Minor 05

Test Pattern
Hindi (1001CMD303521005) )1//1CMD3/3521//5)

CLASSROOM CONTACT PROGRAMME NEET(UG)
MINOR
(Academic Session : 2021 - 2022) 10-10-2021
PRE-MEDICAL : LEADER COURSE PHASE - IV & V (MLE & MLF)
bl iqfLrdk esa 44 i`"B gSaA This Booklet contains 44 pages.
bl ijh{kk iqfLrdk dks tc rd uk [kks y s a tc rd dgk u tk,A
Do not open this Test Booklet until you are asked to do so.
bl ijh{kk iqfLrdk ds fiNys vkoj.k ij fn, funs Z ' kks a dks /;ku ls i<+s a A
Read carefully the Instructions on the Back Cover of this Test Booklet.
egRoiw. kZ funs Z 'k : Important Instructions :
1. mÙkj i= ds i` " B-1 ,oa i` " B-2 ij /;kuiwoZd dsoy uhys @ dkys ckWy 1. On the Answer Sheet, fill in the particulars on Side-1
ikWbaV isu ls fooj.k HkjsaA and Side-2 carefully with blue/black ball point pen only.
2. ijh{kk dh vof/k 180 feuV gS ,oa ijh{kk ifq Lrdk esa 180 iz'u 2. The test is of 180 Minute duration and this Test Booklet
gAS izR;sd iz'u 4 vad dk gAS izR;sd lgh mÙkj ds fy, ijh{kkFkhZ contains 180 questions. Each question carries 4 marks.
For each correct response, the candidate will get 4 marks.
dks 4 vad fn, tk,axasA izR;sd xyr mÙkj ds fy, dqy ;ksx esa ls For each incorrect response, one mark will be deducted
,d vad ?kVk;k tk,xkA vf/kdre vad 720 gSA from the total scores. The maximum marks are 720.
3. bl i`"B ij fooj.k vafdr djus ,oa mÙkj i= ij fu'kku yxkus ds 3. Use Blue/Black Ball Point Pen only for writing
fy, ds o y uhys @ dkys ckWy ikW ba V is u dk iz;ksx djsaA particulars on this page/marking responses.
4. jQ dk;Z bl ijh{kk iqfLrdk esa fu/kkZfjr LFkku ij gh djsaA 4. Rough work is to be done on the space provided for this
purpose in the Test Booklet only.
5. ijh{kk lEiék gks u s ij] ijh{kkFkhZ d{k@gkW y Nks M +u s ls iw o Z 5. On completion of the test, the candidate must
hand over the Answer Sheet to the Invigilator
mÙkj i= fujh{kd dks vo'; lkSai nsaA ijh{kkFkhZ vius lkFk
before leaving the Room/Hall. The candidates
ds o y ijh{kk iqf Lrdk dks ys tk ldrs g S a A are allowed to take away this Test Booklet with
them.
6. ijh{kkFkhZ lqfuf'pr djsa fd bl mÙkj i= dks eksM+k u tk, ,oa ml 6. The candidates should ensure that the Answer Sheet
ij dksbZ vU; fu'kku u yxk,aA ijh{kkFkhZ viuk QkWeZ uEcj iz'u is not folded. Do not make any stray marks on the
Answer Sheet. Do not write your Form No. anywhere
iqf Lrdk@mÙkj i = es a fu/kkZ f jr LFkku ds vfrfjDr vU;= u else except in the specified space in the Test Booklet/
fy[ksaA Answer Sheet.
7. mÙkj i= ij fdlh izdkj ds la'kks/ku gsrq OgkbV ¶+yqbM ds iz;ksx dh 7. Use of white fluid for correction is not permissible on
vuqefr ugha gAS the Answer Sheet.
iz' uks a ds vuqo kn es a fdlh vLi"Vrk dh fLFkfr es a] va xzs th laL dj.k dks gh vaf re ekuk tk,s xkA
In case of any ambiguity in translation of any question, English version shall be treated as final.
ijh{kkFkhZ dk uke (cM+s v{kjksa esa) :

Name of the Candidate (in Capitals)
QkWeZ uEcj : vadksa esa
Form Number : in figures
: 'kCnksa esa
: in words
ijh{kk dsUæ (cM+s v{kjksa esa) :
Centre of Examination (in Capitals) :
ijh{kkFkhZ ds gLrk{kj : fujh{kd ds gLrk{kj
:
Candidate’s Signature : Invigilator’s Signature :
Your Target is to secure Good Rank in Pre-Medical 2022

E + H / 10102021 Page 1/44
ALLEN
Topic : Electromagnetic Induction (Complete), Alternating Current (up to average value, RMS value, different
types of AC circuit), Kinematics (up to motion under gravity), [Back Unit : Basic Math, Vectors, Unit,
Dimension & Error, Electrostatics
1. A circle of radius a has charge density given by 1. त्रिज्या a के एक वृत्त की परिधि पर आवेश घनत्व निम्न
λ = λ0 cos2θ on its circumference. What will be प्रकार दिया जाता है : λ = λ0 cos2θ वृत्त पर कु ल आवेश
the total charge on the circle ? कितना होगा ?
(1) 2πa (2) Zero (1) 2πa (2) शून्य
(3) πaλ0 (4) None of these (3) πaλ0 (4) इनमें से कोई नहीं
2. The coulomb force between two α–particles 2. वायु में 8.2 फर्मी दूरी पर स्थित दो α–कणों के मध्य लगने
separated by a distance of 8.2 fermi, in air is वाला कू लाॅम बल लगभग है :
approximately :
(1) 60N (2) 14N (1) 60N (2) 14N
(3) 120N (4) 140N (3) 120N (4) 140N
3. Two identical point charges are placed at a 3. एक जैसे दो बिन्दु आवेश r दूरी पर रखे हुए हैं। उनके बीच में
separation of r. The variation of electric field दूरी के साथ विद्युत क्षेत्र का परिवर्तन निम्नानुसार दर्शाया जा
with distance in between them can be सकता है।
represented by:
(1) (1)
(2) (2)
(3) (3)
(4) (4)
LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

Page 2/44 Space for Rough Work / रफ कार्य के लिए जगह E + H / 10102021
ALLEN
4. S1 and S2 are two concentric shells enclosing 4. Q
दो संके न्द्रीय खोखले गोले S1 व S2 के अन्दर क्रमश:
Q Q 2
charges and respectively as shown in Q
2 4 एवं आवेश हो तो S1 व S2 से सम्बंधित फ्लक्स का
figure. What is the ratio of the electric Flux 4
through S1 and S2 ? अनुपात क्या होगा ?
3 – 3 –
√ 2 √ 2
(1) – (2) (1) – (2)
√4 3 √4 3
–
√4 3 – 3
√4
(3) (4) – (3) (4) –
3 √2 3 √2
5. An electron enter in high potential region V2 5. एक इलेक्ट्राॅन निम्न विभव क्षेत्र V1 से उच्च विभव क्षेत्र V2
from lower potential region V1. Then its में आता है, इसका वेग-
velocity :
(1) Will increase (1) बढे़गा।
(2) Will decrease (2) कम होगा।
(3) Increase or decrease depends on value of (3) बढ़ेगा या घटेगा, विभव के मान पर निर्भर होगा।
potential (4) परिवर्तित नहीं होगा।
(4) No Change
6. What is electric dipole moment of this 6. चित्र में दिखाए आवेश वितरण के लिए द्विधु्रव आघूर्ण का
distribution of charge :- मान होगा :-
(1) qa (1) qa
(2) 2qa (2) 2qa
– –
(3) qa √ 3 (3) qa √ 3
– –
(4) qa √ 2 (4) qa √ 2

E + H / 10102021 Space for Rough Work / रफ कार्य के लिए जगह Page 3/44
ALLEN
7. Magnetic field due to a long solenoid of cross 7. 15 cm2 अनुप्रस्थ काट की एक लम्बी परिनलिका के
section 15 cm2 is 200 T. This solenoid crosses कारण चुम्बकीय क्षेत्र का मान 200 T है। इस परिनलिका
a square coil of area 2m2 at its center such that को 2m2 क्षेत्रफल वाले एक वर्गाकार कु ण्डली के के न्द्र से
length of solenoid is parallel to the axis of coil इस प्रकार प्रवेश कराते हैं कि परिनलिका की लंबाई
then magnetic flux linked through the square कु ण्डली के अक्ष के समानान्तर हो तो वर्गाकार कु ण्डली से
coil is:- सम्बद्ध फ्लक्स होगा -
(1) Zero (2) 0.1 Wb (1) शून्य (2) 0.1 Wb
(3) 0.2 Wb (4) 0.3 Wb (3) 0.2 Wb (4) 0.3 Wb
8. One conducting U tube can slide inside another 8. कोई चालक U नली किसी दूसरी U नली में, विद्युतीय
as shown in figure, maintaining electrical सम्पर्क बनाकर रखते हुए, आरेख में दर्शाये अनुसार, चल
contacts between the tubes. The magnetic field सकती है। चुम्बकीय क्षेत्र B आरेख के तल के लम्बवत् है।
B is perpendicular to the plane of the figure. If यदि प्रत्येक नली दूसरी नली की ओर एक नियत वेग v से
each tube moves towards the other at a गमन करती है, तो B, ℓ तथा v के पदों में परिपथ में प्रेरित
constant speed v then the emf induced in the विद्युत वाहक बल, जबकि ℓ प्रत्येक नली की चौड़ाई है :-
circuit in terms of B, ℓ and v where ℓ is the
width of each tube, will be :-
(1) zero (2) 2 Bℓν (3) Bℓν (4) –Bℓν (1) शून्य (2) 2 Bℓν (3) Bℓν (4) –Bℓν
9. A conducting wire frame is placed in a 9. चित्रानुसार एक चालक फ्रे म चुम्बकीय क्षेत्र में रखा गया है।
magnetic field as shown. The magnetic field is चुम्बकीय क्षेत्र का मान यदि समय के साथ बढ़ रहा हो तो
increasing. The directions of induced current in शाखा AB तथा CD में प्रेरित धारा की दिशा होगी:-
wires AB and CD are:-
(1) B to A and D to C (2) A to B and C to D (1) B से A तथा D से C (2) A से B तथा C से D

(3) A to B and D to C (4) B to A and C to D (3) A से B तथा D से C (4) B से A तथा C से D
ALLEN
10. An infinitely long cylindrical conducting wire 10. एकसमान चुम्बकीय क्षेत्र के समान्तर एक अनन्त लम्बाई
is kept parallel to uniform magnetic field along का लम्बा बेलनाकार चालक तार धनात्मक z-अक्ष की
positive z-axis. The current induced on the
surface of conducting wire is :- दिशा में रखा है। चालक तार की सतह पर प्रेरित धारा है :-
(1) along the direction of magnetic field (1) चुम्बकीय क्षेत्र की दिशा के अनुरूप
(2) zero (2) शून्य
(3) circulated in anticlockwise direction when
(3) z-अक्ष से देखने पर वामावर्ती दिशा में घूमती हुई
viewed from z-axis
(4) z-अक्ष से देखने पर दक्षिणावर्ती दिशा में घूमती हुई
(4) circulated in clockwise direction when
viewed from z-axis
11. A conducting rod AC of length 4ℓ is rotated about 11. एक चालक छड़ AC की लम्बाई 4ℓ है इसे बिन्दु O के परित:
→ →
a point O in a uniform magnetic field B directed तल में अंदर की ओर उपस्थित चुम्बकीय क्षेत्र B के लम्बवत्
into the paper. AO = ℓ and OC = 3ℓ. Then :- घुमाया जाता है। यदि AO = ℓ एवं OC = 3ℓ है, तब :-
Bωℓ2 Bωℓ2
(1) VA − VO = (1) VA − VO =
2 2
7 7
(2) VO − VC = Bωℓ2 (2) VO − VC = Bωℓ2
2 2
(3) VA – VC = 4Bωℓ2 (3) VA – VC = 4Bωℓ2
9 9
(4) VC − VO = Bωℓ2 (4) VC − VO = Bωℓ2
2 2
12. Magnetic fleld changing at the rate of 4T/sec in a 12. 5 सेमी त्रिज्या के वृत्तीय भाग में चुम्बकीय क्षेत्र 4T/sec की
circular region of 5 cm radius. The value of दर से परिवर्तित होता है। के न्द्र 'O' से 10 सेमी दूर स्थित
induced electric field at a point 'P', which is 10 cm
distance away from the centre 'O' of region is :- बिन्दु P पर प्रेरित विद्युत क्षेत्र होगा :-
(1) 0.05 V/m (2) 0.2 V/m (1) 0.05 V/m (2) 0.2 V/m
(3) 0.5 V/m (4) 2V/m (3) 0.5 V/m (4) 2V/m

ALLEN
13. Faraday's laws are consequence of conservation of :- 13. फै राडे का नियम किसके संरक्षण से सम्बन्धित है :-
(1) Energy (1) ऊर्जा
(2) Energy and magnetic field (2) ऊर्जा एवं चुम्बकीय क्षेत्र
(3) Charge (3) आवेश
(4) Magnetic field (4) चुम्बकीय क्षेत्र
14. A solenoid wound over a rectangular frame. If 14. एक परिनालिका को आयताकार फ्रे म पर लपेटा जाता है।
all the linear dimensions of the frame are यदि सभी रेखीय विमाओं को 3 गुने से बढ़ा दिया जाये तथा
increased by a factor 3 and the number of turns एकांक लम्बाई में घेरों की संख्या नियत रहे तो स्वप्रेरकत्व
per unit length remains the same, the self कितने गुने से बढ़ जायेगा:-
inductance increased by a factor of :–
(1) 3 (2) 9 (3) 27 (4) 63 (1) 3 (2) 9 (3) 27 (4) 63
15. A square conducting loop is placed in the time 15. एक वर्गाकार चालक लूप को समय परिवर्ती चुम्बकीय क्षेत्र
dB dB
varying magnetic field ( = + ve constant) . ( = + ve constant) में रखा गया है। वर्ग का
dt dt
The centre of square coincides with axis of के न्द्र, चुम्बकीय क्षेत्र के बेलनाकार भाग की अक्ष के साथ
cylindrical region of magnetic field. The सम्पाती है। बिन्दु a, b तथा c पर प्रेरित विद्युत क्षेत्र की
directions of induced electric field at point a, b दिशाएँ है:-
and c.
(1) (2) (1) (2)
(3) (4) (3) (4)

ALLEN
16. An inductance coil have the time constant 4 sec, 16. एक प्रेरकत्व कु ण्डली का समय नियतांक 4 sec है। इस
if it is cut into two equal parts and connected कु ण्डली को दो बराबर भागों में विभाजित करके उन भागों
को समान्तर क्रम में जोड़ दें तो निकाय का नया समय
parallel then new time constant of the circuit :-
नियतांक होगा :-
(1) 4 sec (2) 2 sec (1) 4 sec (2) 2 sec
(3) 1 sec (4) 0.5 sec (3) 1 sec (4) 0.5 sec
17. In the figure magnetic energy stored in the coil 17. दिये गये परिपथ में कु ण्डली द्वारा संचित ऊर्जा होगी -
is :
(1) Zero (2) Infinite (1) शून्य (2) अनन्त

(3) 25 Joule (4) None of these (3) 25 जूल (4) इनमें से कोई नहीं
18. Two co–axial solenoids shown in figure. If key 18. चित्र में दो समाक्षीय परिनालिकाऐं प्रदर्शित है। यदि
of primary suddenly opened then direction of प्राथमिक कुं जी को अचानक खोला जावे तो द्वितीयक में
instantaneous induced current in resistance ‘R’ संयुक्त प्रतिरोध R में तात्क्षणिक प्रेरित धारा की दिशा
which connected in secondary: होगी:-
(1) L to N (1) L से N की ओर
(2) N to L (2) N से L की ओर
(3) Alternating (3) प्रत्यावर्ती
(4) Zero (4) शून्य
19. Two coils X and Y are placed in a circuit such 19. दो कु ण्डलियाँ X व Y परिपथ में इस प्रकार व्यवस्थित है
that when a current changes 2A in coil X, the कि कु ण्डली X में 2A धारा परिवर्तन करने पर कु ण्डली Y
magnetic flux changes by 0.4 weber in Y. The में 0.4 वेबर फ्लक्स परिवर्तित होता है तो कु ण्डलियों का
value of mutual inductance of the coils - अन्योन्य प्रेरकत्व होगा -
(1) 0.2 H (2) 5 H (1) 0.2 H (2) 5 H
(3) 0.8 H (4) 20 H (3) 0.8 H (4) 20 H

ALLEN
20. A sinusoidal voltage of frequency 60 Hz and 20. 60 Hz आवृत्ति एवं 150 V शिखर मान वाली प्रत्यावर्ती
peak value 150 V is applied to a series L-R वोल्टता श्रेणी L-R परिपथ पर आरोपित की गयी है, जहाँ
circuit, where R = 20 Ω and L = 40 mH :-
R = 20 Ω तथा L = 40 mH है। धारा, VR तथा VL के
The amplitudes of current, VR and VL are, आयाम के मान हैं, क्रमशः
respectively
(1) 6A, 90 V and 120 V (1) 6A, 90 V तथा 120 V
(2) 3A, 45 V and 60 V (2) 3A, 45 V तथा 60 V
(3) 6A, 120 V and 90 V (3) 6A, 120 V तथा 90 V
(4) 3A, 60 V and 45 V (4) 3A, 60 V तथा 45 V
21. RMS value of I = 3 + 4 sin ωt is :- 21. I = 3 + 4 sin ωt का RMS मान है :-
– – – –
7 √7 7 √ 7
(1) 2 √ (2) (1) 2 √ (2)
2 2
−− −−
(3) √
−−
17 (4) √17 (3) √
−−
17 (4) √ 17
2 2
22. In an ac circuit i = 100 sin 200 πt. The time 22. एक प्रत्यावर्ती धारा परिपथ मे i = 100 sin 200 πt द्वारा
required for the current to achieve its peak दर्शायी जाती है। इस परिपथ में धारा शून्य से बढ़कर उसके
value will be शिखर मान तक पहुंचने में लगा समय है
1 1 1 1
(1) sec (2) sec (1) sec (2) sec
100 200 100 200
1 1 1 1
(3) sec (4) sec (3) sec (4) sec
300 400 300 400
23. A particle moving with uniform acceleration 23. एक कण जो नियत त्वरण के साथ A से B सरल रेखा में
from A to B along a straight line has velocities गति करता हैं, बिन्दु A पर वेग V1 तथा बिन्दु B पर V2 है।
V1 and V2 at A and B respectively. If C is the अगर C बिन्दु A एवं बिन्दु B के बिल्कु ल मध्य हैं, तो C पर
mid-point between A and B then determine the वेग ज्ञात करो -
velocity of the particle at C.
−−−−−−−− −−−−−−−−
V12 + V22 V12 + V22
(1) √ (1) √
2 2
−−−−−−−− −−−−−−−−
V12 − V22 V12 − V22
(2) √ (2) √
2 2
V1 + V2 V1 + V2
(3) (3)
2 2
(4) None of these (4) इनमें से कोई नहीं
ALLEN
24. In the given v-t graph the distance travelled by 24. दिए गए v-t ग्राफ में, पिण्ड के द्वारा 5 सेकण्ड में तय की गई
the body in 5 seconds will be दूरी होगी

(1) 100 m (2) 80 m (1) 100 m (2) 80 m
(3) 40 m (4) 20 m (3) 40 m (4) 20 m
25. A car travels a distance d on a straight road in 25. एक कार सीधी सड़क पर d दूरी दो घण्टे में तय करती है
two hours and then returns to the starting point और अगले तीन घण्टे में पुन: प्रारम्भिक बिन्दु पर पहुँचती है।
in next three hours. Its average speed and इसकी औसत चाल व औसत वेग है :-
average velocity is :
d 2d d 2d
(1) , 0 (2) ,0 (1) , 0 (2) ,0
5 5 5 5
5d d 5d d
(3) , (4) None of these (3) , (4) इनमें से कोई नहीं
6 5 6 5
26. A car accelerates from rest at a constant rate of 26. एक कार विरामावस्था से कु छ समय तक 2 m/s2 की
2 m/s2 for some time. Then, it retards at a नियत दर से त्वरित होती है। इसके प'pkत, यह नियत दर
constant rate of 4 m/s2 and comes to rest. What 4 m/s2 से मंदित होकर विरामावस्था में आ जाती है। यदि
is the maximum speed attained by the car, if it कार 3 सैकण्ड तक गति में रही तो कार द्वारा प्राप्त की गयी
remains in motion for 3 seconds ? अधिकतम चाल कितनी है।
(1) 2 m/s (2) 3 m/s (3) 4 m/s (4) 6 m/s (1) 2 m/s (2) 3 m/s (3) 4 m/s (4) 6 m/s
27. An ant is at a corner of a cubical room of side ' a '. 27. एक चींटी a भुजा वाले घनीय कमरे के कोने पर है। चींटी
The ant can move with a constant speed u. The नियत चाल u से चल सकती है। तो चींटी को कमरे के
minimum time taken to reach the farthest corner of सबसे दूर वाले कोने तक पहुॅंचने में लगने वाला न्युनतम
the cube is: समय होगा :
3a – 3a –
√3a √ 3a
(1) (2) (1) (2)
u u u u
– –
(√ 2 + 1) a
– –
(√ 2 + 1) a
√5 a √5 a
(3) (4) (3) (4)
u u u u
ALLEN
28. A body start from rest and moves with constant 28. एक वस्तु विरामावस्था से प्रारम्भ कर नियत त्वरण से गति
acceleration. What is the ratio of the distance करती है। इसके द्वारा गति के चौथे तथा तीसरे सैकण्ड में तय
travelled by the body during the 4th and 3rd
second of motion. की गई दूरीयों का अनुपात होगा।
7 5 7 5
(1) (2) (1) (2)
5 7 5 7
7 3 7 3
(3) (4) (3) (4)
3 7 3 7
29. The displacement of a particle moving along 29. x-अक्ष के अनुदिश गतिशील कण का विस्थापन इस प्रकार
x-axis is given by :-
दिया जाता है:-
x = a + bt + ct2

x = a + bt + ct2
The acceleration of the particle is :- तो कण का त्वरण होगा :-

(1) b (2) c (1) b (2) c
(3) b + c (4) 2c (3) b + c (4) 2c
30. An auto travelling along a straight road increases 30. एक सीधी सड़क पर चलने वाला एक ऑटो अपनी चाल
its speed from 30.0 m s–1 to 50.0 m s–1 in a को 30.0 m s–1 से 50.0 m s–1 तक 180 m की दूरी पर
distance of 180 m. If the acceleration is constant,
बढ़ा देता है। यदि त्वरण नियत है, तो इस दूरी को तय करने
how much time elapses while the auto moves
this distance ? के दौरान ऑटो को कितना समय लगेगा ?
(1) 6.0 s (2) 4.5 s (1) 6.0 s (2) 4.5 s
(3) 3.6 s (4) 7.0 s (3) 3.6 s (4) 7.0 s
31. Which of the following statements is incorrect ? 31. निम्न में से कौन-सा कथन सही नहीं है ?
(1) Path length is a scalar quantity whereas (1) पथ की लंबाई अदिश राशि है जबकि विस्थापन एक
displacement is a vector quantity सदिश राशि है
(2) The magnitude of displacement is always (2) विस्थापन का परिमाण हमेशा ही किसी वस्तु के द्वारा
equal to the path length traversed by an दिये गए समयान्तराल में पथ की लंबाई के बराबर
object over a given time interval होता है
(3) The displacement depends only on the end (3) विस्थापन के वल अंतिम बिन्दुओं पर निर्भर होता है,
points whereas path length depends on the जबकि पथ की लंबाई अनुसरण किए गए वास्तविक
actual path followed पथ पर निर्भर करती है
(4) The path length is always positive whereas (4) पथ की लंबाई हमेशा धनात्मक होती है जबकि
displacement can be positive, negative and zero विस्थापन धनात्मक, ऋणात्मक या शून्य हो सकता है

ALLEN
32. The speed v of a particle moving along a straight 32. एक सरल रेखा में गतिमान कण की चाल v को समीकरण
line, when it is at a distance x from a fixed point v2 = 108x – 9x2 द्वारा दिया जाता है। जहाँ x पर निश्चित
on the line is given by v2 = 108x – 9x2. The बिंदु से कण की दूरी है। कण के त्वरण का परिमाण x = 3
magnitude of its acceleration when it is at a
पर होगा :-
distance 3 from the fixed point is :-
(1) 9 m/s2 (2) 18 m/s2 (1) 9 m/s2 (2) 18 m/s2
(3) 27 m/s2 (4) None of these (3) 27 m/s2 (4) इनमें से कोई नहीं
33. The displacement of a particle after time t is 33. t समय के प 'pk त् एक कण का विस्थापन
given by x = (k/b2)(1 – e–bt), where b is a समीकरण x = (k/b 2 )(1 – e – bt ) द्वारा दिया गया है,
constant. What is the acceleration of the जहाँ b नियतांक है। कण का त्वरण क्या है ?
particle ?
(1) ke–bt (2) –ke–bt (1) ke–bt (2) –ke–bt
k bt − k bt k bt − k bt
(3) e −
(4) e −
(3) e −
(4) e −
b2 b2 b2 b2
34. A particle has initial velocity ( 3î + 4^j ) and 34. किसी कण का प्रारंभिक वेग ( 3î + 4^j ) तथा त्वरण
has acceleration (0.4î + 0.3^j ). Its speed after (0.4î + 0.3^j ) है। 10 सैकण्ड के प'pkत् कण की चाल
10s is :- होगी:-
(1) 10 units (1) 10 मात्रक
(2) 7 units (2) 7 मात्रक
– –
(3) 7√2 units (3) 7√2 मात्रक
(4) 8.5 units (4) 8.5 मात्रक

35. Which of the following statement is false :- 35. निम्न में से कौन-सा कथन गलत है :-
(1) A body can have zero velocity and still be (1) किसी वस्तु का वेग शून्य होने पर भी यह त्वरित हो
accelerated सकती है।
(2) A body can have a constant velocity and (2) किसी वस्तु का वेग नियत होने पर भी चाल परिवर्तित
still have varying speed. हो सकती है।
(3) A body can have a constant speed and still (3) किसी वस्तु की चाल नियत होने पर भी वेग परिवर्तित
have varying velocity. हो सकती है।
(4) The direction of velocity of a body can (4) किसी वस्तु के वेग की दिशा परिवर्तित हो सकती है
change when its acceleration is constant. जब इसका त्वरण नियत हो।
ALLEN
36. A particle moves 400 m north and 300 m south 36. एक कण उत्तर दिशा में 400 मीटर चलता है फिर दक्षिण
and then 1200 m vertically upwards, its net दिशा में 300 मीटर चलता है फिर 1200 मीटर उर्ध्वाधर
ऊपर की ओर चलता है तो प्रारम्भिक बिन्दु के सापेक्ष कु ल
displacement is
विस्थापन होगा
(1) 1200 m (2) 1300 m (1) 1200 m (2) 1300 m
(3) 1400 m (4) 1500 m (3) 1400 m (4) 1500 m
37. The position time relation of a particle moving 37. x-अक्ष के अनुदिश गतिशील कण की स्थिति व समय
along the x-axis is given by x = 6 – 2t + 3t2 के मध्य निम्न सम्बंध है। x = 6 – 2t + 3t2 कण की गति
then for velocity time graph का वेग-समय वक्र होगा
(1) (2) (1) (2)
(3) (4) (3) (4)
38. A person moves 30 m north and then 20 m 38. एक आदमी उत्तर दिशा की ओर 30 मीटर चलता है और
towards east and finally 30 –2m in south-east
√ फिर पूर्व दिशा में 20 मीटर चलता है और अन्त में दक्षिण-
direction. The displacement of the person from पूर्व में 30 –2 मीटर चलता है। मूल बिन्दु से विस्थापन है
the origin will be

(1) 50 m towards west (1) पश्चिम की ओर 50 मीटर
(2) 50 m towards east (2) पूर्व की ओर 50 मीटर
– –
(3) 60√2m towards north-west (3) उत्तर-पश्चिम की ओर 60 √ 2 मीटर
– –
(4) 60√2m towards east-north (4) पूर्व-उत्तर की ओर 60 √ 2 मीटर
39. A drunkard is walking along a straight road. He 39. एक शराबी एक सीधी सड़क पर चल रहा है। वह 5 कदम
takes 5 steps forward and 3 steps backward, आगे और 3 कदम पीछे रखता है और उसके बाद वह
followed by 5 steps forward and 3 steps फिर 5 कदम आगे और 3 कदम पीछे रखता है और इस
backward and so on. Each step is one meter प्रकार उसका प्रत्येक कदम 1 m लम्बा है और उसे रखने
long and takes one second. There is a pit on the में 1 s लगता है। सड़क पर प्रारम्भिक बिन्दु से 11 m दूर
road 11 meters away from the starting point. एक गड्डा है तो शराबी कितने समय बाद गड्डे में गिरेगा?
the drunkard will fall into the pit after :
(1) 29 s (2) 21 s (3) 37 s (4) 31 s (1) 29 s (2) 21 s (3) 37 s (4) 31 s
ALLEN
40. If P ⃗
. Q⃗ = PQ, then angle between P ⃗ and Q⃗ is : 40. यदि P ⃗
. Q⃗ = PQ हो, तो P ⃗ व Q⃗ के मध्य कोण होगा -
(1) 00 (2) 300 (3) 450 (4) 600 (1) 00 (2) 300 (3) 450 (4) 600
41. The magnitudes of vectors A, B and C ⃗ ⃗ ⃗ 41. सदिश A, ⃗
B ⃗ और C ⃗ के परिमाण क्रमश: 12, 5 और
are respectively 12, 5 and 13 units and 13 इकाई है। यदि A ⃗
+ B ⃗ = C ⃗ तब A⃗ और B ⃗ के मध्य
A B C , then the angle between A and B
⃗
+
⃗
=
⃗ ⃗ ⃗
कोण है :
is :
(1) 0 (2) π/3 (3) π/2 (4) π/4 (1) 0 (2) π/3 (3) π/2 (4) π/4
42. If the vectors i j k and 3i form two
^
( +
^ ^
+ )
^ 42. यदि सदिश i j k और 3i त्रिभुज की दो भुजाओं
^
( +
^ ^
+ )
^
sides of a triangle, then area of the triangle is : को निरूपित करते हैं, तो त्रिभुज का क्षेत्रफल होगा :
– – – –
(1) √ 3 unit (2) 2√3 unit (1) √ 3 इकाई (2) 2√3 इकाई
3 – 3 –
(3) – unit (4) 3√2 unit (3) – इकाई (4) 3√2 इकाई
√2 √2
43. A force F ⃗
= ( 3î + 4^j ) N acts on a body and 43. F ⃗ = (3î + 4^j ) N का एक बल एक वस्तु पर कार्य
displaces it by S ⃗ = (3î + 4^j ) m. The work करता है तथा उसे S ⃗ = (3î + 4^j ) m से विस्थापित
done (W = F ⃗ ⋅ S )
⃗
by the force is : करता है। बल द्वारा किया गया कार्य ( W = F ⃗ ⋅ S )
⃗
है :-
(1) 10J (2) 12J (3) 19J (4) 25J (1) 10J (2) 12J (3) 19J (4) 25J
44. A force F is given by F = at + bt2, where t is 44. एक बल F, समीकरण F = at + bt2 द्वारा दिया जाता है,
time. The dimensions of a and b are जहाँ t समय है। a और b की विमाएँ है:
(1) [M L T–3] and [M L T–4] (1) [M L T–3] तथा [M L T–4]
(4) [M L T–2] and [M L T0] (4) [M L T–2] तथा [M L T0]
45. Percentage error in measuring the radius and 45. एक ठोस गोले की त्रिज्या व द्रव्यमान के मापन में त्रुटियाँ
mass of a solid sphere are 2% & 1% क्रमश: 2% व 1% है, तो इसके व्यास के सापेक्ष जड़त्व
respectively. then error in measurement of
आघूर्ण के मापन में त्रुटि होगी :-
moment of inertia about to its diameter is :-
(1) 3 % (2) 6 % (1) 3 % (2) 6 %
(3) 5 % (4) 4 % (3) 5 % (4) 4 %
ALLEN
Topic : Surface Chemistry (Complete), Mole Concept (Complete), Classification and IUPAC Nomenclature
(Complete). [Back Unit : Chemical Equilibrium]
46. The equilibrium constant for the reaction 46. अभिक्रिया Br2 2Br के 500 K और 700 K पर साम्य
⇌
Br2 2Br at 500 K and 700 K are 10–10 and

⇌ स्थिरांक क्रमश: 10–10 और 10–5 है। तो अभिक्रिया है :-
10–5 respectively. The reaction is :-
(1) Endothermic (1) ऊष्माशोषी
(2) Exothermic (2) ऊष्माक्षेपी
(3) Fast (3) तीव्र
(4) May be endothermic or exothermic (4) ऊष्माशोषी या ऊष्माक्षेपी हो सकती है।
47. If the value of an equilibrium constant for a 47. एक अभिक्रिया का साम्यावस्था स्थिरांक 1.6 × 1012 है,
reaction is 1.6 × 1012, then at equilibrium the तो साम्यावस्था पर निकाय में होंगे :
system will contain :-
(1) mostly reactants (1) अधिकांशत: अभिकारक
(2) mostly products (2) अधिकांशत: उत्पाद
(3) similar amounts of reactants and products (3) अभिकारकों एवं उत्पादों की समान मात्रा
(4) any of the above (4) उपरोक्त में से कोई भी
48. Given a gas phase reaction,
48. गैसीय अभिक्रिया, 2A(g) + B(g) ⇌ C(g) + D(g) के
2A(g) + B(g) ⇌ C(g) + D(g). Which one of the
लिये KC को प्रभावित कौन करेगा ?
following changes will affect the value of KC?
(1) Addition of inert gas (1) अक्रिय गैस का योग
(2) Addition of catalyst (2) उत्प्रेरक का योग
(3) Addition of reactants (3) अभिकारकों का योग
(4) Increasing temperature (4) ताप में वृद्धि
49. For the chemical reaction
49. रासायनिक अभिक्रिया
3X(g) + Y(g)
X3Y(g) + heat;
⇌ 3X(g) + Y(g)
X3Y(g) + ऊष्मा
the amount of X3Y at equilibrium is affected by :- के लिए X3Y की साम्य पर मात्रा प्रभावित होगी :-
(1) temperature and pressure (1) ताप एवं दाब द्वारा
(2) only temperature (2) के वल ताप द्वारा
(3) only pressure (3) के वल दाब द्वारा
(4) temperature, pressure and catalyst (4) ताप, दाब एवं उत्प्रेरक द्वारा
ALLEN
50. Consider the following gaseous equilibria 50. निम्नलिखित गैसीय साम्यों का संज्ञान लीजिए :-
given below :-
(I) N2 + 3H2 ⇌ 2NH3; साम्य स्थिराँक=K1
(I) N2 + 3H2 ⇌ 2NH3; Eqm. constant=K1
(II) N2 + O2 ⇌ 2NO; साम्य स्थिराँक=K2
(II) N2 + O2 ⇌ 2NO; Eqm. constant=K2
1
1 (III) H2 + O 2 ⇌ H2O; साम्य स्थिराँक=K3
(III) H2 + O 2 ⇌ H2O; Eqm. constant=K3

2
2
The equilibrium constant for the reaction, K1, K2 तथा K3 के पदों में अभिक्रिया :-
5 5
2NH3 + O2 ⇌ 2NO + 3H2O in terms of K1, 2NH3 + O ⇌ 2NO + 3H2O के लिए साम्य
2 2 2
K2 and K3 will be :- स्थिराँक का मान है :-
(1) K1K2K3 (1) K1K2K3
K 1K 2 K 1K 2
(2) (2)
K3 K3
K 1 K 32 K 1 K 32
(3) (3)
K2 K2
K 2 K 33 K 2 K 33
(4) (4)
K1 K1
51. In which of the following reaction, equilibrium 51. निम्न में से कौनसी अभिक्रिया का साम्य कु ल दाब घटाने पर
would shift to the right side, if total pressure is
दायीं ओर विस्थापित होगा :-
decreased :-
(1) N2(g) + 3H2(g) 2NH3(g)
⇌ (1) N2(g) + 3H2(g) 2NH3(g)
⇌
(2) H2(g) + I2(g) 2HI(g)

⇌ (2) H2(g) + I2(g) 2HI(g)
⇌
(3) N2O4(g) 2NO2(g)

⇌ (3) N2O4(g) 2NO2(g)
⇌
(4) H2(g) + Cl2(g) 2HCl(g)

⇌ (4) H2(g) + Cl2(g) 2HCl(g)
⇌
52. For the reaction, PCl3(g) + Cl2(g) ⇌ PCl5(g) 52. अभिक्रिया, PCl3(g) + Cl2(g) ⇌ PCl5(g) के लिये
the value of KC at 600K is 24.63. The value of 600K पर KC का मान 24.63 है। इस ताप पर KP का मान
KP at this temperature will be – होगा –
(1) 0.5 (1) 0.5
(2) 0.7 (2) 0.7
(3) 0.83 (3) 0.83
(4) 0.9 (4) 0.9

ALLEN
53. Consider the two gaseous equilibrium involving 53. 298 K पर SO2 के दो गैसीय साम्य व उनके साम्य स्थिरांक
SO2 and the corresponding equilibrium constants at निम्न प्रकार है
298 K
SO2(g) + 1/2 O2(g) SO3(g) ....K1
⇌
SO2(g) + 1/2 O2(g) SO3(g) ....K1
⇌
2SO3(g) 2SO2(g) + O2(g) ....K2
⇌
2SO3(g) 2SO2(g) + O2(g) ....K2
The values of equilibrium constants are related as :- साम्य स्थिरांकों के मान सम्बन्धित है :-
1 1
(1) 2K1 = K22 (2) K22 = K (1) 2K1 = K22 (2) K22 = K
1 1
1 2 1 2
(3) K12 = K (4) K2 = (3) K12 = K (4) K2 =
2 K 12 2 K 12
54. For N 2 O 3 NO + NO 2 , if total pressure is
⇌ 54. N2O3 NO + NO2, के लिए यदि कु ल दाब P atm
⇌
P atm and degree of dissociation is 50%, तथा वियोजन की मात्रा 50% हो तो, Kp का मान होगा।
the value of K p will be
P P P P
(1) 3 P (2) 2 P (3) (4) (1) 3 P (2) 2 P (3) (4)
3 2 3 2
55. In the manufacture of NH3 by Haber's process, 55. हेबर विधि से NH3 के निर्माण में कौनसी परिस्थिति
which condition gives maximum yield – अधिकतम लब्धि देगी
(1) High temperature, High pressure and high (1) उच्च ताप, उच्च दाब और उच्च अभिकारक सान्द्रता
concentration of reactants
(2) High temperature, low pressure and low (2) उच्च ताप, निम्न दाब, निम्न अभिकारक सान्द्रता
concentration of reactants (3) निम्न ताप और उच्च दाब और उच्च अभिकारक
(3) Low temperature, high pressure and high सान्द्रता
(4) Low temperature, low pressure and low (4) निम्न ताप, निम्न दाब और निम्न अभिकारक सान्द्रता
56. The value of Kc for the reaction
56. अभिक्रिया 3A ⇌ 2B + 2C के लिए K c का मान
3A 2B + 2C is 3 × 10–5 At a given time the
⇌
3 × 10 – 5 है। किसी समय पर अभिक्रिया मिश्रण का
composition of reaction mixture is
संघटन यदि [A] = [B] = [C] = 2 × 10 – 4 M.

[A] = [B] = [C] = 2 × 10–4 M. In which
direction the reaction will proceed? हो तो अभिक्रिया कौनसी दिशा में अग्रसर होगी।
(1) Forward direction (2) Reverse direction (1) अग्र दिशा (2) पश्च दिशा
(3) at equilibrium (4) None (3) साम्य पर (4) कोई नहीं
ALLEN
57. 2.0 mole of PCl5 were introduced in a vessel of 57. एक निश्चित ताप पर 2 मोल PCl5 को 5 लीटर आयतन के
5.0 L capacity at a particular temperature. At एक बर्तन में रखा गया है। साम्य पर 35% PCl5, PCl3 व
equilibrium, PCl5 was found to be 35% Cl2 में टूट जाता है। निम्नलिखित अभिक्रिया के लिए Kc
dissociated into PCl3 and Cl2. The value of Kc का मान है :-
for the reaction:-
(1) 1.89 (2) 0.377 (1) 1.89 (2) 0.377

(3) 1.33 (4) 13.3 (3) 1.33 (4) 13.3
58. How many 2°–H are present in the compound : 58.
यौगिक मे कितने 2°–H परमाणु
उपस्थित है :

(1) 2 (2) 6 (3) 5 (4) 7 (1) 2 (2) 6 (3) 5 (4) 7
59. The ratio of π-bond & σ-bond in Ph-COOH :- 59. Ph-COOH में π-बंध तथा σ-बंध का अनुपात होगा:-
(1) 5 : 3 (2) 3 : 5 (1) 5 : 3 (2) 3 : 5
(3) 3 : 16 (4) 4 : 15 (3) 3 : 16 (4) 4 : 15
60. 60.
number of π e– ? π e– कितने हैं?
(1) 14 (2) 16 (3) 18 (4) 20 (1) 14 (2) 16 (3) 18 (4) 20

61. How many sp2 carbon and 2°H atoms are 61. बेंजाईन में कितने sp2 कार्बन तथा 2°H अणु क्रमश:
present in benzyne respectively :- उपस्थित है :-
(1) 4, 4 (2) 6, 6 (3) 6, 4 (4) 4, 6 (1) 4, 4 (2) 6, 6 (3) 6, 4 (4) 4, 6
62. Total number of substituents presents in the 62. निम्नलिखित अणु में प्रतिस्थापियों की कु ल संख्या बताइये :
molecule :
(1) 4 (2) 5 (1) 4 (2) 5

(3) 6 (4) 7 (3) 6 (4) 7
ALLEN
63. The IUPAC name of the compound 63. यौगिक का IUPAC नाम है-
is-
(1) N-Ethyl-N-methylmethanamide (1) N-एथिल-N-मेथिलमेथेनामाइड

(2) N-Methyl-N-ethylmethanamide (2) N-मेथिल-N-एथिलमेथेनामाइड
(3) N-Ethyl-N-methylformamide (3) N-एथिल-N-मेथिलफार्मामाइड
(4) N-Ethylmethylmethanamide (4) N-एथिलमेथिलमेथेनामाइड
64. The correct IUPAC name of following 64. दिये गये यौगिक का सही IUPAC नाम है
compound is :

(1) Methyl -2-ethylpropanoate (1) मेथिल-2-एथिलप्रोपेनोएट

(2) Methyl butane-2-carboxylate (2) मेथिल ब्यूटेन-2-कार्बोक्सीलेट
(3) Methyl- 2-methylbutanoate (3) मेथिल-2-मेथिलब्यूटेनोएट
(4) Methoxypentanone (4) मेथाॅक्सीपेन्टेनाॅन
65. IUPAC name of the compound is : 65. यौगिक का IUPAC नाम है :
(1) Butane-1,2,3-tricarboxylic acid (1) ब्यूटेन-1,2,3-ट्राई कार्बोक्सिलिक अम्ल

(2) Propane-1,2,3-tricarboxylic acid
(2) प्रोपेन-1,2,3-ट्राई कार्बोक्सिलिक अम्ल
(3) 2-carboxy propanedioic acid
(3) 2-कार्बोक्सी प्रोपेन डाइ ओइक अम्ल
(4) Pentane-1,2,4 trioic acid
(4) पेन्टेन-1,2,4 ट्राई ओइक अम्ल

ALLEN
66. 66.
IUPAC name of is :- का IUPAC नाम है :-
(1) 2-Hydroxy pentan-4-one (1) 2-हाइड्राक्सी पेन्टेन-4-ऑन

(2) 4-Hydroxy pentan-2-one (2) 4-हाइड्राक्सी पेन्टेन-2-ऑन
(3) 2-Oxo pentan-4-ol (3) 2-ऑक्सो पेन्टेन-4-ऑल
(4) 4-Hydroxy-2-oxo pentane (4) 4-हाइड्राक्सी-2-ऑक्सो पेन्टेन
67. IUPAC name of the following compound is ? 67. दिए गए यौगिक का IUPAC नाम है ?
(1) 3–Ethyl–4–isopropyl–2–methyl heptane (1) 3–एथिल–4–आइसोप्रोपिल–2–मेथिल हेप्टेन

(2) 4–Ethyl–5–isopropyl–6–methyl heptane (2) 4–एथिल–5–आइसोप्रोपिल–6–मेथिल हेप्टेन
(3) 4–Isopropyl–3–Ethyl–2–methyl heptane (3) 4–आइसोप्रोपिल–3–एथिल–2–मेथिल हेप्टेन
(4) 5–Isopropyl–4–Ethyl–6–methyl heptane (4) 5–आइसोप्रोपिल–4–एथिल–6–मेथिल हेप्टेन
68. 68.

correct I.U.P.A.C. name is :- सही I.U.P.A.C. नाम है :-

(1) 4 – Ethyl – 3 – Methyl hex –1 – en – 5 – yne (1) 4 – एथिल – 3 – मेथिल हेक्स –1 – ईन – 5 – आइन
(2) 4 – Ethyl – 3 – Methyl hexen – 6 – yne (2) 4 – एथिल – 3 – मेथिल हेक्सीन – 6 – आइन
(3) 3 – Ethyl – 4 – Methyl hexen – 5 – yne (3) 3 – एथिल – 4 – मेथिल हेक्सीन – 5 – आइन
(4) 4 – Ethyl – 3 – Methyl hex – 5 – enyne (4) 4 – एथिल – 3 – मेथिल हेक्स – 5 – इनाइन
69. IUPAC name of following compound is 69. निम्न यौगिक का IUPAC नाम है
(1) 4 - Chloro - 2 - bromo cyclo hexanol (1) 4 - क्लोराे - 2 -ब्रोमोसाइक्लोहेक्सेनोल

(2) 2 - Bromo - 4 - Chloro hexanol (2) 2 - ब्राेमो - 4 - क्लोराेहेक्सेनोल
(3) 2 - Bromo - 4 - Cyclohexanol (3) 2 - ब्रोमो - 4 - साइक्लोहेक्सेनोल
(4) 2 - Bromo - 4 - chloro cyclohexanol (4) 2 - ब्रोमो - 4 - क्लोराेसाइक्लोहेक्सेनोल
ALLEN
70. The correct IUPAC name of the following 70. दि गई संरचना का सही IUPAC नाम होगा -
compounds

respectively are :-
(1) 2-chloro-1-methyl-4-nitrobenzene and 3,4- (1) 2-क्लोरो-1-मेथिल-4-नाइट्रोबेंजीन एवं 3,4-डाइमेथिल
dimethyl phenol फीनाॅल
(2) 4-methyl-5-chloronitrobenzene and 3,4- (2) 4-मेथिल-5-क्लोरोनाइट्रोबेंजीन एवं 3,4-डाइमेथिल
(3) 2-methyl-1-chloro-5-nitrobenzene (3) 2-मेथिल-1-क्लोरो-5-नाइट्रोबेंजीन एवं डाइमेथिल
and dimethyl phenol फीनाॅल
(4) 3-chloro-4-methyl-1-nitrobenzene and (4) 3-क्लोरो-4-मेथिल-1-नाइट्रोबेंजीन एवं डाइमेथिल
71. Which of the following is secondary amine :- 71. निम्न में से द्वितीयक ऐमीन है :-
(1) (1)
(2) (2)
(3) (3)
(4) Both 1 & 3 (4) 1 व 3 दोनों
72. Elements A and B form two compounds B2A3 72. तत्व A व B दो यौगिक B2A3 तथा B2A बनाते है
and B2A. 0.05 moles of B2A3 weigh 9.0 g 0.05 मोल B2A3 का भार 9.0 ग्राम है तथा 0.10 मोल
and 0.10 mole of B2A weigh 10 g. Calculate
B2A का भार 10 ग्राम है। A व B के परमाणु भार होंगे -
the atomic masses of A and B :-
(1) 20 and 30 (2) 30 and 40 (1) 20 तथा 30 (2) 30 तथा 40
(3) 40 and 30 (4) 30 and 20 (3) 40 तथा 30 (4) 30 तथा 20
ALLEN
73. If 3.01 × 1020
molecules are removed from 98 mg 73. यदि 98 mg. H2SO4 में से 3.01 × 1020 अणु हटा लिए
of H2SO4, then the number of moles of H2SO4 left जाऐं तो H2SO4 के कितने मोल शेष रहेंगे
are :–
(1) 0.1 × 10–3 (2) 0.5 × 10–3 (1) 0.1 × 10–3 (2) 0.5 × 10–3
(3) 1.66 × 10–3 (4) 9.95 × 10–2 (3) 1.66 × 10–3 (4) 9.95 × 10–2
74. 2.2 g of a compound containing phosphorous 74. फाॅस्फोरस व गंधक युक्त यौगिक के 2.2 ग्राम में 1.24 ग्राम
and sulphur has 1.24 g of 'P' in it. Its
'P' है। इसका मूलानुपाती सूत्र है -
empirical formula is -
(1) P2S3 (2) P3S2 (1) P2S3 (2) P3S2
(3) P3S4 (4) P4S3 (3) P3S4 (4) P4S3
75. Assuming that petrol is octane (C8H18) and has 75. माना कि ऑक्टेन (C8H18) पेट्रोल है तथा इसका
density 0.8 g mL–1. 1.425 L of petrol on घनत्व 0.8 g/mL है। 1.425 लीटर पेट्रोल के पूर्ण दहन के
complete combustion will consume. लिए आवश्यकता होगी -
(1) 50 mole of O2 (2) 100 mole of O2 (1) 50 मोल O2 की (2) 100 मोल O2 की
(3) 125 mole of O2 (4) 200 mole ofO2 (3) 125 मोल O2 की (4) 200 मोल O2 की
76. 2.4 g of a metal displaces 1.12 L hydrogen at 76. एक धातु के 2.4 g NTP पर 1.12 लीटर हाइड्रोजन को
normal temperature and pressure, Equivalent विस्थापित करती है, तो धातु का तुल्यांकी भार होगा -
weight of metal would be:-
(1) 12 (2) 24 (1) 12 (2) 24
(3) 1.2 × 11.2 (4) 1.2 11.2
÷ (3) 1.2 × 11.2 (4) 1.2 11.2
÷
77. In Victor Mayer's method, 0.2 g of a volatile 77. विक्टर मेयर विधि में STP पर, 0.2 ग्राम वाष्पशील यौगिक
compound on volatilisation gave 56 mL of के वाष्पीकरण पर 56 मि.ली. वाष्प बनती है। इसका
vapour at STP. Its molecular weight is - अणुभार होगा -
(1) 40 (2) 60 (3) 80 (4) 120 (1) 40 (2) 60 (3) 80 (4) 120
78. Four one litre flasks are seperately filled with 78. एक लीटर के चार फ्लास्कों को पृथक रूप से, एक
the gases hydrogen, helium, oxygen and ozone समान ताप व दाब पर, हाइड्रोजन, हीलियम, ऑक्सीजन
at same temperature and pressure. The ratio of
तथा ओजोन से भरा गया है। विभिन्न फ्लास्कों में उपस्थित
total number of atoms of these gases present in
the different flasks would be - परमाणुओं की संख्या का अनुपात होगा -
(1) 1 : 1 : 1 : 1 (2) 1 : 2 : 2 : 3 (1) 1 : 1 : 1 : 1 (2) 1 : 2 : 2 : 3

(3) 2 : 1 : 2 : 3 (4) 2 : 1 : 3 : 2 (3) 2 : 1 : 2 : 3 (4) 2 : 1 : 3 : 2
ALLEN
79. When 100 g of ethylene polymerizes to 79. जब 100 gm इथाइलिन निम्न समीकरण के अनुसार
polyethylene according to following equation
पाॅलीइथाइलीन में परिवर्तित होता है
nCH2 = CH2 → (- CH2 - CH2 -)n-. The weight nCH2 = CH2 → (- CH2 - CH2 -)n-
of polyethylene produced will be :- प्राप्त पाॅलीइथाइलिन का भार होगा :-

n n
(1) g (2) 100 g (1) g (2) 100 g
2 2
100 100
(3) g (4) 100n g (3) g (4) 100n g
n n
80. 1.0 g of magnesium is burnt with 0.56 g O2 in a 80. 1.0 g मैग्निशियम को 0.56 g O2 के साथ बंद पात्र में
closed vessel. Which reactant is left in excess जलाया जाता है। कौन सा अभिकारक शेष बचा रहेगा और
and by how much ?
कितना ?
(At. wt. Mg = 24 ; O = 16) (Mg का प. भा. = 24 एवं O का प. भा. = 16)

(1) Mg, 0.16 g (2) O2, 0.16 g (1) Mg, 0.16 g (2) O2, 0.16 g
(3) Mg, 0.44 g (4) O2, 0.28 g (3) Mg, 0.44 g (4) O2, 0.28 g
81. The volume occupied by 1.8 g of water vapour 81. 374 °C एवं 1 बार दाब पर 1.8 g जल वाष्प का आयतन
at 374 °C and 1 bar pressure will be :- [Use R होगा। [Use R = 0.083 bar L K–1 mol–1]
= 0.083 bar L K–1 mol–1]
(1) 96.66 L (2) 55.87 L (1) 96.66 L (2) 55.87 L
(3) 3.10 L (4) 5.37 L (3) 3.10 L (4) 5.37 L
82. 2.76 g of silver carbonate on being strongly 82. 2.76 ग्राम सिल्वर कार्बोनेट को अत्यधिक गर्म करने पर
heated yields a residue weighing –
प्राप्त अवशेष का भार है –
Ag2CO3 → 2Ag + CO2 + ½ O2 Ag2CO3 → 2Ag + CO2 + ½ O2

(1) 2.16 g (2) 2.48 g (1) 2.16 g (2) 2.48 g
(3) 2.32 g (4) 2.64 g (3) 2.32 g (4) 2.64 g
83. How many moles of magnesium phosphate, 83. मैग्नीशियम फाॅस्फे ट, Mg3(PO4)2, के कितने मोल में
Mg3(PO4)2 will contain 0.25 mol of oxygen atoms? ऑक्सीजन परमाणुओं का 0.25 मोल होगा ?
(1) 2.5 × 10–2 (1) 2.5 × 10–2
(2) 0.02 (2) 0.02
(3) 3.125 × 10–2 (3) 3.125 × 10–2
(4) 1.25 × 10–2 (4) 1.25 × 10–2

ALLEN
84. A gaseous hydrocarbon on combustion 84. एक गैसीय हाइड्रोकार्बन दहन पर 0.72 g जल और
gives 0.72 g of water and 3.08 g of CO2. The 3.08 g CO2 देता है। हाइड्रोकार्बन का मूलानुपाती सूत्र
empirical formula of the hydrocarbon is है :
(1) C2H4 (2) C3H4 (3) C6H6 (4) C7H8 (1) C2H4 (2) C3H4 (3) C6H6 (4) C7H8
85. The mass percentage of oxygen in ethanol is 85. इथेनोल में ऑक्सीजन का भार प्रतिशत है :-
(1) 13.13% (2) 34.73% (1) 13.13% (2) 34.73%
(3) 60% (4) 75% (3) 60% (4) 75%
86. x 86. x
Graph between log ( and log P is a
) जब log ( ) और log P के मध्य ग्राफ खीचा जाता
m m
straight line at an angle 45° with x-axis and है तो x-अक्ष के साथ 45° का कोण प्राप्त होता है तथा y-
intercept on y-axis 0.3010. Calculate the अक्ष पर अन्तःखण्ड 0.3010 है अतः 0.2 atm दाब पर
amount of gas adsorbed in gram per gram of अधिशोषक द्वारा अधिशोषित होने वाली गैस की मात्रा
the adsorbent when pressure is 0.2 atm. (x/m) में होगी :-
(1) 0.4 (2) 0.6 (3) 0.8 (4) 0.2 (1) 0.4 (2) 0.6 (3) 0.8 (4) 0.2
87. Brownian motion shown by colloidal particles 87. कोलाॅइडी कणों के द्वारा प्रदर्शित ब्राउनी गति इनका -------
is its ------------- property :- ------ गुण है
(1) Optical (1) प्रकाशीय
(2) Electrical (2) विद्युत
(3) Kinetic (3) बल गतिकी (Kinetic)
(4) Chemical (4) रासायनिक
88. Which is not a colloidal solution : 88. निम्न में से कौनसा कोलाॅइडी विलयन नहीं है -
(1) Smoke (2) Ink (1) धुँआ (2) स्याही
(3) Air (4) Blood (3) वायु (4) रक्त
89. Which of followig ion has minimum 89. निम्न में से कौनसा आयन निम्नतम ऊर्णन मान रखता है :-
flocculation value:
(1) Cl– (2) SO4–2 (1) Cl– (2) SO4–2
(3) PO43– (4) [Fe(CN)6]4– (3) PO43– (4) [Fe(CN)6]4–
90. Zeolites are :- 90. जिओलाइट है :-
(1) Water softener (2) Catalyst (1) जल मृदुकारक (2) उत्प्रेरक
(3) cation exchanger (4) All of these (3) धनायन प्रतिस्थापक (4) उपरोक्त सभी
ALLEN
Topic : Molecular Basis of inheritance (Complete), Animal Kingdom (Complete), Cockroach (Complete).
[Back Unit : Human Reproduction & Reproductive Health]
91. Oxygen carrying respiratory pigment of 91. तिलचट्टे में ऑक्सीजन वहन करने वाला 'oसन वर्णक होता
cockroach is :- है :-
(1) Haemocyanin (2) Haemoglobin (1) हीमोसायनिन (2) हीमोग्लोबिन
(3) Hemoerythrin (4) None (3) होमोइरिथ्रिन (4) कोई नहीं
92. The brain of cockroach is represented by :- 92. तिलचट्टे का मस्तिष्क निरूपित किया जाता है, द्वारा:-
(1) Sub–oesophageal ganglia (1) सब-ईसोफे जियल गैग्लियां
(2) Thoracic ganglia (2) वक्षीय गैग्लियां
(3) Supra–oesophageal ganglia (3) सूप्रा इसोफे जियल गैग्लियां
(4) Last abdominal ganglia (4) अन्तिम उदरीय गैग्लियां
93. Which of the following set of spiracles is 93. निम्नांकित में से कौनसा 'okस रंध्र का समुच्चय
remain open irrespective of inhallation or अंत:'oसन एवं बहि'oसन की परवाह किये बिना सदैव
exhallation? खुले रहते है ?
(1) Thoracic spiracles only (1) के वल वक्षीय 'okस रंध्र
(2) 1st thoracic and 1st abdominal (2) प्रथम वक्षीय एवं प्रथम उदरीय
(3) First 2 pairs of abdominal (3) उदर के प्रथम के दो जोड़ी
(4) All pairs (4) सभी जोड़ी
94. In cockroach which structure help in 94. काॅकरोच में कौनसी संरचना वातावरणीय दशाओं को मापने
monitoring the environment ? का काम करते हैं ?
(1) Legs (2) Antenne (1) टांगे (2) श्रृंगिका
(3) Maxilla (4) Occelli (3) मैक्सिला (4) नेत्रक
95. Which is not a part of blood vascular system of 95. कौनसा काॅकरोच के रक्त परिसंचरण तंत्र का भाग नही
cockroach? हैं ?
(1) Alary Muscles (1) एलेरी पेशियाँ
(2) Dorsal heart (2) पृष्ठीय हृदय
(3) Blood sinuses (3) रक्त कोटर
(4) Spiracles (4) 'oसन रंध्र

ALLEN
96. Salivary ducts in periplaneta open into : 96. पेरिप्लेनेटा में लार ग्रंथि खुलती है, में :
(1) crop (1) क्राॅप
(2) base of pharynx (2) ग्रसनी के आधार पर
(3) base of oesophagus (3) ग्रासनाल के आधार पर
(4) base of hypopharynx (4) अधोग्रसनी के आधार पर
97. Which of the following structure is present 97. निम्न में से कौनसी संरचना के वल नर काॅकरोच में उपस्थित
only in male cockroach ? होती है?
(1) Anal cerci (1) गुद लूम
(2) Anal style (2) गुद कं टिकायें
(3) Arthrodial membrane (3) आथ्रोडाइल झिल्ली
(4) Chitinous exoskeleton (4) काइटनस बाह्य कं काल
98. Study the given table and select the correct 98. दी गई तालिका को पढ़े और सही विकल्प को चुने :
option :
जन्तु लक्षण हैक्सा
Animal Character Taxa
Exclusively
Phylum
संघ
(1) Lancelet (1) लेन्सलेट के वल समुद्री

marine Cephalochordata सिफे लोकाॅर्डेटा
Close type of
हेग बंद प्रकार का
खण्ड
Division -
(2)
(2) Hag fish circulatory
system
Gnathostomata मछली परिसंचरण तंत्र ग्नेथोस्टोमेटा
Skin is moist,
नम त्वचा
(3) Hyla Class - Amphibia (3) हाॅइला वर्ग - उभयचर

Oviparous अण्डयुज
Skin is moist,
नम त्वचा
(4) Struthio fertilization is

Class - Aves (4) स्ट्रु थियो वर्ग - पक्षी
internal निषेचन आंतरिक
99. Which part of alimentary canal of cockroach 99. तिलचट्टे की आहारनाल के किस भाग में बाहरी परत मोटी
has an outer layer of thick circular muscles and वर्तुल पेशियों की तथा आन्तरिक क्यूटिकल छ: स्थानों पर
inner cuticle forming six highly chitinous plate
मोटी होकर काइटिन के दाॅत बनाती है?
called teeth?
(1) Crop (2) Gizzard (1) क्राॅप (2) गिजार्ड
(3) Oesophagus (4) Rectum (3) ग्रसिका (4) मलाशय

ALLEN
100. In cockroach, the ootheca is formed by the 100. काॅकरोच में अण्डकवच निम्न में से किसके स्त्रावण से
secretion of :- बनता है :-
(1) Phallic gland (1) फै लिक ग्रंथि
(2) Uricose gland (2) यूरिकोस ग्रंथि
(3) Collaterial gland (3) काॅलेटिरियल ग्रंथि
(4) Mushroom gland (4) छत्रीय ग्रंथि
101. What is common/true for devil fish, hag fish 101. दानव/प्रेत मछली, चुडै़ल मछली और भूत मछली में क्या
and ghost fish? समानता है?
(1) All are true fishes (1) सभी वास्तविक मछलियाँ हैं
(2) Closed type of blood circulatory system (2) बंद प्रकार का रक्त परिसंचरण तंत्र
(3) Internal fertilisation (3) आंतरिक निषेचन
(4) Presence of notochord during embryonic period (4) भ्रूणीय अवस्था के दौरान नाॅटोकोर्ड की उपस्थिति
102. The figure given below shows the head region 102. नीचे दिये गये चित्र में काॅकरोच के सिर को दर्शाया है A से
of cockroach. Identify A to F. F तक पहचानिये
(1) A-Compound eye, B-Ocellus,

(1) A-संयुक्त नेत्र, B-ऑसिलस, C-मैक्सिला,
C-Maxilla, D-Mandible, E-Labrum, F-Labium D-मैन्डिबल, E-लैब्रम, F-लैबियम

(2) A-Ocellus, B-Compounds eye,
(2) A-ऑसिलस, B-संयुक्त नेत्र, C-मैन्डिबल,
C-Mandible, D-Maxilla, E-Labrum, F-Labium D-मैक्सिला, E-लैब्रम, F-लैबियम

(3) A-Ocellus, B-Compound eye,
(3) A-ऑसिलस, B-संयुक्त नेत्र, C-मैन्डिबल,
C-Mandible, D-Maxilla, E-Labium, F-Labrum D-मैक्सिला, E-लैबियम, F-लैब्रम

(4) A-Ocellus, B-Compound eye,
(4) A-ऑसिलस, B-संयुक्त नेत्र, C-मैक्सिला,
C-Maxilla, D-Mandible, E-Labrum, F-Labium D-मैन्डिबल, E-लैब्रम, F-लैबियम

ALLEN
103. Read the statements given below and select the 103. नीचे दिये गये कथनों को पढो तथा सही विकल्प चुनो -
correct option :
कथन - 1 : सिफै लोकाॅर्डेट अपने संपूर्ण शरीर में जीवनभर
Statement-1 : Cephalochordates bears notochord पृष्ठरज्जु धारण करते हैं।
all along the body throughout life.
कथन - 2 : यूरोकाॅर्डेट जीवनभर कशेरूक दण्ड को के वल

Statement-2 : Urochordates bears vertebral
column only in the tail region throughout the life. अपने पुच्छ क्षेत्र में धारण करते हैं।
(1) Both statements-1 and 2 are correct (1) कथन-1 व 2 दोनों सही हैं।
(2) Statement-1 is correct and statement-2 is incorrect (2) कथन-1 सही तथा कथन-2 गलत हैं।
(3) Statement-1 is incorrect and statement-2 is correct (3) कथन-1 गलत तथा कथन-2 सही हैं।
(4) Both statement-1 and 2 are incorrect (4) कथन-1 व 2 दोनों गलत हैं।
104. Identify the organism given below and its 104. नीचे दिये गये जन्तु को उसके लक्षण, वर्ग के साथ पहचानिए :-
division along with its character :-
(1) Petromyzon, division Agnatha, Endo (1) पेट्रोमाइजाॅन, डिविजन-एग्नेथा (अनैथोस्टोमाटा),

parasite on fishes मछलियों के अन्त: परजीवी
(2) Lamprey, division agnatha, ectoparasite on (2) लैम्प्रे, डिविजन-एग्नेथा (अनैथोस्टोमाटा), मछलियों
fishes के बाहृय परजीवी
(3) Hag fish, division agnatha, ectoparasite on (3) हैगफीश, डिविजन-एग्नेथा (अनैथोस्टोमाटा),
fishes मछलियों के बाहृय परजीवी
(4) Myxine, division agnatha, scavanger (4) मिक्सीन, डिविजन-एग्नेथा (अनैथोस्टोमाटा), सफाई
करने वाले
105. Which of the following is characteristic of 105. निम्न में से कौन उभयचर का लक्षण तथा उदाहरण है ?
amphibia with example :-
(1) External ear and cloaca present - Rana (1) बाहय कर्ण तथा अवस्कर उपस्थित - Rana
(2) Tympanum present and tail absent- Bufo (2) कर्ण पटह उपस्थित तथा पूॅछ अनुपस्थित- Bufo
(3) Tympanum present and tail absent- (3) कर्ण पटह उपस्थित तथा पूॅछ अनुपस्थित -
Salamandra Salamandra
(4) Moist skin and diaphragm present- (4) नम त्वचा तथा डायाफ्राम उपस्थित -Ichthyophis
Ichthyophis

ALLEN
106. Which one is the correct group of animals from 106. निम्नलिखित में से प्राणियों का कौनसा सही समूह है जो
following that bears the all following features ?
निम्न सभी अभिलक्षणों को धारण करते है ?
(a) Homoiothermous animals

(a) समतापी प्राणी।
(b) 4 chambered heart

(b) 4-कक्षीय हृदय
(c) Respiration by lungs (c) 'oसन फु फु स द्वारा

(1) Rana, Naja, Pteropus and Rattus (1) राना, नाजा, टेरोपस तथा रेटस
(2) Pavo, Psittacula, Delphinus and Canis (2) पेवो, सिटेकु ला, डोल्फिनस तथा के निस
(3) Canis, Felis, Bufo and Betta (3) के निस, फे लिस, बूफो तथा बेटा
(4) Pavo, Rattus, Crocodilus and Clarias (4) पेवो, रेटस, क्रोकोडाइल तथा क्लेरीयस
107. Statocysts are balancing structure may be 107. स्टेटोसिस्ट संतुलन करने वाली संरचना है जो उपस्थित हो
present in :- सकती है:-
(1) Ascaris (2) Pheretima (1) एस्के रिस (2) फे रेटिमा
(3) Prawn (4) Leech (3) झींगा (4) जोंक
108. Bilateral symmetry is exhibited by :- 108. द्विपा'ohZय सममिति प्रदर्शित करते हैं :-
(1) Ophiura, Scoliodon, Saccoglossus, Sepia (1) ऑफ्यूरा, स्काॅलियोडाॅन, सैक्कोग्लोसस, सीपीया
(2) Unio, Ancyclostoma, Exocoetus, Apis (2) यूनियो, एन्सायक्लोस्टोमा, एक्सोसिटस, एपिस
(3) Sycon, Naja, Ornithorhynchus, Testudo (3) सायकाॅन, नाजा, ऑर्निथोरिंकस, टेस्ट्यूडो
(4) Adamsia, Ascidia, Rana, Neophron (4) एडेम्सिया, एसीडिया, राना, नियोफ्राॅन
109. Infective stage for human in Taenia solium is – 109. टीनिया सोलियम की मनुष्य के लिए संक्रमक अवस्था है -
(1) Cysticercus (1) सिस्टीसर्क स
(2) Oncosphere (2) आन्कोस्फे यर
(3) Bladderworm (3) ब्लैडरवार्म
(4) Hexacanth (4) हेक्साकै न्थ
110. Identify the incorrect matching pair: 110. गलत मिलाए गए युग्म को पहचानिये:
(1) Leucosolenia - Radial symmetry (1) ल्यूकोसोलेनिया - अरीय सममिति
(2) Pinacoderm - Pinacocytes cells (2) पिनेकोडर्म - पिनेकोसाइट कोशिकाऐं
(3) Choanoderm - Collar cells (3) कोएनोडर्म - काॅलर कोशिकाऐं
(4) Scleroblast - Secrete spongin fibers (4) स्कलेरोब्लास्ट - स्पांजिन तन्तुओं का स्त्रवण

ALLEN
111. Protozoans have varying body shape and are 111. प्रोटोजोआ के जन्तुओं की अलग-अलग आकृ ति होती है
mostly :- तथा वे ज्यादातर होते हैं-
(1) Asymmetrical (1) असममितीय
(2) Radially symmetrical (2) अरीय सममितीय
(3) Bilaterally symmetrical (3) द्विik'oZ सममितीय
(4) Biradially symmetrical (4) द्विअरीय सममितीय
112. Enterocoelous coelom is found in :- 112. एण्टीरोसीलस सीलोम पायी जाती है:-
(1) Deuterostomia (2) Astomia (1) ड्यूटेरोस्टोमिया में (2) एस्टोमिया में
(3) Protostomia (4) Blastostomia (3) प्रोटोस्टोमिया में (4) ब्लास्टोमिया में
113. Cellular grade of organisation is found in :- 113. कोशिकीय स्तर का संगठन पाया जाता है :-
(1) Sponges (2) Coelentrates (1) स्पंजों में (2) सिलेंटरेट में
(3) Platyhelminthes (4) (2) & (3) both (3) प्लेटीहेल्मिंथीज में (4) (2) तथा (3) दोनों में
114. Sponges is the common name of which phylum 114. किस संघ के सदस्यों को सामान्य रूप से स्पन्ज कहा
members – जाता है-
(1) Coelenterata (2) Porifera (1) सीलेण्ट्रेटा (2) पोरीफे रा
(3) Annelida (4) Aschelminthes (3) एनीलिडा (4) ऐस्के हेल्मिन्थीज
115. Metagenesis and cnidoblast cells are found in ? 115. पीढ़ी एकान्तरण तथा दंशकोशिका पाया जाता है।
(1) Cnidaria (2) Protozoa. (1) निडेरिया (2) प्रोटोजोआ
(3) Annelida (4) Arthropoda (3) एनेलिडा (4) आर्थ्रोपोडा
116. Out of following which is an example of organ 116. निम्न में से कौनसा अंगतंत्र स्तर का उदाहरण है -
system level :
(1) Hydra (2) Sycon (1) हाइड्रा (2) साइकाॅन
(3) Amoeba (4) Ascaris (3) अमीबा (4) एस्के रिस
117. Which of the following belongs to Arthropoda : 117. निम्न से कौन आर्थाेपोडा से सम्बधित है :
(1) Lepisma (1) लेपिज्मा
(2) Aplysia (2) एप्लाइसिया
(3) Antedon (3) एण्टिडाॅन
(4) Monocystis (4) मोनोसिस्टिस
ALLEN
118. Triploblastic, organ system grade body, 118. त्रिस्तरीय, अंग तन्त्र (Organ system) शरीर, गुहीय तथा
coelomate and segmented animals are seen in :- खण्डित प्रकार के जन्तु देखे जा सकते है :-
(1) Echinodermata (2) Arthropoda (1) इकाइनोडर्मेटा में (2) आथ्रोपोड़ा में
(3) Ctenophora (4) Aschelminthes (3) टीनोफोरा में (4) ऐस्के ल्मिंथीज
119. Retrogressive metamorphosis is represented by ? 119. प्रतिगामी कायान्तरण प्रदर्शित होता हैै के द्वारा ?
(1) Balanoglossus (2) Herdmania (1) बेलेनोग्लोसस (2) हर्डमानिया
(3) Branchiostoma (4) Petromyzon (3) ब्रेकियोस्टोमा (4) पेट्रोमाइजोन
120. Members of which class are ectoparasites on 120. किस वर्ग के सदस्य वास्तविक मछलियों के बाह्य परजीवी
true fishes ? होते है ?
(1) Ostracodermi (2) Cyclostomata (1) आस्ट्रेकोडर्मी (2) साइक्लोस्टोमेटा
(3) Chondrichthyes (4) Osteichthyes (3) काॅन्ड्रीक्थीज (4) ऑस्टीक्थीज
121. The embryo is surrounded with amnion in :- 121. किसमें भ्रूण चारों ओर से एम्नियोन के द्वारा घिरा होता है :-
(1) Toad (2) Snake (1) टोड (2) सांप
(3) fish (4) Cockroach (3) मछली (4) तिलचट्टा
122. Oil glands are present at the base of tail in :- 122. तेल ग्रन्थियाँ पूँछ के आधार भाग पर पायी जाती है :-
(1) Amphibia (2) Reptelia (1) एम्फीबिया (2) सरीसृप
(3) Birds (4) Urochordates (3) पक्षी (4) यूरोकाॅर्डेट
123. Lateral line system is present in :- 123. ik'oZ रेखा तंत्र उपस्थित होता है :-
(1) Chondrichthyes (1) कांड्रीक्थीज
(2) Osteichthyes (2) ओस्टिक्थीज
(3) Larva of amphibia (3) उभयचर के लार्वा
(4) All of these (4) उपरोक्त सभी
124. Failure of descendence of testis into the 124. वृषण का वृषण कोष तक ना पहुंचना कहलाता है -
scrotum is known as
(1) Paedogenesis (1) पीडोजेनिसिस
(2) Impotency (2) नपुंसकता
(3) Cryptorchidism (3) क्रिप्टोर्कि डिस्म
(4) Castration (4) कै स्ट्रेसन
ALLEN
125. Read the following statements about the given 125. दिये गऐ चित्र के संदर्भ में कथनों को ध्यान से पढिये तथा
diagram carefully and state which of them are बताइयें उनमें से कौनसे सही है:-
correct :-
(i) A-It is the site for formation of sperm.

(i) A-यह शुक्राणु निर्माण की जगह हैं।
(ii) B-It is male external genitalia.

(ii) B-यह बाह्य नर जननांग है।
(iii) C-Secretion of this gland lubricates the penis.

(iii) C-इस ग्रंथि का स्त्रवण शिश्न को स्नेहन प्रदान करता है।
(iv) D-produces seminal fluid. (iv) D-यह शुक्राशय द्रव्य का निर्माण करता है।
(1) i and ii (1) i और ii
(2) ii and iii (2) ii और iii
(3) ii and iv (3) ii और iv
(4) i and iv (4) i और iv
126. Major cause of FSH and LH surge at the end of 126. पूर्व अण्डोत्सर्ग अवस्था के अंत में FSH तथा LH सर्ज
pre-ovulatory phase is :- (अत्यधिक वृद्धि) का मुख्य कारण है :-
(1) Progesterone released from corpus luteum (1) कार्पस ल्यूटियम से स्त्रावित प्रोजेस्ट्रान
(2) Estrogen from corpus luteum (2) कार्पस ल्यूटियम से स्त्रावित एस्ट्रोजन
(3) Estrogen from theca interna (3) थीका इन्टर्ना से स्त्रावित एस्ट्रोजन
(4) Negative feedback of LH and FSH (4) LH तथा FSH द्वारा नेगेटिव फीडबैक
127. Find the incorrect match :- 127. गलत मिलान चुनिये :-
(1) Uterus - womb (1) गर्भाशय - गर्भस्थान (कोख)
(2) Bulbourethral gland – cowper's gland (2) बल्बोयूरिथ्रल ग्रंथि – काऊपर ग्रंथि
(3) Bartholin gland – greater vestibular gland (3) बार्थोलिन ग्रंथि – ग्रेटर वेस्टीबुलर ग्रंथि
(4) Mammary gland – rectal gland (4) स्तन ग्रंथि – गुदा ग्रंथि

ALLEN
128. After spermiogenesis, sperm heads become 128. शुक्राणु जनन के प'pkत् शुक्राणु शीर्ष, सर्टाेली कोशिकाओ
embedded in the sertoli cells, and are finally में अन्त:स्थापित हो जाता है ओर अंत मे जिस प्रक्रिया द्वारा
released from the seminiferous tubules by the शुक्राणु , शुक्रजनक नलिकाओ से मोचित होते हैं उस
process called :- प्रक्रिया को कहते हैं।
(1) Spermiation (1) स्पर्मिएशन
(2) Semination (2) सेमीनेशन
(3) Spermatogenesis (3) शुक्रजनन
(4) Ejaculation (4) वीर्यस्खलन
129. During Oogenesis Ist meiotic division is ?
129. अण्डजनन की प्रक्रिया के दौरान प्रथम अर्द्धसूत्री विभाजन ?
(A) Completed prior to ovulation

(A) अण्डोत्सर्ग के पूर्व समाप्त हो जाता है
(B) Completed after onset of puberty

(B) यौवनारंभ के बाद समाप्त होता है
(C) Completed during maturation phase

(C) परिपक्वन प्रावस्था के दौरान समाप्त होता है
(D) Completed just before puberty

(D) योवनारम्भ के ठीक पहले पूर्ण होता है
Which of the following statement are correct ? निम्नलिखित में से कितने कथन सत्य है ?
(1) C & D (1) C & D
(2) A, C & D (2) A, C & D
(3) A, B & C (3) A, B & C
(4) B, C, & D (4) B, C, & D
130. Which of the following is the first haploid 130. निम्नलिखित में से क्या अण्डजनन में बनने वाली प्रथम
structure formed during the process of oogenesis ? अगुणित संरचना है ?
(1) Primordial germ cells (1) आदि जनन कोशिकाऐं
(2) Primary oocyte (2) प्राथमिक ऊसाईट
(3) Secondary oocyte (3) द्वितीयक ऊसाईट
(4) Ootid (4) ऊटिड
131. In lactation amenorrhea - 131. स्तनपान अनार्तव में -
(1) Menstrual cycle absent (1) मासिक चक्र अनुपस्थित
(2) Milk synthesis stop (2) दुग्ध सं'ysषण बंद
(3) Ovulation absent (3) अण्डोत्सर्ग अनुपस्थित
(4) Both 1 and 3 (4) 1 व 3 दोनों
ALLEN
132. LH surge in female occurs:- 132. मादा में एलएच सर्ज होता है :-
(1) Just before implantation (1) आरोपण से ठीक पहले
(2) Just before ovulation (2) अण्डोत्सर्ग से ठीक पहले
(3) Just after ovulation (3) अण्डोत्सर्ग के ठीक बाद
(4) After the formation of corpus luteum (4) काॅर्पस ल्यूटियम के निर्माण के बाद
133. Follicular phase of menstrual cycle is also 133. मासिक चक्र की पुटकीय प्रावस्था को कौन से नाम से भी
known as:- जाना जाता है :-
(1) Secretory phase or luteal phase (1) स्त्रावी प्रावस्था एवं ल्युटियल प्रावस्था
(2) Bleeding phase or menstruation phase (2) रक्त स्त्राव प्रवस्था एवं मेन्सिस प्रावस्था
(3) Estrogenic phase or post-ovulatory phase (3) इस्ट्रोजेनिक प्रावस्था एवं पश्च अण्डोत्सर्ग प्रावस्था
(4) Estrogenic phase or proliferative phase (4) इस्ट्रोजेनिक प्रावस्था एवं प्रचुरोद्भवन प्रावस्था
134. Which of the following is a non-cellular layer 134. निम्नलिखित में ग्राफियन पुटिका में अकोशिकीय परत होती
in Graafian follicle ? है ?
(1) Theca interna (1) थीका इर्न्टना
(2) Corona radiata (2) कोरोना रेडिएटा
(3) Zona pellucida (3) जोना पेलुसिड़ा
(4) Cumulus oophrous (4) कु मुलस उफोरस
135. At the time of puberty how many primary 135. यौवनारंभ के समय प्रत्येक अण्डाशय में कितनी प्राथमिक
follicles are left in each ovary ? पुटिकाऐं रहती है ?
(1) 60,000 – 80,000 (1) 60,000 – 80,000
(2) 40,000 – 60,000 (2) 40,000 – 60,000
(3) 1,20,000 – 1,60,000 (3) 1,20,000 – 1,60,000
(4) 80,000 – 1,20,000 (4) 80,000 – 1,20,000
136. A female of 24 years age attained puberty at 136. एक स्त्री की आयु 24 वर्ष है उसमें यौवन अवस्था 14 वर्ष
the age of 14 years. She has two children born की आयु में प्रारंभ हुई, स्त्री के सामान्य प्रसव के दो बच्चे है,
by normal delivery. How many polar body are
अभी तक उसके शरीर में कितनी ध्रुवकाय निर्मित हुई
formed in her body till date (each M.C. is
of 30 days) :- (प्रत्येक मासिक चक्र 30 दिन का है) :-
(1) 90 (2) 96 (3) 92 (4) 88 (1) 90 (2) 96 (3) 92 (4) 88

ALLEN
137. Which type of clevage occur in human ? 137. मनुष्यों में किस प्रकार का विदलन पाया जाता है ?
(1) Equal holoblastic (1) समान पूर्णभंजी
(2) Unequal holoblastic (2) असमान पूर्णभंजी
(3) Superficial (3) सुपरफिशियल
(4) Discoidal (4) डिस्काॅएडल
138. Capacitation of sperm occurs in :- 138. शुक्राणु का योग्यतार्जन होता है:-
(1) Testis (2) Epididymis (1) वृषण (2) अधिवृषण
(3) Vagina (4) Urethra (3) योनि (4) मूत्रमार्ग
139. When the heart of foetus is formed :- 139. भ्रूण के ह्नदय का निर्माण होता है :-
(1) After 1st trimester (1) पहली तिमाही के बाद
(2) End of first month of pregnancy (2) सगर्भता के पहले महीने के अंत मे
(3) During second trimester (3) दूसरी तिमाही के बाद
(4) During 3rd trimester (4) तीसरी तिमाही के बाद
140. Which of following antibody is mainly present 140. निम्न में से कौनसी एंटीबाॅडी, कोलोस्ट्रम में मुख्यतया पाई
in colostrum ? जाती है ?
(1) IgE (2) IgM (1) IgE (2) IgM
(3) IgA (4) IgD (3) IgA (4) IgD
141. The signals for parturition originate from - 141. प्रसव के संके तो का आरंभ होता है :-
(1) Fully developed foetus (1) पूर्ण विकसित गर्भ से
(2) Placenta (2) अपरा से
(3) Both (1) and (2) (3) (1) और (2) दोनों
(4) Uterus (4) गर्भाशय
142. Which of following hormone is used by the 142. निम्न में से कौनसे हाॅर्मोन का इस्तेमाल चिकित्सकों द्वारा प्रसव
doctors to induce or support the parturition ? को प्रेरित करने या प्रसव में मदद के लिए किया जाता है?
(1) HCG (1) HCG
(2) Relaxin (2) रिलेक्सीन
(3) Thyroxine (3) थॅायरोक्सीन
(4) Oxytocin (4) ऑक्सीटोसीन
ALLEN
143. Most widely accepted method of contraception 143. निम्नलिखित में से कौन सी गर्भनिरोधक युक्त भारत में
in India is ? व्यापक रूप से प्रचलित है ?
(1) IUDs (1) IUDs
(2) Surgical methods (2) शल्यक्रिया विधि
(3) Terminal methods (3) टर्मिनल विधियां
(4) Condoms (4) कं डोम
144. Incidences of STDs(sexually transmitted 144. यौन संचारित रोगों के संक्रमण के प्रति किस आयु वर्ग के
diseases) are reported to be very high among लोग अतिसंवेदनशील होते हैं :-
persons in the age group of :-
(1) 10-15 years (1) 10-15 वर्ष
(2) 15-24 years (2) 15-24 वर्ष
(3) 35-40 years (3) 35-40 वर्ष
(4) 24-34 years (4) 24-34 वर्ष
145. Generally, which of the following is not used 145. सामान्यत: निम्न में से किसे महिला गर्भनिरोधक की भांति
as female contraceptive :- प्रयोग नहीं किया जाता है।
(1) Progestogens (1) प्रोजेस्टोजेन
(2) Progestogen-estrogen combination (2) प्रोजेस्टोजन-इस्ट्रोजन संयोजन
(3) Vasectomy (3) शुक्रवाहिका-उच्छेदन
(4) Vaults (4) वाॅल्ट
146. If male is impotent and female is fertile that 146. यदि नर बंध्य औरा मादा फर्टाइल हो तो उस जोड़े में
what posible assisted reproductive technology इनफर्टिलिटी के इलाज के लिए क्या सम्भव सहायक जनन
is used for treating the infertility is particular तकनिक प्रयुक्त की जाती है :-
couple?
(1) GIFT (1) GIFT
(2) ZIFT
(2) ZIFT
(3) Intrauterine insemination
(3) अंर्तगर्भाशयी वीर्यसेचन
(4) Embryo transfer
(4) भ्रूण स्थानांतरण

ALLEN
147. Given below are four statements (a-d) 147. सहायक जनन प्रौद्योगिकियाँ (ए.आर.टी.) से सम्बन्धित
regarding assisted reproductive technologies:-
निम्नलिखित वाक्यांश दिये गये है:-
(a) ZIFT - The zygote or early embryo (with (a) जेड.आई.एफ.टी. - इसमें, युग्मनज या प्रारंभिक भ्रूण
upto 8 blastomere) transferred into the
(8 ब्लास्टोमियर) को फै लोपी नलिकाओं में स्थानांतरित
fallopian tube
(b) ICSI - A sperm is directly injected into the किया जाता है।
fallopian tube to form an embryo in the (b) आई.सी.एस.आई - जिसमें भ्रूण निर्माण के लिए
laboratory
प्रयोगशाला में शुक्राणु को सीधे ही फै लोपी नलिकाओं में
(c) IUI - The semen collected either from the अन्त:क्षेपित किया जाता है।
husband or healthy donor is artificially (c) आई.यू.आई. - इस तकनीक में पति या स्वस्थ दाता से
introduced either into the vagina or into the शुक्र लेकर कृ त्रिम रूप से या तो स्त्री की योनि में अथवा
uterus
उसके गर्भाशय में प्रविष्ट किया जाता है।
(d) GIFT - Transfer of zygote collected from a

(d) जी.आई.एफ.टी. - इसमें युग्मनज (जाइगोट) को दाता
donor into the fallopian tube of another female
who cannot produce one but can provide से प्राप्त कर किसी अन्य महिला जो अण्डाणु उत्पन्न नही
suitable environment for fertilisation and कर सकती परन्तु निषेचन तथा भ्रूण विकास के लिए उत्तम
development
वातावरण दे सकती है।
Which two of the above statements are correct: उपरोक्त में कौनसें वाक्यांश सही है:-
(1) a & d (2) b & c (1) a तथा d (2) b तथा c
(3) a & c (4) b & d (3) a तथा c (4) b तथा d
148. What will be the no. of H-bonds in a single 148. एक ATTACGA क्षार वाले एक रज्जुकीय DNA
stranded DNA having base sequence में H-बंधो की संख्या क्या होगी?
ATTACGA?
(1) 16 (2) 8 (3) 0 (4) 21 (1) 16 (2) 8 (3) 0 (4) 21
149. Following structure is related to which compound ? 149. निम्न संरचना किस यौगिक से संबंधित है ?
(1) Adenine (2) Guanine (1) Adenine (2) Guanine

(3) Uracil (4) Thymine (3) Uracil (4) Thymine
ALLEN
150. DNA is a long polymer of nucleotides. If in a ds 150. DNA , न्यूक्लियोटाइड का एक लम्बा बहुलक होता है।
DNA 4000 base pairs are found then what will यदि एक द्विरज्जुकी DNA मे 4000 क्षारक युग्म हो तो
be number of nucleotides, sugar molecules, इसमे न्यूक्लियोटाइड, शर्क रा अणुओं , फाॅस्फे ट अणुओं व
phosphate molecules and ester bond :- एस्टर बन्धों की संख्या क्या होगी-
(1) 8000, 4000, 4000, 2 (1) 8000, 4000, 4000, 2
(2) 4000, 4000, 8000, 2 (2) 4000, 4000, 8000, 2
(3) 4000, 8000, 4000, 2 (3) 4000, 8000, 4000, 2
(4) 8000, 8000, 8000, 2 (4) 8000, 8000, 8000, 2
151. A DNA molecule contain 20,000 base pairs. 151. एक डीएनए के अणु में 20,000 क्षार युग्म है। तो इसमें
How many nucleotides would be present in it? कितने न्यूक्लियोटाइड्स इसमें उपस्थित होंगे ?
(1) 2000 (2) 10,000 (1) 2000 (2) 10,000
(3) 40,000 (4) 20,000 (3) 40,000 (4) 20,000
152. Experiments using N15 to confirm 152. प्रयोगो में N15 का उपयोग करके डीएनए के अर्धसंरक्षी
semiconservative replication of DNA were प्रतिकरण को सुनिश्चित किया गया :-
carried out by:-
(1) Meselson & Stahl (2) Hershey & Chase (1) मेसल्सन व स्टाल द्वारा (2) हर्षे व चेस द्वारा
(3) Watson & Crick (4) Taylor (3) वाॅटसन व क्रिक द्वारा (4) टेलर द्वारा
153. A normal DNA molecule is continuously replicate 153. एक सामान्य DNA अणु N15 माध्यम में लगातार
in N15 medium then what is the % of light DNA in द्विगुणन करता है तो 4th पीढ़ी में हल्के DNA की
4th generation. प्रतिशतता होगी :–
(1) 12·5% (2) 25 % (3) 0 % (4) 6.25 % (1) 12·5% (2) 25 % (3) 0 % (4) 6.25 %
154. Which one is true among the following for 154. निम्न में से DNA प्रतीलीपीकरण के लिए सही कौन है :-
DNA replication :-
(1) (2) (1) (2)
(3) (4) (3) (4)

ALLEN
155. Nucleotide constituents/nitrogen bases of RNA are :- 155. RNA में कौनसी N2 क्षारे पायी जाती है :-
(1) AGCU (2) TCGU (1) AGCU (2) TCGU
(3) AGCT (4) CTAU (3) AGCT (4) CTAU
156. 156.

Above given structure represent :- उपरोक्त दी गई संरचना प्रदर्शित करती है :-

(1) Nuclotide of DNA (1) DNA का न्यूक्लियोटाईड
(2) Nucleoside of RNA (2) RNA का न्यूक्लियोसाईड
(3) Nucleoside of DNA (3) DNA का न्यूक्लियोसाईड
(4) Nucleotide of RNA (4) RNA का न्यूक्लियोटाईड
157. In operon system, when substrate is responsible 157. ओपेरोन तन्त्र में, यदि अवस्तर (substrate) स्वयं अपने
for the formation of its enzyme, then in this एन्जाइम निर्माण के लिए जिम्मेदार होता है तो उस अवस्था
case the substrate may be called as :- में, अवस्तर कहलाएगा :-
(1) Aporepressor (2) Repressor (1) Aporepressor (2) Repressor
(3) Inducer (4) Co-repressor (3) Inducer (4) Co-repressor
158. Which one of the following options given the 158. निम्नलिखित में से किस एक विकल्प में कोडोनो को
correct categorisation of codon according to नीचे दिए गए A, B व C के अनुसार सही-सही श्रेणी में
given A, B and C रखा गया हैं।
A
B
C
A
B
C

Phenyl alanine Glycine Stop codon Phenyl alanine Glycine Stop codon
UUU GAG UAA UUU GAG UAA
(1) (1)
CUU AUG UGA CUU AUG UGA
UUU GGG UAA UUU GGG UAA
(2) (2)
UUC GGC UAG UUC GGC UAG
UAA GAU UGA UAA GAU UGA
(3) (3)
UGA CAG UAG UGA CAG UAG
UUU GGG UGA UUU GGG UGA
(4) (4)
UUA GGU UAG UUA GGU UAG
ALLEN
159. The process of transformation is not affected 159. रूपान्तरण की प्रक्रिया निम्न में से कौन से एन्जाइम द्वारा
by which of the following enzymes?
प्रभावित नहीं होती है ?
A. DNase B. RNase

A. DNase B. RNase
C. Peptidase D. Lipase C. पैप्टीडेज D. लाइपेज

(1) A, B (2) A, B, C, D (1) A, B (2) A, B, C, D
(3) B,C, D (4) A, B, C (3) B,C, D (4) A, B, C
160. 32Pwas used to radiolabel the component of 160. हर्शे और चेज के प्रयोग में 32P का प्रयोग जीवाणुभोजी के
bacteriophage in Hershey and Chase निम्न घटक को रेडियोधर्मी बनाने में किया गया था :-
experiment :-
(1) Viral protein (1) विषाणु प्रोटीन
(2) Viral DNA (2) विषाणु डीएनए
(3) Viral lipid (3) विषाणु के लिपिड़
(4) Both DNA and protein (4) डीएनए और प्रोटीन दोनों
161. Which of the following statement is true? 161. निम्न में से कौनसा कथन सत्य है?
(1) In Griffith's experiment when S-strain of (1) ग्रिफिथ के प्रयोग में चूहे में जीवाणु के S-प्रभेद को
bacteria was injected in mice, the mice died. अन्त:क्षेपित करने पर चूहे की मृत्यु हो गयी।
(2) In Avery and MacLeod's experiment (2) एवेरी और मैकलिओड के प्रयोग में चूहे में RNase
RNase injection into mice did not affect के अन्त:क्षेपण से रूपान्तरण पर काेई प्रभाव नहीं
transformation हुआ।
(3) In Avery and Macleod's experiment DNase (3) एवेरी और मैकलिओड के प्रयोग में चूहे में DNase
injection into mice inhibits transformation के अन्त:क्षेपण से रूपान्तरण अवरूद्ध हो गया।
(4) All of the above (4) उपरोक्त सभी
162. Type of gene mutation which involves 162. पिरिमिडीन द्वारा प्यूरीन अथवा प्यूरीन द्वारा पिरिमिडीन
replacement of purine with pyrimidine or vice
प्रतिस्थापित होने पर कौनसा उत्परिवर्तन होता है :-
versa (OR) The substitution of one type of base
with another type of base is :-
(1) Transduction (1) पारक्रमण (Transduction)
(2) Transversion (2) अनुपथन (Transversion)
(3) Translocation (3) स्थानान्तरण (Translocation)
(4) Transcription (4) अनुलेखन (Transcription)
ALLEN
163. The process of formation of RNA from DNA is 163. DNA से RNA के निर्माण की प्रक्रिया को कहा जाता है
known as
(1) Transcription (2) Translation (1) अनुलेखन (2) अनुवादन
(3) Replication (4) Transformation (3) रेप्लीके शन (4) रूपान्तरण
164. During transcription RNA polymerase enzyme 164. ट्रांसक्रीप्शन के समय RNA पाॅलीमरेज एंजाइम,
binds to which part of transcription unit ? ट्रांसक्रीप्शन इकाई के किस भाग से जुड़ते हैं ?
(1) Operator (2) Structural gene (1) ऑपरेटर (2) संरचनात्मक जीन
(3) Promoter (4) Ori site (3) प्रमोटर (4) Ori स्थल
165. Portion of gene which is transcribed but not 165. जीन का वह भाग जो अनुलेखित होता है पर अनुवादित नहीं
translated is :- होता कहलाता है :-
(1) Exon (2) Intron (1) एक्साॅन (2) इन्ट्राॅन
(3) Cistron (4) Codon (3) सिस्ट्राॅन (4) कोडाॅन
166. In split genes the coding sequence are :- 166. Split gene का कोडिंग क्रम कहलाता है-
(1) Exon (2) Introns (1) Exon (2) Introns
(3) Cistron (4) Operons (3) Cistron (4) Operons
167. Match the following genes of the Lac operon 167. लैक ओपेरान के निम्न जीनों का उनके उत्पादों के साथ
with their respective products. मिलान कीजिए।
(a) i gene (i) β-galactosidase (a) i जीन (i) β-गैलेक्टोसाईडेज
(b) z gene (ii) Permease (b) z जीन (ii) परमीएज
(c) a gene (iii) Repressor (c) a जीन (iii) दमनकारी
(d) y gene (iv) Transacetylase (d) y जीन (iv) ट्रांसएसीटाईलेज

Select the correct option. उचित विकल्प का चयन करो।

(a) (b) (c) (d) (a) (b) (c) (d)
(1) (i) (iii) (ii) (iv) (1) (i) (iii) (ii) (iv)
(2) (iii) (i) (ii) (iv) (2) (iii) (i) (ii) (iv)
(3) (iii) (i) (iv) (ii) (3) (iii) (i) (iv) (ii)
(4) (iii) (iv) (i) (ii) (4) (iii) (iv) (i) (ii)

ALLEN
168. Which of the following pair is correctly 168. निम्न में से कौन सा जोड़ा अपने कार्य के अनुसार सही
matched according to their function?
सुमेलित है :-
(a) spliceosome = splicing process

(a) स्पलाइसियोसोम = स्पलाइसिंग
(b) DNA-ligase = Join protein segment

(b) डी. एन. ए.-लाइगेज = प्रोटीन खण्ड़ो को जोड़ना
(c) DNA - Polymerase - I = DNA synthesis

(c) डी. एन. ए.-पाॅलीमरेज - I = डी. एन. ए. निर्माण
(d) Helicase = Breaking H-bond

(d) हेलीके ज = H-bond को तोड़ना
(e) Primase = RNA primer (e) प्राईमेज = आर. एन. ए. प्राइमर

(1) a, b, c, d, e (2) a, b, c (1) a, b, c, d, e (2) a, b, c
(3) a, d, e (4) c, d, e (3) a, d, e (4) c, d, e
169. The process of copying genetic information 169. डीएनए की एक रज्जुक से आनुवंशिक सूचनाओं का ....
from one strand of DNA into ....(Y)..... is (Y)..... में प्रतिलिपिकरण को....(Z).....कहते है :-
termed as ....(Z).....:- Y Z
Y Z (1) अनुलेखन RNA
(1) Transcription RNA (2) RNA अनुलेखन
(2) RNA Transcription (3) DNA प्रतिकृ तिकरण
(3) DNA Replication (4) प्रतिकृ तिकरण DNA
(4) Replication DNA
170. In a transcription unit, the promoter is located 170. एक अनुलेखन इकाई में, संरचनात्मक जीन के ____पर
towards____of the structural gene and the उन्नायक स्थित होता है तथा कु टलेखन रज्जुक के _____
terminator is located towards_____ of the
पर समापक स्थित होता है :-
coding strand :-
(1) 3' end, 5' end (2) 3' end, 3' end (1) 3' किनारा, 5' किनारा (2) 3' किनारा, 3' किनारा
(3) 5' end, 3' end (4) 5' end 5' end (3) 5' किनारा, 3' किनारा (4) 5' किनारा, 5' किनारा
171. DNA acts as the genetic material in most of the 171. अधिकत्तर जीवो में आनुवंशिक पदार्थ DNA होता है
organisms but RNA also acts as a genetic लेकिन RNA भी आनुवंशिक पदार्थ की तरह कार्य करता
material in :- है, किसमें:-
(1) Tobacco mosaic virus (1) तम्बाकु मोजेक विषाणु
(2) QB bacteriophage (2) QB जीवाणुभोजी
(3) ϕ × 174 bacteriophage (3) ϕ × 174 जीवाणुभोजी
(4) (1) and (2) both (4) (1) तथा (2) दोनों

ALLEN
172. Out of 64 possible genetic codon, how many 172. संभावित 64 आनुंवशिक कोडाॅन में से, कितने एमीनों अम्ल
code for amino acids ? को कोड करते है ?
(1) 4 (2) 16 (3) 60 (4) 61 (1) 4 (2) 16 (3) 60 (4) 61
173. Which of following is not the characteristic 173. निम्न में कौनसा आनुवांशिक कू ट का चारित्रिक लक्षण नहीं
feature of genetic code? है ?
(1) Genetic code is nearly universal (1) आनुवांशिक कू ट अधिकांशतया सार्वात्रिक होता है।
(2) Code is non overlapping (2) कू ट अनअतिव्यापित होता है।
(3) Genetic code is read in discontinouous manner (3) आनुवांशिक कू ट की असतत् रूप से पढ़ा जाता है।
(4) Genetic code is triplet (4) आनुवांशिक कू ट त्रिक होता है।
174. 174.
Choose correct one :- सही का चयन कीजिए:-

(1) a-DNA, b-H1-histone, c-histone octamer,
(1) a-DNA, b-H1-हिस्टोन, c-हिस्टोन अष्टक,
d-core of histone d-हिस्टोन का कें द्र/कोर

(2) a-core of histone, b-DNA, c-H1 histone,
(2) a-हिस्टोन का कें द्र/कोर, b-DNA, c-H1 हिस्टोन,
d-histone octamer d-हिस्टोन अष्टक

(3) a-Histone octamer, b-core of histone,
(3) a-हिस्टोन अष्टक, b-हिस्टोन का कें द्र/कोर,
c-DNA, d-H1 histone c-DNA, d-H1 हिस्टोन

(4) a-H1 histone, b-histone octamer,
(4) a-H1 हिस्टोन, b-हिस्टोन अष्टक,
c-core of histone, d-DNA c-हिस्टोन का कें द्र/कोर, d-DNA
175. First event in translation is the binding of 175. अनुवादन के प्रथम चरण में m-RNA किससे बंधित होता
m-RNA to the : है?
(1) Large sub unit of ribosome (1) राइबोसोम की बड़ी इकाई से
(2) tRNA (2) tRNA से
(3) smaller sub unit of ribosome (3) राइबोसोम की छोटी इकाई से
(4) Formylated methionin tRNA (4) फाॅरमायलेटेड मिथियोनिन tRNA से
ALLEN
176. Refer the given m RNA segment. It can be 176. निम्न दिये m RNA के पूर्ण अनुवादन प्रक्रिया द्वारा एक
translated completely into a polypeptide. पाॅलीपेप्टाइड श्रृंखला का निर्माण होना है। A और B प्रकू ट
Which of the following codons may correspond क्या होगें
with A and B
(1) (A) AUG, GUG (B) UAA, UAG or UGA (1) (A) AUG, GUG (B) UAA, UAG or UGA
(2) (A) UAA, UGA (B) AUG, GUG or UAG (2) (A) UAA, UGA (B) AUG, GUG or UAG
(3) (A) AUG, UGA (B) GUG, UAA or UGA (3) (A) AUG, UGA (B) GUG, UAA or UGA
(4) (A) AUG, GAG (B) UAA, UUU or UGA (4) (A) AUG, GAG (B) UAA, UUU or UGA
177. The association of histone H1 with a 177. हिस्टोन H1 का के न्द्रिकाभ के साथ संबंध क्या निर्देशित
nucleosome indicates: करता है?
(1) DNA replication is occurring (1) DNA प्रतिकृ तीयन हो रहा है।
(2) The DNA is condensed into a Chromatin Fibre (2) DNA क्रोमैटिन रैशों में संघनित है।
(3) The DNA double helix is exposed (3) DNA की द्विकुं डली अनावृत है।
(4) Transcription is occurring (4) अनुलेखन हो रहा है।
178. How many amino acid can be polymerised by 178. निम्नांकित एक अनुवादित होने वाला m-RNA का क्रम है,
given m-RNA sequence during translation in a इस mRNA से बनने वाली पाॅलीपेप्टाइड श्रृंखला में कितने
bacteria ?
एमीनो अम्ल उपस्थित होंगे ?
5' AUGUCCACGAUAGACUGAUAA 3' 5' AUGUCCACGAUAGACUGAUAA 3'

(1) Three (2) Five (1) तीन (2) पाॅंच
(3) Six (4) Two (3) छ: (4) दो
179. In lac operon non sense mutation in cistron 'z' 179. लैक ऑपेरोन में सिस्ट्रोन z में यदि नाॅन सेन्स म्यूटेशन हो
leads to synthesis of ? जाये तो कौनसा एन्जाइम सं'ysषित होगा ?
(1) β-galactosidase (2) permease (1) β-गेलेक्टोसाइडेज (2) पर्मियेज
(3) transacetylase (4) No enzyme (3) ट्रान्सएसीटाइलेज (4) कोई एन्जाइम नहीं
180. A nutritionally wild type organism, which does 180. पोषण की दृष्टि से जंगली प्रकार का जीव वह होता है जिसे
not require any additional growth supplement अतिरिक्त वृद्धि संपूरक प्राप्त करने की आवश्यकता नहीं
is known as : होती। ऐसे पौधों को क्या कहा जाता है :-
(1) Holotype (2) Auxotroph (1) होलोटाइप (2) औक्सोट्रोफ
(3) Prototroph (4) Phenotype (3) प्रोटोट्राॅफ (4) फीनोटाइप
Read carefully the following instructions : fuEufyf[kr funs Z 'k /;ku ls i<+ s a :
1. Each candidate must show on demand his/her 1. iwNs tkus ij izR;sd ijh{kkFkhZ] fujh{kd dks viuk ,yu igpku
Allen ID Card to the Invigilator. i= fn[kk,A
2. No candidate, without special permission of 2. fujh{kd dh fo'ks"k vuqefr ds fcuk dksbZ ijh{kkFkhZ viuk
the Invigilator, would leave his/her seat. LFkku u NksM+As
3. The candidates should not leave the 3. dk;Zjr fujh{kd dks viuk mÙkj&i= fn, fcuk dksbZ ijh{kkFkhZ
Examination Hall without handing over their ijh{kk gkWy ugha NksM+sA
Answer Sheet to the Invigilator on duty.
4. Use of Electronic/Manual Ca lculator is 4. bys D Vª k W f ud@gLrpfyr ifjdyd dk mi;ks x oftZ r
prohibited. gSA
5. The candidates are governed by all Rules and 5. ijh{kk gkWy esa vkpj.k ds fy, ijh{kkFkhZ ijh{kk ds lHkh
Regulations of the examination with regard to fu;eksa ,oa fofu;eksa }kjk fu;fer gAS vuqfpr lk/ku ds lHkh
their conduct in the Examination Hall. All
cases of unfair means will be dealt with as per
ekeyksa dk Ql S yk ijh{kk ds fu;eksa ,oa fofu;eksa ds vuqlkj
Rules and Regulations of this examination. gksxkA
6. No part of the Test Booklet and Answer Sheet 6. fdlh gkyr esa ijh{kk iqfLrdk vkjS mÙkj&i= dk dksbZ Hkkx
shall be detached under any circumstances. vyx u djs aA
7. The candidates will write the Correct Name 7. ijh{kk iqfLrdk@mÙkj&i= esa ijh{kkFkhZ viuk lgh uke o QkWeZ
and Form No. in the Test Booklet/Answer uEcj fy[ksaA
Sheet.
Corporate Office : ALLEN CAREER INSTITUTE, “SANKALP”, CP-6, Indra Vihar, Kota (Rajasthan)-324005
+91-744-2757575 info@allen.ac.in www.allen.ac.in

Page 44/44 E + H / 10102021

Minor 05

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Minor 05

Uploaded by

Copyright:

Available Formats

Test Pattern

Hindi (1001CMD303521005) )1//1CMD3/3521//5)

ijh{kkFkhZ dk uke (cM+s v{kjksa esa) :

Your Target is to secure Good Rank in Pre-Medical 2022

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

(1) B to A and D to C (2) A to B and C to D (1) B से A तथा D से C (2) A से B तथा C से D

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

(1) (2) (1) (2)

(3) (4) (3) (4)

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

(1) Zero (2) Infinite (1) शून्य (2) अनन्त

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

x = a + bt + ct2

The acceleration of the particle is :- तो कण का त्वरण होगा :-

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

(4) 8.5 units (4) 8.5 मात्रक

(1) (2) (1) (2)

(3) (4) (3) (4)

the origin will be

Br2 2Br at 500 K and 700 K are 10–10 and

(I) N2 + 3H2 ⇌ 2NH3; Eqm. constant=K1

(II) N2 + O2 ⇌ 2NO; साम्य स्थिराँक=K2

(II) N2 + O2 ⇌ 2NO; Eqm. constant=K2

(III) H2 + O 2 ⇌ H2O; Eqm. constant=K3

(2) H2(g) + I2(g) 2HI(g)

(3) N2O4(g) 2NO2(g)

(4) H2(g) + Cl2(g) 2HCl(g)

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

संघटन यदि [A] = [B] = [C] = 2 × 10 – 4 M.

for the reaction:-

(1) 1.89 (2) 0.377 (1) 1.89 (2) 0.377

(1) 14 (2) 16 (3) 18 (4) 20 (1) 14 (2) 16 (3) 18 (4) 20

(1) 4 (2) 5 (1) 4 (2) 5

(1) N-Ethyl-N-methylmethanamide (1) N-एथिल-N-मेथिलमेथेनामाइड

(1) Methyl -2-ethylpropanoate (1) मेथिल-2-एथिलप्रोपेनोएट

65. IUPAC name of the compound is : 65. यौगिक का IUPAC नाम है :

(1) Butane-1,2,3-tricarboxylic acid (1) ब्यूटेन-1,2,3-ट्राई कार्बोक्सिलिक अम्ल

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

(1) 2-Hydroxy pentan-4-one (1) 2-हाइड्राक्सी पेन्टेन-4-ऑन

(1) 3–Ethyl–4–isopropyl–2–methyl heptane (1) 3–एथिल–4–आइसोप्रोपिल–2–मेथिल हेप्टेन

correct I.U.P.A.C. name is :- सही I.U.P.A.C. नाम है :-

(1) 4 - Chloro - 2 - bromo cyclo hexanol (1) 4 - क्लोराे - 2 -ब्रोमोसाइक्लोहेक्सेनोल

(1) 1 : 1 : 1 : 1 (2) 1 : 2 : 2 : 3 (1) 1 : 1 : 1 : 1 (2) 1 : 2 : 2 : 3

of polyethylene produced will be :- प्राप्त पाॅलीइथाइलिन का भार होगा :-

(At. wt. Mg = 24 ; O = 16) (Mg का प. भा. = 24 एवं O का प. भा. = 16)

Ag2CO3 → 2Ag + CO2 + ½ O2 Ag2CO3 → 2Ag + CO2 + ½ O2

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

(1) Lancelet (1) लेन्सलेट के वल समुद्री

(3) Hyla Class - Amphibia (3) हाॅइला वर्ग - उभयचर

(4) Struthio fertilization is

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

(1) A-Compound eye, B-Ocellus,

C-Maxilla, D-Mandible, E-Labrum, F-Labium D-मैन्डिबल, E-लैब्रम, F-लैबियम

C-Mandible, D-Maxilla, E-Labrum, F-Labium D-मैक्सिला, E-लैब्रम, F-लैबियम

C-Mandible, D-Maxilla, E-Labium, F-Labrum D-मैक्सिला, E-लैबियम, F-लैब्रम

C-Maxilla, D-Mandible, E-Labrum, F-Labium D-मैन्डिबल, E-लैब्रम, F-लैबियम

LEADER COURSE PHASE - IV & V (MLE & MLF) 1001CMD303521005

all along the body throughout life.

कथन - 2 : यूरोकाॅर्डेट जीवनभर कशेरूक दण्ड को के वल

(1) Petromyzon, division Agnatha, Endo (1) पेट्रोमाइजाॅन, डिविजन-एग्नेथा (अनैथोस्टोमाटा),