Nihal Alam

Familial Hypercholesterolemia

Introduction (About the Disease Cause and Manifestation)

Cause of Disease
Familial Hypercholesterolemia is a disorder that is passed down through the families.

(US National Library of Medicine "Familial hypercholesterolemia: MedlinePlus Medical

Encyclopedia" 2018). It is passed down in an autosomal dominant manner which means you only

need to get one abnormal gene from the parent to get the disease. On the cellular level, it affects

the LDL receptor which involves taking LDL out of the body. There is a mutation in the gene for

the LDL receptor called LDLR which involves passing LDL from the body. Mutations in other

genes can also cause inherited high cholesterol. These genes are PCSK9 and the gene for

Apolipoprotein B and all these genes are connected with one another. Since they are connected,

if a specific type of mutation is inherited in any of these three genes, a possibility of FH can

develop. (American Heart Association "Familial Hypercholesterolemia (FH)" 2017). Rarely a

person with familial hypercholesterolemia has a mutation in both copies of LDLR, APOB, or

PCSK9 gene. FH can be inherited from one parent or from both for homozygous. People with

homozygous traits have the highest amount of LDL cholesterol levels.

How Familial Hypercholesterolemia Affects Cellular Pathways

Due to decreased efficiency of IDL and LDL endocytosis caused by mutation in LDLR, it

causes accumulation of plasma LDL by increasing production of LDL from IDL and decreasing

hepatic clearance of LDL (Thompsons, 2004, 197). The elevated levels of plasma cause

atherosclerosis. Foam cells are formed from monocytes which endocytose oxidized LDL. These

foam cells release cytokines which cause proliferation of smooth muscle cells of arterial media.

Towards the beginning, the smooth muscle cells produce sufficient collagen and matrix proteins

to form fibrous caps over the foam cells however because they continue to endocytose oxidized
1 Nihal Alam Familial Hypercholesterolemia
LDL. This foam cell will eventually rupture through the cap into the arterial lumen and trigger

thrombus formation. Thrombus formation is a common cause for strokes. (Thompsons, 2004,

197 ). The environment, gender and genetic background modify the effect of LDL receptor

mutations on LDL plasma levels and thereby the occurrence of atherosclerosis happens.

(Thompsons, 2004,197). To be more specific, the LDL receptor, a transmembrane glycoprotein

predominantly expressed in the liver and adrenal cortex controls cholesterol homeostasis (

Thompsons, 2004, 197). This binds apo B-100, the sol protein of LDL and apo E, a protein found

on very low-density lipoproteins, intermediate-density lipoproteins, chylomicron remnants, and

some high-density lipoproteins ( Thompsons, 2004, 197).These are helpful because hepatic LDL

receptors clear approximately 50 % of IDL and 66 to 80 percent of LDL from the circulation by

endocytosis ( Thompsons, 2004, 197). But the pathways LDL receptors are poorly understood.

Symptoms of Familial Hypercholesterolemia

This genetic disorder begins at birth and is possible to cause heart attacks at an early age.

(US National Library of Medicine "Familial hypercholesterolemia: MedlinePlus Medical

Encyclopedia" 2018). The defect causes the body inability to remove LDL from blood. This

makes it more likely to have narrowing arteries from atherosclerosis at an early age. When LDL

cannot be removed from the body, this causes fatty skin deposits called xanthomas over the parts

of the hands, elbows, knees, ankles and around the cornea of the eye. (US National Library of

Medicine "Familial hypercholesterolemia: MedlinePlus Medical Encyclopedia" 2018). Along

with the xanthomas, there are cholesterol deposits in the eyelids (xanthelasmas) . (US National

Library of Medicine "Familial hypercholesterolemia: MedlinePlus Medical Encyclopedia" 2018).

For people who have homozygous familial hypercholesterolemia, they develop xanthomas

beneath the skin over their elbows, knees and buttocks as well as in the tendons at a very early

2 Nihal Alam Familial Hypercholesterolemia

age, sometimes in infancy. Due to this, heart attacks and deaths may occur before 30. . (US

National Library of Medicine "Familial hypercholesterolemia: MedlinePlus Medical

Encyclopedia" 2018). Chest pain and other signs of coronary artery disease can be present at a

young age. Another effect when LDL cannot be removed from the body is they cause plaques

which develop in atherosclerosis.

FH (Familial Hypercholesterolemia ) occurs among all races and is prevalent in 1 in 200

to 1 in 100 of most Caucasion populations. This accounts for less than 5 percent of patients (

Thompsons, 2004,197).

Body (Detection, Current Treatment, and Management)

How to Diagnose FH?

The detection of Familial Hypercholesterolemia can be done either clinically or genetically. For

the clinical aspect of it, they do a lipid test that measures the amount of LDL cholesterol there is in the

blood and following this a physical exam and family history is established. For the blood tests, there are

three main sets of criteria for determining FH and this is through the Simon Broome criteria, the Dtuch

Lipid Clinic Network Criteria and the MEDPED criteria. In the Simon Broome criteria, the total

cholesterol has to be more than 260 milligrams per deciliter in children under 6 years old and 290 mg/dL

in adults or LDL cholesterol will be more than 155 mg/dL in children and 190 mg/dL in adults. In the

Dtuch Lipid Clinic Network, the criteria is to have elevated LDL cholesterol of greater than 155 mg/dL.

Lastly, the MEDPED has cutoffs for total cholesterol based upon family history and age(Yu Familial

Hypercholesterolemia) . For the genetic diagnosis side of this, they look for a genetic variant that has

been found and they do genetic testing for that specific variant which can be used to test other family

members and this is known as a process called family screening or cascade screening(The FH

Foundation, Genetic Testing and Familial Hypercholesterolemia).

3 Nihal Alam Familial Hypercholesterolemia

Current Treatments of FH

Current treatment differs from person to person as one may have a case of being heterozygous or

another being homozygous. People who receive only one copy of the defective gene (meaning they are a

heterozygote) can do well with diet changes and statin drugs. Before prescribing medicines, diet changes

will be best. These diet changes include lowering the amount of fat you eat so that it is less than 30 % of

your total calories. If overweight, then losing weight is recommended. Furthermore, cutting out

saturated fat, such as eating less beef, chicken, pork and lamb will be helpful and replacing full-fat dairy

products with low fat products eliminates trans fats. Lowering amount of cholesterol eaten by

eliminating egg yolks and organ meats such as livers

After dietary changes, statin drugs can be used to help lower the risk of heart attack and stroke.

Several include, Lovastatin, Pravastatin, Simvastatin, Fluvastatin, Atorvastatin, Pitavastatin,

Rosuvastatin, Bile acid-sequestering resins, Ezetimibe, Fibrates, Nicotinic acid and PCSK9 inhibitors.

People with severe forms of disorder may need apheresis. This is where blood or plasma is removed

from the body and special filters remove the extra LDL cholesterol and blood plasma is then returned to

the body. Going more in depth with Statin, they block a key enzyme in the liver that is responsible for

producing cholesterol. This leads to the liver sending a signal to clear cholesterol from the bloodstream.

Studies show that it can reduce LDL cholesterol by 35-55 percent and reduce risk of cardiovascular

disease by 22 percent for each 40mg/dl reduction in LDL cholesterol. (The FH Foundation "Statins"

2011) .People with FH are prescribed high potency statins such as Rosuvastatin, Atorvastatin,

Pitavastatin and Simvastatin (The FH Foundation "Statins" 2011).

There are cholesterol absorption inhibitors if a patient does not achieve a therapeutic goal with

statin. In this case, lipid specialists may recommend the use of a cholesterol absorption inhibitor, a type

of drug that works in the small intestine by decreasing cholesterol absorption (Barry Levine "Cholesterol

4 Nihal Alam Familial Hypercholesterolemia

Absorption Inhibitor" 2012). This can reduce LDL cholesterol by 18-25 percent. It is an effective

non-statin therapy which is an effective non-statin therapy for FH when used in combination with

cholesterol lowering medications (Barry Levine "Cholesterol Absorption Inhibitor" 2012). This

Cholesterol Absorption Inhibitor is for those who do not tolerate statins, and cannot lower cholesterol

with statins alone. This ezetimibe can not be taken by women who are trying to conceive, pregnant or

nursing. (Barry Levine "Cholesterol Absorption Inhibitor" 2012). Another class of lipid lowering

medications like bile acid sequestrants may also be used and can also be used for those who have statin

tolerance. Bile Acid Sequestrants lead to a loss of cholesterol in the stool. This then leads to loss of

cholesterol in the bloodstream. (National Lipid Association "Bile Acid Sequestrants" 2014) They work

by binding bile acids in the intestine and then keep them out of circulation and depletion the liver of the

substance (National Lipid Association "Bile Acid Sequestrants" 2014). It helps reduce LDL cholesterol

from bloodstream by 18-25 percent (National Lipid Association "Bile Acid Sequestrants" 2014)

This can be used for pregnant women and for children with homozygous familial hypercholesterolemia

(National Lipid Association "Bile Acid Sequestrants" 2014).

PCSK9 is also another therapy and this is the most recent therapy to have been approved which

was in 2015. This is an injectable drug that targets the proprotein convertase subtilisin kexin (PCSK9)

which is a protein that interferes with clearance of blood cholesterol. This disables PCSK9 and allows

LDL cholesterol to be removed from the body through normal liver clearance processes (The FH

Foundation "PCSK9 Inhibitors for Familial Hypercholesterolemia" Accessed 2020 ). PCSK9 inhibitors

are given under the skin injection. This is through self administration with a pen device about one or two

times per month. This is a monoclonal large molecule drug (Anderson 2019). The side effects of this

include a common cold, sometimes injection site reactions and flu like symptoms (Anderson 2019).

PCSK9 with other LDL drugs has demonstrated to be very effective for some people. It is shown that

5 Nihal Alam Familial Hypercholesterolemia

these drugs reduce LDL cholesterol by 40-65 percent beyond the effect of other lipid lowering drugs.

There are still more clinical trials being run to improve that of PCSK9 because of the potential for

improvement it still has (The FH Foundation "PCSK9 Inhibitors for Familial Hypercholesterolemia"

Accessed 2020 ).

Homozygous Dominant Treatments

For advanced treatments of the severe form of FH (homozygous), treatments include lipoprotein

apheresis, lomitapide and liver transplant. Lipoprotein apheresis is a treatment that involves removing

LDL cholesterol from the blood. Since the patient will build up cholesterol over time again, this

procedure is done every week to every other week. (The FH Foundation "Familial Hypercholesterolemia

Treatments" Accessed 2020) Lomitapide is another treatment which inhibits the function of microsomal

triglyceride transfer protein (MTP) and MTP is an essential role in the liver and intestines by

synthesizing lipoproteins that contain cholesterol (The FH Foundation "Familial Hypercholesterolemia

Treatments" Accessed 2020). This blocking of MTP reduces the level of LDL-C which circulates the

bloodstream by 35-50 percent and those without LDL receptors. (The FH Foundation "Familial

Hypercholesterolemia Treatments" Accessed 2020). People using this must follow a very low fat diet to

minimize gastrointestinal side effects (The FH Foundation "Familial Hypercholesterolemia Treatments"

Accessed 2020). Lastly, when worst comes to worst, there is liver transplant. Liver transplant replaces

the patient's liver with a new liver that does not have FH genes. This procedure is reserved for young

patients with advanced atherosclerosis and no other treatment options (The FH Foundation "Familial

Hypercholesterolemia Treatments" Accessed 2020).

New Therapy In Trial

A therapy which is under study is HILLT which is a high intensity lipid-lowering therapy.

Before treatment cardiovascular disease (55.6%) had suffered the first event before the onset lipid

6 Nihal Alam Familial Hypercholesterolemia

lowering treatment. This treatment is associated with more than 10 times lower odds for cardiovascular

disease (Perez-Calahorra, 2019, 245). It seems promising but more improvements and trials are required

in order to bring it out into the viable world of treatments.

Figure: Please insert here. (Remember to include disease name & your name on the image
face.)

7 Nihal Alam Familial Hypercholesterolemia

8 Nihal Alam Familial Hypercholesterolemia
Cures on the Horizon, Your Proposal and Approach
With other cures and therapies being tested and made, the proposal being made here is a

personalized genetic alteration of the hepatic cell in an ex vivo way through use of CRISPR. Since the

type of mutation can be specific to the patient, personalized treatment will have to occur which is

altering each of the patient's desired sequence. Injecting modified hepatic cells with LDL receptors

working completely on its own without influence of chromosome 19 defect is the goal of this treatment.

The way these will work without influence is these hepatic cells will contain correct genes of LDLR.

Firstly, uptake of a donor patient with a hepatic cell through injection will be taken and uptake of

diseased patient will be taken. Both DNA will be taken into a plasmid and so both will be missing

genetic information. The disease hepatic cell will receive correct DNA plasmid.

Then, comparison of both DNA regarding the LDLR sequence will be taken. Since this is personalized

treatment, an example of Exons 2-6 will be looked at as that controls functionality of the LDL receptors.

So as a result, Exons 2-6 will be targeted and SgRNA will be designed to target the exon affected and

this will be known through software analysis after taking the diseased patients sequence of LDLR gene.

Since every situation can be different, here is a common example of a mutation. The 5’region of UTR

promoter (responsible for transcription factors resulting in how the LDL receptor reacts with

lipoproteins) is usually untranslated. This will be targeted with CAS9. The exonucleases will take the

sequence which could be any part of this long sequence untranslated

(GGAGTGGAATCAGAGCTTCACGGGTTAAAAAGCCGATGTCACATCGGCCGTTCGAACTCCT

CCTCTTGCAGTGAGGTGAAGACATTTGAAAATCAACCCCACTGAAACTCCTCCCCCTGCTAG

AAACCTCAFTTGAATGCTGTAAATGACGTGGGCCCCGAGTGCAATCGCGGGAAGCCAGGGTt

TCAAGCTAGGACACAGAAGGTCGTGATCCGGGTCGGGACACTGCCCTGGCAGAGGCTGCGA

GCATGGGGCC) out from the healthy plasmid and knock in of that untranslated sequence will occur.

The newly formed cells would be in a sterile dish. Intravenous injection of the newly formed cells

9 Nihal Alam Familial Hypercholesterolemia

directing it to the liver through the portal vein will be performed and will be allowed to replicate in the

hepatic region replacing any existing damaged cells or creating new ones within.

Conclusion (Summation/Abstract, Why your approach is Novel and Better)

Familial Hypercholesterolemia is a genetic disease which has no cure but many therapies

which indeed does help relieve the symptoms of what comes with it. This occurs among all races

and is prevalent in 1 in 200 to 1 in 100 of most Caucasion populations which accounts for less

than 5 percent of patients. It is an autosomal dominant genetic discord that is caused by the

defect on chromosome 19 and makes the body struggle in removing LDL cholesterol from the

blood. There are two variants to this; the heterozygote and one that has homozygous traits. Due

to this, problems start to arise for example cholesterol deposits around the eyelids called

Xanthelasmas, xanthomas which are deposits of fat found in tendons and elbows, and more

advanced heart disease. For the treatment proposed it will be a personalized gene procedure.

Firstly, injections of genetically modified hepatic cells with LDL receptors working without

influence of chromosome 19 defect through CRISPR (will be a knock in) by directing it to the

liver through the portal vein. Uptake of a donor with a hepatic cell through injection will be

taken and of diseased; their DNA will be placed into a plasmid. Since this is personalized, the

example given will be Exons 2-6 will be looked at (controls functionality of the LDL

receptors)SgRNA will be designed to target the exon affected and known through software

analysis after taking diseased sequence of LDLR gene. The 5’region of UTR promoter will be

targeted with exonucleases will take the sequence out from the healthy plasmid and knock in that

sequence. The reason why this approach is novel is because all the treatments available are

palliative therapy. Some of these therapies do significantly lower the LDL levels a lot. For

example, when combining a dietary change of lowering amount of fat so it's less than 30 % along

10 Nihal Alam Familial Hypercholesterolemia

with a statin drug, LDL levels do go down. The statins can reduce LDL cholesterol by 35-55

percent and reduce risk of cardiovascular disease by 22 percent. Cholesterol Absorption

inhibitors are also a thing for those resistant to statins and they reduce LDL levels by 18-25

percent which is not really significant but is ok. Then there are Bile Acid Sequestrants which

lead to a loss of cholesterol in stool and then loss in bloodstream. It also helps reduce by 18-25

percent. PCSK9 is a recent therapy which proves to be very effective in some people with

helping reduce LDL levels by 40-65 percent. Among all these treatments, PCSK9 and Statins are

what is most effective. However these treatments have their flaws when it comes to treating

homozygous patients. For homozygous patients, it's more of an extreme treatment suitable for

the dire condition this patients are in. Treatments for these include lipoprotein apheresis,

lomitapide and liver transplant. Lipoprotein apheresis is removing LDL cholesterol from blood, a

procedure done every week. Lomitapide is another treatment which inhibits the function of

microsomal triglyceride transfer protein because of the goal to allow synthesis of lipoproteins

that contain cholesterol. Then there is liver transplant which replaces the patient's liver without

FH genes but is done only for those in severe conditions. The proposal here is similar to the

transplant in the sense that the cells don't have FH genes but theoretically gets rid of the disorder.

This is quite the novel approach as it is a progressive way to slowly transform the some parts of

the liver with health hepatic cells capable of carrying out cholesterol pathways to get rid of LDL.

LDL levels will drastically go down and possibly back to normal and this treatment can be

accessible to all unlike the drastic liver transplant.

11 Nihal Alam Familial Hypercholesterolemia

 Bibliography (References)

“Bile Acid Sequestrants.” The FH Foundation, National Lipid Association, 2014,

thefhfoundation.org/diagnosis-management/fh-treatments/bile-acid-sequestrants#_ftnref1
“Cholesterol Absorption Inhibitor.” The FH Foundation, Barry Levine, 5 July. 2012,
thefhfoundation.org/diagnosis-management/fh-treatments/cholesterol-absorption-inhibitor
Effect of lipid-lowering treatment in cardiovascular disease prevalence in familial hypercholesterolemia
Perez-Calahorra, Sofía et al, Atherosclerosis, Volume 284, 245 - 252
“Familial Hypercholesterolemia (FH).” Heart.org, American Heart Association, 30 Apr. 2017,
www.heart.org/en/health-topics/cholesterol/causes-of-high-cholesterol/familial-hypercholesterolemia-fh.
“Familial Hypercholesterolemia: MedlinePlus Medical Encyclopedia.” MedlinePlus, U.S. National Library of
Medicine, 16 May 2018,
medlineplus.gov/ency/article/000392.htm
“Familial Hypercholesterolemia” Yu, Christine Dimaria and Winnie , Healthline, Healthline Media, 9 Jan.2019
https://www.healthline.com/health/familial-hypercholesterolemia#treatments
“Familial Hypercholesterolemia Treatments.” The FH Foundation, The FH Foundation, Accessed 8 March.
2020
thefhfoundation.org/diagnosis-management/fh-treatments.
“Genetic Testing and Familial Hypercholesterolemia (FH)” The Fh Foundation, The FH Foundation, Accessed
25 March 2020
“PCSK9 Inhibitors for Familial Hypercholesterolemia.” The FH Foundation, The FH Foundation, Accessed 8
March. 2020
thefhfoundation.org/diagnosis-management/fh-treatments/pcsk9-inhibitors-for-familial-hypercholesterolemia
Robert L. Nussbaum, Roderick R.McInnes, Huntington F.Willard, Cornelius F. Boerkoel, Thompson, Genetics
in Medicine: Thompson & Thompson. Saunders, 2004, 197-198
Anderson, Leigh Ann. “PCSK9 Inhibitors: A New Option in Cholesterol Treatment.” Drugs.com, 10 Dec. 2019,
www.drugs.com/slideshow/pcsk9-inhibitors-a-new-option-in-cholesterol-treatment-1166.
“Statins.” The FH Foundation, 8 Nov. 2011,
thefhfoundation.org/diagnosis-management/fh-treatments/statins#_ftnref1

12 Nihal Alam Familial Hypercholesterolemia