668
15. Lazo GR, Stein PA, Ludwig RA (1991) A DNA 19. Murashige T, Skoog F (1962) A revised
transformation-competent Arabidopsis genomic medium for rapid growth and bioassays with
library in Agrobacterium. Biotechnology 9: tobacco tissue cultures. Physiol Plant
963–967 15:473–497
Chapter 23
A Technical Platform for PCR-Based SNP Screening

in Cereals and Other Crops
Zining Wang
Abstract
With the rapid development of sequencing technologies and sequenced genomes, single-nucleotide
polymorphisms (SNPs) have become a common genomic tool in the study of biological diversity, genome
variation, gene mapping, cloning, and marker-assisted selection. In this chapter, PCR-based SNP screen-
ing is discussed in detail. This includes preparation of solutions and buffers, designing of tetra-primers,
PCR for DNA amplification, gel electrophoresis, and SNP screening. By grasping the techniques and
experience from the wet laboratories, researchers can quickly use this genomic tool to tackle problems in
their research.
Key words SNP, PCR, Primer design, Gel electrophoresis, Screening
1 Introduction
SNPs are widely used in genetic studies of human, animals, plants,

and microorganisms [1]. SNP discovery is at the heart of large
worldwide collaborative studies like the HapMap Project and the
1000 Genomes Project, which aim to comprehensively catalog
human genetic variation [2]. SNPs measure the genetic variations
between members of a species, such as individuals in a diversity
panel, a pair of parental lines, and/or individuals in their popula-
tion. A SNP is a single base pair mutation at a specific locus.
Because SNPs are conserved during evolution, they have been
used and will be widely used as markers in diversity studies, associa-
tion studies, and quantitative trait loci (QTL) analysis in place of
microsatellites and other marker systems [1, 3]. SNP screening is
the key step for the success in the analysis. SNP analysis can employ
a few different techniques, such as PCR-based screening, the
Sequenom platform, Illumina platforms, and the newly developed
genotyping by sequencing (GBS) [4–8]. These methods are quite
different in principle, cost, and efficiency. One approach to PCR-
based SNP screening relies on the success of tetra-primer design
281
282 Zining Wang
[9, 10]. It is relatively simple and can be performed in a laboratory

if a thermal cycler and a gel electrophoresis system are available but
cannot process a very large number of samples in a short time,
while the other three screening methods mentioned above can deal
with a large number of SNPs covering the whole genome in a rela-
tively short time often in a service company rather than in a simple
laboratory at present. With advances in resequencing technologies,
GBS has the potential to be a large-scale screening method used in
laboratories in the near future [7, 8]. However, as the easiest and
most accessible SNP screening method, PCR-based screening has
been used by a lot of laboratories. In this chapter, we describe the
technical details of PCR-based SNP screening.
2 Materials
Prepare all solutions using double-distilled water. Store the solu-

tions and carry out all procedures at room temperature unless other-
wise specified.
2.1 PCR 1. 1 M Potassium chloride: Weigh 7.46 g of KCl, and add it to a

beaker. Add 80 mL water, and stir it. Transfer the solution to a
100 mL cylinder. Add water to the final volume of 100 mL.
Transfer the solution to a 100 mL bottle, and keep the solu-
tion at −20 °C.
2. 1 M Tris–HCl: Weigh 12.1 g of Tris base, and add it to a bea-
ker. Add 60 mL ddH2O. Mix, and adjust pH to 9.0 with HCl.
Transfer the solution to a cylinder. Add water to the final vol-
ume of 100 mL. Keep the solution at room temperature.
3. Triton X-100.
4. 10× PCR buffer without magnesium: Transfer 40 mL 1 M KCl
to a beaker. Add 8 mL 1 M Tris–HCl and 0.8 mL Triton
X-100. Add 31.2 mL ddH2O, and mix the solution. Transfer
aliquots of 1.0 mL solution to 1.5 mL Eppendorf tubes, and
store in freezer (see Note 1).
5. 50 mM Magnesium chloride: Weigh 1.02 g of MgCl2·6H2O.
Add 90 mL water. Mix, and make a final volume of 100 mL.
Make aliquots of 1.0 mL in 1.5 tubes, and store in freezer
(see Note 2).
6. Taq DNA polymerase, 6 U/μL (Life Technologies, USA).
7. dNTP each at 25 mM: Mix 25 μL of each of the four dNTPs
(100 mM commercially purchased). Make 50 μL aliquots in
0.5 mL tubes (see Note 3).
8. Primer working solution, 10 μM: Resuspend lyophilized
primer to a stock of 100 nmol/μL. For example, for 30 nmol
of a lyophilized primer add 300 μL sterile distilled water
PCR-Based SNP Screening 283
(10 times 30 in μL). To prepare 10 nm/μL of working solu-

tion, take 10 μL stock solution and add 90 μL of sterile dis-
tilled water (see Note 4).
9. Template DNA: 20 ~ 100 ng/μL.
2.2 Gel 1. Agarose: Molecular biology grade.

2. 0.5 M EDTA solution, pH 8.0: Add 181.6 g of Na2EDTA2H2O
to 800 mL ddH2O. While stirring with a magnetic stirrer,
adjust to pH 8.0 with pellets of NaOH (about 20 g NaOH).
Sterilize by autoclaving, and store at room temperature.
3. 50× TAE buffer, stock solution: Dissolve 242 g Tris base in
ddH2O. Add 57.1 mL glacial acetic acid and 100 mL of 0.5 M
EDTA (pH 8.0) solution. Bring the final volume to 1 L. This
stock solution can be diluted 50:1 with water to make 1×
working solution.
4. 10 mg/mL Ethidium bromide (EB): Weigh 1 g of EB, and
dissolve it in 100 mL water. Cover the bottle with aluminum
foil as EB is light sensitive.
5. Electrophoresis and gel documentation system.
2.3 Primer Design 1. Principle: The PCR system employs the principles of the tetra-
primer PCR method and the amplification refractory mutation
system (ARMS). Tetra-primer ARMS PCR was proposed by Ye
et al. [10] as a simple, efficient, and inexpensive SNP genotyping
method.
2. PCR primers: Four primers are designed to amplify three
amplicons: a larger fragment from template DNA containing
the SNP and two smaller fragments representing each of the
two allele-specific (AS) products (see Fig. 1 and see Note 5).
3. Amplicon sizes: Primers are designed to amplify the amplicons
of two alleles that differ in sizes and can be resolved by agarose
gel electrophoresis (see Note 6).
4. Primer specificity: To enhance the specificity of the reaction,
two mismatches are induced. The first mismatch is at the 3′
end of AS primers, and the second mismatch is at the third
position from the 3′ end of each of the two inner AS primers.
5. Primer lengths and Tm: Primer lengths can range from 20 to
30 nucleotides basically with a Tm range of 55 ~ 70 °C. The
four primers are designed to have similar Tm so as to run a
PCR at the same annealing temperature for all the cycles.
Alternatively, a touch-down PCR will be needed when the two
pairs of the outer–inter primers have different Tm.
2.4 Software 1. Primer1: http://primer1.soton.ac.uk/primer1.html [10]

2. BatchPrimer3 v1.0: Whitehead Institute for Biomedical Research
[11]. http://probes.pw.usda.gov/cgi-bin/batchprimer3/
batchprimer3.cgi.
284 Zining Wang
Fig. 1 Diagrammatic explanations of primer design and allele-specific amplicon

recognition in tetra-primer ARMS PCR. P1: forward outer primer; P2: forward
inner primer; P3: reverse inner primer; P4: reverse outer primer. This figure uses
the G/A transition as an example. The primer P1 and P4 amplify a non-allele-
specific fragment; P2 amplifies the A allele; P3 amplifies the G allele. The figure
also shows the band pattern for homozygous GG and AA and heterozygous GA
3 Methods
Carry out all procedures at room temperature unless otherwise

specified.
3.1 PCR 1. Carry out PCR in a 96- or a 384-well-plate thermal cycler.

Amplify parental and population genomic DNA in a 20 μL
reaction volume containing 50 ng of genomic DNA, 1.5 mM
MgCl2, 3.0 pmol of each outer primer, 20 pmol of each inner
primer, 0.375 mM dNTPs, 2.0 U polymerase, and 2.0 μL of
the 10× PCR buffer.
2. Carry out the PCR in a thermocycler using the following steps,
programmed for an initial 1 min at 94 °C and 35 cycles of
1 min at 94 °C, 1 min at 55 °C (if primer Tm = 60 °C, see Note 7),
and 90 s at 72 °C, followed by a final 10-min extension step at
72 °C. Amplification products can be visualized by standard
1 % agarose gel electrophoresis.
3.2 Gel 1. After PCR, add 4 μL loading dye to each well, mix, and briefly
Electrophoresis centrifuge the plate.
PCR-Based SNP Screening 285
2. Load the PCR products into a 1 % agarose gel containing

0.1 μg/mL of EB and using 1 kb DNA ladder for size
identification.
3. Resolve the DNA by electrophoresis. Run the gel for 30–40 min
at 60 ~ 100 v.
4. Document the resolved DNA using a gel documentation sys-
tem (see Note 8).
3.3 SNP Screening If A/G is the SNP, the genotype of the individuals can be recorded
as homozygous AA, homozygous GG, and heterozygous G/A
(Fig. 1).
4 Notes
1. When doing a PCR it is convenient to use the buffer in 1.5 mL

tubes from the freezer.
2. The solution in 1.5 mL tubes is easy to thaw before use and to
be frozen after use.
3. dNTPs are kept and used in such a small amount each time as
they easily degrade.
4. Before adding water to the tubes, centrifuge them briefly. Each
time after thawing the primer tubes, leave them on ice because
primers degrade easily.
5. To save time, we suggest designing two sets of tetra-primers in
case one set does not work well.
6. It is better for the two amplicons to have a size differ by at least
50 bp so that they could be clearly separated in the gel.
7. It is better to set the annealing temperature in the PCR, 5 °C
lower than the primer Tm.
8. EB is harmful to eye and skin. Wear gloves and avoid direct
contact with the gel and keep away from the fumes after
adding EB to the hot gel solution.
References
1. Seeb JE, Carvalho G, Hauser L et al (2011) 3. Duran C, Appleby N, Edwards D et al (2009)

Single-nucleotide polymorphism (SNP) dis- Molecular genetic markers: discovery, applica-
covery and applications of SNP genotyping in tions, data storage and visualisation. Curr
nonmodel organisms. Mol Ecol Resour Bioinform 4:16–27
11:1–8 4. Moorhead SM, Dykes GA, Cursons RT (2003)
2. Johnson AD (2009) Single-nucleotide poly- An SNP-based PCR assay to differentiate
morphism bioinformatics. A comprehensive between Listeria monocytogenes lineages
review of resources. Circ Cardiovasc Genet derived from phylogenetic analysis of the sigB
2:530–536 gene. J Microbiol Methods 55:425–432
286 Zining Wang
5. http://barleyworld.org/sites/default/files/ ultrahigh-density linkage map based on popu-

illuminasnpgenotyping.pdf lation sequencing. Proc Natl Acad Sci U S A
6. Gabriel S, Ziaugra L, Tabbaa D (2009) SNP 107:10578–10583
genotyping using the Sequenom UNIT 9. Collins A, Ke XY (2012) Primer1: primer
MassARRAY iPLEX platform. Curr Protoc design web service for tetra-primer ARMS-
Hum Genet 60:2.12.1–2.12.18 PCR. Open Bioinform J 6:55–58
7. Elshire RJ, Glaubitz JC, Sun Q et al (2011) A 10. Ye S, Dhillon S, Ke XY et al (2001) An effi-
robust, simple genotyping-by-sequencing cient procedure for genotyping single nucleo-
(GBS) approach for high diversity species. tide polymorphisms. Nucleic Acids Res
PLoS One 6:e19379 29:E88–8
8. Xie W, Feng Q, Yu H et al (2010) Parent- 11. Rozen S, Kaletsky HJ (1998) Primer3. http://
independent genotyping for constructing an primer3.sourceforge.net/
Chapter 24
A Method for Discovery of Genome-Wide SNP Between Any

Two Genotypes from Whole-Genome Re-sequencing Data
S. Gopala Krishnan, Daniel L.E. Waters, and Robert J. Henry
Abstract
Advances in sequencing technologies have aided the discovery of millions of genome-wide DNA
polymorphisms such as single-nucleotide polymorphisms (SNPs) and insertion–deletions (InDels)
which are an invaluable resource for marker-assisted breeding. Presently available bioinformatics tools
assist the discovery of polymorphisms between target genotypes and the reference genome for a range
of species. The discovery of polymorphisms between two genotypes within a breeding program is
complicated by several factors such as bias in the number of reads from each genotype and residual
heterozygosity within each genotype. In this chapter, we describe a novel approach where polymor-
phisms between a pair of genotypes are discovered from whole-genome re-sequencing data.
Key words Next-generation sequencing, Genotypes, Whole-genome re-sequencing, Genome-wide

polymorphisms, Pairwise SNPs
1 Introduction
Advances in sequencing technologies have aided the discovery of

millions of genome-wide DNA polymorphisms such as single-
nucleotide polymorphisms (SNPs) and insertion–deletions
(InDels) which are an invaluable resource for marker-assisted
breeding [1]. SNPs and InDels are becoming the preferred mark-
ers in molecular breeding due to multiple advantages such as high
frequency, stability, high throughput capability, and cost-
effectiveness over other DNA markers [2]. Next-generation
sequencing (NGS) technologies make possible the discovery of a
massive number of DNA polymorphisms by comparing the whole-
genome sequences of individuals with high-quality reference
genome sequences [3]. SNPs have been employed in breeding
programs for marker-assisted and genomic selection, association
and QTL mapping, positional cloning, haplotype and pedigree
analysis, seed purity analysis, and variety identification [4].
287
288 S. Gopala Krishnan et al.
There are a number of different NGS platforms that can be

used for whole-genome re-sequencing [5, 6], and the detailed pro-
cedure for generation of sequence reads for the discovery of poly-
morphisms using Illumina Genome Analyzer has been described
[7]. The bioinformatics tools presently available help the discovery
of genome-wide polymorphisms by comparing the whole-genome
sequence of individual genotypes with high-quality reference
genome sequences [3]. A schematic overview of the steps of SNP
discovery by comparison of high-quality reference genome sequence
with whole-genome re-sequencing data is presented in Fig. 1.
The discovery of polymorphisms between any two genotypes
is very important in practical plant breeding. One way of obtain-
ing SNPs between a set of genotypes whose whole genomes have
been re-sequenced is to first map one of the genotypes to a high-
quality reference genome (such as the IRGSP Pseudo molecule
5.0 of rice cultivar Nipponbare). The consensus sequence of the
first genotype can be retrieved from the mapping which can then
be used for mapping the reads from the whole-genome sequence
data of the second genotype. However, this is not ideal as it suf-
fers from disadvantages such as the following: (1) the consensus
sequence of the first genotype may have large gaps and hence it is
not the ideal sequence for use as reference sequence to map the
reads from the second genotype and (2) the annotations available
in the high-quality reference genome will be lost when the con-
sensus sequence of the first genotype is retrieved from the initial
mapping assembly.
Alternatively, mapping the combined whole-genome re-
sequencing data to the high-quality reference genome may be an
option for SNP discovery. However, polymorphism discovery can
be complicated by several factors such as the following: SNPs
detected may be polymorphic between the reference genome and
the genotypes in question but may not be polymorphic between
the two genotypes; there may be residual heterozygosity in one or
both of the genotypes; and there may be bias in the number of
reads for each genotype at any one locus. Ideally, we expect 50 %
of the reads belonging to one genotype and the remaining 50 % of
the reads to the second genotype at any one genome reference
position, but the number of reads that map to particular reference
position will differ between genotypes, and this bias may create a
problem for SNP discovery when there is an expectation of a 1:1
allelic ratio.
Here, we present a novel robust approach which allows
polymorphisms between a pair of genotypes to be discovered
from the whole-genome data. The method involves first sepa-
rately mapping whole-genome re-sequencing data of each geno-
type to the reference genome and detection of SNPs for
Genome-Wide SNP Discovery from Whole-Genome Re-sequencing Data 289
Fig. 1 A schematic overview of the steps involved in SNP discovery from whole-
genome re-sequencing data in comparison with a high-quality reference genome
sequence
individual genotypes. Then whole-genome data from both gen-

otypes is mapped in combination to the reference genome and
the set of SNPs in both genotypes identified in comparison to
the reference genome. Finally, the SNPs discovered from the
individual assembly and from the combined assembly are used
to identify pairwise SNPs between the genotypes by eliminating
the SNPs which are common to both the genotypes in compari-
son to the reference genome and the heterozygous SNPs which
are inherent to each genotype.
2 Materials
2.1 Whole-Genome 1. High-quality trimmed reads from the whole-genome re-

Re-sequence Data sequencing of the genotypes.
2.2 Software 1. Software such as CLC Genomics Workbench for the assembly
of reads and detection of SNPs (see Note 1).
2. A spreadsheet program such as Microsoft Excel with the option
for filtering and eliminating duplicate values.
3 Methods
3.1 Assembly of 1. Use CLC Genomics workbench to assemble the trimmed and
Reads and Detection high-quality reads from each of the genotypes (e.g., Genotype
of SNPs 1 and Genotype 2) individually to the reference genome
(Fig. 1, steps 1–3).
2. Then use the SNP detection tool to discover SNPs in the
assembled contigs in comparison to the high-quality reference
genome (Fig. 1, steps 4–5).
3. CLC Genomics workbench is used to assemble the trimmed
reads from both genotypes in combination to the reference
genome (Fig. 1, steps 1–3).
4. The SNP detection tool is then used to discover SNPs in com-
parison to the high-quality reference genome (Fig. 1, steps
4–5) (see Note 2).
5. The three assemblies (one combined assembly of Gentoypes 1
and 2 and the two individual assemblies of Genotype 1 and
Genotype 2) give rise to three possible situations (Fig. 2).
Situation 1: In this case (Fig. 2a), even though an SNP
(C compared to T at reference position no. 7,936,303) is discov-
ered in the combined assembly and the individual assemblies, the
allele (C) is the same in both the Genotype 1 and Genotype 2, and
so there is no polymorphism between the gentoypes. Situation 2:
In this case (Fig. 2b) two alleles (G/A, G in the reference sequence
at position no. 7,941,982) are discovered in the combined assem-
bly; in the individual assemblies of Genotype 1 and Genotype 2;
both Genotype 1 (4G/4A) and Genotype 2 (8G/4A) are hetero-
zygous at this position. Therefore, even though there appears to be
two alleles in the combined assembly, the polymorphism is due to
residual heterozygosity at this position which is shared by both
Genotype 1 and Genotype 2. Situation 3: In this case (Fig. 2c),
two alleles (C/T, C in the reference sequence at position no.
7,936,320) are discovered in the combined assembly where one
allele (T) is from Genotype 1 and the other allele (C) is from
291
Fig. 2 Three assemblies (one combined assembly of Genotypes 1 and 2 and the
two individual assemblies of Genotype 1 and Genotype 2) can give rise to three
possible situations: (a) A C/T SNP where the C allele is same in both the Genotype
1 and Genotype 2; (b) a G/A SNP and both Genotype 1 and Genotype 2 are het-
erozygous at this position; (c) a C/T SNP where one allele (T) is from Genotype 1
and the other allele (C) is from Genotype 2
Genotype 2. Therefore, we can conclude that this is an SNP

between Genotype 1 and Genotype 2. The ideal situation is where
two alleles are discovered in the combined assembly, and this rep-
resents a single allele in each of the gentoypes (Situation 3).
However, considering that millions of SNPs are discovered from
whole-genome re-sequencing data, it is impracticable to do such a
comparison for each and every SNP identified in the assemblies
generated. Therefore, there arises a need to devise a simple strategy
to identify SNPs between two gentoypes (Genotype 1 and
Genotype 2, as presented in this case).
3.2 Discovery 1. In the first step, eliminate heterozygous loci from each of the
of SNPs Between genotypes. This is achieved in a spreadsheet by filtering SNPs
Two Genotypes from non-repetitive regions discovered from separate individ-
ual assemblies of Genotype 1 and Genotype 2 with the follow-
ing parameters: coverage > 4, count of variant 1 >0, and count
of variant 2 >0. The SNPs obtained after this step will be SNPs
which are unique to each individual assembly (see Note 3).
2. In the next step, identify SNPs in the combined assembly. This
is done by filtering the SNPs from non-repetitive regions dis-
covered from combined assembly of Genotype 1 and Genotype
2 with the following parameters: coverage > 9, count of variant
1 >4, and count of variant 2 >4 (see Note 4).
3. In the final step, eliminate spurious SNPs from the pool of
putative SNPs identified between Genotype 1 and Genotype 2
in the combined assembly. This is achieved by two substeps:
First, compare SNPs from individual assembly of Genotype 1
with the SNPs identified in the combined assembly one chro-
mosome at a time. Remove the SNPs with the same reference
position in both the assemblies by using remove duplicates
option (see Note 5). Second, compare SNPs from individual
assembly of Genotype 2 with the SNPs identified in the com-
bined assembly, one chromosome at a time. Then remove the
SNPs with the same reference position in both the assemblies
by using remove duplicates option.
4. Retain the set of SNPs from the combined assembly after the
elimination of duplicates in the above steps constituting the
true pairwise SNPs between the Genotype 1 and Genotype 2
(see Note 6).
4 Notes
1. CLC Genomics Workbench is only taken as an example here,

and it is one of the many types of software available for assem-
bly and detection of SNP variants from whole-genome re-
sequencing data. Since the approach described here for
Genome-Wide SNP Discovery from Whole-Genome Re-sequencing Data 293
discovering pairwise SNP starts after SNP discovery, other

software can be utilized for the purpose of SNP discovery.
2. Eliminating the SNPs from repetitive regions can be done
through selection of “No repeats” option in the overlapping
annotation tab in CLC Genome Workbench.
3. There is a possibility of filtering out some real SNP by elimi-
nating heterozygous loci in the individual assembly. However,
there will be a huge number of SNPs remaining between the
genotypes.
4. It is essential to partition SNPs to each chromosome of the
individual genotypes separately. This will avoid complications
arising from the same reference position which occur on differ-
ent chromosomes. For example Chromosome 1, Position
456,239, could be confused with Position 456,239 on any of
the other 11 chromosomes of rice. This also ensures that the
process of eliminating the spurious SNPs from the pool of
putative SNPs identified in the combined assembly is avoided
at a later step.
5. While removing duplicates, it is important to place the SNPs
from the combined assembly below the SNPs from individual
assembly (especially in MS Excel) as the duplicate from the
pool of putative SNPs from the combined assembly needs to
be removed to identify true SNPs between Genotype 1 and
Genotype 2.
6. A confirmatory check for the robustness of the pairwise SNPs
can be performed by viewing the corresponding position of
the chromosome as shown in Fig. 2.
Acknowledgements
G. K. S. acknowledges the Department of Science and Technology,

Government of India, for the financial support under the
BOYSCAST Fellowship.
References
1. Gopala Krishnan S, Waters DLE, Henry RJ 2. Henry RJ, Edwards K (2009) New tools for
(2012) Genome-wide variations between elite single nucleotide polymorphism (SNP) discov-
lines of indica rice discovered through whole ery and analysis accelerating plant biotechnol-
genome re-sequencing. In: Rangasamy SRS ogy. Plant Biotechnol J 7:311
et al (ed) 100 years of rice science and looking 3. Gopala Krishnan S, Waters DLE, Katiyar SK,
beyond. Proceedings of the International sym- Sadananda AR, Satyadev V, Henry RJ (2012)
posium held at Tamil Nadu Agricultural Genome-wide DNA polymorphisms in elite
University, Coimbatore, Tamil Nadu, India, indica rice inbreds discovered by whole-genome
9–12 January 2012, pp 118–119 sequencing. Plant Biotechnol J 10:623–634
4. McCouch SR, Zhao K, Wright M, Tung CW, Molecular markers for plants derived from large
Ebana K, Thomson M et al (2010) Development scale sequencing. J Biosci 37:829–841
of genome-wide SNP assays for rice. Breed Sci 7. Lakdawalla A, Schroth GP (2010) Mutation
60:524–535 discovery with the Illumina genome analyzer.
5. Edwards M, Henry R (2011) DNA sequencing In: Meksem K, Kahl G (eds) The handbook of
methods contributing to new directions in plant mutation screening—mining of
cereal research. J Cereal Sci 54:395–400 natural and induced alleles. Wiley-VCH
6. Henry RJ, Edwards M, Waters DLE, Gopala Verlag GmbH & Co. KGaA, Weinheim, pp
Krishnan S, Bundock P, Sexton TR et al (2012) 103–120
INDEX
A Bio-Rad PDS-1000/He ........................................... 202, 207

BL21 ........................................................................ 148, 150
ABC medium ................................................... 275, 276, 279 Blocking solution...................................... 164, 171, 172, 196
Acetosyringone ................................................ 239, 240, 242, Blotting ....................................................159–161, 164, 167,
246–248, 267, 270, 274, 275 172, 173, 181–182, 186, 189–198
Acrylamide ........................................ 180, 183, 184, 186, 190 Blunt-ended ..................................................................... 124
Agargel .....................................................204, 205, 211, 212, Blunt end ligations ........................................................... 118
238–240, 244, 246 Bovine serum albumin (BSA).............................. 74, 84, 136,
Agarose plugs ............................................. 42, 49–51, 58, 59 150, 162, 181, 192
AGL1 ........................................ 236, 245, 246, 253, 254, 274 Bradford assay .......................................................... 156, 191
Agrobacterium-mediated transformation .................. 213, 214, Bread wheats .............................................. 77, 212, 245, 246
220, 247, 251, 261–271, 273–279
Agrobacterium tumefaciens ................................. 202, 235–237, C
239, 241, 242, 245, 247, 274–275
Capillary transfer .............................. 160, 162–163, 166–168
Alkaline phosphatase ........................... 33, 124, 125, 161, 192
Carbenicillin ...................................... 239, 246, 248, 268, 269
Amplicon ..................................................15, 74, 89, 97–100,
cDNA ........................................................ 99, 101–103, 106,
104, 105, 107, 136, 139–141, 143–145, 283–285
108, 109, 113, 130
Ancient DNA (aDNA) ............................................ 7, 13–15
cDNA library.......................................................... 29–39, 42
Ancient seed ................................................................... 7–15
Cereal SNP genotyping .................................................... 283
Annealing ...................................................33, 67, 68, 70–73,
Cereal varietal identification ............................................. 287
75, 100, 109, 113, 114, 131, 169, 175, 283, 285
Cetyl trimethylammonium bromide
Antioxidant ...................................................................... 274
(CTAB) .................................................... 2, 4, 9, 164
Archaeological grain-specimens ......................... 7–10, 13–14
CFX Manager .......................................... 106, 109, 112, 113
Ascorbic acid ...................................................... 44, 204, 238
Chaff .............................................................................. 9, 14
Assembled contigs ............................................................ 290
Cheese cloth ........................................................... 46, 49, 58
Assemblies ........................................................ 134, 290–292
Chemical mutagens ................................................ 77, 79, 81
AT pairs .............................................................................. 73
Chemiluminescent....................................160, 161, 164, 172,
Autoradiography............................................... 180, 186, 194
174, 192, 197, 198
Awn(s) ...................................................................... 255, 260
Chemiluminescent detection ............. 160, 161, 164, 172, 174
B Chloramphenicol ................................. 43, 46, 47, 53–55, 275
Chloroform:isoamyl alcohol (CI) ............................. 9, 12, 33
Bacterial artificial chromosome (BAC).........................41–62 Clavulanic acid ................................................. 239, 249, 257
Bacto agar ................................................................... 55, 274 CLC Genomics workbench ..................................... 290, 292
Bacto-tryptone ............................................. 43, 44, 124, 125 Clone Manager Professional............................................. 142
Baffles ............................................................................... 228 Cloning................................................. 30, 35, 37, 41–43, 52,
Bar ...............................................................8, 10, 49, 87, 217 55, 60, 117–121, 123–131, 136, 143, 144, 287
Bar gene............................................. 129, 217, 245, 249, 252 Cobalt-60 ...........................................................................78
Barley transformation ............................................... 251–260 Co-cultivation ................................................. 236, 238–243,
β-glucuronidase ........................................ 217, 231, 245, 249 246–249, 256–257, 260, 263, 269, 274, 276, 277
Bialaphos .......................................................... 252, 275, 276 Contigs ............................................................................. 290
Binary vectors .................................... 213, 245, 273, 274, 276 Coomassie Blue ................................................................ 191
Biolistics .......................................................... 202, 213, 220, Copper sulphate (CuSO4)........................ 222, 230, 239, 254
221, 223, 226, 236 Copy number............................................159, 160, 173, 202,
Bioloanalyzer ................................................ 19–21, 101, 288 231, 251, 259, 273
vol. 1099, DOI 10.1007/978-1-62703-715-0, © Springer Science+Business Media New York 2014
295
CEREAL GENOMICS: METHODS AND PROTOCOLS
296 Index
Cosmid ............................................................................... 42 Electrophoretic transfer ................................... 181, 185, 193,

CTAB. See Cetyl trimethylammonium bromide (CTAB) 196, 198
ctDNA. See Chloroplast genomic DNA (ctDNA) Electroporation system ....................................................... 46
CT value .................................................................... 103, 110 Embryo axis .............................................. 206, 214, 241, 247
Cycle threshold (CT) ............................................. 97, 98, 109 Embryogenic callus ..................................200, 210–212, 225,
230–232, 242–243, 246, 257, 259, 270, 273, 278
D Embryos ........................................... 202, 205, 206, 210–211,
2,4-D. See 2,4-Dichlorophenoxyacetic acid (2,4-D) 215, 217, 220, 221, 225, 228–230, 236, 241–244,
Deletion........................................................................ 78, 82 246–249, 251, 252, 255–260, 262, 265, 271, 273–279
Denaturation ............................. 30, 66, 70–72, 162, 166, 169 EMS. See Ethyl-methanesulfonate (EMS)
Denhardt’s solution .................................................. 181, 182 Enzyme assay ....................................148, 149, 151–152, 156
Deoxyribonucleic acid (DNA) Ethidium bromide ................................ 2, 44–46, 48, 56, 78, 84,
ligations .............................................................. 117–121 87, 90, 119–121, 135, 136, 162, 174, 181, 184, 186, 283
polymorphisms ..................................................... 82, 287 Ethyl-methanesulfonate (EMS) ............................ 78, 81–83,
probe ................................................................... 170, 172 85–86, 88
DEPC. See Diethylpyrocarbonate (DEPC) Extend PCR ....................................................................... 97
DEPC treated H2O .................................................. 180–184 Extension........................................... 67, 70–72, 74, 130, 284
Dephosphorylated .................................... 47, 48, 56–58, 124
F
Depurinated ..................................................................... 160
DH10B strain......................................................... 43, 46, 55 False priming ...................................................................... 68
Dialysis membrane ....................................................... 84, 86 Filter sterilize............................ 43, 44, 55, 56, 118, 203–205,
Dicamba ........................................................................... 258 223, 237–239, 253, 254, 265, 269, 270, 274–276
2,4-Dichlorophenoxyacetic acid (2,4-D) ................. 204, 222, Formamide ................................................... 19, 74, 160, 180
230, 239, 268, 275, 278 Functional analyses ................................................... 123–131
Diethylpyrocarbonate (DEPC) ................ 101, 180, 186, 193
Digital PCR ..................................................................... 105 G
Digoxigenin (DIG) labelling ................................... 160, 161, Gamma radiation ......................................................... 78, 82
168–170, 175, 180 GC content ................................... 68, 73, 100, 171, 175, 176
Dimethyl sulfoxide (DMSO) .............................. 45, 74, 136, GC pairs ............................................................................. 73
142, 267, 278 gDNA library ............................................................... 41–62
Dithiothreitol (DTT) ................................... 31, 51, 189, 274 Gel documentation system ............................. 2, 46, 283, 285
D-mannitol ...................................................................... 223 Gel slice .................................................52, 60, 118–120, 144
DNaeasy Plant mini kit ........................................................ 1 Gene
DNA extraction expression ............................................ 97–114, 130, 148,
aged rice-grains................................................... 9, 12–13 151, 179, 220, 231
ancient seed samples ................................................. 7–15 transfer........................................................................ 269
archaeological grain-specimens..................... 7–10, 13–14 Geneticin .................................................................. 213, 223
modern rice grains .................................................... 7–12 Genetic transformation ............................................ 201–218
rice endosperm ......................................................... 7–15 Genome walking (GW) ...........................................133–145
vegetative tissue .......................................................... 1–5 Genome-wide ................................................... 105, 287–293
DNase ......................................... 27, 101, 108, 113, 156, 163 Genomic DNA (gDNA) ..................................14, 15, 42, 43,
DNAse-free ...................................................................... 161 67, 69–73, 87, 90, 101–102, 108, 130, 134, 137–139,
Donor plants...................... 202–203, 236–237, 255, 257, 259 142, 143, 160, 162, 164, 165, 170, 211, 232, 244, 284
Dose response ..................................................................... 79 Genomic DNA library ........................................... 42, 43, 48
Dosimetry..................................................................... 79, 83 GFP. See Green fluorescent protein (GFP)
DTT. See Dithiothreitol (DTT) Glucose ................................................... 44, 45, 55, 118, 238,
Duplex specific nucleases ............................................. 30, 32 263, 267, 274, 275
Durum wheats .................................................... 77, 212, 246 Glufosinate ammonium ........................................... 204, 213,
217, 239, 249
E
Glycine .....................................................149, 152, 156, 191,
E. coli ......................................................... 43, 46, 47, 55, 127, 193, 204, 213, 238, 265, 266, 275, 276
131, 148, 151, 156, 213, 259 Glycogen ............................. 32, 33, 35, 37–39, 136, 138, 144
EcoTILLING ........................................................ 82–89, 91 Green fluorescent protein (GFP) ............................ 128, 129,
Electro-elution ............................................................. 42, 52 149, 150, 154, 155, 213, 217, 231, 232, 245, 249
Index
297
Guanidine Liquid nitrogen .......................................... 2, 3, 9, 12, 18, 19,
hydrochloride...................................................... 193, 195 24, 25, 27, 46, 106–108, 113, 135, 149, 151, 189, 192,
isothiocyanate ............................................................... 17 194, 197, 242
gus activity ................................................................ 217, 249 Loading dye........................................................... 84, 88, 90,
gusA reporter gene ............................................................ 245 120, 166, 284
GW library ............................................... 134–137, 140, 143 Low-melt agarose .............................................................. 144
Low melting point agarose ............................................... 118
H
M
Hairpin ......................................................................... 69, 99
Heat-shock ....................................................................... 127 Macrocarrier .................................................... 205, 207–210,
Helium .....................................................207–209, 215, 216, 215, 216, 226, 227
223, 227, 228 Magenta vessels ................................................ 205, 211, 240
Herbicides ........................................................ 213, 231, 252 Maize.................................................... 79, 81, 165, 211, 220,
Heterozygous SNPs.......................................................... 289 230, 231, 245, 259, 273–279
High molecular weight DNA ........................... 4, 19, 41, 164 Master mix .......................................................70, 84, 87, 88,
High-throughput...................................... 123, 124, 251–260 108–111, 126, 127
Hi-II maize ...................................................................... 278 Material safety data sheets (MSDS) ........................... 17, 135
His-tag ..................................................................... 148, 150 Melt-curve........................................................ 102, 109–111
Hotstart .............................................................................. 74 Melting temperature............................................. 68, 91, 113
Housekeeping genes ......................................................... 103 Messenger RNA (mRNA) ............................... 29–31, 33, 39
Hybridization M1 generation .................................................................... 81
bag .............................................................. 163, 170–172 Micropore ................................................................. 254, 257
oven .................................................... 163, 170, 182, 185 MicroRNA’s ............................................. 129, 130, 179–187
Hygromycin ..................................................... 231, 252, 253, Mineral oil ...................................................... 35, 38, 39, 144
257–259, 262, 268, 269 Miniprep ......................................... 10, 43, 45, 46, 54, 57, 62
Hygromycin phosphotransferase (hpt) gene ..................... 231 Miracloth................................................................ 46, 49, 58
Mis-priming ....................................................................... 69
I Mitochondrial genomic DNA (mtDNA)
Illumina .............................................................. 91, 281, 288 Moloney murine leukemia virus
Immature embryo ............................................ 202, 205, 206, (MMLV) .............................................. 30, 31, 33, 34
210–211, 220, 221, 225, 228–230, 232, 236, 241, M2 population .................................................................... 80
243, 251, 252, 254–262, 264–269, 273–279 mRNA. See Messenger RNA (mRNA)
Indica......................................... 8, 11, 14, 261–271, 273–279 MSDS. See Material safety data sheets (MSDS)
Insertion .............................. 38, 173, 202, 220, 226, 236, 287 MS macrosalts .......................................... 203, 204, 237, 238
Insertion–deletions (InDels).............................................287 MS medium ............................................................. 223, 230
Isopropylthiogalactoside (IPTG) .......................... 44–46, 53, MS vitamin...................................................... 203, 204, 238,
54, 148, 149, 151 265, 267, 275
Multiplexing ............................................................. 103, 104
J Multiplex PCR ................................................................. 104
Mutagenesis............................................................ 77, 78, 80
Japonica .....................................................8, 11, 14, 261, 262
Mutation ...................................................... 77–92, 281, 283
JM109 competent cells ..................................................... 118
Mutation screening....................................................... 77–92
K N
Kanamycin........................................ 213, 231, 239, 246, 248, Nanodrop ................................................. 108, 162, 164, 173
254, 262, 275 nDNA. See Nuclear genomic DNA (nDNA)
Klenow fragment .............................................. 124, 125, 130 Neomycin phosphotransferase .......................................... 231
Komari fragment .............................................................. 245 Nested PCR ............................................................. 134, 136
N-ethyl-N-nitrosourea (ENU) ...........................................78
L
Next generation sequencing (NGS) .......................... 1–5, 82,
LacZ ................................................................................... 43 91, 123, 134, 287
LD50 ................................................................ 80, 81, 86, 88 Nickel resin............................................................... 149, 151
Lethal dose ............................................................. 80, 81, 89 Non-radioactive probes .................................................... 160
Ligation mix ........................................38, 119–121, 127, 137 Nopaline synthase (NOS) ................................................224
298 Index
Normalization ..................................................30, 32, 35, 36, Protein

39, 102–105, 112, 129 blotting ............................................................... 189–198
Northern blot ........................................................... 179–187 expression ............................................................. 73, 155
Northern hybridization ............................................ 179–187 purification ................................................. 149, 151, 156
Nuclear genomic DNA (nDNA)..................................12, 14 Protoplast isolation ................................... 149–150, 152–155
N6 vitamin ............................................................... 275, 276 pSoup ............................................................... 245, 246, 259
Nylon membrane ............................................. 160, 162, 167, pTiBo542 .........................................................................245
172, 174, 175, 181, 184, 185, 187 Pulsed field gel electrophoresis (PFGE)...................... 42, 45,
46, 50–52, 54, 56, 59, 60, 62
O
Q
Oligo dT..................................................................... 33, 102
Organellar DNA ................................................................ 41 qPCR
Osmocote ................................................. 212, 224, 245, 252 analysis.........................................100, 101, 103–105, 113
apparatus............................................... 97, 102, 104, 105
P data analysis ................................................................ 105
PAGE. See Poly-acrylamide gel electrophoresis (PAGE) normalization.............................................................. 102
Pairwise SNPs .................................................. 289, 292, 293 primers................................................................ 101, 102
Particle bombardment ..................................... 129, 201–232, Quantitative Real-Time PCR
235, 248, 251, 261 (qRT-PCR) ...................................... 97–99, 128, 129
Particle gun....................................................... 207–210, 261
R
Particle inflow gun (PIG) ......................................... 220, 221
pBeloBAC11 .......................................................... 43, 46, 55 Radiation ........................................... 77, 78, 81, 82, 202, 217
pBRACT .......................................................... 253, 254, 259 Radiolabelled probes......................................................... 179
pBRACT 204 ...................................................................254 Random hexamers ............................................................ 102
pBRACT 214 ...................................................................254 Rapid
pCAMBIA ....................................................................... 262 cloning ................................................................ 123–131
PCR enhancer ............................................................ 74, 136 ligation........................................................ 118, 119, 131
Pfu ....................................................................................... 74 ligation buffer ..................................................... 118, 119
Pfu DNA polymerase ......................................................... 74 Reconditioning PCR ................................................ 143, 144
pGEM-T .......................................................................... 144 REDTaq ........................................................................... 127
pGreen.............................................................. 245, 246, 259 REDTaq DNA polymerase .............................................. 125
Phenol:chloroform:isoamyl alcohol ............................ 2, 3, 33 Reference genes ................................. 102, 103, 105, 112, 113
Phenylmethyl sulfonyl fluoride Reference position .................................... 288, 290, 292, 293
(PMSF) .....................................44, 50, 56, 59, 84, 86 Reporter
Phosphinothricin (PPT) ..................................................252 assays .................................................................. 128, 129
Phytagel ..................................... 238–240, 246, 253, 254, 259 gene ................................................ 42, 55, 128, 129, 213,
Picloram ................................................................... 239, 240 217, 218, 223, 231, 232, 241, 245, 249, 253
Poly-acrylamide gel electrophoresis Re-sequencing .......................................................... 287–293
(PAGE) ................................................ 186, 190, 192 Reverse transcriptase (RT) ..................29, 31, 33, 34, 39, 106
Polymerase chain reaction (PCR) ........................ 1, 7, 31, 42, Ribonucleases (RNases)........................................ 18, 25, 101
65–75, 82, 97–112, 118, 123, 134, 159, 195, 211, 232, Ribosomal RNA (rRNA) ................................... 21, 184, 185
281–285 Rice ...................................................... 42, 72, 77, 78, 82, 87,
PPT. See Phosphinothricin (PPT) 220, 230, 231, 259, 261–271, 273–279, 288, 293
Prehybridization ................ 169–171, 175, 176, 182, 185, 187 Rice endosperm .............................................................. 7–15
Primary antibody .............................................. 192, 193, 196 RIN. See RNA integrity number (RIN)
Primer RNA ................................................... 3, 5, 17–21, 23–31, 33,
design ....................................... 67, 68, 89, 100, 134, 136, 38, 39, 42, 72, 99, 101, 102, 106–108, 113, 123, 130,
137, 142, 283, 284 156, 173, 179–182, 184–187, 194, 197
dimers ............................................................. 69, 73, 131 RNAase ............................................................................ 2, 3
mix .............................................................................. 163 RNA extraction
Primer3.............................................................................107 cereal leaf ...................................................................... 17
Promoter.................................................. 123–131, 148–150, vegetative tissue .............................................. 1–5, 17–21
231, 245, 253, 259 wheat seeds ............................................................. 23–28
Protective eye wear ............................................................. 24 RNAi .......................................................................... 23, 254
Index
299
RNA integrity number (RIN) .............................. 20, 21, 101 Superbinary vectors .................................................. 273, 274
RNAlater .................................................................... 19, 101 SYBR green ................................................................ 98, 162
RNase away ...................................................................... 101 SYBRSafe............................................................................. 2
RNase-free .................................. 18, 19, 24–26, 38, 101, 192
RNase-free water ......................... 18, 19, 27, 31, 33, 192, 194 T
RNase H....................................................................... 31, 34 T. aestivum L............................................................. 202, 236
RNases. See Ribonucleases (RNases) Taq DNA polymerase ................................................. 66, 282
RNaseZAP®..................................................... 18, 24, 25, 38 TaqMan probes .................................................................. 99
RNasin plus .................................................................. 31, 34 Targeted induced local lesions in genomes
RNeasy Plant Mini Kit....................................................... 24 (TILLING) .......................................... 81–89, 91, 92
RNeasy spin column ..................................................... 26–28 TBE buffer ...................................................4, 50–52, 54, 59,
RT-qPCR ........................................................................... 97 60, 88, 135, 136, 183
Rupture discs ..................................... 205, 207, 210, 213, 215 T-DNA ........................................................... 202, 236, 245,
247, 249, 259, 273
S T4 DNA ligase ........................................... 33, 38, 45, 47, 48,
Saran wrap ........................................................ 185–187, 198 52, 57, 118, 124, 127
Sarkosyl ............................................................................ 2, 3 T4 DNA ligation buffer ........................................... 124, 127
Scutellum..................................................206, 214, 225, 241, TE buffer.......................................... 2, 4, 5, 8–11, 13, 14, 32,
242, 247, 256, 257, 260, 269, 270 35, 37, 49, 50, 56, 59, 84, 136, 138, 139, 162, 164,
SDS-PAGE .............................................. 190–193, 195, 197 173, 205
Secondary structure ..................... 29, 30, 39, 68, 74, 107, 113 Template switching ...................................................... 30, 33
Seed Templiphi ......................................................................... 144
purity .......................................................................... 287 Tetracyclin ........................................................................ 246
tissue ............................................................................. 24 Tetramethylethylenediamine (TEMED).......... 181, 183, 186
Selectable marker........................................55, 127, 128, 210, TILLING. See Targeted induced local lesions in genomes
213, 215, 217, 231, 245, 252, 259 (TILLING)
Sequenom ......................................................................... 281 Timentin ........................... 239, 240, 242, 249, 253, 257, 258
Sfi I......................................................................... 31, 33, 37 Tissue culture ...........................................203, 210–211, 213,
Shrimp alkaline phosphatase .................................... 124, 125 217, 218, 220–224, 229, 230, 237, 245, 249, 250, 254,
Silwet L-77 ...................................................... 239, 246, 248 258, 259, 262, 263
Single nucleotide polymorphisms (SNPs) Total RNA (tRNA) ..................................20, 21, 31, 33, 106,
discovery ..................................................... 281, 287–293 108, 113, 180, 184, 185
genotyping .................................................................. 283 Touch down PCR....................................................... 75, 283
genotyping platform ................................................... 283 T7 promoter ............................................................. 148, 150
loci ...................................................................... 292, 293 Transcriptome sequencing ................................................ 105
screening ............................................................. 281–285 Transformation .............................................60, 61, 120, 121,
Small RNA’s ..................................................... 130, 179–187 127, 128, 130, 149–150, 152–155, 201–232,
SOC medium ........................................................... 118, 120 235–271, 273–279
Sorghum ..................................................42, 77, 82, 219–232 Transient expression ................................................. 155, 211
Southern blot analysis............................................... 159–177 Trimmed reads.................................................................. 290
Southern blots .......................................................... 160, 186 Tris–acetate–EDTA (TAE) buffer ........................ 48, 52, 59,
Spectinomycin .................................................................. 262 61, 118–120, 143, 283
Spermidine .....................................................44, 50, 55, 205, Trizol® ............................... 17–19, 24–27, 189, 192–195, 197
207, 213, 215, 223, 226 TRIZOL reagent ....................................................... 25, 194
Spermine ...................................................................... 44, 55 tRNA. See Total RNA (tRNA)
Spike................................................................................. 255 T. turgidum L. ........................................................... 212, 246
Spikelets ........................................................... 206, 214, 247
35s promoter............................................. 128, 149, 253, 259 U
5S rRNA .................................................................. 184, 185 Ubiquitin promoter .................................. 211, 231, 245, 259
Starch ..........................................................7, 24, 28, 78, 277 Urea ................................................................. 8, 10–12, 181,
Starch co-precipitates with RNA ....................................... 24 183, 184, 186
Stereomicroscope ...................................................... 262, 265 UV
Sterile distilled water .................................. 8, 9, 13, 193, 203, crosslink ...................................................................... 181
205, 206, 214, 221, 237, 240, 256, 265, 282, 283 transilluminator ............................. 46, 48, 50–52, 55, 118
300 Index
V X
Vacuum pump ................................... 210, 223, 227, 228, 254 X-gal........................................................... 44–46, 53, 54, 56
Variety identification ........................................................ 287 X-ray film ......................................... 161, 164, 172, 180, 185,
VectorNTI ........................................................................ 107 186, 194, 197
Vegetative tissue ................................................... 1–5, 17–21
Vermiculite ....................................................... 149, 212, 245 Y
W YEP medium ............................................................ 275, 276
Whatman .......................... 162, 167, 173, 181, 184, 185, 222 Z

Wheat............................ 20, 21, 23–28, 77, 82, 174, 220, 230
Zeatin ....................................................... 204, 205, 239, 240
Wheat transformation .............................. 201–218, 235–250

Dna Extraction From Rice Seeds

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Dna Extraction From Rice Seeds

Uploaded by

Copyright:

Available Formats

Methods in

Molecular Biology 1099

For further volumes:

Methods and Protocols

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Library of Congress Control Number: 2013953327

© Springer Science+Business Media New York 2014

Printed on acid-free paper

Humana Press is a brand of Springer

St. Lucia, QLD, Australia Robert J. Henry

1 DNA Extraction from Vegetative Tissue for Next-Generation Sequencing . . . . 1

16 Protein Blotting Protocol for Beginners . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 189

DNA Extraction from Vegetative Tissue for Next-Generation

One of the most important methods in genetics or genomics is the

1. 1 M Tris–HCl, pH 8: Take 121.1 g of Tris base and dissolve in

1. Take 3 g of tissue (leaf or seedlings) and using a mortar and

1. During this step DNA forms a complex with CTAB. CTAB

5. In this step the DNA is maintained in the precipitate form,

DNA Extraction from Rice Endosperm (Including a Protocol

Key words Endosperm, Urea, Organellar DNA, nDNA, Ancient DNA

Deoxyribonucleic acid (DNA) extracted from grain tissue of mod-

the genetics of modern-day crops resulting from evolution and

10. Phenol/chloroform 1:1 v/v.

7. Microfuge (tabletop centrifuge).

7. Centrifuge the tubes at 12,000 rpm for 5 min at 4 °C using a

5. Transfer about 500 μL of the supernatant into a clean sterile

Eppendorf tube containing 300 μL of 70.0 % ethanol. Mix

1. Make sure that an even emulsion is obtained.

(Fig. 1). Genomic DNA from leaf tissue, isolated using an

1. Pääbo S, Higuchii RG, Wilson AC (1989) 3. Aoki C, Nshimura T, Yasui S, et al (1999)

RNA Extraction from Cereal Vegetative Tissue

Key words Plant RNA, TRIzol®

A range of ribonucleic acid (RNA) extraction methods are avail-

TRIzol® [2] is a phenol and guanidine isothiocyanate solution and

RNA is rapidly degraded by RNases which are ubiquitous in

Carry out all steps at room temperature (RT) unless otherwise

6. Centrifuge the samples at no more than 14,000 × g for 15 min

1. Homogenize in either an RNase-free precooled mortar and

4. Be careful not to over-dry the RNA pellet as this will increase

6. If extracting RNA from underground tissue such as root sam-

1. Chomczynski P, Sacchi N (1987) Single-step 3. RNaseZap® technical insert (Life Technologies

RNA Extraction from Developing or Mature Wheat Seeds

Key words RNA, Extraction, Starch, Cereal, Grain

Purification of ribonucleic acid (RNA) from biological tissue is now

sequencing. However, the use of both methods in sequence can

2.1 Pulverizing 1. Liquid nitrogen.

2.2 First-Step RNA 1. RNaseZap.

Use DNase/RNase-free tips and tubes. While working periodically

3.1 Pulverizing 1. Take roughly 500 mg of seeds (10 developing or 15 mature

3. Centrifuge at 15,000 rpm (no more than 12,000 × g) for

7. We strongly recommend this step although it is indicated as

1. If using mature seeds then surface sterilize prior to extraction.

8. It is not necessary to add the RLC buffer as indicated in the

cDNA Library Preparation

The construction of cDNA libraries is an important technique that

libraries often contain a large amount of truncated cDNA clones.

With the use of MMLV RT- and DSN-directed depletion of

2.1 First-Strand 1. 100 U/μL SMARTScribe MMLV reverse transcriptase

2.2 Second-Strand 1. cDNA from previous step.

10. 75 % Ethanol (v/v) prepared in distilled water.

2.3 Normalization 1. Double-stranded cDNA.

2.4 Analysis of cDNA 1. Normalized cDNA.

2.5 Amplification 1. Normalized cDNA.

2.6 Digestion 1. 20 U/μL Sfi I restriction endonuclease (New England Biolabs,