Accelerat ing t he world's research.

Yersinia species in the dunnock

(Prunella modularis) in sub-alpine
habitats of the Western Carpathians
Marián Janiga, Martina Jurcovicová, Martina Haas

Polish journal of microbiology / Polskie Towarzystwo Mikrobiologów = The Polish Society of

Microbiologists

Cite this paper Downloaded from Academia.edu 

Get the citation in MLA, APA, or Chicago styles

Related papers Download a PDF Pack of t he best relat ed papers 

Cyt ot oxicit y of Aspergillus fungi isolat ed from hospit al environment

Maciej Górkiewicz

Ext ended Abst ract of 31t h Symposium of t he Malaysian Societ y for Microbiology 2012
Zul Helmey Mohamad Sabdin

Inorganic phosphorus and nit rogen modify composit ion and diversit y of microbial communit ies in wat …
Kryst yna Kalinowska
 POLSKIE TOWARZYSTWO MIKROBIOLOGÓW
POLISH SOCIETY OF MICROBIOLOGISTS

Polish Journal of Microbiology

I am pleased to inform you that Polish Journal of Microbiology has been selected
for coverage in Thomson Scientific products and customers information services.
Beginning with No 1, Vol. 57, 2008 information on the contents of the PJM is
included in: Science Citation Index Expanded (ISI) and Journal Citation Reports
(JCR)/Science Edition.
Stanis³awa Tylewska-Wierzbanowska
Editor in Chief

2011
Polish Journal of Microbiology
formerly Acta Microbiologica Polonica
2011, Vol. 60, No 1

CONTENTS

MINIREWIEV

New antibacterial therapeutics and strategies

KUREK A., GRUDNIAK A.M., KRACZKIEWICZ-DOWJAT A., WOLSKA K.I. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3

ORIGINAL PAPERS

Clonning, expression and identification by immunohistochemistry of humanized single-chain variable fragment antibody
against Hepatitis C virus core protein
LUN Y.-Z., CHENG J., ZHONG Y.-W., YU Z.-G., WANG Q., WANG F., FENG J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
The occurrence and comparative phenotypic characteristics of Staphylococcus spp. from healthy and diseased, household
and shelter dogs, based on routine biochemical diagnostic methods
KASPROWICZ A., BIA£ECKA A., BIA£ECKA J., GODZISZ I., BARABASZ W., JAWORSKA O., MA£ACHOWA N.,
MIÊDZOBRODZKI J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
Comparison of different PCR methods for detection of Brucella spp. in human blood samples
AL-AJLAN H.H., IBRAHIM A.S.S., AL-SALAMAH A.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Antibiofilm activity of selected plant essential oils and their major components
BUDZYÑSKA A., WIÊCKOWSKA-SZAKIEL M., SADOWSKA B., KALEMBA D., RÓ¯ALSKA B. . . . . . . . . . . . . . . . . . . . . 35
Competitiveness of Rhizobium leguminosarum bv. trifolii strains in mixed inoculation of clover (Trifolium pratense)
WIELBO J., MAREK-KOZACZUK M., KIDAJ D., SKORUPSKA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
Selection and adaptation of Saccharomyces cerevisae to increased ethanol tolerance and production
FIEDUREK J., SKOWRONEK M., GROMADA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
Cytotoxicity of the Aspergillus fungi isolated from hospital environment
GNIADEK A., MACURA A.B., GÓRKIEWICZ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
Production and partial charcterization of high molecular weight extracellular "-amylase from Thermoactinomyces vulgaris
isolated from Egyptian soil
ABOU DOBARA M.I., EL-SAYED A.K., EL-FALLAL A.A., OMAR N.F. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
Halomonas sp. nov., an EPA-producing mesophilic marine isolate from the Indian Ocean
SALUNKHE D., TIWARI N., WALUJKAR S., BHADEKAR R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73

SHORT COMMUNICATIONS

Yersinia species in the dunnock (Prunella modularis) in sub-alpine habitats of the western Carpathians
KISKOVÁ J., HREHOVÁ Z., JANIGA M., LUKÁÒ M., HAAS M., JURÈOVIÈOVÁ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
First report of Serratia plymuthica causing onion bulb rot in Poland
KOWALSKA B., SMOLIÑSKA U., OSKIERA M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85

INSTRUCTIONS TO AUTHORS AND FULL TEXT ARTICLES (IN PDF FORM) AVAILABLE AT:
www.microbiology.pl/pjm
Polish Journal of Microbiology
2011, Vol. 60, No 1, 3–12

MINIREVIEW

New Antibacterial Therapeutics and Strategies

ANNA KUREK, ANNA M. GRUDNIAK, ANNA KRACZKIEWICZ-DOWJAT
and KRYSTYNA I. WOLSKA*

Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology

University of Warsaw, Warsaw, Poland

Received 13 January 2011, accepted January 2011

Abstract

Studies on new antibacterial therapeutics and strategies are currently being conducted in many microbiological, pharmaceutical and
biochemical laboratories. The antibacterial activity of plant-derived compounds as well as silver and gold nanoparticles is the subject of
this minireview. The application of photodynamic therapy is also discussed.

K e y w o r d s: nanoparticles, new antimicrobials, phototherapy, plant compounds

Introduction categories, this article describe two of them – terpe-

The growing antibiotic resistance of pathogenic
bacterial species is a serious problem for public health.
It can be assumed, that although the bulk of traditional
antibiotics can still manage drug-resistant bacteria,
many commonly used antibiotics are no longer effec-
tive (Levy, 1998; Wright, 2010). This situation is
aggravated by a decline in the development of new
antibiotics, so recently few substances have appeared
in the market (Donadio et al., 2010; Högberg et al.,
2010). In view of above, the growing interest in the
studies aimed at developing new antibacterial thera-
peutics and strategies is very important not only from
medical point of view but also for agriculture and ani-
mal breeding (Myles, 2003). The list of such therapeu-
tics is long with stress on the use of bacteriophages as
antibacterial agents (Chibani-Chennoufi et al., 2004;
Górski et al., 2009). Many papers cover this problem
so it will not be the subject of our publication. The
present article describes the antibacterial potency and
application of plant-derived compounds, nanoparticles
and also the very promising photodynamic therapy.
Plant-derived compounds
Plant-derived compounds of therapeutic value are
mostly the secondary plant metabolites (Cowan, 1999).
Antibacterial phytochemicals are divided in several
nes and phenolics including polyphenols. As a matter
of fact, these compounds cannot be considered a new
group of antimicrobials because people have applied
plants and plant extract for medical purposes for cen-
turies (Rios and Recio, 2005).
Terpenes. Terpenes, also referred to as isoprenoids,
are based on an isoprene structure with general chemi-
cal formula C10H16 and are biosynthesized from the
same basic units, isopentenyl diphosphate, IPP, and its
isomer dimethylallyl diphophate, DMAPP (Fig. 1A).
Their derivatives containing additional elements, usu-
ally oxygen, are called terpenoids. These compounds
have a lot of biological functions and are applied as
pharmaceuticals, fragrances, colorants. Terpenes con-
stitute a very diverse group of compounds isolated not
only from higher plants but also from microorganisms
(Sacchettini and Poulter, 1997). Successful approaches
in engineering Escherichia coli towards biosynthesis
of functional isoprenoids were recently described
(Harada and Misawa, 2009).
Of special interest are two pentacyclic triterpenoids
oleanolic acid (OA) and ursolic acid (UA) and their
derivatives containing sugar moieties – glucosides
and glucuronides. The chemical formulas of OA/UA
are presented in Figure 1B. The antibacterial activity
of these compounds was recently reviewed (Wolska
et al., 2010a). The data described in many papers
are contrasting and indicate either a strong or weak

* Corresponding author: K.I. Wolska, Department of Bacterial Genetics, Institute of Microbiology, University of Warsaw,
Miecznikowa 1, 02-096 Warsaw, Poland; phone: (+48) 22 55-41-302; fax: (+48) 22 55 41 402; e-mail: izabelaw@biol.uw.edu.pl
4 Kurek A. et al.
Fig. 1. Chemical formula of IPP and DMAPP (A) and OA and UA (B)
antibacterial effect of OA and UA which likely results
from the method of compound purification and the
bacterial strain used. A relatively small number of
studies has been performed to investigate the basis
of OA/UA antibacterial activity. It has been shown
that both acids affected peptidoglycan metabolism in
Listeria monocytogenes (Kurek et al., 2010), oleanolic
acid cyclodextrins inhibited insoluble glucan synthesis
by Streptococcus mutans (Kozai et al., 1999) and
oleane-type triterpenoid, glycyrrhizin acted as a potent
E. coli heat-labile enterotoxin inhibitor (Chen et al.,
2009). In turn Ren and coworkers (2005) using
microaaray techniques demonstrated that UA caused
differential gene expression in E. coli and inhibited
biofilm formation in several bacterial species. Recently
Ge and coworkers (2010) proved the synergistic inter-
actions of OA in combination with isoniazid, rifampicin
or ethanbutol against Mycobacterium tuberculosis.
The third pentacyclic triterpenoid with similar chemi-
cal structure – betulic acid (BA) is inactive against
a large number of Gram-positive and Gram-negative
bacteria. This result illustrates the strong structure-
function influence of the antibacterial potential of
terpenes (Fontanay et al., 2008; Wansi et al., 2010).
Other terpenes or terpenoids, such as monoterpenes
and sesquiterpenes and their derivatives, also display
antimicrobial activity (Ahmed et al., 1993; Amaral et al.,
1998; Habtermariam et al., 1993). Many publications
describe the antibacterial potential of diterpenoids. It
was demonstrated that six diterpenoids isolated from
the bark of Podocarpus nagi, of which the most abun-
dant compound was totarol, exhibited potent bacteri-
cidal activity against Gram-positive bacteria: Propiono-
bacterium acnes, S. mutans and Staphylococcus aureus
(Kubo et al., 1992). Naturally occurring diterpenoids
with a dehydroabietane skeleton are highly bioactive
(Savluchinske-Feio et al., 2006) e.g. isopimaric acid
1
extracted from immature cones of Pinus nigra inhib-
ited the growth of multidrug-resistant and methicillin-
resistant Staphylococcus aureus – MRSA (Smith et al.,
2005). Antibacterial activity of diterpenoids isolated
from hairy roots of Salvia sclarea L was also studied.
The results showed that abietane diterpenoids: salvi-
sipone, aethopinone, 1-oxoaethopinone and ferrugiol
were bacteriostatic as well as bacteriocidal for cul-
tures of S. aureus and S. epidermidis but not for the
Gram-negative species, E. coli and Pseudomonas
aeruginosa (KuŸma et al., 2007). Salvipisione and
aethiopinone expressed staphylococcal anti-biofilm
activity, the reduction in the number of live biofilm
cells and changes of biofilm morphology were observed.
Both diterpenoids showed synergy with several
classes of antibiotics, in case of $-lactams this phe-
nomenon was due to the probable alternation of cell
surface hydrophobicity and cell envelopes permeabil-
ity (Walencka et al., 2007). It was also demonstrated
that diterpenes inhibited the growth of M. tuberculosis
(Copp and Pearce, 2007) and recently the Chinese
group showed that diterpenes isolated from the genus
Scutellaria possessed the substantial antimicrobial
and antiviral activities (Shang et al., 2010).
Phenolics and polyphenols. Phenolics and poly-
phenols constitute a very large group of chemical
compounds. Simple phenols consist of a single sub-
stituted phenolic ring, flavones and their derivatives
– flavanoids and flavanols are phenolic structures
containing one carbonyl group, while quinones
contain two carbonyl groups. Tannins are polymeric
phenolic substances and coumarins are phenolic
compounds made of fused benzene and pyrone rings
(Cowan, 1999). The chemical formulas of exemplary
phenolic compounds are shown in Figure 2.
The simple phenol, caffeic acid isolated from
perennial thorny shrub, Paliurus spina-christi was
1 New antibacterial therapeutics and strategies
Fig. 2. Chemical formulas of exemplary phenolic compounds with antibacterial activity. Catechin (A), Antraquinone (B), Tannin (C)
effective against Gram-positive bacterial species
(Brantner et al., 1996). p-guanidinethyl and its simple
parent phenols were active against S. aureus; the
simple phenolic species showed lower activity that
their calixarene analogues (Mourer et al., 2009).
Other groups demonstrated that more highly oxidized
phenols were also more active probably due to their
ability to oxidize of sulfhydryl groups in proteins (Urs
and Dunleavy, 1975; Mason and Wasserman, 1987).
Flavones and their derivatives, flavonoids and fla-
vonols, due to their extremely large amount of bio-
logical properties, including the antibacterial activity,
are placed among the most attractive plant derivatives
enriching the current therapy options (Cazarolli et al.,
2008). These compounds can form complexes with cell
wall and also disrupt bacterial envelopes (Tsuchiya
et al., 1996; Nakayama et al., 2000). Of special inter-
est are catechins, the subgroup of flavonoids present
in the oolong green teas which beneficial effect on
human health is well known (Cabrera et al., 2006).
These compounds are active against food-borne patho-
genic bacteria and therefore exert the beneficial effect
in gastrointestinal diseases (Friedman, 2007; Dryden
et al., 2006; Koo and Cho, 2004). It was shown that
catechins inhibited in vitro the growth of several bac-
terial species such as Vibrio cholerae, S. mutans and
Shigella spp. (Borris, 1996; Sakanaka et al., 1992;
Vijaya et al., 1995). Inactivation of specific bacterial
enzymes, V. cholerae toxin and glucosyltransferases in
S. mutans, was also reported (Borris, 1996; Nakahara
et al., 1993). Chrysin, another flavonoid abundant in
propolis, also displays substantial antimicrobial activ-
ity, preferentially against Gram-positive species, e.g.
Streptococcus sobrinus, Enterococcus faecalis and
Micrococcus luteus (Uzel et al., 2005). Its activity
against certain oral pathogens, such as Peptostrepto-
coccus anaerobius, Peptostreptococcus micros and
Lactobacillus acidophilus creates the possibility of
propolis application in the treatment of oral cavity
diseases (Koru et al., 2007). Recently novel C(7)
modified chrysin was synthesized. This modification
was deliberately designed in order to enhance the anti-
5
bacterial effect. The biological assays indicated that this
compound is a potent inhibitor of beta-ketoacyl-acyl
carrier protein synthetase (FabH) in E. coli (Suresh
Babu et al., 2006; Li et al., 2009).
A number of papers are concerned with the anti-
bacterial activity of quinones. This activity is based
on their high chemical reactivity inactivating the
chemical compounds, mainly proteins. Surface-
exposed bacterial adhesins, cell wall polypeptides and
membrane bound enzymes are their probable targets
(Cowan, 1999; Koyama, 2006). Because the redox-
potential of these compounds was so essential to their
activity, electrochemical techniques along with bio-
chemical and medical knowledge were successfully
combined to design and develop therapeutically
efficient derivatives (Hillard et al., 2008). It should be
also mentioned that quinones are strong poisons for
bacterial type II topoisomerases – gyrase and TopoIV
(Pommier et al., 2010). Potent antibacterial activity is
attributed to the anthraquinones. It was demonstrated
that anthraquinone isolated from Cassia italica is bac-
teriostatic for Bacillus antracis, Corynebacterium
pseudodiphtericum and P. aeruginosa (Kazumi et al.,
1994), in turn hypericin and hyperforin isolated from
Hypericium perforatum (St. John’s wort) were active
against Gram-positive species – S. aureus, S. epider-
midis, E. faecalis and Bacillus subtilis (Males et al.,
2006; Saddiqe et al., 2010). Recently it was shown
that the antibacterial activity of anthraquinone deriva-
tives from Heterophyllaea postulata against S. aureus
involved an increase in the level of superoxide anion
and singlet molecular oxygen (Comini et al., 2010).
The antimycobacterial activity of quinones was also
described (Copp and Pearce, 2007).
Tannins are divided in two groups – hydrolysable
(derivatives of gallic acid) and condensed, also called
proanthocyanidins (derived from flavonoid mono-
mers). Among the various health beneficial activities
of tannins their antimicrobial activity is often referred
to. These compounds are characterized by strong anti-
peroxidation properties which may be responsible for
the inactivation of microbial adhesions, enzymes and
6 Kurek A. et al.
cell envelope transport proteins (Okuda, 2005). The
antioxidation activity of tannins is based on their abil-
ity to scavenge free radicals, to chelate metals and to
inhibit of prooxidative enzymes and lipid peroxidation
(Koleckar et al., 2008). It was well documented that
tannins inhibited the growth of aquatic and foodborne
bacteria, so they can be used in food processing to
increase the storage time of certain foods (Chung et al.,
1998). Tannins, especially proanthocyanins, inhibit the
growth of uropathogenic E. coli (Cimolai and Cimolai,
2007), S. mutans (de la Iglesia et al., 2010) as well
as ruminal bacteria. For the latter it was documented
that condensed tannin (sainfoin) inhibited the growth
and protease activity of Butyrivibrio fibrisolvens A38
and Streptococcus bovis. The morphological changes
of these species implicated the cell wall as a target of
tannin toxicity (Jones et al., 1994). In turn, both hydro-
lysable tannins and proanthocyanidines suppressed the
oxacillin-resistance of MRSA (Hatano et al., 2005).
The number of publications dealing with anti-
microbial activity of yet another group of phenolics,
cummarins, is scarce and generally it can be concluded
that this property has not been evaluated systemati-
cally (Borges et al., 2005; Cechinel Filho et al., 2009).
Silver and gold nanoparticles
Nanoparticles (NPs) are defined as the clusters of
atoms of size ranged from 1 to 100 nm. Their network
forms are called nanowires. NPs are characterized by
a very large surface area to volume ratio (Rai et al.,
2009). Copper, zinc, magnesium but especially silver
and gold NPs display antibacterial activity and are
used for various healthcare, hygiene and personal care
purposes and also in water-treatment (Edwards-Jones,
2009; Gurunathan et al., 2009). The conventional
methods of NPs preparation involves the use of highly
toxic chemical agents, however more friendly tech-
niques have also been developed (Baker et al., 2005;
Wangoo et al., 2008). Recently the biological systems
for nanoparticles synthesis were elaborated, the pro-
cess is known as “green synthesis”. Sharma and co-
workers (2009) described the production of silver
nanoparticles (AgNPs) by plant extract containing
proteins able to reduce Ag cations. Bacteria and fungi
can also be explored for AgNPs production. Their
biosynthesis was achieved through reduction of Ag+
ions by Klebsiella pneumoniae (Shahverdi et al.,
2007), E. coli (Gurunathan et al., 2009) and Bacillus
licheniformis (Vaidyanathan et al., 2010). Ingle et al.
(2008) and Gade et al. (2008) reported the use of
fungi, respectively Fusarium accuminatum and Asper-
gillus niger, for the production of AgNPs. In turn He
et al. (2008) described the synthesis of gold nanowires
using an extract of Rhodopseudomonas capsulata. It
1
Fig. 3. Different types of silver and gold nanoparticles
should be noted that recently microbial synthesis of
selenium, tellurium platinum, thitania, uranitnie and
other nanoparticles by bacteria, actinomycetes, fungi,
yeasts and viruses was also reported (Narayanan and
Sakthivel, 2010).
Silver in ionic form has been known for centuries
to cure venereal diseases, bone and perianal abscesses,
eye diseases and burns. It was proved that Ag+ was
active against various bacterial species e.g. E. coli,
S. aureus, Klebsiella sp. and Pseudomonas sp. (Rai
et al., 2009; Chopra, 2007). AgNPs have an advan-
tage over ionic silver because they show reduced toxi-
city and 1.4–1.9 times higher antibacterial potential
(Ingle et al., 2008). Reports pointing to silver toxicity,
including arygria and the deposition of silver in liver
are rather scarce (Tomi et al., 2004; Landsdown, 2006).
The antibacterial effect of AgNPs depends on their
size. Smaller-sized particles show stronger antibacte-
rial activity due to their higher surface area to volume
ratio (Morones et al., 2005). It was also proved that
the truncated triangular AgNPs displayed stronger
bacteriocidal action against E. coli compared with
spherical and rod-shaped nanoparticles, suggesting
shape-dependent interaction at least with Gram-nega-
tive bacteria (Pal et al., 2007). Different shapes of
silver and gold nanoparticles are shown in Figure 3.
Several studies demonstrated that bacterial mem-
branes constituted the main target of AgNPs antibac-
terial activity, nanoparticles caused their disruption
probably due to the production of reactive oxygen
species (ROS), including free radicals. Production of
ROS is one of the primary mechanisms of nanoparticle
toxicity; it may result in oxidative stress, inflamma-
tion, and consequent damage not only of membranes
but also of DNA and proteins (Singh et al. 2008). The
model of bacterium – nanoparticle interactions pre-
sented by Neal (2008) is based on contact-mediated
membrane lipid peroxidation by arising reactive oxy-
gen species. Contact was facilitated by electrostatic
forces between nanoparticles and negatively charged
cell envelopes. Scanning and transmission electron
1 New antibacterial therapeutics and strategies
microscopy images confirmed the formation of pits
in the E. coli cell wall and the accumulation of silver
in bacterial membranes which increases permeability
and therefore results in cell death (Sondi and Salopek-
Sondi, 2007). AgNPs may target the bacterial mem-
brane, leading to a dissipation of the proton motive
force as shown by proteomic data and biochemical
studies. Short exposure of E. coli cells to AgNPs
resulted in alterations in the expression of several
envelope proteins (OmpA, OmpC, OmpF, OppA,
MetQ) and heat shock proteins, (IbpA, IbpB and 30S
ribosomal subunit) (Lok et al., 2006).
AgNPs interaction with membrane sulfur-contain-
ing proteins was also proven (Rai et al., 2009). Mem-
brane disruption allowed the passage of AgNPs into
cytoplasm causing subsequent damage of DNA and
other phosphorus containing compounds and impair-
ing the respiratory chain and cell division. The anti-
bacterial activity of AgNPs is enhanced by their
decomposition and the release of Ag ions within bac-
terial cell (Feng et al., 2000; Morones et al., 2005).
The antibacterial activity of AgNPs was well
proven basing on in vitro experiments. Activity against
MRSA (Panacek et al., 2006), E. coli (Sondi and
Salopek-Sondi, 2007; Morones et al., 2005; Pal et al.,
2007; Yoon et al., 2007), P. aeruginosa (Morones
et al., 2005), Vibrio cholera (Morones et al., 2005)
and B. subtilis (Yoon et al., 2007) was reported. Kim
and coworkers (2007) demonstrated that E. coli was
inhibited at low concentration of AgNPs whereas the
growth-inhibitory effect of S. aureus was mild. The
efficient antibacterial activity of AgNPs impregnated
with bacterial cellulose against E. coli and S. aureus
has also been demonstrated (Castellano et al., 2007).
Sucrose and soluble and waxy corn starch can also
serve as stabilizers (Valodkar et al., 2010). Synergistic
antimicrobial activity of AgNPs with penicillin G,
amoxicillin, erythromycin, clindamycin and vanco-
mycin against S. aureus and E. coli was observed
(Shahverdi et al., 2007). It was also shown that
AgNPs prevent the formation of bacterial biofilms, e.g.
biofilms formed by P. aeruginosa and S. epidermidis
were inhibited in more than 95% (Kalishwaralal et al.,
2010). This property made these nanoparticles espe-
cially useful in controlling biofilms within the oral
cavity (Allaker, 2010). Biofilm formation was inhib-
ited due to the ability of AgNPs to prevent the initial
step in biofilm development i.e. microbial adhesion
to various surfaces (Monteiro et al., 2009).
AgNPs are characterized by so many medical and
technological applications that they are considered as
new antibacterial agents revolutionizing applied
medicine. They are used in wounds and ulcers heal-
ing, usually in the form of dressings and creams
(Cortivo et al., 2010; Jun et al., 2007). They are also
utilized to coat medical devices such as catheters, den-
7
tures or surgical masks (Li et al., 2006). Silver, together
with copper, is commonly used to inhibit bacterial and
fungal growth in chicken farms and in post harvested
cleaning of oysters (Singh et al., 2008). AgNPs and
other nanoparticles can be used in water filtration and
disinfection (Li et al., 2008; Jain and Pradeep, 2005)
as well in the production of textiles, both non-toxic
and possessing antimicrobial properties (Dastjerdi and
Montazer, 2010) and in the production of antimicro-
bial nanopaints (Kumar et al., 2008).
Gold nanoparticles (AuNPs) also can be used as
antimicrobial agents. In this case the majority of
papers describes their application as a tool to deliver
other antimicrobials or as a factor enhancing photo-
dynamic destruction of bacteria (Pissuwan et al., 2009).
AuNPs were very suitable for delivering drugs, includ-
ing antibiotics; AuNPs conjugates with vancomycin
proved to be 50-fold more active that the free anti-
biotic against Enterococcus faecium and E. faecalis
(Gu, 2003). The AuNPs-ciprofloxacin and amino-
glycosidic antibiotics conjugates were also described
(Tom et al., 2004; Grace and Pandian, 2007). The role
of AuNPs was to facilitate the attachment of conju-
gated antibiotic to bacterium and therefore penetrating
of cell wall. However it should be stressed that there
is no consensus concerning the efficacy of AuNPs-
antibiotic conjugates compared with the same dosage
of free antibiotic, e.g. Rosemary et al. (2006) found
that AuNPs enhanced the efficacy of ciprofloxacin
against E. coli what was not observed for gentamycin
(Burygin et al., 2009).
AuNPs were also used as stabilizers for various
antimicrobial photosensitizers. Four-fold increase of
S. aureus elimination was observed when toluidine
blue O-AuNPs conjugates and methylene blue-AuNPs
conjugates were used in photodynamic therapy com-
pared to dyes alone (Gil-Tomás et al., 2007; Perni
et al., 2009). AuNPs enhanced the absorption of light
due to their plasmon resonance (Pitsillides et al., 2003)
which could cause local hyperthermic effect leading
to the efficient destruction of E. coli irradiated with
X-rays (Simon-Deckers et al., 2009), P. aeruginosa
exposed to near-infrared laser (Norman et al., 2008)
or S. aureus irradiated with strong laser light (Zharov
et al., 2006).
AuNPs are very useful for detection and diagnosis
of bacteria even in complex media like blood
(Kaittanis et al., 2010), this being mainly based on the
detection of bacterial DNA by change of color
(Elghanian et al., 1997). They have been used for fast,
accurate and sensitive detection of Staphylococcus sp.
(Storhoff et al., 2004) and M. tuberculosis (Baptista
et al., 2006; Veigas et al., 2010). AuNPs were also
applied to improve the sensitivity of bacterial detection
methods based on flow cytometry and fluorescence
(Zaharov et al., 2007; Wang et al., 2009).
8 Kurek A. et al.
Natural and synthetic dyes and
photodynamic therapy
The antimicrobial effect of natural and synthetic
dyes has been known for many decades. Already in
the beginning of the last century proflavine, acrifla-
vine, crystal violet and brilliant green were used
against bacterial infections, mainly to cure infected
wounds (Wainwright, 2008; Wainwright, 2010). Pre-
operative use of iodine still remains a common prac-
tice. Gentian (crystal) violet was shown to be very
efficient in the eradication of MRSA from skin lesions
(Saji et al., 1995). Recently it was shown that the
tiazol dye, thioflavin T, exerted a strong inhibitory
effect on S. aureus, the effect on E. coli was less pro-
nounced (Lakatoš, 2010). The list of dyes with anti-
bacterial properties included also pigments synthe-
sized by microorganisms (Wolska et al., 2010b). The
pigment produced by P. aeruginosa – pyocyanin,
due to its unique redox properties, actively elimina-
ted many bacterial species, especially Gram-positive
aerobes (Baron and Rove, 1981). In turn violacein ex-
tracted from Chromobacterium violaceum displayed
a potent antileishamanial activity (Leon et al., 2001).
Many dyes can serve as photosensitizers, some-
times called photomicrobial agents, and are applied in
photodynamic antimicrobial therapy (PACT). Photo-
sensitizers can be activated by visible light to generate
cytotoxic radicals, superoxide radicals and singlet
oxygen ½ O2 which are the reactive oxygen species
(ROS). ROS are highly toxic to various type of cells,
including bacteria, causing the damage of the outer
membrane, cell wall, ribosomes and nucleic acids and
thus impairing many cellular functions (for review see
Wainwright, 2010; Ryskova et al., 2010). Photosensi-
tizers are usually dyes such as methylene blue (Gad
et al., 2004), porphyrins (Hamblin et al., 2005), crystal
violet (Saji et al., 1995), iodocyanine green (Unno
et al., 2008) and erytrosine (Wood et al., 2006).The
latter is of special interest because it can be used for
the therapy of oral plaque biofilms (Wood et al., 2006).
Positively charged (cationic) photosensitizers such as
methylene blue and crystal violet act as broad-spec-
trum antimicrobials, while the negatively charged (an-
ionic) compounds lack efficacy against Gram-nega-
tive species (Demidova et al., 2005). This is because
anionic photosensitizers are not able to penetrate the
lipopolysaccharide outer membrane of Gram-negative
bacteria. In practice photosensitizers are usually acti-
vated by red light and the preferable source of light is
low-power lasers (Ryskova et al., 2010). The stabili-
zation of various photosensitizers by AuNPs was de-
scribed in the previous chapter. Beside dyes, also
fullerenes which are stable chemical molecules com-
posed of 60 carbon atoms arranged in a soccer ball-
1
shaped structure are proved to be the efficient photo-
sensitizers (Krokosz, 2007).
Photodynamic therapy is used mainly in the treat-
ment of local infections. Its efficacy was proved in
healing cutaneous infections e.g. poor-healing wounds
caused by Mycobacterium marinum (Rallis and
Koumantaki-Mathioudaki, 2007) and oral microbial
related diseases such as periodontitis (Liu et al.,
2009). It was clinically studied for leishmaniasis (Dai
et al., 2009). It should be stressed that photodynamic
therapy can be applied in the eradication of antibiotic-
resistant pathogens e.g. MRSA (Griffiths et al., 1997),
VRE (Soncin et al., 2002) and P. aeruginosa (Minnock
et al., 1996) which are life-threat danger in hospitals.
Recently it was shown that two water soluble photo-
sensitizers: methylene blue and neutral red enclosed
in liposomes gave a stronger antibacterial effect than
their free forms (Nisnevitch et al., 2010). It should
be also noted that photodynamic therapy was applied
and found to be efficient in treating lung, stomach and
skin tumors (Maisch et al., 2005).
Conclusions
The huge and constantly growing amount of pa-
pers describing new antibacterial therapeutics reflects
an urgent need to find efficient antimicrobials which
can be an alternative to antibiotics. Plants and their
extracts have been used even in ancient times for
medical purposes. Recently, studies are focused on
the activity of purified compounds. Trials aimed at
resolving the mechanism of their action are also per-
formed. The majority of studies are held in vitro but
the results of preclinical and clinical trial have also
been reported. As it was shown that many plant com-
pounds exert a cytotoxic effect (Zhang et al., 2007)
efforts have been made to synthesize derivatives with
less toxicity and better water solubility (e.g. Farina
et al., 1998; Liu, 2005), which can enhance the possi-
bility of their therapeutic application. Studies on the
antibacterial activity of silver and gold nanoparticles
are more advanced and also comprise their synergism
with commonly used antibiotics and the applica-
tion of AuNPs in stabilizing photosensitizers used in
photodynamic therapy, which is a very proficient new
antibacterial strategy.
Considering the enormous scientific effort put in
elaborating new antibacterial compounds and strate-
gies, alternative possibilities to cope with bacterial
diseases can emerge in the near future.
Acknowledgment
This study was partially supported by Ministry of Science and
Higher Education grant NN302 027937.
1 New antibacterial therapeutics and strategies
Literature
Ahmed A.A., A.A. Mahmoud, H.J. Williams, A.I. Scott,
J.H. Reinbenspiesand and T.J. Mabry. 1993. New sesquiter-
pene "-methylene lactones from the Egyptian plant Jasonia
candicans. J. Nat. Prod. 56: 1276–1280.
Allaker R.P. 2010. The use of nanoparticles to control oral
biofilm formation. J. Dent. Res. 89: 1175–1186.
Amaral J.A., A. Ekins S.R. Richards and R. Knowles. 1998.
Effect of selected monoterpenes on methane oxidation, denitrifi-
cation, and aerobic metabolism by bacteria in pure culture. Appl.
Environ. Microbiol. 64: 520–525.
Baker C., A. Pradhan, L. Pakstis, D.J. Pochan and S.I. Shah.
2005. Synthesis and antibacterial properties of silver nanoparticles.
J. Nanosci. Nanotechnol. 5: 244–249.
Baptista P.V., M. Koziol-Montewka, J. Paluch-Oles, G. Doria
and R. Franco. 2006. Gold-nanoparticle-probe-based assay for
rapid and direct detection of Mycobacterium tuberculosis DNA in
clinical samples. Clin. Chem. 52: 1433–1434.
Baron S. and J.J. Rove. 1981. Antibiotic action of pyocyanin.
Antimicrob. Agents Chemother. 20: 814–830.
Borges F., F. Roleira, N. Mihazes, L. Santana and E. Uriarte.
2005. Simple coumarins and analogues in medical chemistry:
occurrence, synthesis and biological activity. Curr. Med. Chem.
12: 887–916.
Borris R.P. 1996. Natural products research: perspectives from a
major pharmaceutical company. J. Ethnopharmacol. 51: 29–38.
Brantner A., Ž. Maleš, S. Pepelnjak and A. Antoliæ. 1996.
Antimicrobial activity of Paliurus spina-christi Mill. (Christ’s
thorn). J. Ethnopharmacol. 52: 119–122.
Burygin G.L., B.N. Khlebtstov, A.N. Shantrokha, L.A.
Dykman, V.A. Bogatyrev and N.G. Khlebtsov. 2009. On the
enhanced antibacterial activity of antibiotics mixed with gold
nanoparticles. Nanoscale Res. Lett. 4: 794–801.
Cabrera C., R. Artacho and R. Giménez. 2006. Beneficial effect
of green tea – a review. J. Am. Coll. Nutr. 25: 79–99.
Castellano J.J., S.M. Shafii, F. Ko, G. Donate, T.E. Wright,
R.J. Mannari, W.G. Payne, D.J. Smith, M.C. Robson. 2007.
Comparative evaluation of silver-containing antimicrobial dress-
ings and drugs. Int. Wound J. 4: 114–122.
Cazarolli L.H., L. Zanatta, E.H. Alberton, M.S. Figueiredo,
P. Folador, R.G. Damazio, M.G. Pizzolatti and F.R. Silva.
2008. Flavonoids: prospective drug candidates. Mini Rev. Med.
Chem. 8: 1429–1440.
Cechinel Filho V., C. Meyre-Silva and R. Neiro. 2009. Chemical
and pharmacological aspects of the genus Calophyllum. Chem.
Biodivers. 6: 313–327.
Chen J.-C., T.-H. Ho, Y.-S. Chang, S.-L. Wu, C.-C. Li and
C.-Y. Hsiang. 2009. Identification of Escherichia coli enterotoxin
inhibitors from traditional medical herbs in silico, in vitro and
in vivo analyses. J. Ethnopharmacol. 121: 372–378.
Chibani-Chennoufi S., J. Sidoti, A. Bruttin, E. Kutter,
S. Sarker and H. Brussow. 2004. In vitro and in vivo bacterio-
lytic activities of Escherichia coli phages: implications for phage
therapy. Antimicrob. Agents Chemother. 48: 2558–2569.
Chopra I. 2007. The increasing use of silver-based products as
antimicrobial agents: a useful development or a case for concern?
J. Antimicrobial. Chem. 59: 587–590.
Chung K.T., T.Y. Wong, C.I. Wei, Y.W. Huang and Y. Lin.
1998. Tannins and human health: a review. Crit. Rev. Food Sci.
Nutr. 38: 421–464.
Cimolai N. and T. Cimolai. 2007. The cranberry and urinary
tract. Eur. J. Clin. Microbiol. Infect. Dis. 26: 767–776.
Comini L.R., S.C. Núòez Montoya, P.L. Páez, G.A. Argüello,
I. Albesa and J.L. Cabrera. 2010. Antibacterial activity of anthra-
9
quinone derivatives from Heterophyllaea postulate (Rubiaceae).
J. Photochem. Photobiol. B.
Copp B.R. and A.N. Pearce. 2007. Natural product growth inhibi-
tors of Mycobacterium tuberculosis. Nat. Prod. Rep. 24: 278–297.
Cortivo R., V. Vindigni, L. Iacobellis, G. Abatangelo, P. Pinton
and B. Zavan. 2010. Nanoscale particle therapies for wounds and
ulcers. Nanomedicine 5: 641–656.
Cowan M.M. 1999. Plant product as antimicrobial agents. Clin.
Microbiol. Rev. 12: 564–582.
Dai T., Y.-Y. Huang and M.R. Hamblin. 2009. Photodynamic
therapy for localized infections – state of art. Photodiag. Photodyn.
Ther. 6: 170–188.
Dastjerdi R. and M. Montazer. 2010. A review on the applica-
tion of inorganic nano-structured materials in the modification
of textiles: focus on anti-microbial properties. Colloids Surf.
B. Interfaces. 79: 5–18.
de la Iglesia R., F.I. Milagro, J. Campión, N. Boqué and
J.A. Martinez. 2010. Healthy properties of proanthocyanidins.
Biofactors 36: 159–168.
Demidova T.N. and M.R. Hamblin. 2005. Effect of cell-photo-
sensitizer binding and cell density on microbial photoinactivation.
Antimicrob. Agents Chemother. 49: 2329–2335.
Donadio S., S. Maffiolo, P. Monciardini, M. Sosio and
D. Jabes. 2010. Antibiotic discovery in the twenty-first century:
current trends and future perspectives. J. Antibiot. (Tokyo) 63:
423–430.
Dryden G.W., M. Song and C. McClain. 2006. Polyphenols and
gastrointestinal diseases. Curr. Opin. Gastroenterol. 22: 165–170.
Edwards-Jones V. 2009. The benefits of silver in hygiene, per-
sonal care and healthcare. Lett Appl. Microbiol. 49: 147–152.
Elghanian R., J.J. Storhoff, R.C. Mucic, R.L. Letsinger and
C.A. Mirkin. 1997. Selective colorimetric detection of polynucle-
otides based on the distance-dependent optical properties of gold
nanoparticles. Science 277: 1078–1081.
Farina C., M. Pinza and G. Pifferi. 1998. Synthesis and anti-
ulcer activity of new derivatives of glycyrrhetic, oleanolic and
ursolic acids. Pharmacology 53: 22–32.
Feng Q.J., J. Wu, G.Q. Chen, F.Z. Cui, T.N. Kim and J.Q. Kim.
2000. A mechanistic study of the antibacterial effect of silver ions
on Escherichia coli and Staphyloccocus aureus. J. Biomed. Matter
52: 662–668.
Fontanay S., M. Grare, J. Mayer, C. Finance and R.E. Duval.
2008. Ursolic, oleanolic and betulic acids: Antibacterial spectra
and selectivity indexes. J Ethnopharmacol. 120: 272–276.
Friedman M. 2007. Overwiew of antibacterial, antitoxin, antiviral
and antifungal activities of tea flavonoids and teas. Mol. Nutr.
Food Res. 51: 116–134.
Gad F., T. Zahra, T. Hasan and M.R. Hamblin. 2004. Effect of
growth phase and extracellular slime on photodynamic inactiva-
tion of Gram-positive pathogenic bacteria. Antimicrob. Agents
Chemother. 48: 2173–2178.
Gade A.K., P. Bonde, A.P. Ingle, P.D. Marcato, N. Duran and
M.K. Rai. 2008. Explotation of Aspergillus niger for synthesis of
silver nanoparticles. J. Biol. Mater. Bioener. 2: 1–5.
Ge F., F. Zeng, S. Liu, N. Guo, H. Ye, Y. Song, J. Fan, X. Wu,
X. Wang, X. Deng, Q. Jin and L. Yu. 2010. In vitro synergistic
interactions of oleanolic acid in combination with isoniazid,
rifampicin or ethambutol against Mycobacterium tuberculosis.
J. Med. Microbiol. 59: 567–72.
Gil-Thomás J., S. Tubby, I.P. Parkin, N. Narband, L. Dekker,
S.P. Nair, M. Wilson and C. Street. 2007. Lethal photosensitisa-
tion of Staphylococcus aureus using toluidine blue O-tiopronin-
gold nanoparticle conjugate. J. Mat. Chem. 17: 3739–3746.
Górski A., A. Miêdzybrodzki, J. Borysowski, B. Weber-
D¹browska, M. £obocka, W. Fortuna, S. Letkiewicz, M. Zimecki
10 Kurek A. et al.
and G. Filby. 2009. Bacteriophage therapy for the treatment of
infections. Curr. Opin. Investig. Drugs 10: 766–774.
Grace N.A. and K. Pandian. 2007. Antibacterial efficacy of
aminoglycosidic antibiotics protected gold nanoparticles – A brief
study. Colloids Surf. A Physicochem. Eng. Asp. 297: 63–70.
Griffiths M.A., B.W. Wren and M. Wilson. 1997. Killing of
methicillin-resistant Staphylococcus aureus in vitro using alu-
minium disulphonated phthalocyanine, a light-activated antimicro-
bial agent. J. Antimicrob. Chemother. 40: 873–876.
Gu H., P.L. Ho, E. Tong, L. Wang, B. Xu. 2003. Presentation of
vancomycin on nanoparticles to enhance antimicrobial activities.
Nano Lett. 3: 1261–1263.
Gurunathan S., K. Kaliswaralal, R. Vaidyanathan, D. Venka-
taraman, S.R. Pandian, J. Hariharan and S.H. Eom. 2009.
Biosynthesis, purification and characterization of silver nano-
particles using Escherichia coli. Colloids Surf. B. Interfaces 74:
328–335.
Habtermariam S., A.I. Gray and P.G. Waterman. 1993. A new
antibacterial sesquiterpene from Premna oligotricha. J. Nat. Prod.
56: 140–143.
Hamblin M.R., J. Viveiros, C.H. Yang, A. Ahmadi, R.A. Ganz
and M.J. Tolkoff. 2005. Helicobacter pylori accumulates photo-
active porphyrins and is killed by visible light. Antimicrob. Agents
Chemother. 49: 2822–2827.
Harada H. and N. Misawa. 2009. Novel approaches and achieve-
ments in biosynthesis of functional isoprenoids in Escherichia
coli. Appl. Microbiol. Biotechnol. 84: 1021–1031.
Hatano T., M. Kusuda, K. Inada, T.O. Ogawa, S. Shiota,
T. Tsuchiya and T. Yoshida. 2005. Effects of tannins and related
polyphenols on methicillin-resistant Staphylococcus aureus. Phyto-
chemistry 66: 2047–2055.
He S., Y. Zhang, Z. Guo and N. Gu. 2008 . Biological synthesis
of gold nanowires using extact of Rhodopseudomonas capsulata.
Biotech. Prog. 24: 476–480.
Hillard E.A., F.C. de Abreu, D.C. Ferreira, G. Jaouen,
M.O. Goulart, C. Amatore. 2008. Electrochemical parameters and
techniques in drug development, with an emphasis on quinones and
related compounds. Chem Commun. (Camb.) 21: 2612–2628.
Högberg L. D., A. Heddini and O. Cars. 2010. The global need
for effective antibiotics: challenges and recent advances. Trends
Pharmacol. Sci. 31: 509–515.
Ingle A., A. Gade, S. Pierrat, C. Sonnichsen and M. Rai. 2008.
Mycosynthesis of silver nanoparticles using the fungus Fusarium
acuminatum and its activity against some human pathogenic bac-
teria. Curr. Nantechnol. 4: 141–144.
Jain P. and T. Pradeep. 2005. Potential of silver nanoparticle-
coated polyurethane foam as an antibacterial water filter. Bio-
technol. Bioeng. 90: 59–63.
Jones G.A., T.A. McAllister, A.D. Muir and K.J. Cheng. 1994.
Effects of sainfoin (Onobrychis viciifolia Scop.) condensed
tannins on growth and proteolysis by four strains of ruminal bac-
teria. Appl. Environ. Microbiol. 60: 1374–1378.
Jun J., D. Yuan-Yuan, W. Shao-feng, W. Zhong-yi. 2007.
Preparation and characterization of antibacterial silver-contain-
ing nanofibers for wound dressing applications. J. US-China Med.
Sci. 4: 52–54.
Kaittanis C., S. Santra and J.M. Perez. 2010. Emerging nano-
technology based strategies for the identification of microbial
pathogenesis. Adv. Drug Deliv. Rev. 62: 408–423.
Kalishwaralal K., S. BarathManiKanth, S.R. Pandian,
V. Deepak and S. Gurunathan. 2010. Silver nanoparticles impede
the biofilm formation by Pseudomonas aeruginosa and Staphylo-
coccus epidermidis. Colloids Sur. B Biointerfaces 79: 340–344.
Kazumi M.H., A. Malik, S. Hammed, N. Akhtar and S. Noor
Ali. 1994. An anthraquinone derivative from Cassia italica. Phyto-
chemistry 36: 761–763.
1
Kim J.S., E. Kuk, K.N. Yu, J.H. Kim, S.J. Park, H.J. Lee,
S.H. Kim,. Y.K. Park, C.Y. Hwang, Y.K. Kim, Y.S. Lee,
D.H. Jeong and M.H. Cho. 2007. Antimicrobial effect of silver
nanoparticles. Nanomedicine 3: 95–101.
Koleckar V., K. Kubikova, Z. Rehakova, K. Kuca, D. Jun,
L. Jahodar and L. Opletal. 2008. Condensed and hydrolysable
tannins as antioxidants influencing the health. Mini Rev. Med.
Chem. 8: 436–447.
Koo M.W. and C.H. Cho. 2004. Pharmacological effect of green
tea on the gastrointestinal system. Eur. J. Pharmacol. 500: 177–185.
Koru O., F. Toksoy, C.H. Acikel, Y.M. Tunca, M. Baysallar,
A. Uskudar Guculu, E. Akca, A. Ozkok Tuylu, K. Sorkun,
M. Tanyuksel and B. Salih. 2007. In vitro antimicrobial activity
of propolis samples from different geographical origins against
certain oral pathogens. Anaerobe 13: 140–145.
Koyama J. 2006. Anti-infective quinone derivatives of recent
patents. Recent Pat. Antiinfect. Drug Discov. 1: 113–125.
Kozai K., J. Suzuki, M. Okada and N. Nagasaka. 1999. Effect of
oleanolic acid-cyclodextrin inclusion compounds on dental carries
by in vitro experiment in rat-carries model. Microbios 97: 179–188.
Krokosz A. 2007. Fullerenes in biology (in Polish). Post.
Biochem. 53: 91–96.
Kubo I., H. Muroi and M. Himejima. 1992. Antibacterial acti-
vity of totarol and its potentiation. J. Nat. Prod. 55: 1436–1440.
Kumar A., P. K. Vemula, P. M. Ajayan and G. John. 2008.
Silver nanoparticle-embeded antimicrobial paints based on vege-
table oil. Nat. Mater. 7: 236–241.
Kurek A., A.M. Grudniak, M. Szwed, A. Klicka, £. Samluk
and K.I. Wolska. 2010. Oleanolic acid and ursolic acid affect
peptidoglycan metabolism in Listeria monocytogenes. Anton,
Leuven. 97: 1143–1146.
KuŸma £., M. Ró¿alski, E. Walencka, B. Ró¿alska and
H. Wysokiñska. 2007. Antimicrobial activity of diterpenoids
from hairy roots of Salvia sclarea L.: salvipisone as a potential
anti-biofilm agent active against antibiotic resistant Staphylo-
cocci. Phytomedicine 14: 31–35.
Lakatoš B., B. Kaliòková, D. Hudecová. and L. Vareèka. 2010.
New effect and applications of thioflavins. Centr. Eur. J. Biol. 5:
143–150.
Landsdown A.B. 2006. Silver in health care: antibacterial effect
and safety in use. Curr. Probl. Dermatol. 33: 17–34.
Leon L.L., C.C. Miranda, A.O. De Souza and N. Durán. 2001.
Antleishmanial activity of the violacein extracted from Chromo-
bacterium violaceum. J. Antimicrob. Chemother. 48: 449–450.
Levy S.B. 1998. The challenge of antibiotics resistance. Sci. Am.
278: 46–53.
Li Y., P. Leung, Q.W. Song and E. Newton. 2006. Antimicro-
bial effect of surgical masks coated with nanoparticles. J. Hosp.
Infect. 62: 58–63.
Li Q., S. Mahendra, D.Y. Lyon, L. Brunet, M.V. Liga, D. Li
and P.J. Alvarez. 2008. Antimicrobial nanomaterials for water
disinfection and microbial control: potential applications and im-
plications. Water Res. 42: 4591–4602.
Li H.Q., L. Shi, Q. S. Li, P.G. Liu, Y. Luo, J. Zhao and
H.L. Zhu. 2009. Synthesis of C(7) modified chrysin derivatives
designing to inhibit beta-ketoacyl-acyl carrier protein synthetase
III (FabH) as antibiotics. Bioorg. Med. Chem. 17: 6264–6269.
Liu P.F., W.H. Zhu and C.M. Huang. 2009. Vaccines and photo-
dynamic therapies for oral microbial-related diseases. Curr. Drug.
Metab. 10: 90–94.
Liu J. 2005. Oleanolic and ursolic acids: Research perspectives.
J. Ethnopharmacol. 100: 92–94.
Lok Ch-M., Ch-M. Ho, R. Chen, Q-Y. He, W-Y. Yu, H. Sun,
Kwong-Hang, P. Tam, J-F. Chiu and Ch-M. Chi-Ming Che.
2006. Proteomic analysis of the mode of antimicrobial action of
silver nanoparticles. J. Prot. Res. 5: 916–924.
1 New antibacterial therapeutics and strategies
Maisch T., C. Bosi, R.M. Szeimies, N. Lehn and C. Abels.
2005. Photodynamic effect of novel XF porfyrin derivatives on
prokaryotic and eukaryotic cells. Antimicrob. Agents Chemother.
49: 1542–1552.
Males Z., A.H. Branter, K. Soviæ, K.H. Pilepiæ and M. Plazibat.
2006. Comparative phytochemical and antimicrobial investiga-
tions of Hypericium perforatum L. subsp. perforatum and
H. perforatum subsp. angustifolium (DC.) Gaudin. Acta Pharm.
56: 359–367.
Mason T.L. and B.P. Wasserman. 1987. Inactivation of red beet
beta-glucan synthetase by native and oxidized phenolic compounds.
Phytochemistry 26: 2197–2202.
Minnock A., D.I. Vernon, J. Schofield., J. Griffith., J. Howard
Parish and S.B. Brown. 1996. Photoinactivation of bacteria. Use
of cationic water-soluble zinc phthalocyanine to photoinactivate
both Gram-negative and Gram-positive bacteria. J. Photochem.
Photobiol. B. Biol. 32: 159–64.
Monteiro D.R., L.P. Gorup, A.S. Takamiya, A.C. Ruvollo-
Filho, E.R. de Camargo and D. Barros Barbosa. 2009. The
growing importance of materials that prevent microbial adhesion:
antimicrobial effect of medical devices containing silver. Int.
J. Antimicrob. Agents 34: 103–110.
Morones J.R., J.L. Elechigerra, A. Camacho and J.T. Ramirez.
2005. The bacterial effect of silver nanoparticles. Nanotechnology
16: 2346–2353.
Mourer M., H.M. Dibama, S. Fontanay, M. Grare, R.E. Duval,
C. Finance and J.B. Regnouf-de-Vains. 2009. p-Guanidinoethyl
calixarene and parent phenol derivatives exhibiting antibacterial
activities. Synthesis and biological evaluation. Bioorg. Med. Chem.
17: 5496–5509.
Myles D.C. 2003. Novel biologically active natural and unnatural
products. Curr. Opin. Biotechnol. 14: 627–633.
Nakayama T., T. Hashimoto, K. Kajiyaand S. Kumazawa.
2000. Affinity of polyphenols for lipid bilayers. Biofactors 13:
147–151.
Nakahara K., S. Kawabata, H. Ono, K. Ogura, T. Tanaka,
T. Ooshima and S. Hamada. 1993. Inhibitory effect of oolong
tea polyphenols on glucosyltransfrases of mutant streptococci.
Appl. Environ. Microbiol. 59: 968–973.
Narayanan K.B. and N. Sakthivel. 2010. Biological synthesis
of metal nanoparticles by microbes. Adv. Colloid Sci. 156: 1–13.
Neal A.I. 2008. What can be inferred from bacterium – nano-
particle interactions about the potential consequences of en-
vironmental exposure to nanoparticles? Exotoxicobiology 7:
362–371.
Nisnevitch M., F. Nakonechny and Y. Nitzan. 2010. Photo-
dynamic antimicrobial chemotherapy by liposome-encapsulated
water-soluble photosensitizers. Bioorg. Chim. 36: 396–402.
Norman R.S., J.W. Stowe, A. Gole, C.J. Murphy and T.L. Sabo-
Altwood. 2008. Targeted photothermal lysis of pathogenic bac-
teria, Pseudomonas aeruginosa, with gold nanorods. Nano. Lett.
8: 302–306.
Okuda T. 2005. Systematics and health effects of chemically dis-
tinct tannins in medical plants. Phytochemistry 66: 2012–2031.
Pal S., Y.K. Tak and J.M. Song. 2007. Does the antibacterial
activity of silver nanoparticles depend on the shape of the
nanoparticle? A study of the Gram-negative bacterium Escherichia
coli. Appl. Environ. Microbiol. 27: 1712–1720.
Panacek A., L. Kvitek, R. Prucek, M. Kolar, R. Vecerova
and N. Pizurova. 2006. Silver colloid nanoparticles: synthesis,
characterization and their antibacterial activity. J. Phys. Chem.
110: 16248–16243.
Perni S., C. Piccirillo, J. Pratten, P. Prokopovich, W. Chrza-
nowski, P. Parkin and M. Wilson. 2009. The antimicrobial pro-
perties of light-activated polymers containing methylene blue and
gold nanoparticles. Biomaterials 30: 89–93.
11
Pissuwan D., C.H. Cortie, S.M. Valenzuela and M.B. Cortie.
2009. Functionalised gold nanoparticles for controlling patho-
genic bacteria. Trends Biotechnol. 28: 207–213.
Pitsillides C.M., E.K. Joe, X Wei, R.R. Anderson and C.P. Lin.
2003. Selective cell targeting with light-absorbing microparticles
with nanoparticles. Biophys. J. 84: 4023–4032.
Pommier Y., E. Leo, H. Zhang and C. Marchand. 2010. DNA
topoisomerases and their poisoning by anticancer and antibacterial
drugs. Chem. Biol. 28: 421–433.
Rai M., A. Yadav and A Gade. 2009. Silver nanoparticles as
a new generation of antimicrobials. Biotech. Adv. 27: 76–83.
Rallis E. and E. Koumantaki-Mathioudaki. 2007. Treatment
of Mycobacterium marinum cutaneous infections. Expert Opin.
Pharmacother. 8: 2965–2978.
Ren D., R. Zuo, A.F. Gonzalez Barrios, L.A. Bedzyk,
G.R. Eldridge, M.E. Pasmore and T.K. Wood. 2005. Differen-
tial gene expression for investigation of Escherichia coli biofilm
inhibition by plant extract ursolic acid. Appl. Environ. Microbiol.
71: 4022–4034.
Rios J.L. and M.C. Recio. 2005. Medical plants and antimicro-
bial activity. J. Ethnopharmacol. 100: 80–84.
Rosemary M.J., I. MacLaren and T. Pradeep. 2006. Investiga-
tions of the antibacterial properties of ciprofloxacin SiO2. Langmuir
22: 10125–10129.
Ryskova L., V. Buchta and R. Slezak. 2010. Photodynamic anti-
microbial therapy. Centr. Eur. J. Biol. 5: 400–406.
Sacchettini J.C. and C.D. Poulter. 1997. Creating isoprenoid
diversity. Science 277: 1788–1789.
Saddiqe Z., I. Naeem and A. Maimoona. 2010. A review of the
antibacterial activity of Hypericum perforatum L. J. Ethnophar-
macol. 131: 511–521.
Saji M., S. Taguchi, K. Uchiyama, E. Osomo, N. Hayama and
H. Ohkumi. 1995. Efficacy of gentian-violet in the eradication
of methicillin-resistant Staphylococcus aureus from skin lesions.
J. Hosp. Infect. 31: 225–228.
Sakanaka S., N. Shimura, M. Aizawa, M. Kim and T. Yamamoto.
1992. Preventive effect of green tea polyphenols against dental car-
ies in conventional rats. Biosci. Biotechnol. Biochem. 56: 592–594.
Savluchinske-Feio S., M.J. Curto, B. Gigante and J.C. Roseiro.
2006. Antimicrobial activity of resin acid derivatives. Appl. Micro-
biol. Biotech. 72: 430–436.
Shahverdi A.R., A. Fakhimi, H.R. Shahverdi and S.M. Minaian.
2007. Synthesis and effect of silver nanoparticles on the antibacte-
rial activity of different antibiotics against Staphylococcus aureus
and Escherichia coli. Nanomedicine 3: 168–171.
Shang X., X. He, M. Li, R. Zhang, P. Fan, Q. Zhang and
Z. Jia. 2010. The genus Scutellaria an ethnopharmacological and
phytochemical review. J. Ethnopharmacol. 128: 279–313.
Sharma V.K., R.A. Yngard and Y. Lin. 2009. Silver nano-
particles: green synthesis and their antimicrobial activities. Adv.
Colloid Interface Sci. 145: 83–96.
Simon-Deckers A., S. Loo, M. Mayne-L’hermite, N. Herlin-
Boime, N. Menguy, C. Reynaud, B. Gouget and M. Carriere.
2009. Size-, composition-, and shape-dependent toxicological
impact of metal oxide nanoparticles and carbon nanotubes towards
bacteria. Environ. Sci. Technol. 43: 8423–8429.
Singh M., S. Singh, S. Prasada and I.S. Gambhir. 2008. Nano-
technology in medicine and antibacterial effect of silver nano-
particles. Digest J. Nanomat. Biostruct. 3: 115–122.
Smith E., E. Williamson, M. Zloh and S. Gibbons. 2005.
Isopimaric acid from Pinus nigra shows activity against multidrug-
resistant and EMRSA strains of Staphylococcus aureus. Phytother.
Res. 19: 538–542.
Soncin M., C. Fabris, A. Busetti, D. Dei, D. Nistri and
G. Roncucci. 2002. Approaches to selectivity in the Zn (II)-
phthalocyanide-photosensitized inactivation of wild-type and
12 Kurek A. et al.
antibiotic-resistant Staphylococcus aureus. Photochem. Photobiol.
Sci. 1: 815–819.
Sondi J. and B. Salopek-Sondi. 2004. Silver nanoparticles as
antimicrobial agent: a case study on E. coli as a model for Gram-
negative bacteria. J. Colloid Interface 275: 177–182.
Storhoff J.J., A.D. Lucas, V. Garimella, Y.P. Bao and U.R.
Müller. 2004. Homogenous detection of unamplified genomic
DNA sequences based on colorimetric scatter of gold nano-
particles probes. Nat. Biotechnol. 22: 883–887.
Suresh Babu K., T. Hari Babu, P.V. Srinvas, K. Hara Kishore,
U.S. Murthy and J.M. Rao. 2006. Synthesis and biological
evaluation of novel C(7) modified chrysin analogues as antibac-
terial agents. Bioorg. Med. Chem. Lett. 16: 221–224.
Tom R.T., V. Suryanarayanan, P.G. Reddy, S. Baskaran and
T. Pradeep. 2004. Ciprofloxacin-protected gold nanoprticles.
Langmuir 20: 1909–1914.
Tomi N.S., B. Kranke and W. Aberer. 2004. A silver man. Lan-
cet 363: 532
Tsuchiya H., M. Sato, M. Miyazaki, S. Fuijwara, S. Tanigaki,
M. Ohyama, T. Tanaka, and M. Iinuma. 1996 Comparative
study on the antibacterial activity of photochemical flavanones
against meticillin-resistant Staphylococcus aureus. J. Ethnophar-
macol. 50: 27–34.
Unno N., M. Suzuki, N. Yamamoto, K. Inuzuka, D. Sagara and
M. Nishiyama. 2008. Indocyanine green fluorescence angio-
graphy for intraoperative assessment of blond flow: a feasibility
study. Eur. J. Vasc. Endovasc. Surg. 35: 205–207.
Urs N.V.R.R. and J.M. Dunleavy. 1975. Enhancement of the
bactericidal activity of peroxidase system by phenolic compounds
(Xanthomonas phaseoli var. sojensis, soybeans). Phytopathology
65: 686–690.
Uzel A., K. Sorkun, O. Onçag, D. Cogülu, O. Gençay and
B. Salih. 2005. Chemical composition and antimicrobial activities
of four different Anatolian propolis samples. Microbiol. Res. 160:
189–195.
Vaidyanathan R., S. Gopalram, K. Kalishwaralal, V. Deepak,
S.R. Pandian and S. Gurunathan. 2010. Enhanced silver
nanoparticle synthesis by optimization of nitrate reductase activity.
Colooids Sur. B Biointerfaces 75: 335–341.
Valodkar M., A. Bhadoria, J. Pohnerkar, M. Mohan and
S. Thakore. 2010. Morphology and antibacterial activity of carbo-
hydrate-stabilized silver nanoparticles. Carbohydr. Res. 345:
1767–1773.
Veigas B., D. Machado, J. Perdigao, I. Portugal, I. Couto,
M. Viveiros and P.V. Baptista. 2010. Au-nanoprobes for detec-
tion of SNPs associated with antibiotic resistance in Mycobacte-
rium tuberculosis. Nanotechnology 21: 415101.
1
Vijaya K., S. Ananthan and R. Nalini. 1995. Antibacterial effect
of teaflavin, polyphenon 60 (Camellia sinensis) and Euphorbia
hirta on Shigella spp. – a cell culture study. J. Ethnopharmacol.
49: 115–118.
Wainwright M. 2008. Dyes in the development of drugs and
pharmaceuticals. Dyes Pigments 76: 582–589.
Wainwright M. 2010. “Safe” photoantimicrobials for skin and
soft-tissue infections. Int. J. Antimicrob. Agents 36: 14–18.
Walencka E., S. Ró¿alska, S. Wysokiñska, M. Ró¿alski,
L. KuŸma and B. Ró¿alska. 2007. Salvipisone and aethiopinone
from Salvia sclarea hairy roots modulate staphylococcal anti-
biotics resistance and express anti-biofilm activity. Planta Med.
73: 545–551.
Wang X., L.H. Liu, O. Ramström and M. Yan. 2009. Engineer-
ing nanomaterial surfaces for biomedical applications. Exp. Biol.
Med. 234: 1128–1139.
Wangoo N., K.K. Bhasin, R. Boro and C.R. Suri. 2008. Facile
synthesis and functionalization of water-soluble gold nanoparticles
for bioprobe. Anal. Chim. Acta 610: 142–148.
Wansi J.D., D.D. Chiozem, A.T. Tcho, F.A. Toze, K.P. Devkota,
B.L. Ndjakou, J. Wandji and N. Sewland. 2010. Antimicrobial
and antioxidant effects of phenolic constituents from Klainedoxa
gaboniensis. Pharm. Biol. 48: 1124–1129.
Wolska K.I., A.M. Grudniak, B. Fiecek, A. Kraczkiewicz-
Dowjat and A. Kurek. 2010 a. Antibacterial activity of oleanolic
and ursolic acids and their derivatives. Centr. Eur. J. Biol. 5:
543–553.
Wolska K.I., A.M. Grudniak, A. Kraczkiewicz-Dowjat and
A. Kurek. 2010 b. Various functions of selected bacterial pig-
ments (in Polish). Post. Mikrobiol. 40: 105–114.
Wood S., D. Metcalf, D. Devine and R. Robinson. 2006. Erythro-
sine is a potential photosensitizer for the photodynamic therapy
of oral plaque biofilms. J. Antimicrob. Chemother. 57: 680–684.
Wright G.D. 2010. Antibiotic resistance in the environment:
a link to the clinic? Curr. Opin. Microbiol. 13: 589–594.
Yoon K-Y, J.H. Byeon, J.-H. Park and J. Hwang. 2007. Sus-
ceptibility constants of Escherichia coli and Bacillus subtilis to
silver and copper nanoparticles. Sci. Tot. Environm. 373: 572–575.
Zharov V.P., E.I. Galanzha and W. Tuchin. 2007. Photothermal
flow cytometry in vitro for detection and imaging of individual
moving cells. Cytometry A 71: 191–206.
Zharov V.P., K.E. Mercer, E.N. Galitovskaya and M.S. Smeltzer.
2006. Photothermal nanotherapeutics for selective killing of bac-
teria targeted with gold nanoparticles. Biophys. J. 90: 619–627.
Zhang Y., F. Bao, J. Hu, S. Liang, Y. Zhang, G. Du, C. Zhang
and Y. Chen. 2007. Antibacterial ligands and triterpenoids from
Rostellularia procumbens. Planta Med. 73: 1596–1599.
Polish Journal of Microbiology
2011, Vol. 60, No 1, 13–17

ORIGINAL PAPER

Cloning, Expression and Identification by Immunohistochemistry

of Humanized Single-Chain Variable Fragment Antibody
against Hepatitis C Virus Core Protein

YONG-ZHI LUN1, 2, *, JUN CHENG2, YAN-WEI ZHONG2, ZENG-GUO YU1, QI WANG2,

FANG WANG and JIE FENG1

1 Liaoning Provincial University Key Laboratory of Biophysics, Medical College

Dalian University, Dalian 116622, China
2 Institute of Infectious Diseases, Beijing Ditan Hospital, Beijing 100015, China

Received 29 April 2010, revised 17 December 2010, accepted 14 January 2011

Abstract

Expression of single-chain variable fragment (scFv) antibodies on the surface of bacteriophage is widely used to prepare antibodies with
pre-defined specificities. A phage antibody library containing the gene for scFv antibody against Hepatitis C virus core protein was panned
with core protein immobilized on microtiter plate wells. After five rounds of panning 60 phage clones specific to core protein were
obtained and one selected clone was sequenced. It was found that the specifically detected antigen consists of 774bp and is capable of
encoding 257 amino acids in the patients but not in healthy persons.

K e y w o r d s: Hepatitis C virus; core protein; phage display; single-chain variable fragment antibody

Abbreviations: HRP, horseradish peroxidase; HCV, Hepatitis C virus; HCV core protein scFv antibody, scFv antibody against HCV
core protein; MAb, monoclonal antibody; scFv, single-chain variable fragment.

Introduction various HCV genotypes (Houghton et al., 1991) and

Hepatitis C virus (HCV) was first described in
1989 as the putative viral agent of non-A non-B hepa-
titis. An estimated 170 million people are infected
with HCV worldwide (Armstrong, 2003; Stoll-Keller
et al., 2009). HCV is a member of the Flaviviridae
family and has been recognized as the major caus-
ative agent of chronic liver disease, including chronic
active hepatitis, cirrhosis and hepatocellular carci-
noma (Di Bisceglie, 2000). It has recently been sug-
gested that HCV core protein suppresses the antiviral
cytotoxic T-lymphocyte response by interacting with
the C1q complement receptor, thereby playing a key
role in the induction and maintenance of chronic HCV
infection and liver damage (Kittlesen et al., 2000;
Large et al., 1999). The presence of serum HCV core
protein is associated with active HCV viremia, and its
detection is now used for clinical evaluations
(Dickson et al., 1999; Tanaka et al., 2000). In addi-
tion, HCV core protein is highly conserved among the
elicits a rapid Antibody response after the onset of
the disease. Thus, antibody responses to HCV core
protein may be considered to confer protection against
HCV infection regardless of viral subtypes. The
monoclonal antibodies (McAb) of HCV core protein
could passively conduce to prevent HCV infection.
However, the production periodicity of McAb made
by hybridoma technique is relatively long. In addition,
clinical testing has shown that murine monoclonal
antibodies may evoke human anti-mouse antibody
response. Phage display technology offers a means of
cloning human anti-HCV antibodies coding gene of
a defined specificity that may have potential thera-
peutic use (Canaan-Haden et al., 1995). We now
utilize a semi-synthetic human single-chain Fv anti-
body library and solid-phase bound hepatitis C virus
core protein to screen out the phage display antibody
that recognizes the HCV core protein (Zhong et al.,
2001), using HCV core protein as the immobilized
antigen and proceeding immunohistochemistry.

* Corresponding author: Yong-Zhi Lun; e-mail: lunyz@163.com

14 Lun Y.-Z. et al.
Experimental
Materials and Methods
Materials. A recombinant HCV core protein from
Virostat (USA) was employed. A human scFv antibody
phage library in which the genes encoding VL and
VH were amplified by PCR with degenerate primers
and connected with a glycine linker [(Gly4Ser)3], was
purchased from Novagen (USA). M13K07 phage was
employed as helper (Pharmacia).
Phagemids rescue. To rescue phagemids from the
library, 5 ml of 2× TY broth containing 100 mg/ml
ampicillin and 1% glucose (2× TY-AMP-GLU) was
inoculated with 10 µl of Escherichia coli TG1 taken
from the library stock and grown for 3 hrs at 37°C.
The bacteria were spun down, resuspended in 50 ml
of 2× TY broth containing 100 mg/ml ampicillin
(2× TY-AMP), and shaken until A 600 reached 0.5.
The bacteria were inoculated with M13K07 phage
(1×1010 PFU) and incubated for 30 mins at 37°C with-
out shaking. After pelleting the cells were resuspended
in 200 ml of 2× TY broth containing 100 mg/ml ampi-
cillin and 25 mg/ml kanamycin (2× TY-AMP-KAN),
and shaken for 12 hrs at 37°C. Phage particles were
purified and concentrated using polyethylene glycol
and resuspended in 2 ml of distilled water.
Screening of HCV core protein scFv antibody
clones. Delta surface plates (Nalge Nunclon Inter-
national, Denmark) were coated with 1 ml of HCV
core protein (80 µg/ml) per well in a coating buffer
(50 mmol/l carbonate/bicarbonate pH 9.6) overnight
at 4°C. After washing with Tris-borate-saline (TBS),
the plates were incubated in 2% BSA in PBS for 2 hrs
at 37°C (blocking). The washing was repeated and the
purified phage in 2% BSA (1 ml) was added. The
plates were rotated gently for 10 mins, left undis-
turbed for 90 mins at 37°C, and washed 20 times with
PBS with 0.1% Tween 20 and 20 times with PBS. The
bound phage particles were eluted from the plates
with 1 ml of 100 mmol/l triethylamine per plate. The
phage-containing elutate was immediately neutralized
with 0.5 ml of 1.0 mol/l Tris-HCl pH 7.4 and stored at
4°C. The phage was used to infect 10 ml of log-phase
E. coli TG1 plated on TYE-AMP-GLU plates and
grown overnight at 37°C. The colonies were picked
up into 2 ml of TYE-AMP-GLU per colony with 30%
(v/v) glycerol and stored at –20°C. The panning (am-
plification-adsorption-elution) was repeated 5 times,
and 30 phage clones were picked up randomly from
well-isolated colonies on the top-agar plates. Each
clone was grown in 400 µl of 2× TY-AMP-GLU at
37°C overnight. Aliquots (20 µl) of each clone were
transferred to 400 µl of 2×TY-AMP and further cultu-
red until A600 reached 0.5. After adding a helper phage
1
the cultures were incubated at 30°C overnight. To col-
lect samples for ELISA the supernatants after centrifu-
gation at 12,000 r.p.m. for 1 min at 4°C were saved.
Identification of phage clones. Wells of 96-well-
plates were coated overnight with 8 µg HCV core
protein in 100 µl of coating buffer per well. After
blocking for 2 hrs at 37°C 50 µl aliquots of culture
supernatants and 50 µl of 2% BSA were added per
well for 1 hr at 37°C. After washing with 0.05%
Tween 20 in PBS a 1/5000 dilution of horseradish per-
oxidase (HRP)-labeled anti-M13 secondary antibody
was added for 1 hr at 37°C. The plates were washed
with 0.05% Tween 20-PBS and a tetramethylbenzidine
solution was added for 10 mins at 37°C. The reaction
was stopped with H2SO4 and A450 was read.
ELISA. Wells of 96-well-plates were coated over-
night with 8 µg HCV core protein per well in the coat-
ing buffer. After blocking 100 µl aliquots of diluted
(1:50) culture supernatants were added per well for
1 hr at 37°C. The plates were washed and loaded with
the secondary antibody as described above. M13K07
phage served as negative control.
DNA sequencing. Plasmid DNA was prepared
from the culture of a selected positive clone using
Wizard Plus Minipreps DNA Purification System
(Promega) and sequenced in an ABI3700 automated
DNA sequencer (Perkin Elmer).
Expression of soluble HCV core protein scFv
antibody in E. coli. To express the scFv antibody
in soluble E-tagged form the selected clone was
subcloned into the pCANTAB5E expression vector.
Restriction digestion and subsequent 1% agarose gel
electrophoresis confirmed the identity of the recom-
binant pCANTAB5E-scFv vector. Competent E. coli
XL1-Blue was transformed with pCANTAB5E-scFv
and induced with IPTG for 20 hrs. The culture was
centrifuged at 10,000 r.p.m. and the supernatant was
subjected to SDS-PAGE and Western blot analysis.
Western blot analysis. The culture supernatant
was diluted 1:1 with 2× SDS loading buffer, heated
at 100oC for 10 mins, briefly centrifuged again, and
20 µl of the supernatant was used for SDS-PAGE.
After the run the gel was blotted onto a PVDF mem-
brane (Millipore). The blot was blocked with 5%
non-fat dry milk for 2 hrs, incubated with an anti-
E-tag MAb for 1.5 hr and with a secondary HRP-goat
anti-mouse IgG antibody for another 1 hr, and stained
with DAB and hydrogen peroxide.
Immunohistochemistry. Paraffin-embedded liver
tissue slices from patients with positive anti-HCV
antibodies and HCV-RNA. were examined. After de-
activating endogenous hyperoxidase the slices were
submersed in a methanol solution (should be defined)
with 0.5% hydrogen peroxide at room temperature for
50 mins, washed with PBS 3 times, and kept in 5%
1 ScFv antibody against HCV core protein 15

Table I
The complementarity-determining regions (CDRs) and framework regions (FRs) of deduced amino acids sequence
of ScFv against HCV core protein

CDR1 CDR2 CDR3 FR1 FR2 FR3 FR4

H chain GFTFSSY- AISGSGGST- TRTKRF EVQLVESGGGLV- WVRQAPGKGL- RFTISRDNSKNTL- WGQGALVTVSR
AMS YYADSVKG RPGGSLRLSCAAS EWVS YLQMNSLRAEDT
-AVYYCAR
L chain CQGDSL- GKNNRPS NSPDSSG- SELTQDPAVS- WYQQKPGQAP- GIPDRFSGSSSGN- FGGGTKLTVLG
RSYYAS NHVV VALGQTVRIT VLVIY TASLTITGAQAED-
EADYYC

BSA overnight at 4°C. Then the slices were incubated Twenty of these were found positive. Six of these
with the scFv antibody diluted 1:100 for 1 hr at 37°C showed a low cross-reaction with BSA (Fig. 1). One
and overnight at 4°C. A sheep HRP-anti-M13 anti- positive clone with the highest reaction with HCV core
body diluted 1:200 was dropped on tissue prepara- protein and the lowest reaction one with BSA was cho-
tions and left to react for 40 min at 37°C. The prepa- sen for a confirmatory test with restriction digestion.
rations were washed 3 times with PBS, a few drops of The digestion with NcoI and NotI and subsequent gel
a DAB solution (9 mg DAB, 13.5 ml 0.01 M Tris-HCl electrophoresis proved the presence of a 774 bp insert
(pH7.6), 1.5 ml 0.3 % CoCl2, and 15 ml 30% hydrogen corresponding to the scFv antibody gene (Fig. 2).
peroxide) were added. After 10 min at room tempera-
ture the preparations were washed with PBS 3 times
and 1% haematin was used to stain the cell nucleus.
After a standard dehydratation procedure the prepara-
tions were observed under microscope. Negative con-
trols consisted of PBS instead of the scFv antibody
and liver tissue preparations from healthy persons.

Results

Identification of HCV core protein scFv-positive

clones. After five rounds of panning (amplification-
absorption-elution) 60 clones were picked up and
tested for HCV core protein scFv antibody by ELISA.

Fig. 2. Restriction map of plasmid DNA carrying HCV core

protein scFv gene prepared from a single positive clone
by NcoI/NotI digestion.
a, b: DNA fragment with HCV core protein scFv gene;
M: DNA Marker DL2000 (Takara Co., Japan)

Fig. 1. Identification of positive clones. The binding activities
of the phage antibodies from six clones infected by bound phage
particles to coated 8 µg HCV core protein and 20 µg bovine
serum albumin.
a-f: positive clones’ culture supernatant with scFv antibody against
HCV core protein; g: helper M13K07 instead of phage antibodies, used
as negative.
Fig. 3. Western blot analysis of the supernate protein derived
from induced and non-induced E. coli XL1-Blue transformed
by expression vector.
Supernate protein from non-induced E. coli XL1-Blue transformed with
pCANTAB5E-HCV core protein-scFv (lane a) and supernate protein
from induced E. coli XL1-Blue transformed with pCANTAB5E-HCV
core protein-scFv (lane b).
16 Lun Y.-Z. et al.
A
B to detect HCV core antigen in peripheral blood of
Fig. 4. Immunostaining of HCV core protein of different
sections from liver tissues of healthy persons and patients with
chronic hepatitis C, self-made anti-HCV core protein single
chain antibodies used as primary antibody.
A: Immunohistochemistry of HCV core protein of liver tissue from
health person; B: Immunohistochemistry of HCV core protein of liver
tissue from patients with chronic hepatitis C, core protein was detected
in the cytoplasm of some liver cells (arrowhead pointing).
Sequencing of HCV core protein ScFv gene. The
nucleotide sequence of the selected clone was deter-
mined and submitted to GenBank (Acc. No AF271150).
The corresponding amino acid sequence was deduced
and complementarity-determining regions and frame-
work regions were located according to the Kabat
database (Table I).
Expression of HCV core protein scFv in E. coli.
The HCV core protein scFv antibody was expressed
in E. coli and confirmed by Western blot analysis
(Fig. 3). A negative control consisting of E. coli in-
fected with empty vector did not show any specific
protein. These results indicated that the soluble form
of human HCV core protein scFv antibody was suc-
cessfully expressed in this system.
Immunostaining of HCV core protein of liver
tissue sections. Immunostaining of sections of liver
tissues from and 17 patients with chronic hepatitis C
and healthy persons gave positive results in the for-
mer but not latter group (Fig. 4). HCV core pro-
tein was mainly located in the cytomembrane of the
hepatocytes.
1
Discussion
The mature HCV protein is located in the cyto-
plasm of infected cells, in close vicinity to the peri-
nuclear membranes and the endoplasmic reticulum,
where it polymerizes in the presence of genomic RNA
to form viral capsids (Reed and Rice, 2000). The
HCV core protein is highly antigenic, induces spe-
cific cellular and humoral responses, and probably
plays a pivotal role in the pathogenesis of HCV infec-
tion (Lai and Ware, 2000; Nelson et al., 1997). The
availability of an anti-HCV core protein humanized
scFv antibody allowed the development of an ELISA
patients with HCV (Aoyagi et al., 1999). The major
neutralizing epitope of HCV core protein lies within
the first 45 aa of the protein, the major antigenic
segment of core recognized both by murine and
human antibodies. Noticeable, the recognized epitope
(29–37: QIVGGVYLL) has an unusual preponderance
of hydrophobic residues, some of which are buried in
a small hydrophobic core in the nuclear magnetic
resonance structure of the peptide in solution, suggest-
ing that the antibody may induce a structural rearrange-
ment upon recognition (Menez et al., 2003).
Phage libraries are a powerful tool for the selection
of antibodies of important and useful specificities,
particularly for humanized scFv antibodies (Marks
et al., 1991; Hoogenboom et al., 1998; Lamarre and
Talbot, 1997; Rondon and Marasco, 1997). It has
many advantages. First, it is the only method to get
specific antibody by passing the immunization step.
It can mimic the maturation process of human anti-
body in vivo, so that it is possible to obtain a high
affinity antibody from this selection. Second, a scFv
antibody consisting of antigen-binding domains of
heavy and light chain regions of immunoglobin con-
nected by a flexible peptide linker is a small-size mol-
ecule compared with the full-length antibody. If an
antibody library of human origin is used, the selected
antibody is most suitable to human administration and
is potentially applicable to clinical diagnosis and
treatment of both infectious disease and cancer.
Finally, as it contains no Fc fragment, its background
in immunohistological study is very low. In contrast,
a MAb against the recombinant HCV core protein
prepared from hybridomas is of murine origin and
hence immunogenic if used systemically in humans
(Songsivilai et al., 1996). In order to overcome the
disadvantages of an intact MAb applied in vivo and
to offer an antibody with a stable genetic source,
soluble scFv antibodies are currently generated by
advanced recombinant phage antibody technique,
which may provide novel targeting vehicle for diag-
nosis and treatment of diseases.
1 ScFv antibody against HCV core protein
In this study, we succeeded in cloning the HCV
core protein scFv gene by means of the phage display
library technique. The cloned gene was sequenced
and expressed in E. coli. These results illustrate the
feasibility of using the antibody-engineering techno-
logy that may prove useful in the future for diagnos-
tics and therapy of hepatitis C infection.
Literature
Aoyagi K., C. Ohue and K. Iida. 1999. Development of a simple
and highly sensitive enzyme immunoassay for hepatitis C virus
core antigen. J. Clin. Microbiol. 37: 1802–1808.
Armstrong G.L. 2003. Commentary: modeling the epidemio-
logy of hepatitis C and its complications. Int. J. Epidemiol. 32:
725–726.
Canaan-Haden L., M. Ayala and M.E. Fernandez-de-Cossio.
1995. Purification and application of a single-chain Fv antibody
fragment specific to hepatitis B virus surface antigen. Biotechniques
19: 606–612.
Di Bisceglie A.M. 2000. Natural history of hepatitis C: its impact
on clinical management. Hepatology 31: 1014–1018.
Dickson R.C., M. Mizokami and E. Orito. 1999. Quantification
of serum HCV core antigen by a fluorescent enzyme immuno-
assay in liver transplant recipients with recurrent hepatitis C:
clinical and virologic implications. Transplantation. 68: 1512.
Hoogenboom H.R., A.P. de Bruine and S.E. Hufton. 1998.
Anti-body phage display technology and its applications. Immuno-
technology 4: 1–20.
Houghton M., A. Weiner and J. Han. 1991. Molecular biology
of the hepatitis C virus: implications for diagnosis, development,
and control of viral disease. Hepatology 14: 381.
Kittlesen D.J., K.A. Chianese-Bullock and Z.Q. Yao. 2000.
Interaction between complement receptor gC1qR and hepatitis C
virus core protein inhibits T-lymphocyte proliferation. J. Clin.
Investig. 106: 1239–1249.
17
Hagedorn C.H. and C.M. Rice. 2000. The hepatitis C viruses.
Springer-Verlag KG Berlin, Germany.
Lamarre A. and P.J. Talbot. 1997. Characterization of phage-
displayed recombinant anti-idiotypic antibody fragments against
coronavirus neutralizing monoclonal antibodies. Viral. Immunol.
10: 175–182.
Large M.K., D.J. Kittlesen and Y.S. Hahn. 1999. Suppression
of host immune response by the core protein of hepatitis C virus:
possible implications for hepatitis C virus persistence. J. Immunol.
162: 931–938.
Marks J.D., H.R. Hoogenboom and T.P. Bonnert. 1991. By-
immunization human antibodies from V-gene libraries displayed
on phage. J. Mol. Biol. 222: 581–597.
Menez R., M. Bossus and B.H. Muller. 2003. Crystal structure
of a hydrophobic immunodominant antigenic site on hepatitis C
virus core protein complexed to monoclonal antibody 19D9D6.
J. Immunol. 170: 1917–1924.
Nelson D.R., C.G. Marousis and G.L. Davis. 1997. The role of
hepatitis C virus-specific cytotoxic lymphocytes in chronic hepa-
titis C. J. Immunol. 158: 1473–1481.
Reed K.E. and C.M. Rice. 2000. Overview of hepatitis C virus
genome stucture, polyprotein processing, and protein properties.
Curr. Top. Microbiol. Immunol. 242: 55–84.
Rondon U. and W.A. Marasco. 1997. Intracellular antibodies
(intrabodies) for gene therapy of infectious disease. Annu. Rev.
Microbiol. 51: 257–283.
Songsivilai S., T. Dharakul and R. Kunkitti. 1996. Molecular
cloning and expression of hepatitis C virus core protein and pro-
duction of monoclonal antibodies to the recombinant protein.
Asian Pac J Allergy Immunol. 14: 31–41.
Stoll-Keller F., H. Barth and S. Fafi-Kremer. 2009. Deve-
lopment of hepatitis C virus vaccines: challenges and progress.
Expert Rev. Vaccines 8: 333–345.
Tanaka E., C. Ohue and K. Aoyagi. 2000. Evaluation of a new
enzyme immunoassay for hepatitis C virus (HCV) ore antigen
with clinical sensitivity approximating that of genomic amplifi-
cation of HCV RNA. Hepatology 32: 388.
Zhong Y., J. Cheng and S. Shi. 2001. Screening and character-
ization of human phage antibody to hepatitis C core antigen (in
Chinese). Zhonghua Gan Zang Bing Za Zhi 9: 217–219.
18 Lun Y.-Z. et al. 1
Polish Journal of Microbiology
2011, Vol. 60, No 1, 19–26

ORIGINAL PAPER

The Occurrence and Comparative Phenotypic Characteristics

of Staphylococcus spp. from Healthy and Diseased, Household and Shelter Dogs,
Based on Routine Biochemical Diagnostic Methods
ANDRZEJ KASPROWICZ1, ANNA BIA£ECKA1, JOANNA BIA£ECKA1, IZABELA GODZISZ2,
WIES£AW BARABASZ2, OLGA JAWORSKA3, NATALIA MA£ACHOWA4, 5 and JACEK MIÊDZOBRODZKI4*

1 Centre
for Microbiological Research and Autovaccines Ltd., Kraków, Poland
2 Department
of Microbiology, Agricultural University of Kraków, Kraków, Poland
3 Rescue Animal Shelter, Kraków Society for Animal Care, and “Alvet” Veterinary Clinic, Kraków, Poland
4 Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology

Jagiellonian University, Kraków, Poland

5 Laboratory of Human Bacterial Pathogenesis, National Institute of Health, Hamilton, MT, USA

Received 9 September 2010, revised 30 November 2010, accepted 6 December 2010

Abstract

To determine the staphylococcal colonization pattern in healthy and diseased dogs, living in two particular environments, a number of
microbiological samples were taken. Overall, twenty dogs, either healthy or with infected skin lesions, were examined. In each case
bacterial swabs were collected from the nasal mucosa, ear, perineum, lumbo-sacralis triangle, and from the infection sites if such were
present. A total number of 104 isolates representing different staphylococcal species were isolated and identified using routine biochemi-
cal methods applied in diagnostic laboratories. Among 17 isolated staphylococcal species, Staphylococcus intermedius was the most
common species isolated from both healthy or diseased dogs living either in animal shelter or household environments. The pattern of
Staphylococcus sp. colonization differs considerably for animals living in the two tested habitats. In particular, S. aureus MRSA and
MSSA isolates were detected only in infected skin lesion samples from animals that dwelled in the animal shelter. As could be expected,
S. intermedius was found to be a predominant causative agent in canine skin infections. In our study, we demonstrated that S. intermedius
in its carrier-state, inhabits mainly the mucosal membrane of the nasal vestibule. It was also found in the samples taken from the skin, the
lumbo-sacralis triangle and perineum, but was rarely isolated from the ears.

K e y w o r d s: Staphylococcus spp. from dogs, diagnostic, phenotyping, biochemical methods

Introduction healthy dogs. It comprised 40.3% of all isolated strains

and was identified as a resident of the physiological
Staphylococcus species are considered to be one bacterial flora of healthy dogs (Cox et al., 1988; Król,
of the most widespread bacteria found in nature. Bac- 1998). Devriese and DePelsmaecker proved in their
teria that constitute this genus, colonize a number of research that S. intermedius strains were predominantly
domestic animals, including dogs and cats. Usually isolated from nostrils and the rectum region of healthy
they belong to the normal skin flora of these animals dogs (Devriese and DePelsmaecker, 1987). These two
commonly present on skin and mucosal membranes ecological niches were proposed to be the source for
(Stepanovic et al., 2001; Hauschild and Wojcik, 2007). colonization of other areas in healthy dogs by S. inter-
In 1976 Hajek described a new staphylococcal coagu- medius strains (Nagase et al., 2002). Usually occurring
lase-positive species Staphylococcus intermedius in healthy individuals, under favorable conditions
which colonized predominantly the skin and the S. intermedius can cause a variety of infections in dogs
mucosal membrane of the nasal vestibule in dogs and cats (Biberstein et al., 1984, Kim et al., 2005).
(Hajek, 1976). Later studies revealed that S. inter- Dermatitis or inflammation of the skin is caused by
medius was the most frequent species isolated from the diverseness of allergens, irritation and infectious
* Corresponding author: J. Miêdzobrodzki, Dept. of Microbiol., Faculty of Biochem., Biophys. and Biotechnol., Jagiellonian
University, Gronostajowa Str. 7, 30-387 Kraków, Poland; phone: +48-12-664-6371; fax: +48-12-664-6902;
e-mail: jacek.miedzobrodzki@uj.edu.pl
20 Kasprowicz A. et al. 1

factors, or systematic diseases (Hendricks et al., 2002;

Kizerwetter-Œwida et al., 2009). Pyoderma is a type
of dermatitis. It occurs fairly often among dogs. In
pyoderma, either flesh or deep skin infections can be
observed. Commonly in both cases, S. intermedius is
the main causative agent. Infective skin lesions usually
show up in warm, moist and wrinkled skin regions,
where there appear to be propitious conditions for
bacterial colonization and progression of pyoderma
(Allaker et al., 1993; Guardabassi et al., 2004).
Notwithstanding the growing responsibility and
microbiological awareness among dog owners and the
increasing interest for the S. intermedius species among
the veterinary society, this species still has not been
adequately studied. Bearing this in mind, knowledge
of the bacterial flora composition of the dogs skin
would be extremely useful in the epidemiological
study of a variety of a skin infections that occur in dogs.
The main goal of this project was to determine the
similarity, disparity and potential relationship between
the different colonization patterns of the staphylo-
Fig. 1. Characeistics of all examined dogs
coccal species characteristic for healthy and diseased
dogs, living either in a rescue shelter or households.
Commonly the diagnostics of bacterial strains iso- were caused by hypersensitivity, and may have had
lated from dogs are based on phenotypic methods and pus complications. The lesions were not only always
these type of methods were considered in this study exuding with pus or serum-pus, but also painful and
(Miêdzobrodzki et al., 2008). Although based on strongly pruritic. However, there were no immuno-
the fact that some staphylococcal species (S. inter- logical changes, understood as autoaggression, such
medius and S. pseudintermedius) can be distinguished as lupus or pemphigus. There were no spontaneous
almost only by genetic methods, the further intro- bacterial infections either.
duction of genetic based techniques in routine veteri- Swabs were taken from each dog from both the
nary diagnostics is essential (Bannoehr et al., 2009; left and right ear, the nasal vestibule, and perineum, as
Devriese et al., 2009). well as from the back, and in the case of the diseased
dogs, also from the infection site (Fig. 2). All the iso-
lated samples/strains were described in the following
Experimental manner: (i) classification of the etiological agent caus-
ing from skin infections; (ii) characteristic of the iso-
Materials and Methods lated bacterial strain by standard phenotypic methods;

Bacterial strain isolation. Bacterial samples iso-

lated from 20 healthy and diseased dogs were exam-
ined. The examined group of dogs was heterogeneous.
It consisted of 20 mongrels, both male and female that
weighed from 5 to 45 kg. Among the 20 dogs, 12 had
skin lesions and the remaining 8 had none. The dogs
living in an animal shelter had been staying there for
a few weeks up to 3 years. A similar time range was
for the dogs living in household environments. Five out
of 7 sheltered dogs, and 7 out of 13 household dogs
demonstrated skin lesions. In the 8 remaining dogs,
no skin lesions were observed, as shown in Figure 1.
Samples were taken from skin lesions found in
sick dogs as well as from healthy dogs without skin
changes. The samples were collected by a veterinarian.
The material used for research was derived from skin
lesions caused by flea allergy dermatitis. These lesions Fig. 2. Different reservoir sites for staphylococcal strains in dogs
1 Staphylococcus spp. isolated from dogs 21

(iii) correlation between a particular isolation site and Table I

a staphylococcal species. Microbiological samples Distribution of 104 strains of the Staphylococcus species
isolated from dogs were inoculated onto Columbia in all examined dogs
blood (supplemented with 5% sheep blood), Baird- Living environment of examined dogs
Parker and Candida ID agar within 2 hours of isola- total number of bacterial strains (%)
tion. After an incubation period of 48 h at 35°C, Staphylococcus spp.
7 sheltered dogs-45 13 household-59
all colonies were screened and staphylococcal-like strains strains
colonies were isolated and plated on tryptic soy agar S. intermedius 18 (40.0 %) 28 (47.4%)
for 24 h at 35°C. Pure isolates were then used for S. aureus (MSSA) 3 (6.7%) 0
future experiments. A total number of 104 isolates S. aureus (MRSA) 8 (17.8%) 0
was received from 20 examined dogs. S. warneri 0 4 (6.8%)
Microscopic analysis. To confirm the purity iden- S. gallinarum 2 (4.4%) 0
tification of all the 104 isolates to Gram-positive cocci, S. hominis 0 3 (5.1%)
Gram staining was performed (Beveridge, 2001). S. chromogenes 0 5 (8.5%)
Biochemical identification. Throughout the bio- S. epidermidis 0 1 (1.7%)
chemical analysis, two reference strains S. aureus S. haemolyticus 1 (2.2%) 8 (13.5%)
ATCC25933 and S. epidermidis ATCC 12228 were S. lentus 3 (6.7%) 1 (1.7%)
tested alongside the canine isolates. All isolates were S. saprophyticus 1 (2.2%) 0
evaluated for catalase activity and furazolidone resis- S. equorum 3 (6.7%) 1 (1.7%)
tance. Bacterial identification was performed by S. xylosus 1 (2.2%) 5 (8.5%)
a coagulase tube test (Biomed, Poland). Detection of S. cohni 1 (2.2%) 1 (1.7%)
the clumping factor with rabbit plasma was performed S. schleiferi 0 1 (1.7%)
by PASTOREXTM STAPH-PLUS test (BIO-RAD). S. simulans 3 (6.7%) 0
In order to confirm identification of staphylococcal S. lugdunensis 0 1 (1.7%)
species, ID32 STAPH (BioMerieux, Poland) analysis S. sciuri 1 (2.2%) 0
was done (Sasaki et al., 2007a; Weese et al., 2009). Total number of
11 12
staphylococcal species

Results mucosal membrane of the nasal vestibule, from dogs

A total of 104 staphylococcal strains were isolated
from healthy and diseased dogs living in either ani-
mal shelter or households. All strains demonstrated
typical colony growth on blood and Baird-Parker
selective agar. Coagulase-positive staphylococci pro-
duced black, shiny, convex colonies with entire mar-
gins and clear zones with or without an opaque zone
around the colonies.
Phenotypic characteristics of isolated strains.
The free coagulase tube test revealed a positive reac-
tion in 61 strains (59%), whereas no coagulation was
observed in the remaining 43 (41%) strains. Although
the production of the clumping factor was detected in
44 (42%) strains, 57 (55%) did not produce this factor,
and for 3 (3%) strains the results were uncertain. The
PASTOREXTM STAPH-PLUS test showed that only
39 among all strains (37.5%) have the ability to
autoagglutinate. In terms of the ID32 STAPH method,
104 strains were identifiable, Table I. S. intermedius
(46 strains) and S. aureus (11 strains) were the only
two coagulase-positive staphylococcal species isolated
among all the tested canine strains. The remaining
strains belong to the coagulase-negative group.
Domicile and Staphylococcus sp. variety. Table I
presents the rate of occurrence of different staphylo-
coccal species in swabs taken from the skin, ears, and
living in the animal shelter or households. A total of
17 different species belonging to the Staphylococcus
genus were found. Animals living in the shelter carried
11 different species, whereas 12 species were isolated
from dogs living in household conditions. Regardless
of living environments, S. intermedius isolates were
the most common. It accounts for 40% and 47.4% of
all isolated strains, respectively for the animal shelter
and household environment. Based on the obtained
results the difference between staphylococcal profiles
and the various environments that they colonize was
noticeable. Dogs from the animal shelter were carriers
for such staphylococcal species, like S. gallinarum,
S. saprophyticus, and S. simulans that were not isolated
from any animal living in the household environment.
On the other hand, such species as S. warneri, S. ho-
minis, and S. chromogenes, were isolated only from
dogs living in the households. A fact worth noticing
was that 11 S. aureus strains (MSSA and MRSA) were
isolated only from samples obtained from the shelter.
Manifestation of particular staphylococcal species
in samples isolated from the nasal vestibule are shown
in Table II. In the group of 11 isolated species the
most frequent, despite of habitat, was S. intermedius.
Nevertheless, S. intermedius was detected more often
in samples taken from dogs kept in households than
in the animal shelter, 55.5% and 31.6% respectively.
22 Kasprowicz A. et al. 1

Table II Table IV
Staphylococcal strain distribution in the nasal mucosa Staphylococcal strain distribution in the lumbo-sacralis
triangle region
Living environment of examined dogs
total number of bacterial strains (%) Living environment of examined dogs
Staphylococcus spp.
7 sheltered dogs-19 13 household-18 total number of bacterial strains (%)
Staphylococcus spp.
strains strains 7 sheltered dogs-8 13 household-12
S. intermedius 6 (31.6%) 10 (55.5%) strains strains
S. aureus 6 (31.6%) 0 S. intermedius 6 (75.0%) 2 (16.7%)
S. lentus 2 (10.5%) 1 (5.6%) S. aureus 2 (25.0%) 0
S. equorum 2 (10.5%) 0 S. xylosus 0 3 (25.0%)
S. haemolyticus 1 (5.3%) 2 (11.1%) S. haemolyticus 0 2 (16.7%)
S. sciuri 1 (5.3%) 0 S. cohni 0 1 (8.3%)
S. cohni 1 (5.3%) 0 S. schleiferi 0 1 (8.3%)
S. lugdunensis 0 1 (5.6%) S. hominis 0 1 (8.3%)
S. chromogenes 0 1 (5.6%) S. equorum 0 1 (8.3%)
S. xylosus 0 1 (5.6%) S. chromogenes 0 1 (8.3%)
S. warneri 0 2 (11.1%) Total number of
2 8
Total number of staphylococcal species
7 7
staphylococcal species
shared among household and shelter dogs. The fol-
Table III lowing species were detected in swabs taken from the
Staphylococcal strain distribution in the perineum region perineum region of the sheltered animals: S. aureus,
S. saprophyticus, S. gallinarum, S. equorum, S. simu-
Living environment of examined dogs lans, and S. lentus. Subsequently, domestic dogs car-
total number of bacterial strains (%) ried S. hominis, S. warnerii, S. chromogenes, S. haemo-
Staphylococcus spp.
7 sheltered dogs-19 13 household-12 lyticus, and S. epidermidis in the material from the
strains strains same isolation region.
S. intermedius 4 (33.3%) 4 (33.3%) From the lumbo-sacralis triangle region shown in
S. aureus 2 (16.7%) 0 Figure 2, 9 species of Staphylococcus were distin-
S. gallinarum 2 (16.7%) 0 guished, Table IV. In comparison to the samples taken
S. saprophyticus 1 (8.3%) 0 from shelter animals, the dogs living at home were
S. equorum 1 (8.3%) 0 characterized by a broad range of staphylococcal spe-
S. simulans 1 (8.3%) 0 cies, 2 and 8 species respectively. As mentioned
S. lentus 1 (8.3%) 0 above only two species were isolated from the lumbo-
S. hominis 0 2 (16.7%)
sacralis triangle samples from sheltered dogs: S. inter-
S. warneri 0 2 (16.7%)
medius (75%) and S. aureus (25%).
S. chromogenes 0 1 (8.3%)
The above data demonstrated that S. intermedius in
S. haemolyticus 0 2 (16.7%)
carrier-state, predominantly colonized nares of tested
S. epidermidis 0 1 (8.3%)
dogs. Over 50% of all animals, regardless of their
Total number of
staphylococcal species
7 6 living environment, sick or healthy carried strains of
this species in the nasal vestibule. The next preferred
region was the lumbo-sacralis triangle and perineum.
S. aureus strains were isolated mainly from the mucosal S. intermedius, however was isolated more often from
membrane of the nasal vestibule of dogs living in the the sheltered dogs (75%) then from animals living in
shelter in the range of 31.6%. Adjacent to coagulase- households (16.7%), Table IV. In both healthy and
positive species, coagulase-negative staphylococcal diseased dogs, the patterns of colonization were simi-
species were also present in the biological material. lar, as it is shown in Figure 3A and Figure 3B.
While, S. equorum, S. sciuri or S. cohni were found The etiological factor for skin lesions of canine
only in dogs from the shelter, S. lugdunensis, S. chro- origin. The rate of occurrence of different staphylo-
mogenes, S. xylosus or S. warneri were presented in coccal species, isolated from 12 dogs with infection
the samples taken from the animals living at home. sites are listed in Figure 4. The most common species
This should be treated as a trend because the number found in 7 out of 12 examined animals (58.3%) was
of examined dogs was relatively low. S. intermedius. In 5 out of 7 dogs living in households
S. intermedius was also the most prevalent species it was the only staphylococcal species isolated from
among isolates from the perineum region, Table III. the skin lesion. Moreover, 7 additional Staphylococ-
Furthermore, it was the only staphylococcal species cus spp. were isolated, including: methicillin-resistant
1 Staphylococcus spp. isolated from dogs
Body site
Fig. 3A. Distribuion of S. intermedius in the carrier-state
at different body sites in sheltered and household dogs
Body site
Fig. 3B. Distribuion of S. intermedius in the carrier-state
at different body sites in healthy and diseased dogs
S. aureus (MRSA), S. haemolyticus, S. chromogenes,
S. simulans, S. equorum, S. xylosus, and S. cohni which
appeared to be single cases. Staphylococcal species
distribution in diseased dogs was also analyzed based
on habitat, Figure 4. Among the 8 species mentioned
Fig. 4. Distribution of Staphylococcus species found in infected skin lisions of 12 examined dogs
23
earlier, 6 originated from animals living in the shelter
and three from dogs living at home. Evidently, S. inter-
medius was the dominant species in each habitat, nev-
ertheless it was isolated more repeatedly from animals
living in households (71.4% of all animals). A greater
variety of staphylococcal species were found in skin
lesion samples taken from animals living in the shelter,
where S. intermedius occurred in 40% of these animals.
Among these species S. aureus (MRSA), S. simulans,
S. equorum, S. xylosus, and S. cohni were identified. In
skin infections of dogs living in household conditions,
beside S. intermedius strains, only S. haemolyticus,
S. chromogenes were found in skin infections.
Discussion
Normal animal skin is colonized by numerous bac-
terial species, which contribute to the physiological
skin flora. Staphylococcus species are not out num-
bered among this flora. The most typical staphylococ-
cal species isolated from canine skins are S. interme-
dius, S. xylosus, S. sciuri, S. capitis, S. chromogenes
and S. lentus, by Nagase et al. (Nagase et al., 2002).
At the same time other studies show a slightly different
profile of isolated strains from dog skin at carrier-
state: S. intermedius, S. aureus, S. simulans, S. heamo-
lyticus, and S. saprophyticus (Hauschild and Wójcik,
2007). So far not many studies have been done to de-
termine the staphylococcal colonization pattern based
on a specific part of the body or living habitat condi-
tions of the animals from which swabs were taken.
In the recent study we took an effort to characterize
the contribution of the different staphylococcal spe-
cies in the colonization of dogs living in two different
environments: the animal shelter and households. Our
data confirm the general trend that S. intermedius
strains are isolated at a higher rate from dogs that
inhabit households, whereas S. aureus is isolated from
dogs living at the shelter. These differences could be
explained by distinctness in animal exposition to other
24 Kasprowicz A. et al.
animals and people (Talan et al., 1989; Król, 1998).
S. aureus strains isolated during our research, seem
to be an excellent example. The animals from the
shelter living in small closed areas and are in constant
contact with other animals and moreover with the
personnel, who are one of the main carriers of
S. aureus (Kloos and Musselwhite, 1975). Humans
are colonized by MSSA or MRSA by a carriage rate
of 20–40% (Shopsin et al., 2000). These numbers
grow even higher in the case of elderly persons or
hospital personnel, where they can reach up to 90%
(Szewczyk, 2005). Throughout our study, S. aureus
strains were isolated only from dogs living in the
animal shelter and comprise 24.5% of all strains iso-
lated in these animals. Among this group we isolated
both MSSA and MRSA strains.
On the other hand our data confirm, that S. interme-
dius is present in carrier-state in dogs. Isolates of this
species were the most common, regardless of habitat
and dog health conditions. The most favorable place
for bacterial colonization was the mucosal membrane
of nostrils. It was a reservoir for nearly 55% of all
S. intermedius isolates, followed by the lumbo-sacralis
triangle region (almost 30%).
Dermatitis is the most common type of infectious
disease found in dogs (Ackerman, 1994). Dermatoses
have a variety of etiological factors, where some of
them are caused by particular bacterial strains. 90%
of pyoderma in dogs is caused by S. intermedius
strains infection (Craig, 2003), while S. aureus is one
of the causative agents in skin lesions of non-
pyodermal origin (Biberstein et al., 1984). Our data
show that S. intermedius species seem to be the only
species presented in microbiological samples from
infected skin lesions of dogs living in both animal
shelter and household environments. It was isolated
from almost 60% of all diseased animals. Five out of
seven of these dogs had only S. intermedius strains
presented in the infected skin lesion. In the remaining
two cases, S. intermedius strains were accompanied
by other coagulase-negative strains.
The achieved data enriches our knowledge of the
colonization of dogs by not only staphylococcal coagu-
lase-postive strains like S. aureus or S. intermedius
but also by coagulase-negative strains. The presented
results are also important for understanding the epi-
demiology of infectious animal diseases, in which
bacteria from the staphylococcal genus play a crucial
role. In the last few years, a new Staphylococcus spe-
cies – S. pseudintermedius was separated from the
group previously considered to be S. intermedius spe-
cies (Devriese et al., 2005; W³adyka et al., 2008).
S. pseudintermedius can be easily misclassified as
S. intermedius by routine biochemical methods used in
standard diagnostics. Furthermore, it seems that all the
isolates classified in our and other projects by routine
1
biochemical identification tests seem to be S. pseudin-
termedius. Therefore, the final microbiological iden-
tification must require the use of genetic methods
(Sasaki et al., 2007a; Bannoehr et al., 2009).
The number of dogs used in the project was twenty
which was not very high. However they were used to
show whether the similarity in lesions is because of
same etiological factors in diseased dogs (twelve) and
to recognize the staphylococcus species in healthy
dogs at carrier state (eight). The staphylococcal spe-
cies isolated from healthy and diseased dogs were
compared to understand the colonization although
disease was not studied. The main question was, do the
carriage or the life conditions (house/shelter) effect
the occurrence of disease?
The less number of dogs taken in the project re-
sulted from trouble in selection of animals. There were
often abrasions or wounds present on the skin. Only
the dogs with skin lesions were taken for the project.
The idea was that the similarity in skin lesions is
caused by staphylococci, the carriage in same area
and the localization of dogs in environment. Thus the
work was to be done with high precision. Dogs were
taken from one acute shelter hostel and the skin lesions
were clinically evaluated. All the samples were taken
by same veterinary doctor.
Analysis shown in the paper is an introduction on
the general elaboration of carriage phenomenon in dogs
living under different environments (house/shelter)
and of isolated strains from skin lesions in part of dogs
in the population. Thus showing the relation between
diseased to healthy dogs and house to shelter conditions.
A total of one hundred four bacterial strains were
isolated from twenty dogs. Higher species heteroge-
neity was observed among bacteria in dogs from shel-
ter and that this difference did not affect pathology,
which is mainly caused by S. intermedius, indepen-
dent of the living environment of dogs. So the etio-
logical factor can be easily observed among the tested
dogs and the number of dogs used were enough to
give the phenomenon. Authors were interested nei-
ther in the numbers of dogs nor in possessed isolates,
but in observation of differences in colonization and
etiological factors according to dogs’ life environment.
In conclusion, we described the isolation of various
staphylococcal strains which were constituents of the
normal biocenosis of the skin of dogs. We also reported
staphylococci as etiological factors of wound infec-
tions in household or rescue shelter dogs, healthy or
diseased. Our observations enriched by recent reports
by other authors expand the knowledge to be more
precise which brings focus to ecological phenomena
and epidemiological pathways. A carriage pheno-
menon and transient colonization by such strains in
dogs and/or their owners facilitate the transmission of
staphylococci between humans and domestic animals
1 Staphylococcus spp. isolated from dogs
(Simoons-Smit et al., 2000; Nagase et al., 2002) with
a particular share of staphylococci from poultry
(Wieliczko et al., 2002). As it is reported the genomic
similarity of strains isolated in veterinary pathology
is particularly specific (Cuteri et al., 2004, Jakubczak
et al., 2007). The dissemination of methicillin-resis-
tant S. pseudintermedius in various animals and the
confirmed presence of their resistance genes places
them as potentially serious pathogens (Ruscher et al.,
2009). They have to be precisely analysed by a num-
ber of validated and recommended methods (Cuteri
et al., 2004; Ma³achowa et al., 2005). Recently ela-
borated molecular methods should be introduced to
restriction analysis of the chromosomal DNA with the
final aim of increasing the effectiveness in discrimi-
nating closely related strains (Krawczyk et al., 2007;
Black et al., 2009). A need of such an investigation
is additionally enhanced by single reports on human
colonization by S. intermedius (Talan et al., 1989;
Mahoudeau et al., 1997; Kikuchi et al., 2004) as well
as recently reported infections caused by S. pseudin-
termedius (Van Hoovels et al., 2006; Sasaki et al.,
2007b). Thus the elaboration of new procedures and
diagnostic schemes for both veterinary and human
bacteriology are an emerging challenge.
Acknowledgements
The authors thank Miss Ma³gorzata Wójcik from the Jagiello-
nian University for helping prepare this manuscript.
Literature
Ackerman L. 1994. Guide to Skin and Haircoat Problems in
Dogs. Alpine Publications, Loveland CO, pp. 7–19.
Allaker R.P., N. Garrett, L. Kent, W.C. Noble and D.H. Lloyd.
1993. Characterization of Staphylococcus intermedius isolates
from canine pyoderma and from healthy carriers by SDS-Page of
exoproteins, immunoblotting and restriction endonuclease digest
analysis. J. Med. Microbiol. 39: 429–433.
Bannoehr J, Franco A, Iurescia M, Battisti A, Fitzgerald JR.
2009. Molecular diagnostic identification of Staphylococcus
pseudintermedius. J. Clin. Microbiol. 47: 469–71.
Beveridge T.J. 2001. Use of the gram stain in microbiology.
Biotech. Histochem. 76: 111–118.
Biberstein E.L., S.S. Jang and D.C. Hirsh. 1984. Species distri-
bution of coagulase-positive staphylococci in animals. J. Clin.
Microbiol. 19: 610–615.
Black C.C., S.M. Solyman, L.C. Eberlein, D.A. Bemis,
A.M. Woron and S.A. Kania. 2009. Identification of predomi-
nant multilocus type, pulsed-field gel electrophoresis cluster, and
novel staphylococcal chromosomal cassette in clinical isolates of
mecA-containing, methicillin-resistant Staphylococcus pseudin-
termedius. Vet. Microbiol. 139: 333–338.
Cox H.U., J.D. Hoskins, S.S. Newman, C.S. Foi, G.H. Turnwald
and A.F. Roy. 1988. Temporal study of staphylococcal species
on healthy dogs. Am. J. Vet. Res. 49: 747–751.
Craig M. 2003. Diagnosis and Management of Pyoderma in the
Dog. In Practice 25: 418–425.
25
Cuteri V., M.L. Marenzoni, R. Mazzolla, N. Tosti, L. Merletti,
S. Arcioni and C. Valente. 2004. Staphylococcus aureus: study
of genomic similirity of strains isolated in veterinary pathology
using amplified fragment length polymorphism (AFLP). Comp.
Immunol. Microbiol. Infect. Dis. 27: 247–253.
Devriese L.A. and K. DePelsmaecker. 1987. The anal region as
a main carrier site of Staphylococcus intermedius and Streptococ-
cus canis in dogs. Vet. Rec. 121: 302–303.
Devriese L.A., K. Hermans, M. Baele and F. Haesebrouck.
2009. Staphylococcus pseudintermedius versus Staphylococcus
intermedius. Vet. Microbiol. 133: 206–207.
Devriese L.A., M. Vancanney, M. Baele, M. Vaneechoutte,
E. De Graef, C. Snauwaert, I. Cleenwerck, P. Dawyndt,
J. Swings, A. Decostere and F. Haesebrouck. 2005. Staphylo-
coccus pseudintermedius sp. Nov., a coagulase-positive species
from animals. Int. J. Syst. Evol. Microbiol. 55: 1569–1573.
Guardabassi L., M.E. Loeber and A. Jacobson. 2004. Trans-
mission of multiple antimicrobial-resistant Staphylococcus inter-
medius between dogs affected by deep pyoderma and their owners.
Vet. Microbiol. 98: 23–27.
Hajek V. 1976. Staphylococcus intermedius, a new species iso-
lated from animals. Int. J. Syst. Bacteriol. 26: 401–408.
Hauschild T. and A. Wójcik. 2007. Species distribution and
properties of staphylococci from canine dermatitis. Res. Vet. Sci.
82: 1–6.
Hendricks A., H.J. Schuberth, K. Schueler and D. Lloyd. 2002.
Frequency of superantigen-producing Staphylococcus intermedius
isolates from canine pyoderma and proliferation-inducing potential
of superantigens in dogs. Res. Vet. Sci. 73: 273–7.
Jakubczak A., P. Szweda, K. £ukaszewska and J. Kur. 2007.
Molecular typing of Staphylococcus aureus isolated from cows
with mastitis in the east of Poland on the basis of polymorphism of
genes coding protein A and coagulase. Pol. J. Vet. Sci.10: 199–205.
Kikuchi K., T. Karasawa, C. Piao, I. Itoda, H. Hidai,
H. Yamaura, K. Totsuka, T. Morikawa and M.Takayama.
2004. Molecular confirmation of transmission route of Staphylo-
coccus intermedius in mastoid cavity infection from dog saliva.
J. Infect. Chemother. 10: 46–48.
Kim T.J., Y.R. Na and J.I. Lee. 2005. Investigation into the basis
of chloramphenicol and tetracycline resistance in Staphylococcus
intermedius isolates from cases of pyoderma in dogs. J. Vet. Med.
B. Infect. Dis. Vet. Public. Health 52: 119–124.
Kizerwetter-Œwida M., D. Chrobak, M. Rzewuska and M.
Binek. 2009. Antibiotic resistance patterns and occurence of
mecA gene in Staphylococcus intermedius strains of canine origin.
Pol. J. Vet. Sci. 12: 9–13.
Kloos W.E. and M.S. Musselwhite. 1975. Distribution and persis-
tence of Staphylococcus and Micrococcus species and other aero-
bic bacteria on human skin. Appl. Environ. Microbiol. 30: 381–395.
Krawczyk B., J. Leibner, W. Barañska-Rybak, A. Samet,
R. Nowicki and J. Kur. 2007. ADSRRS-fingerprinting and PCR
MP techniques for studies of intraspecies genetic relatedness in
Staphylococcus aureus. J. Microbiol. Meth. 71: 114–122.
Król J. 1998. Characterization of staphylococci isolated from
healthy and infected dogs (in Polish). Zeszyty Naukowe Akademii
Rolniczej, Wroc³aw, Weterynaria LVIII, 344: 17–47.
Mahoudeau I., X. Delabranche, G. Prevost, H. Monteil and
Y. Piemont. 1997. Frequency of isolation of Staphylococcus inter-
medius from humans. J. Clin. Microbiol. 35: 2153–2154.
Ma³achowa N., A. Sabat, M. Gniadkowski, J. Krzysztoñ-
Russjan, J. Empel, J. Miêdzobrodzki, K. Kosowska-Shick,
P.C. Appelbaum and W. Hryniewicz. 2005. Comparison of mul-
tiple-locus variable-number tandem-repeat analysis with pulsed-
field gel electrophoresis, spa typing, and multilocus sequence
26 Kasprowicz A. et al.
typing for clonal characterization of Staphylococcus aureus iso-
lates. J. Clin. Microbiol. 43: 3095–3100.
Miêdzobrodzki J., N. Ma³achowa, T. Markiewski, A. Bia³ecka
and A. Kasprowicz. 2008. Differentiation of Staphylococcus
aureus isolates based on phenotypical characters (in Polish).
Postêpy Hig. Med. Doœw. 62: 322–327.
Nagase N., A. Sasaki, K. Yamashita, A. Shimizu, Y. Wakita,
S. Kitai and J. Kawano. 2002. Isolation and species distribution
of staphylococci from animal and human skin. J. Vet. Med. Sci.
64: 245–250.
Ruscher C., A. Lubke-Becker, C.G. Wleklinski, A. Soba,
L.H. Wieler and B. Walther. 2009. Prevalence of methicillin-
resistant Staphylococcus pseudintermedius isolated from clinical
samples of companion animals and equidaes. Vet. Microbiol. 136:
197–201.
Sasaki T., K. Kikuchi, Y. Tanaka, N. Takahashi, S. Kamata and
K. Hiramatsu. 2007a. Reclassification of phenotypically iden-
tified Staphylococcus intermedius strains. J. Clin. Microbiol. 45:
2770–2778.
Sasaki T., K. Kikuchi, Y. Tanaka, N. Takahashi, S. Kamata
and K. Hiramatsu. 2007b. Methicillin-resistant Staphylococcus
pseudintermedius in a veterinary teaching hospital. J. Clin.
Microbiol. 45: 1118–1125.
Shopsin B., B. Mathema, J. Martinez, E. Ha, M.L. Campo,
A. Fierman, K. Krasinski, J. Kornblum, P. Acabes, M. Wad-
dington, M. Riehman and B.N. Kreiswirth. 2000. Prevalence
of methicillin-resistant and methicillin-susceptible Staphylococcus
aureus in the community. J. Infect. Dis. 182: 359–362.
1
Simoons-Smit A.M., P.H.M. Savelkoul, J. Stoof, T.M. Starink
and C.M.J. Vandenbroucke-Grauls. 2000. Transmission of
Staphylococcus aureus between humans and domestic animals in
a houshold. Eur. J. Clin. Microbiol. Infect. Dis. 19: 150–152.
Stepanovic S., V. Dimitrijevic, D. Vukovic, I. Dakic, B. Savic
and M. Svabic-Vlahovic. 2001. Staphylococcus sciuri as a part
of skin, nasal and oral flora in healthy dogs. Vet. Microbiol. 82:
177–185.
Szewczyk E.M. 2005. Bacteriological diagnostics (in Polish).
Wydawnictwo Naukowe PWN, Warszawa, pp 20–23.
Talan D.A., D. Staatz, A. Staatz and G..D. Overturf. 1989. Fre-
quency of Staphylococcus intermedius as human nasopharyngeal
flora. J. Clin. Microbiol. 27: 2393–2399.
Van Hoovels L., A. Vankeerberghen, A. Boel, K. Van Vaeren-
bergh and H. De Beenhouwer. 2006. First case of Staphylococcus
pseudintermedius infection in a human. J. Clin. Microbiol. 44:
4609–4612.
Weese J.S., R. Poma, F. James, G. Buenviaje, R. Foster and
D. Slavic. 2009. Staphylococcus pseudintermedius necrotizing
fascilitis in a dog. Can. Vet. J. 50: 655–656.
Wieliczko A., J. Król, T. Piasecki, M. Mazurkiewicz and
Z. Staroniewicz. 2002. Occurence and characteristics of staphylo-
cocci isolated from poultry (in Polish). Med. Weter. 58: 348–352.
W³adyka B., M. Biœta, A.J. Sabat, E. Bonar, S. Grzeszczuk,
W. Hryniewicz and A. Dubin. 2008. A novel member of the
thermolysin family, cloning and biochemical characterization of
metalloprotease from Staphylococcus pseudintermedius. Acta
Biochim. Pol. 55: 525–536.
Polish Journal of Microbiology
2011, Vol. 60, No 1, 27–33

ORIGINAL PAPER

Comparison of Different PCR Methods for Detection of Brucella spp.

in Human Blood Samples
HISHAM H. AL-AJLAN, ABDELNASSER S.S. IBRAHIM* and ALI A. AL-SALAMAH

Medical Unit, Department of Botany and Microbiology, Faculty of Science

King Saud University, P.O. 2454, Riyadh 11451, Saudi Arabia

Received 2 July 2010, revised 15 December 2010, accepted 18 December 2010

Abstract

For detection of Brucella species by PCR four DNA extraction methods and four targets were compared using pure culture of Brucella
melitensis and the best conditions were applied in clinical samples. It was found that the MagNA Pure LC method was the most efficient
and sensitive method showing a positive PCR reaction with DNA extracted from as low as 25 and 100 CFU suspended in one ml blood and
one ml water, respectively. Detection of Brucella spp. by conventional PCR was investigated using four different targets. The results
indicated that The B4-B5 amplification method was the most sensitive one as it could amplify DNA extracted from as a low as 25 and
100 CFU/ml suspended in one ml water and blood, respectively. Furthermore real-time PCR was able to detect Brucella using DNA
extracted from as low as 50 CFU/ml blood and 15 CFU/ml water, respectively. The best and optimum detection conditions were applied to
the clinical samples. Evaluation of conventional PCR assays on blood specimens confirmed 72% of the results obtained by conventional
blood culture methods with a specificity of 95%, while serum samples had a sensitivity of 54% and specificity of 100%. Real-time PCR
was generally found to be more sensitive and specific for detecting Brucella spp. in blood and serum samples compared to conventional
PCR. The real-time PCR done on blood specimens confirmed 77.5% of the results obtained by conventional blood culture methods with
specificity of 100%, while 60% of serum samples were found to be positive with specificity of 100%. These results suggest that serum and
blood analysis by conventional and real time PCR is a convenient and safe method for rapid and accurate diagnosis of brucellosis.

K e y w o r d s: Brucella spp., brucellosis, detection, PCR methods for detection

Introduction 2005). In man, infection is associated with protean

Brucellosis is a major zoonotic disease that causes
a serious health and economic problem worldwide
(Elfaki et al., 2005). In spite of the growing number
of countries declared Brucella-free, the disease remains
one of the main zoonotic infections throughout many
parts of the world with major economical and public
health implications. About 500,000 new cases occur
annually worldwide, with predominance in the Middle
East, Mediterranean countries, South America and
Central Asia (Godfroid, 2002; Sauret and Villissova,
2002). The causative organisms of brucellosis are
Gram-negative facultative intracellular pathogens that
may affect a range of different mammals including
man, cattle, sheep, goats, swine, rodents and marine
mammals and in most host species, the disease prima-
rily affects the reproductive system with concomitant
loss in productivity of animals affected (Cutler et al.,
manifestations and characteristically recurrent febrile
episodes that led to the description of this disease as
undulant fever (Abdoel et al., 2008). Currently, the
diagnosis of brucellosis is based on microbiological
and serological laboratory tests. However the diag-
nostic value of serological tests is unsatisfactory in
the early stages of the disease due to low sensitivity,
serological cross-reactions, and the inability to distin-
guish between active and inactive infection due to
antibody persistence after therapy (Diaz and Moriyo,
1989; Navarro et al., 2002). Furthermore in patients
with persistent or relapsing brucellosis, dependance on
blood culture analysis is usually impeded by the low
yield of microorganisms as a result of dormancy of
brucellae in the mononuclear phagocytic cells (Elfaki
et al., 2005). Blood cultures (which represent the ‘gold
standard’ of laboratory diagnosis) are among the most
important tests used for the diagnosis of infectious

* Corresponding author: A.S.S. Ibrahim, Department of Botany and Microbiology, Faculty of Science, King Saud University,
P.O. 2454, Riyadh 11451, Saudi Arabia; phone: +96 6597359415; e-mail: ashebl@ksu.edu.sa
28 Al-Ajlan H.H. et al.
diseases including brucellosis. However, contamina-
tion with skin type flora like coagulase negative
staphylococcus could over grow the slow growing
organisms like Brucella in addition to a serious threat
to laboratory personnel (Yagupsky, 1999; 2004).
Therefore, other diagnostic methods are needed to
overcome such limitations of conventional approaches
for the diagnosis of brucellosis. DNA-based methods
such as gene probes and polymerase chain reaction
(PCR) are attractive means for the confirmation of
brucellosis. Because of the prevalence of brucellosis
in Saudi Arabia, a precise diagnostic method should
be established for the control of brucellae in this
population. Different target genes, primer pairs, PCR
techniques and extraction procedures have been pre-
viously investigated for Brucella detection, however,
most of these assays have used Brucella DNA of pure
cultures and only a few of these primers have been
used in clinical animal, and human samples (Zerva
et al., 2001; Abdoel et al., 2008; Bogdanovich et al.,
2008; Hiniæ et al., 2008) and there is no enough
report about comparison of these assays. Therefore
the aims of the current work were to compare different
DNA extraction method for DNA purification from
Brucella cells, compare different targets and PCR
methods for detection of Brucella and apply it to clini-
cal human samples
Experimental
Material and Methods
Clinical samples and bacterial strains. A total
of 200 clinical blood specimens were collected from
the Armed Forces Hospitals (Riyadh, Saudi Arabia)
including 160 blood samples obtained from patients
with clinically proven or suspected systemic brucel-
losis infection and 40 control samples from healthy
subjects without any clinical evidence or history of
brucellosis. The diagnosis of brucellosis was confirmed
by isolation and identification of Brucella spp. from
blood culture. Blood (8 to 10 ml) was inoculated into
BACTEC Plus aerobic/F blood culture bottle (enriched
soybean-casein digest broth) and incubated for 28 days
or until the bottles were positive. All blood cultures
were evaluated in the BACTEC 9600 blood culture
system (Becton Dickinson Diagnostic Instrument Sys-
tems), which detect microbial growth by continuous
monitoring. One ml aliquots from bottles shown to con-
tain Gram-negative coccobacilli bacteria were removed
and stored at –80°C until use. All isolated strains were
identified in the lab. The reference strain used in this
study was Brucella melitensis 16 M, which was obta-
ined from the Central Veterinary laboratory (Weybridge,
UK). It was propagated on chocolate agar (Oxoid) me-
1
dium and incubated at 37°C in a humidified atmo-
sphere supplemented with 5% CO2. Brain heart infu-
sion broth (Oxoid) with 20% glycerol (Sigma) was
used for the storage of bacterial strains at –80°C.
Preparation of bacterial cells suspensions.
Freshly cultured Brucella melitensis was killed by the
addition of 70% methanol in sterile saline (0.9%
NaCl) and recovered by centrifugation at 5000 rpm
for 5 min, washed twice with 5 ml of sterile distilled
water then recovered by centrifugation at 5000 rpm
for 5 min. The cells were serially diluted with sterile
distilled water and adjusted to a 0.5 McFarland stan-
dard (which is approximately 1.5× 108 CFU/ml). Dif-
ferent cell dilutions were prepared and suspended in
either sterile distilled water or whole blood collected
in EDTA Vacutainer from healthy individual with no
evidence or history of brucellosis infection, to give
a final cell count in the range of 25 to 105 CFU/ml.
The inoculated whole blood samples and cells sus-
pended in water were subsequently used for DNA
extraction. Sterile water inoculated blood samples
served as a negative control.
Bacterial DNA extraction methods. Four differ-
ent DNA extraction kits were used to extract the
genomic DNA of Brucella melitensis according to
the manufacturer instructions including QIAmp kit
(Qiagen), GenomicPrep DNA Isolation Kit (Amersham
Biosciences), Automated Nucleic Acid Purification
system (MagNA Pure LC Systems), in addition to 10%
Chelex-100 resin suspension (Bio-Rad Laboratories)
where 0.2 ml cell suspension was mixed with 0.1 ml of
a 10% Chelex-100 resin suspension (Bio-Rad Labo-
ratories), and the mixture was boiled for 10 min. After
centrifugation at 10000 rpm for 5 min, about 0.1 ml
of supernatant was removed and used for PCR.
Detection of Brucella melitensis by conventional
PCR. The sensitivity of conventional PCR was inves-
tigated for detection of Brucella melitensis using a modi-
fication of previously reported methods (Navarro et al.,
2002; Baddour and Alkhalifa, 2008) using four diffe-
rent primers pairs (TIB MOLBIOL, Berlin, Germany),
specific to four different targets in Brucella spp.
(Table I). The PCR reaction contained (25 µl): reac-
tion buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris
HCl, pH 9.0), 200 µM of each of dATP, dCTP, dGTP,
and dTTP and 2.5 U of puReTaq DNA polymerase
(Amersham-Pharmacia). For optimization of PCR con-
ditions different concentrations of primers (5–25 pmol)
and MgCl2 (1.5–4 mM), amplification at different
temperature settings and cycling programs were used
(Table I). Following PCR reaction, 10 µl of the reac-
tion mixture was mixed with 2 µl of loading buffer
ReddyRun (ABgene) and was run in 2 % agarose gel
electrophoresed in Tris-borate-EDTA buffer (TBE) at
120 V for about 50 min and the amplified DNA bands
were visualized in ethidium bromide staining and
1 Detection of Brucella spp. by different PCR methods 29

photographed under UV light. 100 bp Superladder

F-5-GCGCTCAGGCTGCCGACGCAA-3
gene encoding an outer membrane protein
(ABgene) was used as DNA Marker. Sterile water

R-5-GACGATAGCGTTTC AACTTG-3 R-5-AACCATAGTGTCTCCACTAA-3 R-5-ACCAGCCATTGCGGTCGGTA-3

instead of DNA was used as a negative control.
Detection of Brucella melitensis by Real-time
PCR. Detection of Brucella using Real-time PCR was
investigated using modified of previously reported
JPF-JPR

method (Redkar et al., 2001). The reaction mixture for

the real time contained 2 µl of 10x LightCycler-FastStart
DNA master hybridization probes (Roche Diagnos-
tics), 2.4 µl MgCl2 (final concentration of 4 mM),
4 µl Reagent mix (Brucella-specific primers and
(omp-2)

hybridization probes), and 6.6 µl nucleases free water

193

2.5
60
60
and 5 µl of the tested DNA. Thermocycling conditions
3

were as follows: one cycle of initial denaturation at

F-5-GGTTGTTAAAGGAGAACAGC-3 F-5-TCGAGCGCCCGCAAGGGG-3

95°C for 10 min, followed by 55 amplification cycles

sequence 16S rRNA of B. abortus

(temperature transition rate of 20°C/s), each includ-

ing denaturation (95°C for 10 s), annealing (55°C for
8 s), and extension (72°C for 15 s). Fluorescence was
F4-R2

measured continuously during the slow temperature

rise to monitor the dissociation of the LightCycler Red
Main characteristics of PCR methods used in the study

640-labeled sensor probe at the F2 channel. Water was

used instead of DNA as a negative control.
905

2.5
1.5

54
90

Results

Sensitivity of the DNA extraction methods. Four

Table I

different DNA extraction methods were evaluated for

whole DNA purification from Brucella melitensis.
Serial dilution of Brucella melitensis cells were sus-
ISP1-ISP2

pended in either sterile water or whole blood to give

a final cells count of 25 to 25000 CFU/ml. DNA was
extracted and the purified DNA was used as a tem-
plate for PCR reaction. The sensitivity and efficacy
was measured as the minimum number of CFU
IS6501

required to produce DNA showing a positive PCR.

600

2.5
1.5

56
45

The results for the approximate sensitivity of each

R-5-CGCGCTTGCCTTTC AGGTCTG-3

method are shown in Tables II and III. It was found

gene encoding a 31 kDa Brucella abortus

F-5-TGGCTCGGTTGCCAATATCAA-3

that the MagNA Pure LC method was the most effi-

cient and sensitive method as it showed positive
PCR reaction with DNA extracted from as low as
25 and 100 CFU suspended in one ml blood and
B4-B5

Table II
Sensitivities of different DNA extraction methods.
Serial dilution of the Brucella melitensis cells was prepared
in one ml blood. Total DNA was extracted using different
1.5, 2.5, 4

methods and the purified DNA was used as template in PCR

antigen
223

2.5
60
60

DNA extraction Count of Brucella cells (CFU/ml blood)

Taq polymerase (IU)

Methods 25000 6000 800 400 200 100 50 25

MgCl2 conc. (mM)

Extension time (s)

PCR conditions:
Characteristic

Product size (bp)

Primer sequence

MagNA Pure LC + + + + + + – –
Annealing temp

QIAmp silica column + + + + – – – –

PCR target

GenomicPrep Blood + + + + + – – –
Chelex resin – – – – – – – –

+: Positive PCR, –: Negative PC

30 Al-Ajlan H.H. et al. 1

one ml water respectively, followed by GenomicPrep
Blood method and QIAmp silica column purification
method respectively (Table II and III). However none
of the extracted DNA using Chelex resin was able
to give positive PCR reaction. Based on these results
the MagNA Pure LC method was selected for further
analysis.
Detection of Brucella by conventional and real
time PCR. Detection of Brucella melitensis by con-
ventional PCR was investigated using four different
targets. The results presented in Table IV and V and
Figure 1 indicated that the B4-B5 amplification
method was the most sensitive as it could amplify
DNA extracted from as low as 25 and 100 CFU/ml
suspended in one ml water and blood, respectively,
followed by ISP1-ISP2 and F4-R2, respectively.
However, none of the bacterial DNA from whole
blood or water gave a positive PCR using the JPR-
JPF method. Based on these results the B4-B5 method
was used in analysis of the clinical samples. The sen-
sitivity of the real-time PCR was determined using
Brucella specific probes. The reaction was carried out
using DNA extracted from serial dilution of bacterial
cells suspended in blood and water. Real-time PCR
was able to detect Brucella using DNA extracted from
as low as 50 and 15 CFU suspended in one ml blood
and water respectively (Fig. 2).
Clinical samples. During the study period, 200
clinical blood specimens (160 patients and 40 con-
trols) were tested for brucellosis by blood culture, op-
timum conventional PCR and real-time PCR. Among
the 160 clinical samples tested, 89 specimens were

Fig. 1. Sensitivity of PCR using different targets for detection of Brucella sp.
Using B4-B5 and DNA extracted from and DNA extracted from serial dilutions of cells suspended in Blood (A) and water (B).
Using ISP1-ISP2 and DNA extracted from serial dilutions cells suspended in blood (C) and water (D). Using F4-R2 and DNA extracted
from cells suspended blood (E) and water (F). Lane 1: 100 bp Marker, 2: Negative control, 3: 25,000 CFU/ml, 4:6,000 CFU/ml,
5: 800 CFU/ml, 6: 400: CFU/ml, 7: 200 CFU/ml, 8: 100 CFU/ml, 9: 50 CFU/ml and 10: 25 CFU/ml
1 Detection of Brucella spp. by different PCR methods 31

Fig. 2. Detection of Brucella by real time PCR

Fluorescence is plotted against number of PCR cycles to monitor amplification of different cells counts Brucella suspended in blood (A)
and water (B) 1: 800 CFU/ml, 2: 200 CFU/ml, 3:100 CFU/ml, 4: 50 CFU/ml, 5–25 CFU/ml, 6:15 CFU/ml, 7&8: Negative control

blood culture positive for Brucella and 71 were nega-
tive but 9 of them were positive for other bacteria (six
coagulase negative staphylococci, one Staphylococ-
cus aureus, one Klebsiella spp. and one Acinatobacter
spp). One of the blood culture positive for coagulase
Table III
Sensitivities of different DNA extraction methods.
Serial dilution of the Brucella melitensis cells was prepared
in one ml water. Total DNA was extracted using different
methods and the purified DNA was used as template in PCR
negative staphylococcus (detection after 33 h) was
positive for Brucella by conventional PCR and light
cycler PCR in blood, negative in serum and negative
by blood culture. DNA was extracted from the
89 blood samples (which were found to be positive for
Brucella by blood culture) and detection was carried
Table IV
Sensitivities of four PCR methods for detection of Brucella
suspended in blood determined by amplifying the DNA
extracted from different cells dilutions

DNA extraction Count of Brucella cells (CFU/ml water) Count of Brucella cells (CFU/ml blood)
Methods
Methods 25000 6000 800 400 200 100 50 25 25000 6000 800 400 200 100 50 25
MagNA Pure LC + + + + + + + + B4-B5 + + + + + + – –
QIAmp silica column + + + + + + – – ISP1-ISP2 + + + + + – – –
GenomicPrep Blood + + + + + + + – F4-R2 + + + – – – – –
Chelex + + + – – – – – JPF-JPR – – – – – – – –

+: Positive PCR, –: Negative PC +: Positive PCR, –: Negative PC

32 Al-Ajlan H.H. et al. 1

Table V method should be established for the control of bru-

Sensitivities of four PCR methods for detection of Brucella cellae in this population (Elfaki et al., 2005). PCR
suspended in water specimens determined by amplifying the offers an alternative choice over the conventionally
DNA extracted from the dilution series
available methods for an accurate diagnosis of bru-
Count of Brucella cells (CFU/ml water)
cellosis. However, sufficient nucleic with removal of
Methods inhibitory substances is essential for optimal detection
25000 6000 800 400 200 100 50 25
of the microbial pathogens by PCR. The aim of this
B4-B5 + + + + + + + +
study was to optimize the DNA extraction and PCR
ISP1-ISP2 + + + + + + – –
conditions for detection of Brucella spp. and apply
F4-R2 + + + + + – – –
the optimum conditions in the clinical samples and
JPF-JPR – – – – – – – –
compare it with blood culture approach. Therefore
+: Positive PCR, –: Negative PC four different DNA extraction methods were evaluated
to purify total DNA from Brucella melitensis. Although
Table VI blood is known to possess substances inhibitory to
Detection of Brucella in blood and serum samples PCR, the DNA purification methods used in this study
by conventional PCR in comparison to blood culture method
(except chelex resin method) were successful in elimi-
Specimen Positive False pos. Sensitivity Specificity
nating these inhibitors, the most sensitive and efficient
one being the MagNA Pure LC method showing posi-
Blood Culture 89 (89) 0 (40) 100% 100%
tive PCR reaction with DNA extracted from as low as
Blood 64 (89) 2 (40) 72% 95%
25 and 100 CFU suspended in one ml blood and one
Serum 48 (89) 0 (40) 54% 100%
ml water respectively. The detection of bacterial DNA
in blood specimens by PCR usually requires sensitive
Table VII DNA amplifying method with sensitive primers and
Detection of Brucella spp. in blood and serum samples optimized PCR conditions because of the presence of
by real-time PCR in comparison to blood culture method
human DNA and inhibitors in blood (Bricker, 2002;
Specimen Positive False pos. Sensitivity Specificity Bogdanovich et al., 2004). With the aim of finding
Blood culture 89 (89) 0 (40) 100% 100%
the most efficient and sensitive methods for detection
Blood 69 (89) 0 (40) 77.5% 100%
of Brucella DNA in blood specimens, four DNA
amplifying methods were evaluated using four prim-
Serum 54 (89) 0 (40) 60 % 100%
ers pairs including B4-B5, ISP1-ISP2, F4-R2 and
JPF-JPR. The results indicated that the detection limit
out using optimum conditions of conventional PCR varied between 25 to 800 CFU/ml, depending on the
and real-time PCR. The results of conventional PCR amplifying method (except JPF-JPR method). The
showed that 64 out of 89 blood samples and 2 of B4-B5 amplification method was the most sensitive
the 40 control samples (5%) were positive. In addi- one as it could amplify DNA extracted from as a low
tion, 48 of the 89 serum samples were positive and as 25 and 100 CFU/ml suspended in one ml water and
none of the control samples were positive. The sensi- blood respectively, followed by ISP1-ISP2 and F4-R2,
tivities of PCR detection in blood, serum and blood respectively. This result is consistent with that pre-
culture were 72, 54 and 100%, respectively, and viously reported by Elfeki et al. (2005) where PCR
the specificities were 95, 100, 100% respectively using primers B4-B5 was the most sensitive one for
(Table VI). The results of detection of Brucella spp. detection of Brucella spp. However in another study
using real-time PCR are shown in Table VII. It was by Navarro et al. (2002) for comparison of three PCR
found that 69 out of 89 blood samples were positive methods for detection of Brucella, F4/R2 was the
and 54 of the 89 serum samples (60%) were positive most sensitive primers. Furthermore the sensitivity of
and none of the control samples were positive. The the real-time PCR was determined using Brucella spe-
sensitivities for blood, serum and blood culture were cific probes. The reaction was carried out using DNA
77.5, 60 and 100% with specificities of 100, 100, extracted from serial dilution of bacterial cells sus-
100%, respectively. pended in blood and water. Real-time PCR was even
more sensitive than conventional PCR as it was able
to detect Brucella spp. using DNA extracted from as
Discussion low as 50 CFU /ml blood 15 CFU/ml water.
The best DNA extraction method was used to ex-
An accurate diagnosis of brucellosis is very im- tract DNA from the clinical samples and optimum
portant for treatment, control and eradication of bru- conventional PCR conditions, RT-PCR and blood
cellae and due to the prevalence of brucellosis in culture were compared for detection of Brucella spp.
Saudi Arabia, an efficient and sensitive diagnostic in the clinical blood samples. It was found that 72%
1 Detection of Brucella spp. by different PCR methods
and 54% of the positive blood culture was detected
by PCR with specificity of 95% and 54% in blood and
serum, respectively. The use of PCR for the detection
of Brucella DNA in blood samples of certain groups of
patients with brucellosis has been previously studied
with sensitivity in the range of 50% to 100% (Mattar
et al., 1996; Navarro et al., 1999; Zerva et al., 2001).
Several systems of real-time PCR have been devel-
oped. They are user-friendly, rapid, and free of con-
tamination. Moreover, these PCRs overcome the con-
ventional PCR by allowing quantification of the
targeted copies in the specimen (Newby et al., 2003;
Probert et al., 2004). Evaluation of the real-time PCR
for detection of Brucella spp. in the clinical blood
samples showed excellent specificity and good sensi-
tivity. The real-time PCR confirmed 77.5% of the
results obtained with the blood culture assays with
specificity of 100%. In this study it appears that the
real-time PCR has greater sensitivity and specificity
than conventional PCR.
Conclusions. In conclusion comparison of blood
culture, conventional PCR conditions and RT-PCR
for detection for detection of Brucella spp. in the clini-
cal blood samples indicated that PCR amplification
technology is promising method for the detection of
Brucella in clinical samples with high sensitivity and
specificity close to that reported by conventional
blood culture. Although the PCR detection of Bru-
cella spp. using peripheral blood is not without diffi-
culties, it presents considerable advantages. Compared
to standard bacteriological methods, the PCR assays
are safer and more rapid to perform. Therefore, these
assays may be important diagnostic tools to detect
Brucella spp.
Acknowledgment
This work was financially supported by Deanship of Scien-
tific Research, King Saud University. The authors are gratefully
acknowledged for this support
Literature
Abdoel T., I.T. Dias, R. Cardoso and H.L. Smit. 2008. Simple
and rapid field tests for brucellosis in livestock. Vet. Microbiol.
130: 312–319.
Baddour M.M. and D.H. Alkhalifa. 2008. Evaluation of three
polymerase chain reaction techniques for detection of Brucella
DNA in peripheral human blood. Can. J. Microbiol. 54: 352–357.
33
Bogdanovich T., M. Skurnik, P.S. Lubeck, P. Ahrens and
J. Hoorfar. 2004. Validated 5’ nuclease PCR assay for rapid
identification of the genus Brucella. J. Clin. Microbiol. 42:
2261–2263.
Bricker B.J. 2002. PCR as a diagnostic tool for brucellosis. Vet.
Microbiol. 90: 435–446.
Cutler S.J., A.M. Whatmore and N.J. Commander. 2005. Bru-
cellosis – new aspects of an old disease. J. Appl. Microbiol. 98:
1270–128.1
Diaz R. and I. Moriyo. 1989. Laboratory techniques in the diag-
nosis of human brucellosis. In: Brucellosis: Clinical and Labora-
tory Aspects (Young, E.J. and Corbel, M.J., Eds.), pp. 73–83. CRC
Press, Boca Raton, FL.
Elfaki M.G., T. Uz-Zamana, A.A. Al-Hokailb and S.M.
Nakeeba. 2005. Detection of brucella DNA in sera from patients
with brucellosis by polymerase chain reaction. Diagnos. Microbiol.
and Infect. Dis. 53: 1–7.
Godfroid J. 2002. Brucellosis in Wildlife. Rev. Sci. Tech. Int.
Epiz. 21: 277–286.
Hiniæ V., I. Brodard, A. Thomann, Ž. Cvetniæ, P.V. Makaya,
J. Frey and C. Abril. 2008. Novel identification and differen-
tiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis,
and B. neotomae suitable for both conventional and real-time PCR
systems. J. Microbiol. Methods. 75: 375–378.
Mattar G.M., I.A. Khneisser and A.M. Abdelnoor. 1996. Rapid
laboratory confirmation of human brucellosis by PCR analysis of
a target sequence on the 31-Kilodalton Brucella antigen DNA.
J. Clin. Microbiol. 34: 477–478.
Navarro E., J. Escribano, J.A. Fernandez and J. Solera.
2002. Comparison of three different PCR methods for detection
of Brucella spp. in human blood samples. FEMS Immun. Med.
Microbiol. 34: 147–151.
Navarro E., J.A. Fernandez and J. Solera. 1999. PCR assay for
diagnosis of human brucellosis. J. Clin. Microbiol. 37: 1654–1655.
Newby D.T., T.L. Hadfield and F.F Roberto. 2003. Real-time
PCR detection of Brucella abortus: a comparative study of SYBR
Green I, 5’-exonuclase, and hybridization probe assays. Appl.
Environ. Microbiol. 69: 4753–4759.
Probert W.S., K.N. Schrader, N.Y. Khuong, S.L. Bystrom and
M.H. Graves. 2004. Real time multiplex PCR assay for detection
of Brucella spp., B. abortus, and B. melitensis. J. Clin. Microbiol.
42: 1290–1293.
Redkar R., S. Rose, B. Bricker and V. Del Vecchio. 2001. Real-
time detection of Brucella abortus, Brucella melitensis and Bru-
cella suis. Mol. Cell. Prob. 15: 43 52
Sauret J.M. and N. Villissova. 2002. Human brucellosis. J. Am.
Board. Pract. 15: 401–406.
Yagupsky P. 1999. Detection of Brucella in blood cultures. J. Clin.
Microbiol. 37: 3437–3342
Yugupsky P. 2004. Use of the BACTEC MYCO/F LYTIC me-
dium for detection of Brucella melitensis bacteremia. J. Clin.
Microbiol. 42: 2207–2208.
Zerva L., K. Bourantas, S. Mitka, A. Kansouzidou and
N.J. Legakis. 2001. Serum is the preferred clinical specimen for
diagnosis of human brucellosis by PCR. J. Clin. Microbiol. 39:
1661–1664.
34 Al-Ajlan H.H. et al. 1
Polish Journal of Microbiology
2011, Vol. 60, No 1, 35–41

ORIGINAL PAPER

Antibiofilm Activity of Selected Plant Essential Oils

and their Major Components
ALEKSANDRA BUDZYÑSKA1, MARZENA WIÊCKOWSKA-SZAKIEL1, BEATA SADOWSKA1,
DANUTA KALEMBA2 and BARBARA RÓ¯ALSKA1*

1 Institute of Microbiology, Biotechnology and Immunology, University of £ódŸ, Poland

2 Institute of General Food Chemistry, Technical University of £ódŸ, Poland

Received 14 October 2010, accepted 15 December 2010

Abstract

The aim of the study was to examine the antibiofilm activity of selected essential oils (EO): Lavandula angustifolia (LEO), Melaleuca
alternifolia (TTO), Melissa officinalis (MEO) and some of their major constituents: linalool, linalyl acetate, "-terpineol, terpinen-4-ol.
Biofilms were formed by Staphylococcus aureus ATCC 29213 and Escherichia coli NCTC 8196 on the surface of medical biomaterials
(urinary catheter, infusion tube and surgical mesh). TTC reduction assay was used for the evaluation of mature biofilm eradication from
these surfaces. Moreover, time-dependent eradication of biofilms preformed in polystyrene 96-well culture microplates was examined and
expressed as minimal biofilm eradication concentration (evaluated by MTT reduction assay). TTO, "-terpineol and terpinen-4-ol as well
as MEO, showed stronger anti-biofilm activity than LEO and linalool or linalyl acetate. Among the biomaterials tested, surgical mesh was
the surface most prone to persistent colonization since biofilms formed on it, both by S. aureus and E. coli, were difficult to destroy. The
killing rate studies of S. aureus biofilm treated with TTO, LEO, MEO and some of their constituents revealed that partial (50%) destruction
of 24-h-old biofilms (MBEC50) was achieved by the concentration 4–8× MIC after 1 h, whereas 2–4× MIC was enough to obtain 90%
reduction in biomass metabolic activity (MBEC90) after just 4 h of treatment. A similar dose-dependent effect was observed for E. coli
biofilm which, however, was more susceptible to the action of phytochemicals than the biofilms of S. aureus. It is noteworthy that an
evident decrease in biofilm cells metabolic activity does not always lead to their total destruction and eradication.

K e y w o r d s: biofilm eradication, biomaterial-associated infections, essential oils

Introduction Thus, the search for alternative therapies is a necessity

A frequent complication while using artificial de-
vices in medical practice (BAI, biomaterial-associated
infections) are infections dependent on microbial ad-
hesion and biofilm formation. They should be con-
sidered a serious health problem requiring a rapid
solution. Very often BAI are a consequence of direct
biomaterial contamination during implantation but
they can also be caused by haematogenous spread of
bacteria from an infection site anywhere within the
human body. A similar medical problem is posed by
wound-associated chronic infections, which are also
often characterized as having a biofilm nature. The
biofilm mode of growth results in an increased bac-
terial resistance against classical antimicrobial treat-
ment and host immune factors (Bryers, 2008; James
et al., 2008; Dai et al., 2010; Hoiby et al., 2010).
and using, for example, natural plant/animal products
and/or their combinations with antibiotics or synthetic
counterparts seems to be one of the promising solu-
tions (Dürig et al., 2010).
Higher plants evolved through developing mecha-
nisms for avoiding the effects of microbial attack based
on the production of protective substances, usually
their secondary metabolites. Compounds with strong
bacteriostatic or bactericidal activity belong mostly to
phytoalexins and, within this group, essential oils are
the most important members (Gibbons, 2008). Essen-
tial oils are complex mixtures of chemical substances,
at least one of which shows antimicrobial activity.
They consist mainly of monoterpenes, sesquiterpenes,
diterpenes and other aromatic or aliphatic compounds
(Kalemba and Kunicka, 2003; Bakkali et al., 2008;
Reichling et al., 2009). Essential oils of several plants

* Corresponding author: B. Ró¿alska, Department of Immunology and Infectious Biology, Institute of Microbiology, Biotechno-
logy and Immunology, University of £ódŸ; Banacha 12/16, 90-237 £ódŸ, Poland; e-mail: rozab@biol.uni.lodz.pl
36 Budzyñska A. et al.
are widely used in ethnomedicine for their antimicro-
bial and anti-inflammatory properties but their anti-
biofilm activity has not been so far studied extensively
(Carson et al., 2006; Fabian et al., 2006; Cavanagh
and Wilkinson, 2002; Karpanen et al., 2008; Warnke
et al., 2006; Chao et al., 2008; Gursoy et al., 2009;
Hossainzadegan and Delfan, 2009).
Essential oils derived from Melaleuca alternifolia,
Lavandula angustifolia, Melissa officinalis and their
major constituents were selected for the present study.
Tea tree oil (TTO) is an essential oil from the leaves
of the Australian M. alternifolia tree, a member of the
botanical family Myrtaceae. The oil from the leaves
is used medicinally, being effective against bacterial,
viral and fungal organisms as well as having immuno-
stimulatory activity. It is also known that it can allevi-
ate inflammation and may help wound healing (Carson
et al., 2006). Essential oils distilled from members of
the genus Lavandula have been applied both cosmeti-
cally and therapeutically for centuries with the most
commonly used species being L. angustifolia, L. lati-
folia, L. stoechas and L. intermedia. The claims made
for lavender oil include its antibacterial, antifungal,
smooth muscle relaxing, sedative, antidepressive prop-
erties (Cavanagh and Wilkinson, 2002; Roller et al.,
2009). Melissa is commonly used in Europe as a tea,
liquid extract, and topical preparation. Melissa essen-
tial oil (lemon balm) is also a common antibacterial
and antifungal agent (Mimica-Dukic et al., 2004).
The attention of our study was focused on the pos-
sibility of using essential oils in the fight against
biofilms of two members of the “alert” pathogens
group. These were Gram-positive staphylococci, Sta-
phylococcus aureus and Gram-negative enteric bacte-
ria – Escherichia coli, since the epidemiological data
on the incidence of infection with their participation
sound serious. Moreover, these strains were chosen
because the known differences in the cell wall struc-
tures between Gram-positive and Gram-negative bac-
teria imply the extent of their susceptibility to various
antimicrobial agents (Gibbons, 2008; Fabian et al.,
2006; Chao et al., 2008).
Experimental
Materials and Methods
Biomaterials, bacteria, phytochemicals. The
following biomaterials/culture surfaces were used:
short term urine drainage catheter of Nelaton type
(Bicakcilar, Turkey), infusion tube (Polfa Lublin,
Poland) (both 0.5 cm in length); surgical mesh sup-
port for muscle/fascia (Tricomed, £ódŸ, Poland)
(0.5×0.5 cm); 96-well polystyrene tissue culture micro-
plates (Nunc, Denmark). Eradication of Staphylococ-
1
cus aureus ATCC 29213 and Escherichia coli NCTC
8196 biofilms by essential oils (EO) and some of their
main components was evaluated. There were oils of
Melaleuca alternifolia (tea tree oil, TTO), Lavandula
angustifolia (lavender essential oil, LEO), Melissa
officinalis (Melissa essential oil, MEO or lemon balm)
and "-terpineol, terpinen-4-ol, linalool, linalyl acetate.
All essential oils were purchased from Pollena Aroma,
Poland and the isolated compounds of EO were pur-
chased from SAFC, USA, via Sigma, USA.
Evaluation of bacterial susceptibility to essential
oils and their major constituents. MIC (minimal
inhibitory concentration) of phytochemicals was de-
termined by the standard CLSI (Clinical Laboratory
Standards Institute) microdilution method, with minor
modifications (Budzyñska et al., 2009). Essential oils/
components were initially diluted in 96% ethanol
(1:1 v/v), and later in Mueller-Hinton Broth (MHB,
Sigma) with 0.5% Tween 20 (Sigma). The tested con-
centrations of phytochemicals (range 6.75–0.024%)
were deposited in triplicate, in a volume of 100 µl
in the wells of flat-bottomed polystyrene 96-well
microplates (Nunc, Denmark). Then, 100 µl of bacte-
rial suspension with a density of 106/ml in MHB/0.5%
Tween 20 was added to each well. The positive control
was a suspension of bacteria in 200 µl of MHB/0.5%
Tween 20, and a negative control was the medium
without bacteria. After 24 h incubation at 37°C, the
absorbance at A600 (Victor 2, Wallac, Finland) was
determined. The concentration at which the A600 of the
wells did not exceed the value of absorbance of the
control medium was accepted as the MIC. The lowest
concentration of essential oils/components, bactericidal
to ≥ 99.9% of the original inoculum (MBC, minimal
bactericidal concentration) was determined from broth
dilution MIC tests, by subculturing 100 µl (from the
wells of MIC, 2× MIC, 4× MIC, 8× MIC) to the broth
medium without any antimicrobial agents. No visible
growth after subsequent 24 h incubation means MBC
on condition that the concentration is not higher than
the 4-fold value of MIC. Antimicrobial substances
– oxacillin and ofloxacin (Sigma, USA) were accep-
ted as a reference.
Surface colonization and biofilm eradication.
Fragments of biomaterials (three pieces of each type)
were incubated with bacterial suspension in tryptic soy
broth (TSB) supplemented with glucose (TSB/0.25%
Glc) for 24 h at 37°C. Colonized surfaces, after their
washing with phosphate-buffered saline (PBS), were
transferred to the wells of a 96-well tissue culture
microplate containing dilutions of essential oils/com-
ponents and were incubated for the next 24 h at 37°C.
Then, biomaterial fragments were rinsed with PBS
and transferred to a new 96-well microplate contain-
ing TSB with 1% TTC (2,3,5-triphenyltetrazolium
chloride) for 24 h incubation at 37°C, as previously
1 Antibiofilm activity of plant essential oils
described (Ró¿alska et al., 1998). TTC is a redox
indicator used to differentiate between metabolically
active and inactive cells; the colorless compound is
enzymatically reduced to red TPF (1,3,5-triphenylfor-
mazan) in living cells due to the activity of various
dehydrogenases. The presence/reduction of biofilm
biomass was evaluated by comparing the color inten-
sity of biofilm deposit on biomaterials treated and un-
treated with phytochemicals, according to arbitrarily
fixed scale (4+, 3+, 2+, 1+, –). The experiments were
performed twice to confirm reproducibility of the results.
The results of the semi-quantitative method were
compared with those of a standard biomass quantifica-
tion method by CFU determination. The fragments of
colonized biomaterials treated with phytochemicals,
which were scored by TTC assay as (+) and (–), were
removed from the wells and rinsed in PBS. Then, they
were placed in 1 ml of sterile broth medium and the
remaining bacterial deposit was removed by ultra-
sonic disruption for 5 min. One hundred µl of the
sonicate was spread onto two agar plates for overnight
incubation and CFU counting.
Time-dependent biofilm eradication. Time-de-
pendent inhibitory concentration of phytochemicals
for biofilms preformed in a polystyrene 96-well cul-
ture microplate, used at concentrations from MIC to
8× MIC was determined. Mature (24-h old) biofilms
of S. aureus ATCC 29213 and E. coli NCTC 8196
were exposed to the action of essential oils/compo-
nents for 1, 4, 6 and 24 h co-incubation at 37°C. The
essential oils/components concentrations causing
50% or at least 90% reduction in biomass metabolic
activity (MBEC50 and MBEC90) at each time point
were determined using MTT-reduction assay, as de-
scribed earlier (Walencka et al., 2005; 2007). MBEC50
means that A550 of the sample dropped below the half
value of the positive control (A550 = 1.5) and MBEC90
means that A550 of the sample was close to the value of
the negative control (A550 = 0.2). To avoid interference
between the phytochemical’s red-ox potency and MTT,
before its application, the fluid above the biofilm was
aspirated and removed. In this assay, pale-yellow MTT
(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide) is reduced to purple formazan by living,
respiratory active cells. A solubilizer was added to
dissolve the formed formazan product into a colored
solution whose absorbance was quantified (550 nm
(Victor 2, Wallac, Finland). The experiments were
performed in duplicate to confirm reproducibility of the
results. Mean A550 ± S.D. values were presented.
Evaluation of viability of bacterial cells treated
with essential oils. The potential effect of essential
oil on bacterial cell membranes was assessed using
EO-mediated SYTO 9 and propidium iodide uptake
(LIVE/DEAD BacLight Bacterial Viability kit, Mole-
cular Probes, Invitrogen, Poland). Cell suspensions of
37
S. aureus ATCC 29213 and E. coli NCTC 8196 in
PBS (1.0× 106 CFU/ml) were incubated with 4× MIC,
2× MIC or MIC) of EO at 37°C for 4 h, with shaking.
After the incubation, the bacteria were washed with
5 ml sterile PBS and stained using the LIVE/DEAD
kit, according to the manufacturer’s recommenda-
tions. The cells with LIVE/DEAD and no EO served
as negative controls. After the incubation all the
samples were washed and resuspended in PBS, and
a drop of each suspension was examined with a con-
focal scanning laser microscope for green/red fluo-
rescence to visualize SYTO 9 and propidium iodide,
respectively. Six areas of each of the triplicate samples
were photographed with an integrated Hamamatsu digi-
tal camera (C4742–95; Nikon UK).
Results
The minimal inhibitory concentration (MIC) of
selected essential oils and their major constituents was
determined using the broth microdilution method and
defined as the lowest concentration able to inhibit
visible microbial growth. The essential oil of Melaleuca
alternifolia (TTO), "-terpineol and terpinen-4-ol, as
well as the essential oil of Melissa officinalis (MEO),
showed stronger antibacterial activity than the essen-
tial oil of Lavandula angustifolia (LEO) and its major
components, such as linalool and linalyl acetate. Their
MICs values against Staphylococcus aureus and Esche-
richia coli are presented in Table I. The experiments
performed to check whether the tested phytochemi-
cals are bactericidal showed that MBC values did not
exceed the obligatory 4 x MIC, since more than
99% of the bacterial inoculum was killed even by
MIC or 2× MIC. One exception was the S. aureus
culture which was killed by 8× MIC of linalool – one
of the components from the lavender and melissa
essential oils. The data on this set of experiments are
presented in Table I.
The answer to the question whether TTO, LEO,
MEO are bacteriostatic or bactericidal was also provi-
ded by the experiments for EO-mediated SYTO 9/PI
uptake, evaluated by fluorescent confocal microscopy.
As assessed by the emission of green/red fluorescence,
non-treated S. aureus or E. coli cells, showed only
green fluorescence (live with undamaged cell wall),
except for very few red cells. However, EO-treated
cells exhibited increased uptake of propidium iodide
(leaking cell wall and membrane), proportional to the
increase in the compound concentration. All bacterial
cells from planktonic cultures treated with EO at the
concentration of 2–4 MIC, exhibited red fluorescence
(data not shown).
In the further experiments, essential oils/compounds
were shown to possess the bactericidal activity against
38 Budzyñska A. et al. 1

Fig. 1. Time- and concentration-dependent effect of essential oils on biofilm viability, determined by MTT-reduction assay.
A1, A2, A3 (S. aureus), B1, B2, B3 (E. coli) biofilms exposed to tea tree oil (A1, B1), lavender oil (A2, B2), or lemon balm (A3, B3).
A550 mean ± S.D.

mature S. aureus and E. coli biofilms formed earlier
on the surface of polystyrene culture microplate wells.
The time-dependent inhibitory concentration of phyto-
chemicals for biofilms preformed in the polystyrene
96-well culture microplate was determined by MTT
reduction assay. All biocides were used for this pur-
pose at MIC up to 8× MIC. There was only a small
difference between planktonic and biofilm biocidal
concentrations, usually not exceeding 2–4-fold higher
values. Killing rate studies of S. aureus biofilm eradi-
cation by TTO and its constituents revealed that par-
tial (50%) destruction of 24-h-old biofilms (MBEC50)
1 Antibiofilm activity of plant essential oils 39

Table I
Bacteriostatic and bactericidal activity of essential oils/consituents against planktonic
and biofilm cultures of Staphylococcus aureus and Escherichia coli

Essential MIC (planktonic), MBC (planktonic) MBEC90 (4 hours), MBEC90 (24 hours),
Bacteria
oil/component % v/v % v/v % v/v % v/v
TTO S. aureus 0.39 0.78 0.78 0.78
E. coli 0.19 0.19 0.19 0.19
"-terpineol S. aureus 0.19 0.78 0.38 0.38
E. coli 0.097 0.097 0.19 0.19
Terpinen-4-ol S. aureus 0.19 0.78 0.19 0.19
E. coli 0.048 0.19 0.097 0.048
LEO S. aureus 0.78 1.56* 1.56 1.56
E. coli 0.19 0.19 0.19 0.19
Linalool S. aureus 0.19 1.56 0.78 0.78
E. coli 0.097 0.39 0.78 0.19
Linalyl acet. S. aureus 0.19 0.78 >1.56 0.19
E. coli 0.19 0.19 >1.56 0.19
MEO S. aureus 0.097 0.19 >0.78 0.38
E. coli 0.048 0.097 0.19 0.19
TTO – Tea Tree oil (Melaleuca alternifolia); LEO – lavender oil (Lavandula angustifolia)
MEO – Lemon balm oil (Melissa officinalis); MIC – minimal inhibitory concentration
MBC – minimal bactericidal concentration, value not exceded 4× MIC;
* – exception linalool which is not bactericidal for S. aureus, MBC = 8× MIC
MBEC90 – minimal biofilm eradication concentration causing ≥ 90% reduction of biomass
metabolic activity, measured after 4 or 24 h of compounds application on the biofilm culture

was achieved by the concentration of 4–8× MIC just LEO, "-terpineol, linalool, linalyl acetate) was neces-
after 1 h, whereas 2× MIC was enough to obtain TTO sary to achieve such an effect on the surface of surgical
MBEC90 after 4 h of treatment. Effective MBEC90 of mesh. In all cases it was proved that indeed TTC score
LEO and its constituents was as high as 4–8× MIC. (–) means that the lack of metabolically active cells is
The time-dependent activity of MEO was comparable equal to the lack of viable bacteria, since the CFU
to TTO. With few exceptions, the tested phytochemi- counting method used for the measurement of biofilm
cals reduced the metabolic activity of bacterial cells survival showed its total eradication (data not shown).
in biofilms after 24 h exposure at concentrations close Our study leads to the conclusion that essential oils
to MICs. A similar dose- and time-dependent effect and some of their major constituents are able to effi-
was observed for E. coli biofilm, however, surprisingly, ciently reduce biofilms of both S. aureus and E. coli on
it was more susceptible to the action of phytochemicals biomaterial surfaces. However, a satisfactory effect is
than the S. aureus biofilms, similarly to what was ob- strongly dependent on the surface structure and pro-
served for planktonic cultures. (Table I, Fig. 1). perties. The example of TTO antibiofilm activity is
Among the medical biomaterials tested, surgical presented in Fig. 2.
mesh was the surface most prone to persistent coloni-
zation, since biofilms formed on it by both bacterial
strains were more difficult to eradicate by the tested
compounds. Modified Richard’s method was used
to detect the presence or eradication of biofilm, as
described earlier (Ró¿alska et al., 1998). The obtained
visual results scored by TTC assay as (+) and (–),
were compared with the data from the standard biom-
ass quantification method by bacterial dislodgement
and CFU determination. Only TTO and terpinen-4-ol
used at MIC – 2× MIC caused visible biofilm eradi-
cation (TTC reduction) from the surface of urological
catheter and infusion tube, evaluated later as greater Fig. 2. Image of infusion tube colonized by S. aureus biofilm:
A, B – treated for 24 h with TTO, respectively at MIC or ½ MIC.
than 90% decrease in the number of live bacteria
C(+) – not treated positive control, C(–) – not colonized negative control.
(CFU). However, the use of higher concentrations TTC-reduction assay – scored according to an arbitrarily fixed scale as
(4–8× MIC) of these and other compounds (MEO, described in Material and Methods.
40 Budzyñska A. et al.
Discussion
In the present study, the in vitro strong effects of
Melaleuca alternifolia (TTO), Lavandula angustifolia
(LEO), Melissa officinalis (MEO) essential oils and
some of their main constituents ("-terpineol, terpinen-
4-ol, linalool, linalyl acetate) on the biofilms of Gram-
positive S. aureus and Gram-negative E. coli were
shown. Remarkably, the in vitro activity of the oils
against the biofilm of both strains tested was equal to
or only slightly lower than that against bacterial
planktonic culture (Table I). This is worth emphasizing
because the biofilm resistance to classical chemothera-
peutics is typically 100–1000 times higher (Bryers,
2008, Hoiby et al., 2010). It is a promising observation
since plant-derived compounds have gained a general
interest in the search to identify alternatives for the
control of infections, especially those connected with
the use of artificial medical devices. Research on this
topic is focused on natural or synthetic substances,
which have potent broad-spectrum microbicidal and
antibiofilm activities and pose a low risk for the de-
velopment of resistance. It is accepted that there are
two main reasons why essential oils do not create
resistant strains of bacteria: they are complex and
comprise numerous compounds in variable propor-
tions depending on the plant chemotype. Hence, even
if bacteria did figure out an oil’s effective compo-
nents, they would have to start all over with the next
set (Bakkali et al., 2008; Reichling et al., 2009).
In the present study we demonstrated that essen-
tial oils, not only of M. alternifolia well known in
this respect from other studies (Brady et al., 2006;
Kwieciñski et al., 2009; Karpanen et al., 2008), but
also of M. officinalis and L. angustifolia have anti-
biofilm potency. According to our knowledge, this is
the first report concerning such activity of MEO and
LEO. Both S. aureus and E. coli biofilms were eradi-
cated efficiently by MEO. However, this effect was
more time-dependent than the activity of TTO and
LEO. The antibacterial, antifungal and antioxidant
properties of M. officinalis essential oil, but not anti-
biofilm activity, have been earlier described. The main
constituents of MEO are citrals (geranial + neral,
39.9%), citronellal (13.7%), limonene (2.2%), geraniol
(3.4%), $-caryophyllene (4.6%), $-caryophyllene oxide
(1.7%), and germacrene D (2.4%) (Mimica-Dukic
et al., 2004). Our further research will be devoted to
examining the activity of individual components.
However, it is also possible that they can be more
active when they are in their natural proportions in
the native oil. The main chemical components of lav-
ender oil – the second active in our experiments are
a-pinene, limonene, 1,8-cineole, cis-ocimene, trans-
ocimene, 3-octanone, camphor, linalool, linalyl acetate,
caryophyllene, terpinen-4-ol and lavendulyl acetate
1
(Roller et al., 2009; Cavanagh and Wilkinson, 2002).
Three of these components linalool, linalyl acetate,
terpinen-4-ol were tested for antibiofilm activity since
they are also major constituents of active TTO. Among
them, terpinen-4-ol seems to have the most potent acti-
vity, causing more than 90% reduction in biofilm
metabolic activity (MBEC90) after just 4 h of exposure.
Our results on TTO antibiofilm activity are slightly
different from those published by Brady et al. (2006).
The authors showed that biofilms formed by MSSA
and MRSA isolates were completely eradicated fol-
lowing an exposure to 5% TTO for 1 h. In our study,
S. aureus biofilm was also eradicated in such a short
time but only by 66%. However, the concentration of
TTO used was much lower – 3.1% (8× MIC). On the
other hand, total eradication of S. aureus biofilm was
achieved not earlier than after 4 h but the concentration
of TTO needed for that was only 0.78% (2× MIC).
Similarly to our results, TTO activity against S. aureus
biofilms was reported by Kwieciñski et al. (2009).
Usually plant-derived compounds show consider-
able activity against Gram-positive bacteria but not
against Gram-negative species or yeast, which have
evolved significant permeability barriers (Bakkali
et al., 2008; Gibbons, 2008; Reichling et al., 2009;
Amalradjou et al., 2010). Thus, it is worth empha-
sizing that in our experiments the Gram-negative
bacteria were very susceptible to damage by all the
essential oils used. For example, the potent and very
fast antibiofilm activity of TTO was noticed for
E. coli which was eradicated within 1 h exposure
to concentration 0.78%.
It is noteworthy that the evident decrease in bio-
film cells metabolic activity measured by MTT-reduc-
tion assay (biofilms in microplate wells), is not equal
to their total destruction and eradication from the sur-
face of the real medical biomaterials. We, like some
other authors, have defined a drug concentration re-
sulting in ≥ 90 biomass reduction measured by MTT
staining as the MBEC (minimal biofilm eradication
concentration). This method indeed has shown excel-
lent applicability as it is able to detect dose-dependent
and time-dependent differences in the effect of anti-
microbials. But, contrary to other investigators, we
have not found a strong correlation between the amount
of biofilm mass exposed to essential oils, quantified
with TTC staining on medical biomaterials and the
metabolic activity quantified with MTT in the wells
of microplate. A great advantage of the TTC reduc-
tion method is the fact that the metabolic reduction of
colorless TTC into red-colored formazan by bacteria
adhering to the surface of a synthetic implant occurs
regardless of the type, shape or color of the biomate-
rial. However, this method is only semi-quantitative
and requires confirmation using a more objective
evaluation method, which was done in our study. This
1 Antibiofilm activity of plant essential oils
suggests that research on given compound’s antibiofilm
activity should be conducted using simultaneously at
least two independent methods. It is well known that
the growth conditions and the type of surface may
affect the architecture of a biofilm which can influ-
ence the cells sensitivity to antimicrobial agents
(Bryers, 2008; Flemming et al., 2009; Hoiby et al.,
2010). However, our results encourage the explora-
tion of the other essential oils and their constituents
showing the most potent antibiofilm activity since
the oils used in this study have superior antimicrobial
activity in S. aureus and E. coli biofilms, compared
with conventional antibiotics.
Literature
Amalaradjou M.A.R., A. Narayanan, S.A. Baskaran and
K. Venkitanarayanan. 2010. Antibiofilm effect of trans-cinnamal-
dehyde on uropathogenic Escherichia coli. J. Urology. 184:
358–363.
Bakkali F., S. Averbeck, D. Averbeck and M. Idaomar. 2008.
Biological efects of essential oils – A review. Food Chem. Toxicol.
46: 446–475.
Brady A., R. Loughlin, D. Gilpin, P. Paddy Kearney and
M. Tunney. 2006. In vitro activity of tea-tree oil against clinical
skin isolates of meticillin-resistant and -sensitive Staphylococcus
aureus and coagulase-negative staphylococci growing planktoni-
cally and as biofilms. J. Med. Microbiol. 55: 1375–1380.
Bryers J.D. 2008. Medical biofilms. Biotechnol. Bioeng. 100: 1–17.
Budzyñska A., M. Wiêckowska-Szakiel, D. Kalemba, B. Sadow-
ska and B. Ró¿alska. 2009. The optimization of methods utilized
for testing the antibacterial activity of essential oils (in Polish).
Med. Doœw. Mikrobiol. 61: 281–281.
Carson C.F., K.A. Hammer and T.V. Riley. 2006. Melaleuca
alternifolia (Tea Tree) oil: a review of antimicrobial and other
medicinal properties. Clin. Microbiol. Rev. 19: 50–62.
Cavanagh H.M.A. and J.M. Wilkinson. 2002. Biological acti-
vities of lavender essential oil. Phytotherapy Res. 16: 301–308.
Chao S., G. Young, C. Oberg and K. Nakaoka. 2008. Inhibition
of methicillin-resistant Staphylococus aureus (MRSA) by essential
oils. Flavour and Fragrance J. 23: 444–449.
Dai T., Y-Y. Huang, K.S. Sharma, T.J. Hashmi, B.D. Kurup
and R.M. Hamblin. 2010. Topical antimicrobials for burn wound
infections. Recent Patents on Anti-Infective Drug Discovery 5:
124–151.
Dürig A., I. Kouskoumvekaki, R.M. Vejborg and P. Klemm.
2010. Chemoinformatics-assisted development of new antibiofilm
compounds. Appl. Microbiol. Biotechnol. 87: 309–317.
Fabian D., M. Sabol, K. Domaracka and D. Bujnakova. 2006.
Essential oils – their antimicrobial activity against Escherichia
coli and effect on intestinal cell viability. Toxicology in vitro 20:
1435–1445.
41
Flemming K., C. Klingenberg, J.P. Cavanagh, M. Sletteng,
W. Stensen, J.S. Svendsen and T. Flægstad. 2009. High in vitro
antimicrobial activity of synthetic antimicrobial peptidomimetics
against staphylococcal biofilms. J. Antimicrob. Chemother. 63:
136–145.
Gibbons S. 2008. Phytochemicals for bacterial resistance – strengths,
weaknesses and opportunities. Planta Med. 74: 594–602.
Gursoy U.K., M. Gursoy, O.V. Gursoy, L. Cakmakci,
E. Kononen and V-J. Uitt. 2009. Antibiofilm properties of
Satureja hortensis L. essential oil against periodontal pathogens.
Anaerobe, 15: 164–167.
Hoiby N., T. Bjarnsholt, M. Givskov, S. Molin and O. Ciofu.
2010. Antibiotic resistance of bacterial biofilm. Int. J. Antimicrob.
Agents 35: 322–332.
Hossainzadegan H. and Delfan B. 2009. Evaluation of antibiofilm
activity of dentol. Acta Med. Iranica. 47: 35–40.
James G.A., E. Swogger, R. Wolcott, E. Pulcini, P. Secor,
J. Sestrich, J.W. Costerton and P.S. Stewart. 2008. Biofilms in
chronic wounds. Wound Repair Regen. 16: 37–44.
Kalemba D. and A. Kunicka. 2003. Antibacterial and antifungal
properties of essential oils. Curr. Med. Chem. 10: 813–29.
Karpanen T.J., T. Worthington, E.R. Hendry, B.R. Conway
and P.A. Lambert. 2008. Antimicrobial efficacy of chlorhexidine
digluconate alone and in combination with eucalyptus oil, tea tree
oil and thymol against planktonic and biofilm cultures of Staphylo-
coccus epidermidis. J. Antimicrob. Chemother. 62, 1031–1036.
Kwieciñski J., S. Eick and K. Wójcik. 2009. Effects of tea tree
(Melaleuca alternifolia) oil on Staphylococcus aureus in biofilms
and stationary growth phase. Int. J. Antimicrob. 33: 343–347.
Mimica-Dukic N., B. Bozin, M. Sokovic, and N. Simin. 2004.
Antimicrobial and antioxidant activities of Melissa officinalis L.
(Lamiaceae) essential oil. J. Agric. Food Chem. 52: 2485–2489.
Reichling J., P. Schnitzler, U. Suschke and R. Saller. 2009.
Essential oils of aromatic plants with antibacterial, antifungal,
antiviral, and cytotoxic properties – an overview. Forsch Komple-
mentmed. 16: 79–90.
Roller S., N. Ernest and J. Buckle. 2009. The antimicrobial acti-
vity of high-necrodane and other lavender oils on methicillin-sen-
sitive and -resistant Staphylococcus aureus (MSSA and MRSA).
J. Altern. Complement Med. 15: 275–279.
Ró¿alska B., B. Sadowska, M. Wiêckowska and W. Rudnicka.
1998. Detection of biomaterial-associated bacterial biofilm (in
Polish). Med. Doœw. Mikrobiol. 50: 115–122.
Walencka E., B. Sadowska, S. Ró¿alska, W. Hryniewicz and
B. Ró¿alska. 2005. Lysostaphin as a potential therapeutic agent
for staphylococcal biofilm eradication. Pol. J. Microbiol. 54:
191–200.
Walencka E., S. Ró¿alska, H. Wysokiñska, M. Ró¿alski,
£. KuŸma and B. Ró¿alska. 2007. Salvipisone and aethiopinone
from Salvia sclarea hairy roots modulate staphylococcal antibiotic
resistance and express antibiofilm activity. Planta Med. 73: 545–551.
Warnke P.H., E. Sherry, P.A.J. Russo, Y. Acil, J. Wiltfang,
S. Sivananthan, M. Sprengel, J.C. Roldan, S. Schubert,
J.P. Bredee and others. 2006. Antibacterial essential oils in malo-
dorous cancer patients: Clinical observations in 30 patients. Phyto-
medicine 13: 463–467.
42 Budzyñska A. et al. 1
Polish Journal of Microbiology
2011, Vol. 60, No 1, 43–49

ORIGINAL PAPER

Competitiveness of Rhizobium leguminosarum bv. trifolii Strains

in Mixed Inoculation of Clover (Trifolium pratense)
JERZY WIELBO*, MONIKA MAREK-KOZACZUK, DOMINIKA KIDAJ
and ANNA SKORUPSKA

Department of Genetics and Microbiology, Maria Curie-Sk³odowska University

Lublin, Poland

Received 10 April 2010, revised 10 January 2011, accepted 14 January 2011

Abstract

Rhizobium leguminosarum bv. trifolii (Rlt) establishes beneficial root nodule symbiosis with clover. Twenty Rlt strains differentially
marked with antibiotic-resistance markers were investigated in terms of their competitiveness and plant growth promotion in mixed
inoculation of clover in laboratory experiments. The results showed that the studied strains essentially differed in competition ability.
These differences seem not to be dependent on bacterial multiplication in the vicinity of roots, but rather on complex physiological traits
that affect competitiveness. The most remarkable result of this study is that almost half of the total number of the sampled nodules was
colonized by more than one strain. The data suggest that multi-strain model of nodule colonization is common in Rhizobium-legume
symbiosis and reflects the diversity of rhizobial population living in the rhizosphere

K e y w o r d s: clover growth promotion, competitiveness, mixed inoculation, rhizobia

Introduction its host (reviewed by, Perret et al., 2000; Spaink,

Biological nitrogen fixation (BNF) is a process in
which atmospheric dinitrogen is reduced to forms
available to plants and is provided by free-living bacte-
ria or bacteria symbiotically associated with legumi-
nous plants, commonly known as rhizobia. Rhizobia
belong to different taxonomic families of "-proteobac-
teria such as Rhizobiaceae, Phylobacteriaceae and
Bradyrhizobiaceae, and to $-proteobacteria such as
the recently described Burkholderia spp. (reviewed
by Perret et al., 2000; Masson-Boivin et al., 2009).
Significance of rhizobial symbioses in agriculture
stems from providing an extra source of nitrogen for
plant growth, supplementing low nitrogen level in the
soil and replacing nitrogenous fertilizer (Peoples
et al., 1995; Ramos et al., 2001).
Rhizobium leguminosarum bv. trifolii (Rlt) induces
and colonizes nodules elicited on roots of clover
(Trifolium spp.). The symbiosis between rhizobia and
legumes is a multi-step process including the exchange
of molecular signals between the microsymbiont and
2000; Jones et al., 2007). Initially, flavonoids released
by plants attract bacteria to the roots and induce syn-
thesis of bacterial Nod factors that are lipochitooligo-
saccharide signals that trigger several plant responses,
such as root hair curling and differentiation of plant
meristems leading to the formation of root nodules.
Nodules are colonized by rhizobia via tubular struc-
tures known as infection threads in which rhizobia mul-
tiply. After releasing from infection threads bacteria
surrounded by peribacteroid membranes colonize nod-
ule tissue forming symbiosomes in which bacteria are
converted into bacteroids. Bacteroids localized in the
symbiotic zone of mature nodules reduce atmospheric
dinitrogen into forms, which are easily assimilated by
plants (Vasse et al., 1990; Timmers et al., 2000).
Competition for nodulation is a quantitative pheno-
type, which determines the ability of Rhizobium strains
to dominate in the nodules of a given legume host in
competition with other strains present in the root rhizo-
sphere (Dowling and Broughton, 1986). Soil popula-
tions of Rhizobium usually consist of numerous strains,

* Corresponding author: J. Wielbo, Department of Genetics and Microbiology, Maria Curie-Sk³odowska University,
Akademicka 19 st., 20-033 Lublin, Poland; e-mail: jerzy.wielbo@poczta.umcs.lublin.pl
44 Wielbo J. et al.
which compete with each other during the phase of
vegetative growth in the soil, as well as during several
stages of plant colonization and nodule formation
(Wilson et al., 1998; Stuurman et al., 2000; Duodu
et al., 2009). Rhizobial strains are genetically and meta-
bolically diverse, reveal significant differentiation in
competitive fitness to infect and occupy nodule of the
host plant and differ in the symbiotic activities (Maier
and Triplett, 1996; Wielbo et al., 2007; Depret and
Laguerre, 2008). To investigate the competition be-
tween rhizobial strains, numerous molecular markers
were developed and employed. Spontaneous or ac-
quired antibiotic resistance markers are commonly
used due to feasibility of detection and a broad differ-
entiation allowing simultaneous identification a num-
ber of strains (Sharma et al., 1991; Cresswell et al.,
1994; Sessitsch et al., 1998; Wilson et al., 1998;
Stuurman et al., 2000).
In this work, we investigated the competition abil-
ity of 20 Rlt strains originating from clover root nod-
ules under laboratory conditions. The results showed
that in most cases simultaneous inoculation of plants
with a mixture of rhizobial strains carrying different
antibiotic resistance markers resulted in nodule colo-
nization by more than one strain. The commonly ob-
served nodule colonization by multiple strains that
differ in respect to the efficiency of plant growth
promotion may have significant impact on overall
symbiosis in the soil.
Experimental
Materials and Methods
Rhizobium leguminosarum bv. trifolii strains.
20 Rlt strains used in this study were obtained from
nodules of clover (Trifolium pratense) cultivated in
arable sandy loam soil in the region of Lublin, Poland.
Rifampicin, streptomycin and trimethoprim-resistant
spontaneous mutants were obtained as follow: from
overnight cultures of Rlt isolates grown in liquid
TY medium (Sambrook et al., 1989) with constant
shaking, about 5× 109 cfu/ml of the given culture was
plated on TY agar medium supplemented with
rifampicin, streptomycin or trimethoprim (40 µg/ml,
200 µg/ml, 200 µg/ml, respectively). Single colonies
resistant to appropriate antibiotic were isolated. Nali-
dixic acid for selection of naturally resistant strains
was used in the concentration of 150 µg/ml. Tetra-
cycline resistant Rlt strains were obtained by intro-
ducing pJBA21Tc plasmid via triparental conjugation
(Wielbo and Skorupska, 2001). Each of 20 strains was
resistant to one of the following antibiotics: rifam-
picin, streptomycin, tetracycline, trimethoprim and
nalidixic acid (Table I).
1
Table I
Relevant characteristics of Rhizobium leguminosarum bv.
trifolii strains used in this study
Group I Group II Group III Group IV Group V
K416 Tm R
K417 Rf R
K38 Rf R
K29 Tc R
K313 TcR
K411 RfR K108 TmR K413 NalR K87 StrR K312 StrR
K36 StrR KO17 TcR KO18 TcR K322 NalR K415 RfR
KO27 TcR K71 StrR K91 StrR K810 Rf R K107 TmR
The spontaneous mutants were isolated in the case of RfR – rifampicin
resistance, StrR – streptomycin resistance and TmR – trimethoprim
resistance. TcR – tetracycline resistant strains were obtained by intro-
ducing pJBA21Tc plasmid. NalR – natural nalidixic acid resistance.
Plant tests. Red clover seeds (Trifolium pratense
L. cv. Dajana) were surface-sterilized, germinated on
TY agar medium, and then transferred onto agar slants
with nitrogen-free Fåhraeus medium (Vincent, 1970).
Clover seedlings were inoculated with 200 µl single
strain suspension in water, which was scratched from
TY agar medium plate, or with 200 µl mixture of four
strains differently tagged with antibiotic-resistance
marker (1:1:1:1 v/v). In both cases the bacterial sus-
pensions contained about 1.0×109 cfu/ml. Plants were
grown in a greenhouse under natural light supple-
mented with artificial light (14 h day/10 h night, at
24/19°C). After 5 weeks, clover plants were harvested
and nodules were counted. The efficiency of symbiotic
nitrogen fixation was estimated by weighing fresh
mass of shoots and roots. For each experimental group
20 plants were used and two independent experiments
were conducted.
Estimation of rhizobial competitiveness. Ten clo-
ver plants were randomly chosen from each experi-
mental group inoculated with a mixture of four strains
and wet masses of shoots and roots were estimated.
Root nodules were surface-sterilized and the content
of individual nodules was plated on TY agar medium.
Colonies derived from individual nodules were used
for preparation of water suspension an OD550 of 0.05
(~ 5× 107 cfu/ml). 20 µl of each suspension was spot-
ted on a set of TY agar medium plates containing one
of four antibiotics, depending on antibiotic resistance
markers carried by strains in a particular mixture.
Bacteria were grown for three days at 28°C. Detect-
able growth on only one plate from a set was inter-
preted as the presence of pure culture in the nodule,
whereas the growth on more than one plate from a set
was interpreted as mixed colonization of nodule.
Rhizobial growth assay. 5 ml Fåhraeus medium
supplemented with appropriate amount of TY me-
dium was inoculated with 50 µl of overnight culture
of Rlt strains growing in TY medium, and incubated
for 2 days at 28°C. Bacterial growth was measured
by monitoring OD550. For all tested strains the experi-
ment was conducted in triplicate.
1 Competitiveness of Rhizobium leguminisarum strains
Results
To study nodulation competitiveness, twenty Rlt
strains were divided into five groups (I–V). Strains
were assigned to groups randomly, and four strains
belonging to the same group differed from each other
with respect to the antibiotic resistance markers they
were carrying (Table I). Clover seedlings were inocu-
lated with individual strains or with a mixture of four
strains belonging to a given group. After 5 weeks,
samples of nodules were taken and rhizobia were re-
covered from nodules by selection on TY medium
supplemented with an appropriate antibiotic. In the
case of groups II, III and V, all four strains used for
clover inoculation were recovered from the nodules,
whereas in the case of groups I and IV, three of four
strains used for inoculation were found in the sampled
nodules. For Rlt strains assigned to a given group
the “relative competition ratio” (RCR) was calculated
as follow: (a) the number of nodules occupied by the
Fig. 2. Distribution of nodules infected by one, two or three strains in particular groups of R. leguminosarum bv. trifolii strains.
45
Fig. 1. Competition ability of R. legumino-
sarum bv. trifolii strains in the mixed inocu-
lation of clover measured as relative compe-
tition ratio (RCR) (see Results). RCR equal 1
– number of nodules colonized by strain
most rarely found in the sampled nodules of
a given group (I–V).
least frequently found strain was normalized to 1;
(b) RCR for the three other strains were calculated by
dividing the number of nodules colonized by a par-
ticular strain by the number of nodules occupied by
the least frequent strain; (c) if a strain was absent
in all tested nodules, the RCR was 0 (Fig. 1A, B, C,
D, E). As regards their high “relative competition
value”, K411 (group I), K417, K71 (group II), K38,
K413 (group III), K87 (group IV) and K415 (group
V) strains can be considered competitive. On the other
hand, KO27 and K810 strains were not recovered
from the sampled nodules and they were considered
uncompetitive.
Based on the antibiotic resistance selection of Rlt
strains recovered from clover nodules, it has been
found that nodules occupied by only one strain com-
prised at average 56 ± 7% (Fig. 2 A, B, C, D, E). The
others nodules were occupied by two or three strains
that were distinguished by different antibiotic markers.
Two-strain nodule occupancy ranged from 28% to
46 Wielbo J. et al. 1

Table II
Symbiotic activity of R. leguminosarum bv. trifolii strains

Fresh mass Fresh mass Fresh mass

Rlt strain number No of nodules/plant
of shoots/plant (mg) of roots/plant (mg) of plant/nodule (mg)
Group I of Rlt strains
K 416 5.4 ± 1.5 a 26.3 ± 3.5 a 22.7 ± 1.3 a 9.0
K 411 6.8 ± 0.7 a 31.3 ± 9.4 a 29.7 ± 10.2 a 8.9
K 36 4.3 ± 1.0 a 36.8 ± 2.1 a 18.5 ± 3.6 a 12.8
KO27 6.6 ± 2.3 a 28.6 ± 6.6 a 32.3 ± 5.3 a 9.2
Mixed inoculation (I) 7.4 ± 2.2 a 36.2 ± 8.3 a 23.7 ± 7.4 a 8.1
Group II of Rlt strains
K 417 7.0 ± 0.7 b 45.8 ± 9.3 ab 25.6 ± 11.6 a 10.2
K 108 5.4 ± 0.7 ab 50.9 ± 8.5 b 26.5 ± 10.0 a 14.3
KO17 3.6 ± 0.4 a 33.4 ± 1.9 a 12.6 ± 4.2 a 12.7
K 71 3.7 ± 0.6 a 34.2 ± 8.6 a 13.7 ± 3.8 a 13.0
Mixed inoculation (II) 4.7 ± 1.9 ab 30.5 ± 10.0 a 10.5 ± 6.3 a 8.8
Group III of Rlt strains
K 38 5.2 ± 2.0 a 36.6 ± 4.1 a 16.0 ± 0.9 a 10.1
K 413 8.6 ± 2.1 a 44.3 ± 2.5 a 39.4 ± 7.0 b 9.8
KO18 10.2 ± 0.9 a 68.5 ± 7.3 b 43.3 ± 7.1 b 11.0
K 91 5.8 ± 2.7 a 56.6 ± 3.0 c 40.0 ± 12.5 b 16.6
Mixed inoculation (III) 9.0 ± 2.8 a 33.9 ± 3.4 a 24.9 ± 6.3 ab 6.5
Group IV of Rlt strains
K 29 3.6 ± 1.2 a 31.2 ± 7.0 a 12.1 ± 2.0 a 12.2
K 87 2.8 ± 0.7 a 24.6 ± 9.4 a 12.4 ± 4.1 a 13.4
K 322 4.2 ± 1.8 a 34.6 ± 9.2 a 18.8 ± 8.2 ab 12.7
K 810 6.8 ±1.6 b 29.5 ± 4.5 a 21.8 ± 5.5 b 7.5
Mixed inoculation (IV) 3.3 ± 0.9 a 25.2 ± 7.1 a 10.4 ± 2.5 a 10.9
Group V of Rlt strains
K 313 3.8 ± 1.5 a 44.1 ± 12.9 a 23.7 ± 10.5 ab 17.7
K 312 3.4 ± 1.0 a 35.0 ± 7.0 a 13.3 ± 2.1 a 14.4
K 415 6.2 ± 1.2 ab 41.3 ± 0.9 a 22.8 ± 5.0 b 10.4
K 107 5.1 ± 1.6 ab 55.3 ± 10.4 a 27.4 ± 8.1 b 16.4
Mixed inoculation (V) 6.8 ± 0.4 b 44.7 ± 7.0 a 25.7 ± 6.1 b 10.3
Average values
Inoculation by individual strains 6.2 ± 2.3 a 34.1 ± 7.2 a 19.0 ± 7.9 a 12.1 ± 2.8 a
Inoculation by a mixture of strains 5.4 ± 1.9 a 39.4 ± 11.4 a 23 ± 9.6 a 8.9 ± 1.8 b

Values are the mean ± standard deviation of 20 clover plants in experiment. Means within the same column and followed by the same letter
are not significantly different (P>0.05).

40%, and three-strain nodule occupancy from 3% to
16% of nodules, depending on the group of strains
(I–V) used for clover inoculation (Fig. 2 A, B, C,
D, E). Nodules simultaneously colonized by all four
strains were not detected. The obtained results showed
that nodule colonization by more than one strain was
prevalent, at least in competition experiments con-
ducted under laboratory conditions.
Rlt strains used in competition experiments were
characterized with regard to the symbiotic properties
such as nodulation ability and plant growth promo-
tion (Table II). The tested strains varied both in the
number of nodules elicited and in the impact on fresh
mass of clovers. In the case of some strains the differ-
ences in nodule number and shoot and root mass were
statistically significant. It is worth noting that plants
inoculated with a mixture of four strains showed in-
termediary values of symbiotic parameters, which can
reflect averaged effects of individual strains on sym-
biosis. In almost all cases, fresh mass of total plant
per nodule was lower in the mixed inoculation in
comparison to the same parameter in clover inocula-
tion by individual strains (Table II).
The differences observed in the nodule coloniza-
tion ability of Rlt strains might result from some
physiological differences between the strains, for
instance, in the growth rate. In the competition expe-
riment, the mixtures of strains used as inocula were
prepared by mixing equal volumes of four bacterial
water suspensions with the same OD550, which should
minimize the effect of possible differences in the ini-
tial cell density. In addition, growth of rhizobia was
1 Competitiveness of Rhizobium leguminisarum strains
assayed in the medium composed of nitrogen-free
Fåhraeus medium used in plant tests supplemented
with 1%, 2%, 5%, 10% or 20% TY medium. It was
assumed that addition of some amount of TY to the
plant medium allows for the growth of bacteria while
simultaneously resembling the plant growth medium.
Rhizobia were grown in these media for 2 days and
OD550 was measured. The results showed that Rlt
strains used in the competition experiments grow
weakly and only in Fåhraeus medium supplemented
with 10% or 20% of TY, reaching OD550 values from
0.13 to 0.2 (data not shown). Differences in growth of
strains on Fåhraeus medium supplemented with 10%
TY, as well as on medium supplemented with 20%
TY were observed, however, the analysis of variance
indicated that these differences were statistically in-
significant (data not shown). In conclusion, the pos-
sible differences in the initial growth of Rlt strains
on plant medium at the time of inoculation could not
essentially affect their competitiveness.
Discussion
Local population of R. leguminosarum specific for
a given legume host is composed of numerous strains
characterized by great variability in genetic and meta-
bolic traits (Lakzian et al., 2002; Wielbo et al., 2010).
Rhizobial competitiveness is a complex process depen-
dent on genetic and overall metabolic status of bacteria
(Wielbo et al., 2007), susceptibility to plant molecular
signals (Mabood et al., 2008; Maj et al., 2010), mo-
tility of bacteria (Mellor et al., 1987), production of/
resistance to bacteriocins (Wilson et al., 1998) or even
distribution of bacteria in the soil (Lopez-Garcia
et al., 2002). Several studies indicate that both the
legume hosts and microsymbionts affect the outcome
of rhizobial competition (Kiers et al., 2006; Depret
and Laguerre, 2008; Rangin et al., 2008).
All these and other variables characterizing indi-
vidual strains influence their overall competition abili-
ties. As a result, appreciable variability in rhizobial
competitiveness is observed, both in highly controlled
experiments under laboratory conditions, and in ex-
periments carried out in the soil (Maier and Triplett,
1996; Svenning et al., 2001; Wielbo et al., 2007;
Duodu et al., 2009; Sachs et al., 2009).
The strains compete with each other on the level
of root adsorption, root hair infection, growth inside
the infection threads, nodule tissue colonization and
survival after release into the soil, where they consti-
tute part of population capable of symbiotic interac-
tions (Duodu et al., 2005; Silva et al., 2007; Rangin
et al., 2008; Sachs et al., 2009). Less competitive
rhizobia comprising another part of the population
may be eliminated from nodule infection (Streeter,
47
1994). Finally, nonsymbiotic rhizobia constitute the
fraction that lost the nodulation genes but is still able
to colonize root surfaces and can play an important
role in competition (Sachs et al., 2009).
In several studies, the competition between rhizo-
bia was commonly investigated in a two-strain com-
petition assay under controlled conditions. In this
assay both strains were tagged with different markers
such as antibiotic resistance genes (Bromfield, 1984),
lux (Cresswell et al., 1994) or gfp reporter genes
(Stuurman et al., 2000) and occupancy of both strains
was easily determined in the nodule. The drawback
of this method is the extreme simplification of the
model, which does not reflect native conditions. The
second most frequently used method for rhizobial
competition analysis was to use a single marked strain
vs. the entire unmarked soil population composed of
numerous strains. Major drawback of this approach is
lack of any information about the unmarked strains
possibly present in the nodules. Recently, the com-
petitiveness of unmarked rhizobial strains was stud-
ied by molecular identification of particular genotypes
occupying the nodules (Svenning et al., 2001).
In the present work, the two methods have been
combined, and clover plants were inoculated by four
differently marked strains. It allowed determining the
differences in competitive ability of the individual
strains, and the predominance of nodules occupied by
more than one strain, in the case of a mixed inocula-
tion. It is worth noting that infection by several strains
negatively affected plant growth promotion when
compared to single-strain infection.
Past studies showed mixed colonization of infec-
tion threads and nodules (Bromfield, 1984) in a two-
strain competition assay (Stuurman et al., 2000; Gage,
2004). Expanding the competition test to clover in-
oculation by four strains, we demonstrated the possi-
bility of single clover nodule colonization by three
different strains. The percent of nodules colonized
by three strains was relatively low and ranged from 3
to 16% of the sampled nodules. Nodules colonized
by four strains were not found. It is possible that the
number of the sampled nodules should have been
greater to allow detection of nodules occupied by
all four strains. On the other hand, the limited space
available in the infection threads and/or in young
nodules might restrict the growth of rhizobia, and
this might also explain why four strain nodule colo-
nization was not observed. The most important find-
ing from the presented study is that almost half of
the total number of the sampled nodules was colo-
nized by more than one strain. It suggests that multi-
strain model of nodule colonization is predominant
also in the soil environment, and reflects the com-
plexity and diversity of rhizobial population in the
rhizosphere.
48 Wielbo J. et al.
The comparison of symbiotic efficiencies of clo-
ver inoculation by individual strains vs. a mixture of
strains was not conclusive. Whereas, significant dif-
ferences between the averaged data of shoots and
roots masses in single strain inoculation and in the
mixed inoculation have not been found, significant
difference in ratios of fresh mass of the entire plant
to nodule number was evident when these two types
of inoculations were compared (Table II). A possible
explanation for this result might be that the concen-
tration of several Nod factors produced by particular
strains in the mixed inoculation is substantially
greater than in a single strain inoculation. Nod factors
stimulate nodule organogenesis (Perret et al., 2000;
Spaink, 2000) and that nodule number increase was
not accompanied by increased plant growth probably
due to the relatively short timeframe of the experi-
ment. This observation is consistent with our previous
studies, in which treatment of clover seeds with Nod
factors under controlled conditions enhanced the
growth of clover only when a Nod factor was applied
in appropriate concentration (Maj et al., 2009).
In summary, our data revealed that R. legumino-
sarum strains investigated in the experimental compe-
tition model were greatly differentiated with respect
to competitiveness for nodule occupancy. In the mixed
inoculation of clover plants, nodule coinfection by
two or three strains was commonly observed. The
prevalence of nodule coinfection by native soil popu-
lation is yet to be determined.
Acknowledgements
The research reported in this paper was funded in part by
a grants of Ministry of Sciences and Higher Education of Poland
nr N N304 026734 and N N301 028734.
Literature
Bromfield E.S.P. 1984. Variation in preference for Rhizobium
meliloti within and between Medicago sativa cultivars grown in
soil. Appl. Environ. Microbiol. 48: 1231–1236.
Cresswell A., L. Skot and A.R. Cookson. 1994. The construc-
tion, detection and use of bioluminescent Rhizobium legumino-
sarum biovar trifolii strains. J. Appl. Bacteriol. 77: 656–665.
Depret G. and G. Laguerre. 2008. Plant phenology and genetic
variability in root and nodule development strongly influence
genetic structuring of Rhizobium leguminosarum biovar viciae
populations nodulating pea. New Phytol. 179: 224–235.
Dowling D.N. and W.J. Broughton. 1986. Competition for nodu-
lation of legumes. Annu. Rev. Microbiol. 40: 131–157.
Duodu S., C. Brophy, J. Connolly and M.M. Svenning. 2009.
Competitiveness of native Rhizobium leguminosarum bv. trifolii
strain for nodule occupancy is manifested during infection. Plant
Soil 318: 117–126.
Duodu S., T.V. Bhuvaneswari, J. Gudmundsson and M.M.
Svenning. 2005. Symbiotic and saprophytic survival of three un-
marked Rhizobium leguminosarum biovar trifolii strains intro-
duced into the field. Environ. Microbiol. 7: 1049–1058.
1
Gage D.J. 2004. Infection and invasion of roots by symbiotic
nitrogen-fixing rhizobia during nodulation of temperate legumes.
Microbiol. Mol. Biol. Rev. 68: 280–300.
Jones K.M., H. Kobayashi, B.W. Davies, M.E. Taga and
G.C. Walker. 2007. How symbionts invade plants: the Sinorhizo-
bium-Medicago model. Nature 5: 619–633.
Kiers E.T., R.A. Rousseau and R.F.Denison. 2006. Measured
sanctions: legume hosts detect quantitative variation in rhizobium
cooperation and punish accordingly. Evol. Ecol. Res. 8: 1077–1086.
Lakzian A., P. Murphy, A. Turner, J.L. Beynon and K.E. Giller.
2002. Rhizobium leguminosarum bv. viciae populations in soils
with increasing heavy metal contamination: abundance, plasmid
profiles, diversity and metal tolerance. Soil Biol. Biochem. 34:
519–529.
Lopez-Garcia S.L., T.E.E. Vazquez, G. Favelukes and
A.L. Lodeiro. 2002. Rhizobial position as a main determinant in
the problem of competition for nodulation in soybean. Environ.
Microbiol. 4: 216–224.
Mabood F., W.J. Jung and D.L. Smith. 2008. Signal in the
underground: microbial signaling and plant productivity. In:
Nautiyal C.S., P.E. Dion and V.L. Chopra (eds.). Molecular
mechanisms of plant and microbe coexistence. Springer-Verlag,
Berlin, Heidelberg.
Maier R.J. and E.W. Triplett. 1996. Toward more productive,
efficient, and competitive nitrogen-fixing symbiotic bacteria. Crit.
Rev. Plant Sci. 15: 191–234.
Maj D., J. Wielbo, M. Marek-Kozaczuk and A. Skorupska.
2009. Pretreatment of clover seeds with Nod factors improves
growth and nodulation of Trifolium pratense. J. Chem. Ecol.
35: 479–487.
Maj D., J. Wielbo, M. Marek-Kozaczuk and A. Skorupska.
2010. Response to flavonoids as a factor influencing competiti-
veness and symbiotic activity of Rhizobium leguminosarum.
Microbiol. Res. 165: 50–60.
Masson-Boivin C., E. Giraud, X. Perret and J. Batut. 2009.
Establishing nitrogen-fixing symbiosis with legumes: how many
rhizobium recipes? Trends Microbiol. 17: 458–466.
Mellor H.Y., A.R. Glenn and M.J. Dilworth. 1987. Symbiotic
and competitive properties of motility mutants of Rhizobium
trifolii TA1. Arch. Microbiol. 148: 34–39.
Peoples M.B, J.K. Ladha and D.F. Herridge. 1995. Enhancing
legume N2 fixation through plant and soil management. Plant Soil
174: 83–101.
Perret, X., C. Staehelin and W.J. Broughton. 2000. Molecular
basis of symbiotic promiscuity. Microbiol. Mol. Biol. Rev. 64:
180–201.
Ramos M.G., M.A. Villatoro, S. Urquiaga, B.J. Alves and
R.M. Boddey. 2001. Quantification of the contribution of bio-
logical nitrogen fixation. J. Biotechnol. 91: 105–115.
Rangin, C., B. Brunel, J.-C. Cleyet-Marel and G. Bena. 2008.
Effects of Medicago truncatula Genetic Diversity, Rhizobial
Competition, and Strain Effectiveness on the Diversity of a Natural
Sinorhizobium Species Community. Appl. Environ. Microbiol. 74:
5653–5661.
Sachs J.L., S.W. Kembel, A.H. Lau and E.L. Simms. 2009.
In situ phylogenic and diversity of wild Bradyrhizobium commu-
nities. Appl. Environ. Microbiol. 75: 4727–4735.
Sambrook, J., E.F. Fritsch and T. Maniatis. 1989. Molecular
Cloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory.
Sessitsch A., G. Hardarson, W.M. de Vos and K.J. Wilson.
1998. Use of marker genes for competition studies of Rhizobium.
Plant Soil 204: 35–45.
Sharma P.K., R.C. Anand and K. Lakshminarayana. 1991.
Construction of Tn5 tagged mutants of Rhizobium spp. (Cicer)
for ecological studies. Soil Biol. Biochem. 23: 881–885.
1 Competitiveness of Rhizobium leguminisarum strains
Silva C., F.L. Kan and E. Martínez-Romero. 2007. Population
genetic structure of Sinorhizobium meliloti and S. medicae iso-
lated from nodules of Medicago spp. in Mexico. FEMS Microbiol.
Ecol. 60: 477–489.
Spaink H.P. 2000. Root nodulation and infection factors pro-
duced by rhizobial bacteria. Annu. Rev. Microbiol. 54: 25–288.
Streeter J.G. 1994. Failure of inoculant rhizobia to overcome the
dominance of indigenous strains for nodule formation. Can. J.
Microbiol. 40: 513–522.
Stuurman N., C. Pacios Bras, H.R.M. Schlaman, A.H.M.
Wijfjes, G. Bloemberg and H.P. Spaink. 2000. Use of green
fluorescent protein color variants expressed on stable broad-host-
range vectors to visualize rhizobia interacting with plants. Mol.
Plant-Microbe Interact. 13: 1163–11699.
Svenning M.M., J. Gudmundsson, I.L. Fagerli and P.
Leinonen. 2001. Competition for nodule occupancy between in-
troduced strains of Rhizobium leguminosarum bv. trifolii and its
influence on plant production. Ann. Bot. 88: 781–787.
Timmers A.C., E. Soupène, M.C. Auriac, F. de Billy, J. Vasse,
P. Boistard and G. Truchet. 2000. Saprophytic intracellular
rhizobia in alfalfa nodules. Mol. Plant-Microbe Interact. 13:
1204–1213.
49
Vasse J., F. de Billy, S. Camut and G. Truchet. 1990. Correla-
tion between ultrastructural differentiation of bacteroids and ni-
trogen fixation in alfalfa nodules. J. Bacteriol. 172: 4295–4306.
Vincent J.M. 1970. A manual for the practical study of root nod-
ule bacteria. International biological program handbook no.15.
Blackwell Scientific Publications Ltd, Oxford, UK.
Wielbo J. and A. Skorupska. 2001. Construction of improved
vectors and cassettes containing gusA and antibiotic resistance
genes for studies of transcriptional activity and bacterial localiza-
tion. J. Microbiol. Methods 45: 197–205.
Wielbo J., M. Marek-Kozaczuk, A. Kubik-Komar and A.
Skorupska. 2007. Increased metabolic potential of Rhizobium
spp. is associated with bacterial competitiveness. Can. J.
Microbiol. 53: 957–967.
Wielbo J., Marek-Kozaczuk M., Mazur A., Kubik-Komar A.
and A. Skorupska. 2010. Genetic and metabolic divergence
within a Rhizobium leguminosarum bv. trifolii population recov-
ered from clover nodules. Appl. Environ. Microbiol. 76: 4593–
4600.
Wilson R.A., B.A. Handley and J.E. Beringer. 1998. Bacterio-
cin production and resistance in a field population of Rhizobium
leguminosarum bv. viciae. Soil Biol. Biochem. 30: 413–417.
50 Wielbo J. et al. 1
Polish Journal of Microbiology
2011, Vol. 60, No 1, 51–58

ORIGINAL PAPER

Selection and Adaptation of Saccharomyces cerevisae

to Increased Ethanol Tolerance and Production
JAN FIEDUREK*, MARCIN SKOWRONEK and ANNA GROMADA

Department of Industrial Microbiology, Maria Curie-Sk³odowska University, Lublin, Poland

Received 2 August 2010, revised 12 January 2011, accepted 20 January 2011

Abstract

A total of 24 yeast strains were tested for their capacity to produce ethanol, and of these, 8 were characterized by the best ethanol yields
(73.11–81.78%). The most active mutant Saccharomyces cerevisiae ER-A, resistant to ethanol stress, was characterized by high resistance
to acidic (pH 1.0 and 2.0), oxidative (1 and 2% of H2O2), and high temperature (45 and 52°C) stresses. During cultivation under all stress
conditions, the mutants showed a considerably increased viability ranging widely from about 1.04 to 3.94-fold in comparison with the
parent strain S. cerevisiae ER. At an initial sucrose concentration of 150 g/l in basal medium A containing yeast extract and mineral salts,
at 30°C and within 72 h, the most active strain, S. cerevisiae ER-A, reached an ethanol concentration of 80 g/l, ethanol productivity of
1.1 g/l/h, and an ethanol yield (% of theoretical) of 99.13. Those values were significantly higher in comparison with parent strain (ethanol
concentration 71 g/l and productivity of 0,99 g/l/h). The present study seems to confirm the high effectiveness of selection of ethanol-
resistant yeast strains by adaptation to high ethanol concentrations, for increased ethanol production.

K e y w o r d s: adaptation to high ethanol concentration, ethanol tolerance, fermentation, yeast

Introduction tolerance, aiming to increase ethanol productivity

Bio-ethanol production by yeast is a growing
industry due to energy and environmental demands
(Schubert, 2006). Saccharomyces cerevisiae and
related yeast species have been extensively used in
fermentation, wine-making, sake-making and brewing
processes. Successful performance of alcoholic fer-
mentations, however depends on the ability of the yeast
strains used to cope with a number of stress factors
occurring during the process (Van Uden, 1985; Viegas
et al., 1989; Hirasawa et al., 2007), including osmotic
pressure imposed by the initial high sugar concentra-
tion and stress induced by fermentation end-products
or sub-products such as ethanol or acetate. Among
these, the stress induced by increasing amounts of
ethanol, accumulating to toxic concentrations during
ethanol fermentation, is the major factor responsible
for reduced ethanol production yields and, ultimately,
for stuck fermentations (Gibson et al., 2007). Thus,
yeast strains that can endure stress imposed by high
ethanol concentrations are highly desirable. Through-
out the years many efforts have been made to cha-
racterize the mechanisms underlying ethanol stress
* Corresponding author: J. Fiedurek, Department of Industrial Microbiology, Maria Curie-Sk³odowska University, Akademicka 19,
20-033 Lublin, Poland; phone: +48 81 537 59 33; fax: +48 81 537 59 60; e-mail: janek@poczta.umcs.lublin.pl
(Van Uden, 1985; You et al., 2003; Alper et al., 2006;
Hirasawa et al., 2007). To overcome fermentation
problems, sophisticated refinements of fermentation
processes, involving extractive fermentation (Jones
et al., 1993; Da Silva et al., 1999), cell immobiliza-
tion (de Vasconcelos et al., 2004; Verbelen et al.,
2006), and recycling or retention by membranes
(Nishiwaki and Dunn, 1998; Wang  and Lin,  2010),
were employed with a view to obtaining a large quan-
tity of fermenting biomass as well as removing the
inhibitory ethanol product. Successful engineering of
yeast transcription machinery for this purpose was
also reported (Alper et al., 2006).
The present study was conducted to select the
best ethanol-producing yeast strains from our collec-
tion, to improve yeast fermentation performance
by adaptation, and to optimize the conditions for
alcohol production from sucrose. There are, to our
knowledge, only a few studies that describe the
creation of ethanol-tolerant S. cerevisiae mutants
using adaptation and ethanol stress as the selection
pressure (Brown et al., 1982; Remize et al., 1999;
Stanley et al., 2010).
52 Fiedurek J. et al. 1

Experimental that medium and were incubated at 30°C without

Material and Methods
Microorganisms and media. The strains of the
yeast listed in Table I were maintained at 4°C on malt
agar slants. For inoculum preparation selected strains
were cultivated on a growth medium A containing
glucose, 2%; bactopepton, 2% and yeast extract, 1%.
Fermentations were performed using a basal medium
A containing: sucrose, 15.0%; yeast extract, 1.0%;
(NH4)2SO4, 0.3% and KH2PO4, 0.1%.
Adaptation for increased ethanol production.
Enrichments for increased ethanol production were
carried out according to the method of Dinh et al.,
(2008) with some modifications. The cultivation of
the S. cerevisiae ER strain was carried out in malt
medium containing ethanol and then the culture was
transferred to a fresh medium containing the same
ethanol concentration. Adapted cultures were grown
in culture tubes (18 by 150 mm) containing 10 ml of
agitation. After that, the culture was transferred to
a medium containing a higher ethanol concentration,
followed by repetitive cultivations. The initial ethanol
concentration was set at 5.0% (w/v) and it was changed
gradually from 6.0 to 15.0%. New derivatives of
S. cerevisiae were isolated from the adapted cultures
after 10 months of serial transfers into media with high
concentrations of ethanol. At the end of this period,
two clones were selected for further study; these
clones were designated as strain ER-A and ER-M.
The adaptation of the yeast was evaluated by mea-
suring the optical density of the culture at OD600.
Viability in ethanol was determined by maintaining
yeast cells of S. cerevisiae ER in malt medium supple-
mented with 5–15% ethanol for 48 h at 30°C, plating
them on malt agar plate, and subsequently counting
the number of colonies formed. Control cultures were
maintained in the same medium without ethanol.
Inoculum preparation. For the preparation of
inoculum, yeast strains were transferred from agar

Table I
Screening yeast strains for efficient ethanol production

Sucrose concentration (%)

15 40 15 40 15 40
Strain
Catalase activity Ethanol Ethanol yield
(U) (% w/v)a (% of theoretical)
Candida shaetaceae ATCC 22–994 8.67 6.61 0.70 0.40 8.67 1.86
Candida utilis CCY 29–38–18 8.70 7.13 2.00 0.70 24.78 3.25
Kluyveromyces fragilis IPF 8.07 10.00 5.00 3.00 61.96 13.94
Kluyveromyces marxianus CCY 50–2–1 4.38 4.69 3.10 4.30 38.41 19.98
1
Saccharomyces bayanus S-21 4.25 1.89 6.60 7.60 81.78 35.32
1
Saccharomyces owiformis 3.78 5.34 6.00 7.00 74.35 32.53
2
Saccharomyces carlsbergensis FD 4.31 4.48 6.48 6.49 80.30 30.16
3
Saccharomyces cerevisiae Anker 2.58 6.03 5.80 8.10 71.87 37.64
Saccharomyces cerevisiae A364A 1.83 2.08 3.80 2.80 47.09 13.01
Saccharomyces cerevisiae DBY 747 6.81 6.64 6.40 6.80 79.30 31.60
4
Saccharomyces cerevisiae ER 3.78 3.08 6.60 9.75 81.78 45.31
4
Saccharomyces cerevisiae GM 5.20 9.04 5.80 6.00 71.87 27.88
3
Saccharomyces cerevisiae Hammer 3.22 6.75 5.80 9.20 71.87 42.75
1
Saccharomyces cerevisiae JA 8.41 5.34 5.90 7.20 73.11 33.46
2
Saccharomyces cerevisiae PG 4.06 5.09 6.00 6.80 74.35 31.60
1
Saccharomyces cerevisiae J 5.81 4.84 1.10 2.40 13.63 11.15
1
Saccharomyces elipsoideus Sz.o. 3.81 4.29 6.48 5.64 80.30 26.21
Saccharomyces fragilis II 11 4.71 4.90 5.00 2.20 61.96 10.22
Saccharomyces fragilis 11–54 9.07 7.72 3.80 6.20 47.09 28.81
Saccharomyces fragilis S-24 9.84 5.91 3.10 3.20 38.41 14.87
Saccharomyces fragilis S-25 6.88 8.05 5.10 6.20 63.20 28.81
1
Saccharomyces mellis 1 3.71 3.78 0.70 0.80 8.67 3.72
Saccharomyces muciparus CCM 21–25–1 8.54 7.72 4.10 3.00 50.80 13.94
1
Saccharomyces rouxii 7.53 8.71 0.60 0.20 7.43 0.93

The strains were incubated in 50 ml conical flasks, each containing 20 ml of basal medium A containing 15%
or 40% of sucrose during 72 h.
a Values are averages of 3 replicate determinations with standard deviations of < ± 5%
1 Wine yeasts; 2 Brewing yeasts; 3 Baker’s yeast; 4 Distillery yeast
1 S. cerevisae adaptation for increased ethanol levels
slants into 50-ml Erlenmeyer flasks containing 10 ml
of sterile liquid growth medium A, which were cul-
tured at 30°C on a rotary shaker (Shaker Orbit The
LAB-LINE Instruments Inc, Melrose Park, Illinois,
USA) at 150 rpm for 24 h.
Ethanol fermentations. Fermentations with the
selected strain were conducted in 300-ml Erlenmeyer
flasks containing 100 ml of basal medium A (pH 5.5).
The flasks were inoculated with 10% v/v seed culture.
Fermentations were carried out for 72 h at 30°C (if not
indicated otherwise) in a shaker at 90 rpm. Ethanol
evaporation was prevented by rubber stoppers, with
fermentative tubes filled with 50% H2SO4. The fermen-
tation parameters were corrected by ethanol, sucrose
and biomass withdrawn during sampling. Overall bio-
mass as well as ethanol yields and sucrose consump-
tion were calculated from end-of-batch data, where
the peak ethanol concentration was recorded. Other
methodological details are given in tables and figures.
Assays. Biomass was estimated from optical den-
sity at 600 nm. Dry mass was calculated by referring
to a standard curve of cell mass versus absorbance
(Hughest et al., 1984). Ethanol was quantified using
the Gonchar et al. (2001) method in own modification
using o-dianisidine instead of 3,3,5,5,-tetramethylben-
zidine (TMB) as chromogen.
Extracellular catalase activity was measured spec-
trophotometrically by observing the decrease in light
absorption at 525 nm during decomposition of H2O2
by the enzyme (Fiedurek and Gromada, 1997). One
unit (U) of catalase activity was defined as the amount
of enzyme catalysing the decomposition of 1 µmol
hydrogen peroxide per min at 30°C. Fermentations
were performed in 2 replicate cultures, and analyses
were carried out in duplicate. The data given here are
the averages of the measurements.
Measurement of respiration. Cell suspensions,
prepared as described above, were used to measure
the rate of yeast respiration at various medium pH,
either in the absence or in the presence of ethanol.
Other methodological details are given in the tables
and figures. Oxygen concentration in the culture me-
dium was measured by a polarographic dissolved
oxygen sensor (Ingold, CH Industrie Nord, Urdorf,
Switzerland). The readings were expressed as per-
centage of the initial level of saturation (100%).
Results
Production of ethanol during fermentation is lim-
ited by the inability of yeast to grow at high ethanol
levels, which is why a great deal of effort has been
devoted to creating yeast strains that would tolerate
high ethanol levels, and be able to continue the fer-
mentation to produce higher concentrations of alcohol.
53
The development of such strains would have the
major advantage of saving the energy involved in dis-
tilling and refining ethanol.
A total of 24 yeast strains were tested for their capac-
ity to produce ethanol, and of these, 8 were character-
ized by the best ethanol yields (73.11–81.78%). Etha-
nol production, catalase activity, and ethanol yield
were monitored on synthetic medium A. The effects
of increasing sucrose concentration from 15 to 40%
on ethanol yield, catalase activity and biomass of the
yeast strains were examined. Along with the increase
in sucrose concentration from 15 to 40%, a decrease
in biomass and ethanol yield was observed. On the
other hand, the increase enhanced extracellular cata-
lase production, probably as an effect of stress condi-
tions. Among the 24 strains, 13 (54.2%) were charac-
terized by high catalase activity when grown on
a medium with a high sucrose concentration (40%)
(Table I). The increase in sucrose concentration in the
medium (from 15 to 40%) caused a significant (1.02
to 3-fold) reduction in biomass production.
For further selection an industrial strain of Sac-
charomyces cerevisiae ER characterized by high etha-
nol tolerance, higher cell viability especially during
“very high gravity” fermentation, and working under
a wide range of temperatures (35–40°C) was used.
This strain was used for preparation of inocula for
adaptation with high concentrations of ethanol (5 to
15%) in order to select ethanol-tolerant yeast. New
derivatives of S. cerevisiae were isolated from adapted
cultures after 10 months of serial transfers. During
this period about 120 subsequent transfers were per-
formed. At the end of this period, a two clones were
selected from enrichment for further study; those
clones, designated as strain S. cerevisiae: ER-A and
ER-M, were able to grown at 15% of ethanol in
the medium (data not shown). When subjected to
a stepwise increase in ethanol concentration with
repetitive cultivations, the yeast cells S. cerevisiae
ER-A adapted to the high ethanol concentration
showed better biomass accumulation in the medium
containing the same ethanol concentration, in com-
parison to the cells of the parent strain (Table II). This
strain was used for further study.
The most active mutant, S. cerevisiae ER-A, resis-
tant to ethanol stress, was characterized by high resis-
tance to acidic (pH 1.0 and 2.0), oxidative (1 and 2%
of H2O2) and high temperature (45 and 52oC) stresses.
The viability of mutants during cultivation under all
the mentioned stress conditions increased about 1.04
to 3,94-fold in comparison with the parent strain
S. cerevisiae ER. It is worth noting, that mutant of
S. cerevisiae ER-A resistant to ethanol stress, generally
showed a better adaptation to higher ethanol concen-
tration, as expressed by the increased (about 4-fold)
viability at 20% of ethanol in comparison to its 10%
54 Fiedurek J. et al. 1

Table II slowly, reaching 10.7% after 20 min. The higher con-

Effect of ethanol concentration on biomass production centration (10%) of ethanol significantly reduced
oxygen consumption; in these conditions, more than
Dry matter Relative to
Ethanol (g/l)a after the parent-type (-fold)
half of the initial dissolved oxygen content remained
(% w/v)
24 h 48 h 24 h 48 h Table IV
Saccharomyces cerevisiae ER (parent) Effect of externally added ethanol at concentration 0–15%
Control (none) 2.33 3.04 on CO2 and biomass production by parent and adapted strain
11 1.10 1.67 of Saccharomyces cerevisiae MR-A
12 0.58 1.11
13 0.41 0.63 Relative metabolic rate (%)a, b
Ethanol Dry matter
14 (% w/v) Mixing Mixing (g/l)b
15 0.19 0.22 (90 rpm) (180 rpm)
Saccharomyces cerevisiae ER-A Saccharomyces cerevisiae ER (parent)
Control (none) 2.42 2.74 1.04 0.90 Control (none) 39.13 73.90 2.33
11 1.35 1.67 1.23 1.00 5 21.74 39.13 1.73
12 0.65 1.24 1.12 1.12 10 4.35 4.35 1.36
13 0.53 0.87 1.29 1.38 11 0 4.30 1.10
14 0.44 0.77 1.42 1.64 12 0 0 0.58
15 0.30 0.36 1.58 1.64 13 0 0 0.39
14 0 0 0.28
The strains were incubated in 50 ml conical flasks, each containing 15 0 0 0.19
20 ml of basal medium A with ethanol (11–15%) during 24–48 h.
a Values are averages of 6 replicate determinations with standard devia- Saccharomyces cerevisiae ER-A
tions of < ± 6% Control (none) 43.48 100.00 2.46
5 30.43 52.17 2.25
Table III 10 5.43 13.44 1.50
Effect of abiotic stresses on surviving cells
11 4.43 13.00 1.35
of Saccharomyces cerevisiae ER
12 0 4.35 0.70
Relative 13 0 0 0.53
Surviving cells (%)a
Stress conditions to the wild- 14 0 0 0.44
Parent ER-A type (-fold) 15 0 0 0.34
Low pH (2.0) 81.99 93.70 1.14 a Relative metabolic rate (%) was calculated by counting the number of
Low pH (1.0) 3.85 7.14 1.85 bubbles of CO2 released from fermentative tubes during 60 min. Maxi-
Oxidative stress (1% H2O2) 80.90 100.0 1.24 mal amount of bubbles formed during culture of the adapted strain ER-
Oxidative stress (2% H2O2) 72.0 96.50 1.34 A was defined as 100%. The strains were incubated in 50 ml conical
flasks, each containing 20 ml of basal medium A with ethanol (5–15%)
High temperature (45oC) 47.59 69.85 1.46 during 24 h
High temperature (52oC) 26.34 43.17 1.64 b Values are averages of 6 replicate determinations with standard devia-

Ethanol (10%) 89.25 90.37 1.04 tions of < ± 5%

Ethanol (15%) 61.02 77.93 1.28
Ethanol (20%) 10.00 39.40 3.94 Table V
Effect of (NH4)2SO4 concentration on ethanol production
The strains were incubated in 50 ml conical flasks, each containing
20 ml of basal medium during 24 h of stress conditions. Low pH media Ethanol yield Dry
were obtained by adding 0.1 M HC1. Ethanol
Medium (% of matter
a Values are averages of 4 replicate determinations with standard devia- (% w/v)
theoretical) (g/l)
tions of < ± 4%
Saccharomyces cerevisiae ER (parent)a
Basal medium A 6.30 78.06 5.38
concentration (Table III). A similar trend was also ob-
served for oxidative (1 and 2% of H2O2) and high tem- Modified basal medium A
with (NH4)2SO4 – 1,0% 7.10 87.98 6.75
perature (45 and 52°C) stress, when higher numbers of
Saccharomyces cerevisiae ER-A a
cells survived in more drastic stress conditions.
Basal medium A 7.20 89.22 5.04
Measurements of oxygen consumption at 30°C
and pH 4.5 showed that ethanol inhibited the respira- Modified basal medium A
8.00 99.13 6.23
with (NH4)2SO4 – 1,0%
tion rate of yeast. In the absence of added ethanol, the
oxygen concentration decreased gradually over the Fermentation conditions: inoculation: 2× 107 cells/ml, time fermenta-
first 15 min to the level of about 6%. When the experi- tion 72 h at 30°C in shaker 90 rpm. The strain was incubated in 50 ml
conical flasks, each containing 20 ml of basal medium A containing 0.3
ment was repeated in the presence of 5% (w/v) etha- and 1.0% of with (NH4)2SO4.
nol, the respiration rate of the yeast cells was markedly a Values are averages of 6 replicate determinations with standard devia-

inhibited, and the oxygen concentration fell more tions of < ± 5%

1 S. cerevisae adaptation for increased ethanol levels 55

a)

b)

Fig. 1. Effect of ethanol concentration in the medium on the oxygen consumption of Saccharomyces cerevisiae ER strain (a)
and Saccharomyces cerevisiae ER-A strain (b).
The values shown represent the mean of three experiments. Error bars represent standard deviations.

in the medium after 20 min from the beginning of the
experiment (Fig. 1a). The adapted cells of S. cerevisiae
ER-A consumed more oxygen than the parent strain
in media with all the tested ethanol concentrations
(Fig. 1b). After 20 min of respiration, the levels of
oxygen concentration in media with 5% and 10%
ethanol were lower by 10.7% and 13.2%, respectively,
as compared with values for the parent strain.
The effect of 5–15% ethanol externally added to
basal medium A on CO2 production by the parent and
the adapted strain of S. cerevisiae ER-A was exam-
ined. In comparison with the parent strain, the meta-
bolic activity of adapted cells of S. cerevisiae ER-A
showed higher resistance to inhibition by ethanol
when the cells were grown with 5 and 10% (w/v)
ethanol. The higher concentration (11%) of ethanol
completely inhibited metabolic activity of the parent
strain when culture was carried out in a shaker at
90 rpm, and adapted cells showed insignificant activity
in these conditions. Under a higher mixing rate (180
rpm), at 11% of ethanol, adapted cells of S. cerevisiae
ER-A were characterized by an about 3-fold higher
56 Fiedurek J. et al.
metabolic activity than the parent strain. A further in-
crease in ethanol concentration in basal medium A to
12% completely inhibited metabolic activity of the
parent strain, and the adapted strain showed very
small this activity in these conditions (Table IV).
Table V compares ethanol production by the pa-
rental and the mutant strain of S. cerevisiae ER-A in
basal and modified medium A. The highest ethanol
yields for the two strains were obtained on modified
medium A, containing 15% of sucrose, 1% of yeast
extract, 1% of (NH4)2SO4 and 1% of KH2PO4, using
a very simple fermentation system (shake flask). Con-
siderably better results were achieved for mutant
S. cerevisiae ER-A, which was characterized by an
ethanol yield of 99.13% and an ethanol concentration
of 8.0%; the respective values for the parental strain
were 87.98 % and 7.1%.
Discussion
Tolerance to high ethanol and sucrose concentra-
tions is an important property of industrial micro-
organisms. The accumulation of ethanol during culti-
vation causes stress to yeast cells, leading to a decrease
in cell growth and production of target products. Thus,
understanding the process of adaptation of yeast to
high ethanol concentrations is important as it may
lead to the construction of yeast strains able to grow
well at high ethanol concentrations. Such ethanol-tol-
erant yeasts are highly desirable for the production
of useful compounds. Improving ethanol tolerance in
yeast should, therefore, reduce the impact of ethanol
toxicity on fermentation performance (Dinh et al.,
2008; Stanley et al., 2010).
Stanley et al. (2010) obtained ethanol-tolerant yeast
mutants by subjecting mutagenised and non-muta-
genised populations of S. cerevisiae W303-1A to adap-
tive evolution using ethanol stress as a selection pres-
sure. Mutants CM1 (chemically mutagenised) and SM1
(spontaneous) had increased acclimation and growth
rates when cultivated in sub-lethal ethanol concentra-
tions, and their survivability in lethal ethanol concen-
trations was considerably improved compared with
the parent strain. Those authors suggested that the
increased ethanol tolerance of the mutants was due
to their elevated glycerol production rates and the
potential of these to increase the ratio of oxidised
and reduced forms of nicotinamide adenine dinucle-
otide (NAD+/NADH) in an ethanol-compromised
cell, stimulating glycolytic activity.
The viability of the adapted S. cerevisiae ER-A
was always higher than for the parental strain, for all
the stress conditions used (Table III). For example,
the viable population (expressed as a percentage of
the initial population) of the ER- culture after 24 h in
1
20% (w/v) ethanol was 39.40%, respectively, com-
pared with 10.0% for the parent. Similar viability
characterized SM1 and CM1 cultures obtained by
Stanley et al. (2010) under lethal ethanol stress con-
ditions (12% (w/v) ethanol, after 12 h) – 52% and
44%, respectively, compared with 5% for the parent.
Some researchers have analyzed phenomena asso-
ciated with adaptation of yeast cells to high ethanol
concentrations. Lloyd et al. (1993) found that yeast
previously grown in the presence of 5% ethanol could
grow in the medium containing 10% ethanol, whereas
yeast inoculated directly into a medium containing
10% ethanol failed to grow. Ismail and Ali (1971)
reported that no increase in the tolerance of yeast to
a high ethanol concentration was observed after ten
successive transfers to an environment containing
a high ethanol concentration. Therefore, it is expected
that exposing yeast cells to a stepwise increase in the
level of ethanol stress should be effective for obtain-
ing ethanol-tolerant yeast strains.
The results presented above confirmed that an
adapted strain resistant to ethanol stress generally
showed better adaptation to other stress conditions,
as expressed by the increased survival of the mutant
of S. cerevisiae ER-A during cultivation under acidic
(pH 1.0 and 2.0), oxidative (1 and 2% of H2O2), and
high temperature (45 and 52°C) stresses. It is worth
noting that in the more drastic stress conditions, the
ethanol-tolerant mutant was characterized by a higher
survival rate. This is in accordance with data presented
by Ogawa et al. (2000), who showed that several genes
were highly expressed only in the ethanol-tolerant mu-
tant but not in the parent strain. The ethanol-tolerant
mutant also exhibited resistance to other stresses
including heat, high osmolarity, and oxidative stress
in addition to ethanol tolerance. These results indicate
that the mutant exhibits multiple stress tolerances due
to elevated expression of stress-responsive genes,
resulting in accumulation of high amounts of stress
protective substances such as catalase, glycerol, and
trehalose (Ogawa et al., 2000). The ability of one
stress condition to provide protection against other
stresses is referred to as cross-protection. Several stud-
ies have shown that adaptation to acid stress confers
resistance to a wide range of stress conditions includ-
ing heat, salt, crystal violet, and polymyxin B (Lee
et al., 1995; Bearson et al., 1997). However, adapta-
tion to other stresses does not typically induce signi-
ficant acid tolerance. This implies that acid exposure
may be treated by microorganisms as a more general
stress indicator, whereas salt and H2O2 may be more
specific stress signals.
A number of specific selection schemes have been
elaborated to improve the biosynthetic capacity of
production strains. Thus the acid tolerance of Leuco-
nostoc oenos was examined in cells surviving at pH
1 S. cerevisae adaptation for increased ethanol levels
2.6, which is lower than the acid limit of growth (about
pH 3.0). The acid-resistant mutant L. oenos, was
found to be able to grow in acidic media and charac-
terized by a high H +–ATPase activity at low pH. Such
strains may be an important part of the technology of
modern commercial wine production (Drici-Cachon
et al., 1996). Accumulation of a large amounts of
metabolic end-products during the fermentation period,
especially in case of industrial amino acid fermenta-
tion, builds up a high osmotic strength which affects
both growth and production. Enhanced l-treonine pro-
duction by salt tolerant mutants of E. coli was achieved
(Drici-Cachon et al., 1996). Some mutants have been
described in E. coli which are more resistant to cell
lysis in the presence of ethanol (Fried and Novick
1973; Ingram et al., 1980). In this respect, our results
obtained in ethanol production can be compared with
data provided by Ortiz-Zamora et al. (2008), who iso-
lated and selected yeast strains from alcoholic fermen-
tations of natural sources. These strains were exposed
several times to high concentrations of glucose and
ethanol in order to select ethanol- and glucose-
tolerant yeast; 10 were obtained that adapted best to
these conditions. Some of these strains demonstrated
the highest adaptation to both ethanol (5–7% w/v) and
glucose (20% w/v). The maximum yield obtained was
0.46 g/g (90% theoretical yield) in a 20-L bioreactor
with cane molasses.
Araque et al. (2008) selected thermotolerant yeast
strains Saccharomyces cerevisiae for bioethanol pro-
duction, which were able to grow and ferment glucose
in the temperature range 35–45°C. All the strains
grew (in agar plates) at 35 and 40°C, only two strains
grew at 42°C, and no strain grew at 45°C. Glucose-
to-ethanol conversion yield was between 50% and
80% of the theoretical value. The ethanol yields by
SSF using the selected strain were higher than those
obtained using the control yeast.
The selected strain, S. cerevisiae ER-A, showed an
ability to grow and ferment sucrose at ethanol concen-
trations in the medium of 15 and 12% (w/v), res-
pectively (Tables II and IV). Its resistance to ethanol,
externally added to the medium, was significantly
higher than for the parent strain. An increase in the
rate of mixing from 90 to 180 rpm correlated with
a simultaneous increase in the relative fermentation
rate (%) both for the parent and the adapted strain,
probably as an effect of a higher mass transfer. The
effect of ethanol on yeast growth and fermentation has
been studied by Brown et al. (1981).These authors
showed complex kinetics which resulted from both
an inhibition of the growth rate itself and also a reduc-
tion in cell viability. The growth and viability effects
had different inhibition constants. Contrary to our
data, ethanol was less inhibitory toward fermentation
than toward growth in sake yeast.
57
Some data suggest that an improvement in ethanol
tolerance leads to an increase in both ethanol produc-
tion rate and the total amount of ethanol produced
(Jiménez and Benítez, 1988). The adapted S. cerevisiae
ER-A reached an ethanol concentration of 80 g/l, an
ethanol productivity of 1.1 g/l/h, and an ethanol yield
(% of theoretical) 99.13. Those values were signifi-
cantly higher in comparison with the parent strain
(ethanol concentration of 72.9 g/l and productivity of
1,01 g/l/h).
The studies presented above seem to confirm the
high effectiveness of selection of resistant yeast
strains by adaptation to high ethanol concentrations
for increased ethanol production. Additionally, better
adaptation of these mutants to abiotic stresses can
affect yeast growth and ethanol productivity. The
advantage gained in direct screening is to reduce in
a very specific way the number of cultures isolated
from the plates, which would normally require testing
of productivity via shake flask cultures. This is a signi-
ficant contribution to make screening of ethanol-pro-
ducing yeast more efficient. The ethanol tolerant strain
was stable in the subsequent subcultures in the absence
of stress during 6 months. It can be concluded from
the present results that the adapted strain S. cerevisiae
ER-A showed, at this stage of our studies, a moderate
fermentation activity, which gave reasonable ethanol
yields from sucrose. Further improvements to the iso-
lated yeast strain and the growth conditions are neces-
sary to utilize the strain for larger-scale fermentation.
Acknowledgements
The authors wish to thank Prof. Józef Kur (Department of
Microbiology Chemical Faculty, Gdañsk University of Techno-
logy, Poland) for supplying yeast strain Saccharomyces cerevisiae
ER (Ethanol Red).
This work was financially supported by Research Program
BW/BiNoZ/UMCS.
Literature
Alper H., J. Moxley, E. Nevoigt, G.R. Fink and G. Ste-
phanopoulos. 2006. Engineering yeast transcription machinery
for improved ethanol tolerance and production. Science 314:
1565–1568.
Araque E., C. Parra, M. Rodríguez, J. Freer and J. Baeza.
2008. Selection of thermotolerant yeast strains Saccharomyces
cerevisiae for bioethanol production. Enzyme Microb. Technol.
43: 120–123.
Bearson S., B. Bearson and J.W. Foster. 1997. Acid stress re-
sponses in enterobacteria. FEMS Microbiol. Lett. 147: 173–180.
Brown S.W., S.G. Oliver, D.E.F. Harrison and R.C. Righelato.
1981. Ethanol inhibition of yeast growth and fermentation: Differ-
ences in the magnitude and complexity of the effect. J. Appl.
Microbiol. Biotechnol. 11: 153–155.
Brown S.W. and S.G. Oliver. 1982. Isolation of ethanol-tolerant
mutants of yeast by continuous selection. Eur. J. Appl. Microbiol.
Biotechnol. 16: 119–122.
58 Fiedurek J. et al.
Da Silva F.L.H., M.I. Rodrigues and F. Maugeri. 1999. Dynamic
modeling simulation and optimization of an extractive continuous
alcoholic fermentation process. J. Chem. Technol. Biotechnol.
74: 176–182.
Dinh T.N., K. Nagahisa, T. Hirasawa, C. Furusawa and
H. Shimizu. 2008. Adaptation of Saccharomyces cerevisiae cells
to high ethanol concentration and changes in fatty acid composi-
tion of membrane and cell size. PLoS ONE 3(7):e2623. doi:
10.1371/journal.pone.0002623.
Drici-Cachon Z., J. Guzzo, J.F. Cavin and C. Divies. 1996.
Acid tolerance in Leuconostoc oenos. Isolation and characteriza-
tion of an acid-resistant mutant. Appl. Microbiol. Biotechnol. 44:
785–789.
Fried V.A. and A. Novick. 1973. Organic solvents as probes for
the structure and function of the membrane: effects of ethanol on
the wild and ethanol resistant mutant of Escherichia coli K-12.
J. Bacteriol. 114: 239–248.
Gibson B.R., S.J. Lawrence, J.P. Leclaire, C.D. Powell and
K.A. Smart. 2007. Yeast responses to stresses associated with
industrial brewery handling. FEMS Microbiol. Rev. 31: 535–69.
Gonchar M.V., M.M. Maidan, H.M. Pavlishko and A. Sibirny.
2001. A new oxidase-peroxidase kit for ethanol assays in alco-
holic beverages. Food Technol. Biotechnol. 39: 37–42.
Fiedurek J. and A. Gromada. 1997. Selection of biochemical
mutants of Aspergillus niger with enhanced catalase production.
Appl. Microb. Biotechnol. 47: 313–316.
Hirasawa T., K. Yoshikawa, Y. Nakakura, K. Nagahisa,
C. Furusawa, Y. Katakura, H. Shimizu and S. Shioya. 2007.
Identification of target genes conferring ethanol stress tolerance
to Saccharomyces cerevisiae based on DNA microarray data
analysis. J. Biotechnol. 131: 34–44.
Hughest D.B., N.J. Tudroszen and C.J. Moye. 1984. The effect
of temperature on the kinetics of ethanol production by a thermo-
tolerant strain of Kluyveromyces marxianus. Biotechnol. Lett. 6:
1–6.
Ingram L.O., N.S. Vreeland and L.C. Eaton. 1980. Alcohol tole-
rance in Escherichia coli: a proposed common mechanism for
changes induced by ethanol. Pharmacol. Biochem. Behav. 13:
191–195.
Ismail A.A. and M.M. Ali. 1971. Selection of high ethanol-yield-
ing Saccharomyces I. Ethanol tolerance and the effect of training in
Saccharomycess cerevisiae Hansen. Folia Microbiol. 16: 346–369.
Jiménez J. and T. Benítez. 1988. Selection of ethanol-tolerant
yeast hybrids in pH-regulated continuous culture. Appl. Environ.
Microbiol. 54: 917–922.
Jones T.D., J.M. Havard and A.J. Daugulis. 1993. Ethanol pro-
duction from lactose by extractive fermentation. Biotechnol. Lett.
15: 871–876.
1
Lee I.S., J. Lin, H.K. Hall, B. Bearson and J.W. Foster. 1995.
The stationary-phase sigma factor sS (RpoS) is required for a sus-
tained acid tolerance response in virulent Salmonella typhimurium.
Mol. Microbiol. 17: 155–167.
Lloyd D., S. Morrell, H.N. Carlsen, H. Degn, P.E. James and
C.C. Rowlands. 1993. Effects of growth with ethanol on fermen-
tation and membrane fluidity of Saccharomyces cerevisiae. Yeast
9: 825–833.
Nishiwaki A. and I.J. Dunn. 1998. Analysis of a two-stage fer-
mentor with recycle for continuous ethanol production. Chem.
Eng. Commun. 168: 207–227.
Ogawa Y., A. Nitta, H. Uchiyama, I. Takesh, H. Shimoi and
K. Ito. 2000. Tolerance mechanism of the ethanol-tolerant mutant
of sake yeast. J. Biosc. Bioeng. 90: 313–320.
Ortiz-Zamora O., R. Cortés-García, M. Ramírez-Lepe,
J. Gómez-Rodríguez and M.G. Aguilar-Uscanga. 2008. Isola-
tion and selection of ethanol-resistant and osmotolerant yeasts
from regional agricultural sources in Mexico. J. Food. Process.
Engin. 32: 775–786.
Remize F., J.L. Roustan, J.M. Sablayrolles, P. Barre P and
S. Dequin. 1999. Glycerol overproduction by engineered Saccha-
romyces cerevisiae wine yeast strains leads to substantial changes
in by-product formation and to a stimulation of fermentation rate
in stationary phase. Appl. Environ. Microbiol. 65: 143–149.
Schubert C. 2006. Can biofuels finally take center stage? Nat.
Biotechnol. 24: 777–784.
Stanley D., S. Fraser, P.J. Chambers, P. Rogers and
G.A. Stanley. 2010. Generation and characterisation of stable
ethanol-tolerant mutants of Saccharomyces cerevisiae. J. Ind.
Microbiol. Biotechnol. 37: 139–149.
Van Uden N. 1985. Ethanol toxicity and ethanol tolerance in
yeasts. Ann. Rep. Ferm. Process. 8: 11–58.
de Vasconcelos J.N., C.E. Lopes and F.P. de Franca. 2004. Con-
tinuous ethanol production using yeast immobilized on sugar-cane
stalks. Braz. J. Chem. Eng. 21: 357–365.
Verbelen P.J., D.P. De Schutter, F. Delvaux, K.J. Verstrepen
and F.R. Delvaux. 2006. Immobilized yeast cell systems for con-
tinuous fermentation applications. Biotechnol. Lett. 28: 1515–1525.
Viegas C.A., M.F. Rosa, I. Sa-Correia and J.M. Novais. 1989.
Inhibition of yeast growth by octanoic and decanoic acids pro-
duced during ethanolic fermentation. Appl. Environ. Microbiol.
55: 21–28.
Wang F.S. and H.T. Lin. 2010. Fuzzy optimization of continuous
fermentations with cell recycling for ethanol production. Ind. Eng.
Chem. Res. 49: 2306–2311.
You K.M., C.L. Rosenfield and D.C. Knipple. 2003. Ethanol
tolerance in the yeast Saccharomyces cerevisiae is dependent on
cellular oleic acid content. Appl. Environ. Microbiol. 69: 1499–503.
Polish Journal of Microbiology
2011, Vol. 60, No 1, 59–63

ORIGINAL PAPER

Cytotoxicity of Aspergillus Fungi Isolated from Hospital Environment

AGNIESZKA GNIADEK1, ANNA B. MACURA2 and MACIEJ GÓRKIEWICZ3

1 Department
of Medical and Environmental Nursing, Faculty of Health Sciences
Jagiellonian University Medical College, Kraków, Poland
2 Department of Mycology, Chair of Microbiology, Jagiellonian University Medical College, Kraków, Poland
3 Department of Epidemiology and Population Research, Jagiellonian University Medical College, Kraków, Poland

Received 18 May 2010, revised 10 January 2011, accepted 14 January 2011

Abstract

The majority of mycotoxins produced by Aspergillus fungi are immunosuppressive agents, and their cytotoxicity may impair defense
mechanisms in humans. The objective of the study was evaluation of the cytotoxicity of fungi isolated from an environment where
inpatients with impaired immunity were present. The materials comprised 57 fungal strains: Aspergillus fumigatus, Aspergillus niger.
Aspergillus ochraceus, Aspergillus flavus, Aspergillus versicolor and Aspergillus ustus isolated from hospital rooms in Cracow. The
cytotoxicity of all the strains was evaluated using the MTT test (3-(4,5-dimethylthiazol-2-yl) 2,5 diphenyltetrazolium bromide). To emphasize
the differences in cytotoxicity among the particular strains, variance analysis (ANOVA) and Tukey’s difference test were used. Out of
57 Aspergillus strains tested, 48 (84%) turned out to be cytotoxic. The cytyotoxicity was high (+++) in 21 strains, mainly in A. fumigatus.
The least cytotoxic were A. niger fungi, this being statistically significant (p<0,05). To protect a patient from the adverse effects of
mycotoxins, not only his or her immunity status should be evaluated but also the presence of fungi in hospital environment and their
cytotoxicity should be monitored (possible exposure).

K e y w o r d s: Aspergillus sp., cytotoxicity, environment

Introduction lose their mycotoxin production potential (Fischer

There is evidence that a number of Aspergillus
fungi present in hospital environment produce toxins
(Burr, 2001; Ben-Ami et al., 2009; Klich et al., 2009).
Their secondary metabolites such as ochratoxin A,
aflatoxins, trichotecins or sterigmatocystine are toxic
for various cellular structures and interfere with key
processes like RNA and DNA synthesis (Ciegler and
Bennet, 1980). Depending on fungal species and/or
strain, mycotoxins differ in their specificity and influ-
ence on target cells, cellular structures and processes
in them (Steyn, 1995; Pitt, 2000). It should be also
kept in mind that not all moulds produce mycotoxins,
and their production depends on culture medium, life
cycle and environmental conditions (Pitt et al., 2000;
Kelman et al., 2004). To assess the ability of a given
strain to produce mycotoxins, the presence of other
moulds in the environment should be taken into
account as well as their influence on mycotoxin pro-
duction intensity. It has been documented that the
fungi incubated in monocultures in laboratory setting
and Dott, 2003; Jarvis and Miller, 2005). The ability
of fungi to produce mycotoxins is hard to evaluate
because there is a no possibility to analyze the myco-
toxins produced in the tissues of living organisms.
The relationship between disease (or predisposition
to it) and the level of exposure (detection of patho-
genic spores) as well as symptoms and signs charac-
teristic of experimental lesions produced by myco-
toxins may contribute to establishing the noxiousness
of fungi to human health. The objective of the study
was evaluation of the cytotoxicity of Aspergillus fungi
isolated from hospital environment.
Experimental
Materials and Methods
The materials comprised mould strains belonging
to the Aspergillus genus, isolated from the environment,
mainly from indoor air in hospital rooms at a number
of hospitals in Kraków in the years 2007–2008.

* Corresponding author: A. Gniadek, PhD, Department of Medical and Environmental Nursing, Faculty of Health Sciences,
Jagiellonian University Medical College, 12 Micha³owskiego str., 31-126 Kraków, Poland; phone: (+48 12) 6336259; fax: (+48 12) 429482;
e-mail: mxgniade@cyf-kr.edu.pl
60 Gniadek A. et al.
Primarily, the mycological flora was evaluated in hos-
pital ward environment (neonatal intensive care unit,
medical intensive therapy unit, the wards of chemo-
therapy and radiotherapy). The fungi were sampled
using a MAS 100 device (Merck) from the indoor air
in various hospital rooms. The species of particular
strains were detected on the basis of thorough macro-
scopic and microspocic analysis. Out of all of the
fungi isolated, 57 Aspergillus strains were randomly
chosen for further examination. The chosen strains
belonged to six species: A. fumigatus (21 strains),
A. niger (14 strains), A. ochraceus (13 strains), A. fla-
vus (5 strains), A. versicolor (3 strains) and A. ustus
(a single strain). The fungi were divided into groups:
each group comprised different species. The cytotoxi-
city test MTT (3-(4,5-dimethylthiazol-2-yl) 2,5 diphe-
nyltetrazolium bromide) was performed separately for
each strain. To evaluate the total cytotoxicity of the
fungi, swine kidney cells (SK) were used because they
are sensitive to most mycotoxins. The test is based on
the reduction of yellow MTT tetrazolium salt to violet
formazan, insoluble in water. The reduction occurs in
the presence of intact SK, not damaged by mycotoxins.
The intensity of reaction is proportional to the amount
of metabolically active SK. When the SK are infected
with moulds producing mycotoxins, their mitochon-
dria fail to reduce tetrazolium salt into formazan.
Therefore, when the SK are damaged by mycotoxins,
the reaction is less intensive or does not occur, which
can be measured photometrically as more or less
intensive change of colour. Thus, the reduction or the
absence of the reaction gives evidence of cytotoxicity
of the fungal strain tested. (Hanelt et al., 1994).
The analysis comprised the evaluation of a test
sample (Petri dish with the mould on Czapek medium)
and a control sample (Petri dish with Czapek medium).
The SK were grown in medium containing antibiotics
(penicillin and streptomycin, Sigma Aldrich) and calf
fetal serum (Sigma Aldrich) in the Hera Cell incuba-
tor with carbon dioxide, manufactured by Heraeus
(5% CO2, 37°C, 98% humidity). The number of SK
was 2.2× 105. The ranges of testing concentrations
were prepared in ratio 1:2 and amounted from 31.251
to 0.061 cm2/ml. The value was expressed in terms of
cm2/ml, where the area of the Petri dish from which
the moulds were extracted together with the medium,
was measured in square centimetres.
The quantitative evaluation of cytotoxicity was per-
formed using a microslide spectrophotometer (Elisa
Digiscan reader, Asys Hitech GmbH, Austria) and the
programme MikroWin 2000 (Mikrotek Laborsysteme
GmbH, Germany). The readings were made at the
wave-length of 510 nm. All of the absorption values
below 50% of the threshold activity were considered
as toxic. So, the borderline toxic concentration was
evaluated on the basis of the dilution i.e. the mean
1
inhibitory concentration IC50 was equal to the small-
est sample (in cm2/ml) which was toxic to the SK.
The cytotoxicity was considered as low (+) when the
values were within the range of 31.251>15.625> 7.813
[cm2/ml], intermediate (++) for the values > 3.906 >
1.953> 0.977 [cm2/ml], and high (+++) for > 0.488 >
0.244> 0.122> 0.061. The lack of cytotoxicity was
reported when the absorption value exceeded 31.251
[cm2/ml] (Gareis, 1994).
The cytotoxicity was tested in the Department of
Physiology and Toxicology, Institute of Experimental
Biology at the Casimirus the Great University in
Bydgoszcz, Poland.
To evaluate differences among the particular groups
of fungi, the fungi were divided into four groups. The
first group – I (21 strains) comprised fungi belonging
to the A. fumigatus species, the second group – II
(14 strains) A. niger, the third group – III (13 strains)
A. ochraceus, and the fourth group – IV (9 strains)
comprised the remaining strains (A. flavus, A. verisco-
lor and A. ustus). Descriptive statistics were used, and
the mean values and standard deviations were calcu-
lated. To show the differences of cytotoxicity of the
species tested ANOVA test was used. As the mean
toxicities were different in particular groups, the
Tuckey’s post hoc test was used to find out between
which groups the differences were significant. The
value of p< 0,05 was assumed as the borderline of
significance (Armitage, 1971).
Results
The amounts of fungi and fungal species varied
from one room to another. The mean numbers of fungi
in the particular wards varied from 5 to 2370 c.f.u.× m–3.
The fungi were most abundant in the neonatal inten-
sive care unit: the mean number of colonies on a single
Petri dish reflected 530 c.f.u.× m–3 in the indoor air.
The lowest number of fungi was detected in the
chemotherapy ward: 29 c.f.u.m–3 (Table I). The domi-
nating genera were Penicillium, Cladosporium and
Aspergillus. The highest percentage of Aspergillus
was isolated in the neonatal intensive care unit: 38%.
The moulds were the most abundant in this environ-
ment. The lowest percentage of Aspergillus was
detected in air-conditioned intensive therapy ward:
22%. The total number of Aspergillus strains isolated
was too high to evaluate cytotoxicity in all of them.
The strains chosen to cytotoxicity test originated from
three hospital wards because it was assumed that strains
from the same ward might be similar genotypically.
Out of the 57 Aspergillus strains tested, 48 (84%)
turned out to be cytotoxic. They belonged to the
following species: A. fumigatus 19/21, A. niger 8/14,
A. ochraceus 12/13, A. flavus 5/5, A. versicolor 3/3,
1 Cytotoxicity of Aspergillus sp. 61

Table I
Results of cytotoxicity tests

Number Number of
Number Numbers of fungal colonies c.f.u.×m–3 Percentage of fungi
of Aspergillus strains with
Ward of
strains examined documented
samples Minimum Maximum Mean Median A C P I for cytotoxicity cytotoxicity
Radiotherapy 130 5 360 39,5 17,5 32% 9% 31% 28% 16 12
Chemotherapy 130 5 130 29 20 29% 8% 29% 34% 20 16
Neonatal ICU 30 50 2370 530 260 38% 18% 32% 12% 12 12
Intensive therapy 48 5 170 40 30 22% 17% 38% 23% 9 8
ICU – intensive care unit, A – Aspergillus sp., C – Cladosporium sp., P – Penicillium sp., I– other fungal

Table II genicity within the particular fungal species (p = 0,03;

Distribution of fungal species in relation to their cytotoxicity p< 0,05). The least cytotoxic was the Aspergillus
niger species: its mean value 32.71 and SD 27.97
Cytotoxicity
No Species N (%) were the highest among the fungi tested. The Tuckey’s
None + ++ +++ post hoc test, performed following ANOVA, revealed
1 Aspergillus fumigatus 21 (37%) 2 1 7 11 that the cytotoxicity of A. niger is significantly lower
2 Aspergillus niger 14 (25%) 6 3 3 2 than those of A. fumigatus and A. ochraceus (p<0,05).
3 Aspergillus ochraceus 13 (23%) 1 3 2 7 The cytotoxicity of the other Aspergillus fungi
4 Aspergillus flavus 5 (8%) 0 2 2 1 (group IV) did not differ significantly from the three
5 Aspergillus veriscolor 3 (5%) 0 0 3 0 species mentioned above, which may be a result of
6 Aspergillus ustus 1 (2%) 0 1 0 0 too small number of fungi in the samples. Moreover,
Total 57 (100%) 9 10 17 21 the confidence interval was calculated for each of the
N– Total number of fungi; (+) – low cytotoxicity; species tested; these are presented in Fig. 1.
(++) – intermediate cytotoxicity; (+++) – high cytotoxicity

and a single strain A. ustus. Only nine strains were Discussion

not cytotoxic (16%). The absorption value > 31.251
[cm2/ml] (lack of cytotoxicity) was most frequently
found in A. niger (six strains). Twenty one strains tested
revealed high cytotoxicity (+++), most often A. fumi-
gatus (11 strains), and A. ochraceus (7 strains). Inter-
mediate cytotoxicity was found in seventeen strains,
mainly A. fumigatus. Ten strains revealed low cyto-
toxicity, mainly A. niger and A. ochraceus (Table II).
The ANOVA test revealed differences of the patho-
Fig. 1. Intervals of confidence 95% CI and mean value
of Aspergillus cytotoxicity estimated as difference between
reference level equal to 50 and measured value of IC 50 cm 2/ml.
Legend: the squares at the middle represent the mean value
of the estimated cytotoxicity, and the vertical lines represent the size
of the confidence interval of the estimated cytotoxicity.
Moulds can grow mainly in the environment in
which humidity exceeds 45%, the temperature is
within the range of 5°C–35°C (optimum 18°–27°C).
and water activity above 0.8. Such environment is
conducive to the production of secondary metabolites
– mycotoxins. Penicillium and Aspergillus are domina-
ting mould species in the rooms where water activity
is around 0.85 (Jarviss, 2003). The Aspergillus genus
is the most pathogenic to living organisms, however,
it globally produces less mycotoxins than Stachybotrys
even though the former dominates in the environment.
This may not be true in all the Aspergillus species,
because sterigmatocystein produced by A. versicolor
may contribute to 1% of its biomass when water acti-
vity is equal to one (Fog Nielsen, 2003). We managed
to isolate only three A. versicolor strains and to evalu-
ate their cytotoxicity, which was intermediate in all
cases. Such a small number of isolates resulted from
the fact that this fungal species is rarely isolated in-
door and is present mainly in colder regions such as
mountains or polar areas. The species most frequently
isolated from indoor air are A. fumigatus and A. niger.
Just these two species were most often isolated in our
study and examined for cytotoxicity.
It is reported in many papers that A. fumigatus
is the most pathogenic Aspergillus species (Bennett,
62 Gniadek A. et al.
2009; Krishnan et al., 2009; Albrecht et al., 2010).
This finding was confirmed by Kamei et al. (2002)
who analyzed the virulence of A. fumigatus, A. flavus,
A. niger and A. terreus and their influence on murine
macrophages. The macrophages treated with 1% A. fu-
migatus filtrate were seriously damaged, up to necro-
biosis while the damage caused by similar filtrates of
A. niger was lighter and that caused by A. flavus and
A. terreus was almost undetectable. Those data are
consistent with our findings because A. fumigatus was
the most frequently highly cytotoxic (+++) as com-
pared with other species, and only two strains out od
21 were not toxic to SK. On the other hand, only eight
out of fourteen A. niger strains were cytotoxic, but
their toxicity was the lowest as compared with other
species. All of the A. flavus strains were cytotoxic in
our study. Only five strains were tested, perhaps too
few to come to a conclusion.
The MTT test focused on in vitro influence of
fungi on living cells is performed with swine, sheep
or lamb cell cultures. Stec et al. (2007) investigated the
influence of mycotoxins such as aflatoxin B, ochra-
toxin, patuline, citrinine and zelarenon on various cell
cultures. They found out that SK fibroblasts were
most sensitive to mycotoxins, however, the intensity
of the yellow tetrazolium salt reduction to formazan
depended on the kind of toxin. It appears that the
choice of SK in our study was appropriate, and it
could be expected that the majority of strains isolated
in our study might by pathogenic to living organisms.
In further trials carried out by Stec et al. (2007) cell
cultures responded in different ways to treatment with
various mycotoxins. Therefore, it appears essential to
determine the kind of mycotoxins produced by highly
mycotoxic fungi. It is not always possible. In our pre-
vious study (Gniadek and Macura, 2003) performed
in 2001 with 21 A. flavus strains isolated from the
environment at social welfare homes were examined
for aflatoxins B1, B2, G1 and G2 using high performance
liquid chromatography – HPLC. Aflatoxins were not
detected in any of the strains tested. The strains were
not tested using MTT, however we were not sure that
they were not pathogenic. The isolated A. flavus strains
could produce the so called “masked mycotoxins”, e.g.
aflatrem, aspergillic acid, cyclopiaze acid, kojic acid,
maltoryzin, paspalicin or highly toxic sterigmatocys-
tine. It should be kept in mind that fungi are able to
produce mycotoxins in presence of other fungi (toxic
metabolites are released only in a cross-reaction with
toxins secreted by other fungi). (Fischer et al., 2000).
Such a conclusion may be confirmed by the findings
of Murtoniemi et al. (2005), who examined the influ-
ence of cytotoxicity of various fungi (Stachybotrys
chartarum, Streptomyces californicus, A. veriscolor
and Penicillium spinulosum) isolated from wet plaster
bars on murine macrophages. They have shown that
1
some microcultures, after prolonged growth on wet
cardboard sheets, were mutually stimulated or caused
a synergic growth of cytotoxic fungi (especially
S. chartarum and A. versicolor), but they did not
cause inflammatory reaction in the cells tested.
Variable environmental conditions may stimulate
fungi to produce mycotoxins, e.g. gliotoxin produced
by A. fumigatus (Ben-Ami et al., 2009; Kwon-Chung
and Sugui, 2009). This substance inhibits T-cell activ-
ity, stimulates macrophage apoptosis and is included
into pathogenesis of severe allergic rhinitis, bronchial
asthma and allergic alveolitis in form of farmer’s lung,
baker’s lung as well as allergic broncho-pulmonary
alveolitis (ABPA). The study carried out by Watanabe
et al. (2004) gives evidence that a good access to oxy-
gen stimulated A. fumigatus to produce toxic gliotoxins
and increased the general cytotoxicity of the fungi.
The conditions in the rooms in our study were condu-
cive to fungal growth: the mean temperature was 24°C,
and humidity around 40%.
The indoor environment is an active ecosystem
that changes in the course of time and as a result of
changing temperature and humidity, and in the pres-
ence of other microorganisms. The toxin production
by moulds is influenced by those factors and depends
also on the fungal culture age, the stage of sporula-
tion and the access to nutrients (Kelman et al., 2004).
The examination of the environment of a patient diag-
nosed with a mycotoxin infection is most often per-
formed after the initial phase of the disease and may
not reflect the exposure to harmful substances present
in the course of the disease (Gniadek et al., 2005;
Hardin et al., 2003). On the basis of the measurements
of environmental factors which appeared after the in-
fection, the real exposure at the onset of the disease
may be only estimated. Therefore, it is a reasonable
prophylactic measure to monitor mycological clean-
ness of the environment where immunocompromised
patients are present and to evaluate the cytotoxicity
of the fungi known as pathogenic.
Conclusions. 1. The majority of the fungi Asper-
gillus in the environment of the rooms tested were
cytotoxic and most often (p< 0,05) were non- A. niger.
2. To protect patients from harmful influence of myco-
toxins, the immunity status of the patients should be
evaluated and the presence of fungi in the environ-
ment should be monitored, including their cytotoxicity
testing (possible exposure).
Literature
Albrecht D., R. Guthke, A.A. Brakhage and O. Kniemeyer.
2010. Integrative analysis of the heat shock response in Aspergil-
lus fumigatus. BMC Genomics. 15: 11–32.
1 Cytotoxicity of Aspergillus sp.
Armitage P. 1971. Statistical Methods in Medical Research.
Blackwell Scientific Publications. Oxford. p. 189–207
Ben-Ami R., R.E. Lewis, K. Leventakos and D.P. Kontoyiannis.
2009. Aspergillus fumigatus inhibits angiogenesis through the
production of gliotoxin and other secondary metabolites. Blood.
114: 5393–5399.
Bennett J.W. 2009. Aspergillus: a primer for the novice. Med.
Mycol. 47 (Suppl. 1): S5–12.
Burr M.L. 2001. Health effects of indoor moldes. Rev. Environ.
Health. 16: 97–103.
Ciegler A. and J.W. Bennet. 1980. Mycotoxins and mycotoxi-
cosis. Bioscience 30: 512–513.
Fischer G. and W. Dott. 2003. Relevance of airborne fungi and
their secondary metabolites for environmental, occupational and
indoor hygiene. Arch. Microbiol. 179: 75–82.
Fischer G., T. Müller, R. Schwalbe, R. Ostrowski and
W. Dott. 2000. Species-specific profiles of mycotoxins pro-
duced in cultures and associated with conidia of airborne
fungi derived from biowaste. Int. J. Hyg. Environ. Health. 203:
105–116.
Fog Nielsen K. 2003. Mycotoxin production by indoor molds.
Fungal Genet Biol. 39: 103–117.
Gareis M. 1994. Cytotoxicity testing of samples originating from
problem buildings. [In:] Fungi and Bacteria in Indoor Air Environ-
ments: Health Effects, Detection and Remediation. E. Johanning
(ed.), Eastern New York Occupational Health Program, Saratoga
Springs, New York, USA, Proceedings. 139–144.
Gniadek A. and Macura A.B. 2003. The presence of fungi in
the environment of social welfare homes and the mycotoxins
threat (in Polish). Ann. Univ. Maria Sklodowska. Sect. D. Med.
58 (Suppl 13): 416–421.
Gniadek A., A.B. Macura, E. Oksiejczuk, E. Krajewska-
Ku³ak and C. £ukaszuk. 2005. Fungi in the air of selected social
welfare homes in the Ma³opolskie and Podlaskie provinces – a com-
parative study. Int. Biodeterior. Biodegrad. 55: 85–91.
Hanelt M., M. Gareis and B. Kollarczik. 1994. Cytotoxicity of
mycotoxins evaluated by the MTT-cell culture assay. Mycopatho-
logia 128: 167–174.
63
Hardin B.D., B.J. Kelman and A. Saxon. 2003. Adverse human
health effects associated with molds in the indoor environment.
J. Occup. Environ. Med. 45: 470–478.
Jarvis B.B. 2003. Analysis for mycotoxins: the chemist’s perspec-
tive. Arch. Environ. Health. 58: 479–483.
Jarvis B.B. and J.D. Miller. 2005. Mycotoxins as harmful in-
door air contaminants. Appl. Microbiol. Biotechnol. 66: 367–372.
Kamei K., A. Watanabe, K. Nishimura and M. Miyaji. 2002.
Cytotoxicity of Aspergillus fumigatus Culture Filtrate Against
Macrophages. Nippon Ishinkin Gakkai Zasshi. 43: 37–41.
Kelman B.J., C.A. Robbins, L.J. Swenson and B.D. Hardin.
2004. Risk from inhaled mycotoxins in indoor office and residen-
tial environments. Int. J. Toxicol. 23: 3–10.
Klich M.A., S. Tang and D.W. Denning. 2009. Aflatoxin and
ochratoxin production by Aspergillus species under ex vivo condi-
tions. Mycopathologia 168: 185–191.
Krishnan S., E.K. Manavathu and P.H. Chandrasekar. 2009.
Aspergillus flavus: an emerging non-fumigatus Aspergillus species
of significance. Mycoses. 52: 206–222.
Kwon-Chung K.J. and J.A. Sugui. 2009. What do we know
about the role of gliotoxin in the pathobiology of Aspergillus
fumigatus? Med. Mycol. 47 (Suppl. 1): S97–103.
Murtoniemi T., P. Penttinen, A. Nevalainen and M.R. Hirvonen.
2005. Effects of microbial cocultivation on inflammatory and cyto-
toxic potential of spores. Inhal. Toxicol. 17: 681–693.
Pitt J.I. 2000. Toxigenic fungi: which are important? Med. Mycol.
38 (Suppl. 1): 17–22.
Pitt J.I., J.C. Basilico, M.L. Abarca and C. López. 2000. Myco-
toxins and toxigenic fungi. Med. Mycol. 38 (Suppl. 1): 41–46.
Stec J., M. Szczotka and J. KuŸmak. 2007. Cytotoxicity of feed-
borne mycotoxins to animal cell lines in vitro using MTT assay.
Bull. Vet. Inst. Pulawy 51: 679–684.
Steyn P.S. 1995. Mycotoxins, general view, chemistry and struc-
ture. Toxicology Letters 82/83: 843–851.
Watanabe A., K. Kamei, T. Sekine, H. Higurashi, E. Ochiai,
Y. Hashimoto and K. Nishimura. 2004. Cytotoxic substances
from Aspergillus fumigatus in oxygenated or poorly oxygenated
environment. Mycopathologia 158: 1–7.
64 Gniadek A. et al. 1
Polish Journal of Microbiology
2011, Vol. 60, No 1, 65–71

ORIGINAL PAPER

Production and Partial Characterization of High Molecular Weight Extracellular

"-amylase from Thermoactinomyces vulgaris Isolated from Egyptian Soil
M.I. ABOU DOBARA, A.K. EL-SAYED, A.A. EL-FALLAL and N.F. OMAR*

Botany Department, Faculty of Science, Mansoura University (Damietta Branch), Egypt

Received 14 July 2010, revised 15 January 2011, accepted 20 January 2011

Abstract

Optimizing production of "-amylase production by Thermoactinomyces vulgaris isolated from Egyptian soil was studied. The optimum
incubation period, temperature and initial pH of medium for organism growth and enzyme yield were around 24 h, 55°C and 7.0,
respectively. Maximum "-amylase activity was observed in a medium containing starch as carbon source. The other tested carbohydrates
(cellulose, glucose, galactose, xylose, arabinose, lactose and maltose) inhibited the enzyme production. Adding tryptone as a nitrogen
source exhibited a maximum activity of "-amylase. Bactopeptone and yeast extract gave also high activity comparing to the other nitrogen
sources (NH4Cl, NH4NO3, NaNO3, KNO3, CH3CO2NH4). Electrophoresis profile of the produced two "-amylase isozymes indicated
that the same pattern at about 135–145 kDa under different conditions. The optimum pH and temperature of the enzyme activity were 8.0
and 60°C, respectively and enzyme was stable at 50°C over 6 hours. The enzyme was significantly inhibited by the addition of metal ions
(Na+, Co2+ and Ca2+) whereas Cl– seemed to act as activator. The enzyme was not affected by 0.1 mM EDTA while higher concentration
(10 mM EDTA) totally inactivated the enzyme.

K e y w o r d s: Thermoactinomyces vulgaris, high molecular weight "-amylase

Introduction the decreased risk of contamination, the increased dif-

Enzymes produced by thermophilic bacteria have
been highlighted for their potential as biocatalysts in
biotechnology. The importance of this was referred
to the general relationship between enzyme thermo-
stability and the thermophilicity of the host bacterium
(Herbert, 1992).
The "-amylase (EC 3.2.1.1) is a well-known endo-
amylase that hydrolyzes starch by randomly cleaving
internal a- 1,4 – glucosidic linkages. The spectrum of
"-amylase applications has widely used in many
fields, such as starch saccharification, textile, food,
brewing, distilling industries, medical and analytical
chemistries (Pandey et al., 2000). Despite this, interest
in new and improved "-amylase is growing vastly.
Therefore, the search for thermostable Ca2+ indepen-
dent "-amylase (Tonkova, 2006) is continuous. Enzy-
mes of the thermophilic actinomycetes Thermoactino-
myces species, especially their "-amylase (Ito et al.,
2007), have attracted much interest because of their
activity at high temperature. The advantages for using
thermostable "-amylases in industrial processes include
fusion rate and the decreased cost of external cooling.
In addition, the stability of biocatalysts is often a limi-
ting factor in the selection of enzymes for industrial
applications due to the elevated temperature or extreme
pH of many biotechnological processes.
The aim of the investigations was to determine the
optimum conditions for production of highly active
and industrial stable "-amylase by an Egyptian isolate
of the thermophilic actinomycete Thermoactinomyces
vulgaris and to investigate the enzyme properties.
Experimental
Materials and Methods
T. vulgaris strain. T. vulgaris strain was isolated
from fertile soil samples collected from Egypt at
50°C and identified according to Bergey’s Manual
of Systematic Bacteriology (Lacey and Cross, 1989).
The culture was maintained on Czapek-yeast-casein
(CYC) agar slants.

* Corresponding author: N.F. Omar, Botany Department, Faculty of Science, Mansoura University (Damietta Branch), New
Damietta, Egypt. P.O. Box 34517; e-mail: noha_omar15@yahoo.com
66 Abou Dobara M.I. et al.
Production of "-amylase. The organism was
grown in conical flasks containing starch-nitrate me-
dium (Waksman, 1959) as a basal medium with pH
adjusted to 7.5. The medium (20 ml taken in 250 ml
Erlenmeyer flasks) was inoculated with 1 ml of spore
suspension of pure colonies of the organism and in-
cubated at 50°C with shaking (150 rpm) for 72 hours.
The initial pH of the medium (4.0–10.0), tempera-
ture of incubation (30–60°C), and incubation period
(12–96 h) were tested for "-amylase production. Dif-
ferent carbon sources (1%) and nitrogen sources
(equimolecular nitrogen amounts equivalent to the
nitrogen content of the basal medium) were used for
optimization of nutritional factors. The various tested
carbon sources were: starch, cellulose, glucose, galac-
tose, xylose, arabinose, lactose and maltose. The nitro-
gen sources were included NH4Cl, NH4NO3, NaNO3,
KNO3, ammonium acetate, bactopeptone, yeast extract
and tryptone were tested.
On the compilation of the previous experiments,
the cell-free enzyme supernatant was obtained by cen-
trifugation at 8000×g for 20 min. Experiments were
carried out in triplicate and the results were treated
statistically and standard errors are shown.
"-Amylase assay. The amylase assay was based on
the reduction in blue colour intensity resulting from
starch hydrolysis (Palanivelu, 2001). The reaction
mixture consisted of 0.4 ml of diluted enzyme, 0.5 ml
of 0.1% soluble starch and 1 ml of phosphate buffer
(0.1 M, pH 7) was incubated at 50°C for 10 minutes.
The reaction was stopped by adding 0.5 ml of 0.1 N
HCl and the colour was developed by adding 0.5 ml
of (2% KI in 0.2% I2) solution. The optical density
(OD) of the blue colour solution was determined using
a Unico 7200 SERIES spectrophotometer at 690 nm.
One unit of enzyme activity is defined as the quantity
of enzyme that caused 20% reduction of blue colour
intensity of starch iodine solution at reaction incuba-
tion temperature in 1 min per ml.
Intracellular protein content of T. vulgaris. The
harvested mycelia of T. vulgaris strain were used for
determination of intracellular protein. Washed pellets
were dissolved in 20 ml of NaOH (1 M), and boiled
for 20 minutes. Dilution of clarified solution was used
to determine the intracellular protein concentration
using Bradford method (1976). Bovine serum albumin
was used as standard.
Physicochemical properties of "-amylase. Enzy-
me activity at various temperatures and pH was stud-
ied by incubating reaction mixtures at different tem-
peratures (30–80°C) and Tris-HCl buffer (pH 4.0–9.0).
Enzyme stability at various temperatures was also stud-
ied by pre-incubating cell-free supernatants for differ-
ent time (1–6 h) at various temperatures (50°C–80°C).
The effect of metal salts (NaCl, CoCl2 and CaCl2)
and EDTA on activity was determined by adding of
1
different concentrations of each salt to the standard
assay. Activities were expressed as a percentage of
the maximal activity.
Ammonium sulphate precipitation of the en-
zyme. The supernatant of culture was brought to 70%
ammonium sulphate saturation in an ice bath. The pre-
cipitated protein was collected by centrifugation at
3000×g at 4°C and dissolved in 1–2 pellet volumes
of phosphate buffer (0.1 M, pH 7.0). The enzyme
solution was dialyzed overnight at 4°C against the same
buffer then concentrated over sucrose bed. The final
enzyme solution was taken for polyacrylamide gel elec-
trophoresis (PAGE).
Electrophoresis and molecular weight determi-
nation. Nondenaturing PAGE was carried out by
omitting SDS from the method of Laemmli (1970)
with 10% polyacrylamide. The reference pre-stained
protein marker (Molecular weights 10 to 170 kDa,
SM 0671, Fermentas) was used. Amylase activity of
proteins was detected according to Garcia-Gonzalez
et al., (1991) by incubating the gels at 50°C for 20 min
in 0.2 M phosphate buffer (pH 7.0) containing 2% starch
and then immersing in staining solution (KI 13 g/l and
I2 6 g/l). The gel was destained with distilled water.
The stain was stable for only a few minutes.
Statistical analysis. Data were statistically ana-
lyzed for variance and the least significant difference
(LSD at 0.01 level) using one-way analysis of vari-
ance (ANOVA). A software system SPSS version 15
was used.
Results
The production of "-amylase by T. vulgaris in-
creased significantly during the growth of the organ-
ism, with the maximum production after 24 hours
(1.03 ± 0.09 U/ml). After 36 hours the activity was
reduced rapidly by 72.8% (Fig. 1). Although there was
Fig. 1. Effect of incubation period on growth and "-amylase
production by T. vulgaris grown in starch-nitrate medium
containing 1.0 % starch.
1 Extracellular "-amylase from Thermoactinomyces vulgaris 67

Fig. 4. Effect of pH on growth and "-amylase production

by T. vulgaris grown in starch-nitrate medium containing
1.0 % starch
( ) denotes the final pH.

Fig. 2. Active-PAGE of "-amylase profile of T. vulgaris

grown in starch-nitrate medium containing 1.0 % starch
after 24 hours (A), and 72 hours (B).
Arrows indicate the position of the two "-amylase isozymes
of approximate size between 135–145 kDa.
a significant increase in the production after 72 hours,
the "-amylase profile; on active PAGE didn’t differ
from that at 24 hours (Fig. 2) as they produce two
"-amylase isozymes with approximate molecular
weight 135–145 kDa.
The optimum temperatures for the production of
"-amylase were in the range 45°C to 55°C with non
significant difference in this range. Below 45°C, the
organism could grow weakly but no activity could be
detected (Fig. 3).
Maximum production occurred in the pH range of
6.0 to 7.0 (3.5 U/ml), increasing the pH above 7.0
induced a significant decrease in the yield. At pH 10.0
and below pH 6, the production of the enzyme was
completely inhibited (Fig. 4).
T. vulgaris was able to grow well using different
carbon sources (1% w/v), namely, starch, cellulose,
glucose, galactose, xylose, arabinose, lactose and mal-
tose. However, the used carbon sources other than
starch induced an extremely significant decrease in
the enzyme yield (Table I). Although different carbon
sources affected the quantity of the enzyme production,
it didn’t affect its isozymal pattern as they produced
the same two "-amylase isozymes of approximate
molecular weight 135–145 kDa (data not shown).
Tryptone, bactopeptone, yeast extract and NH4Cl
caused a highly significant increasing in enzyme pro-
duction comparing with KNO3 of the basal medium
(Table II). The highest production of "-amylase
(93.81 ± 0.20 U/ml) was recorded with tryptone and
the lowest (1.86±0.16) was recorded with NaNO3.
The different used nitrogen sources (NH4Cl, NH4NO3,
NaNO3, KNO3, ammonium acetate, bactopeptone, yeast
Table I
Effect of carbon sources on growth and "-amylase
production by T. vulgaris grown in starch-nitrate medium
containing different carbon sources instead of starch

Carbon sources Amylase Intracellular protein

(1.0%) (w/v) (U/ml) (mg/ml)
Starch 3.43 ± 0.02 1.06 ± 0.04
Glucose 0.04 ± 0.02 0.78 ± 0.02
Galactose 0.02 ± 0.01 0.86 ± 0.08
Xylose 0.10 ± 0.06 0.76 ± 0.02
Arabinose 0.07 ± 0.02 0.76 ± 0.01
Lactose 0.11 ± 0.02 0.63 ± 0.02
Maltose 0.36 ± 0.05 0.71 ± 0.04
Fig. 3. Effect of temperature on growth and "-amylase production Cellulose 0.05 ± 0.03 0.52 ± 0.01
by T. vulgaris grown in starch-nitrate medium containing
1.0% starch. ± standard error
68 Abou Dobara M.I. et al. 1

Table II Table III

Effect of nitrogen sources on growth and "-amylase Effect of various EDTA concentrations on "-amylase
production by T. vulgaris grown in starch-nitrate medium activity. The enzyme activities are represented relative to
containing different nitrogen sources instead of KNO3 the control activity

Amylase Intracellular Concentration of EDTA (mM) Amylase relative activity (%)

Nitrogen sources Final PH
(U /ml) protein (mg/ml) 0.001 99.62 ± 4.46
Ammonium acetate 6.71 1.06 ± 0.15 6.46 ± 0.11 0.01 104.36 ± 1.70
Tryptone 6.75 1.10 ± 0.12 93.81 ± 0.20 0.1 108.85 ± 0.10
Yeast extract 6.87 0.72 ± 0.03 45.29 ± 0.08 0.5 53.59 ± 0.52
Bactopeptone 6.64 0.93 ± 0.07 63.05 ± 0.63 1 18.81 ± 5.78
NH4Cl 6.46 0.66 ± 0.06 21.56 ± 3.64 5 1.12 ± 0.70
NH4NO3 6.40 0.95 ± 0.03 6.34 ± 0.17 10 0.00 ± 0
NaNO3 6.81 0.80 ± 0.01 1.86 ± 0.16 ± standard error
KNO3 6.73 0.53 ± 0.02 3.54 ± 0.01

± standard error The enzyme was significantly influenced by the

different metal salts including NaCl, CoCl2 and CaCl2
extract and tryptone) didn’t have any effect on the (Fig. 7). CoCl2 induced significant inhibition of the
enzyme electrophoretic profile. The "-amylase profile enzyme activity. An amount of 1 mM of NaCl and
had the same previous pattern of two "-amylase CaCl2 caused extremely significant decrease in enzyme
isozymes at about 135–145 kDa (data not shown).
Physicochemical properties of "-amylase. The
"-amylase activity couldn’t be detected at pH 4.0 but
it increased significantly with the increase of the pH
until it reaches its optimum point at pH 8.0 (Fig. 5).
The optimum activity occurred at temperature range
between 50°C and 60°C, with an optimum point of
60°C (Fig. 5). The minimum level of the activity
(54.4 ± 2.3 U/ml) was occurred at 80°C.
The enzyme was stable at 50°C retaining about
80% of its activity over 6 hours incubation period,
but at higher temperature the activity of the enzyme
declined (Fig. 6). At 60°C and 70°C, the enzyme has
a half-life of about one hour. However, at 80°C it
retained more than 20% of its activity up to 4 hours.
At 90°C the enzyme lost its activity rapidly.
Fig. 6. Effect of temperature on the stability of "-amylase.
The enzyme activities are represented relative to the maximal value.

Fig. 7. Effect of various metal salts concentrations

Fig. 5. Effect of temperature and pH on "-amylase activity. on "-amylase activity.
The enzyme activities are represented relative to the maximal value. The enzyme activities are represented relative to the control activity.
1 Extracellular "-amylase from Thermoactinomyces vulgaris
activity by about 80% and 70% respectively. How-
ever, increasing of their concentration up to 10 mM
of NaCl and CaCl2 resulted in retaining 60.8% and
63.4% of its activity respectively. The enzyme acti-
vity was not affected by 0.001, 0.01 and 0.1 mM
EDTA but it was totally inactivated by 10 mM EDTA
(Table III). On the other hand, 0.5 mM EDTA was
found to decrease the activity to 53.6% comparing
with the control (96.6 Uml–1).
Discussion
"-Amylases have been isolated from diversified
sources including plants, animals, and microbes, where
they play a dominant role in carbohydrate metabolism.
In spite of the wide distribution of "-amylase, micro-
bial sources are used for the industrial production. This
is due to their advantages such as cost effectiveness,
consistency, less time and space required for produc-
tion, and ease of process modification and optimiza-
tion (Lonsane and Ramesh, 1990). Growth expressed
as intracellular protein and "-amylase production by
the thermophilic actinomycete Thermoactinomyces
vulgaris reached maximum values after 24 hrs, after
which, the activity was reduced rapidly by 72.8%.
This might be corresponding to the rapid autolysis of
Thermoactinomyces species (Lacey, 1971). However,
it increased significantly at 60 and 72 hours. After
72 hrs, the production decreased gradually and reached
its minimum recorded level at 96 hours. As the
isozymal pattern was the same at 24 hrs and 72 hrs,
the observed peaking and troughing of the production
can be attributed to differential inhibition by products
of substrate hydrolysis rather than the isozymes down
or over expression. In support, studies on both gluco-
amylase and "-amylase indicate that inhibition does
not occur below a critical concentration of product
(Wang et al., 2006). These results indicated that the
production of extracellular "-amylase by T. vulgaris
was growth associated and this is in agreement with
other investigators (Kuo and Hartman, 1966; Shimizu
et al., 1978; Murthy et al., 2009; Asoodeh et al., 2010).
The influence of temperature on amylase produc-
tion is related to the growth of the organism. The
present results revealed an optimum yield of "-amy-
lase at 45°C to 55°C. In spite of the relative good
growth of the organism at 40°C, "-amylase activity
couldn’t be detected. This referred to the action of
protease; that is rapidly inactivated at higher tem-
perature (Behnke et al., 1982), which suppresses the
amylolytic activity.
The pH change of the growth medium not only
affected the growth and "-amylase secretion of T. vul-
garis but also influence the enzyme stability in the
medium. Therefore, the difference of the final pH of
69
the medium from pH 10.0 to pH 6.0 could explain the
complete inhibition of the enzyme activity at pH 10.0
in contrast to the optimum production at pH 6.0 in
spite of the same ability of the organism to grow.
The results confirms the inducibility nature of the
"-amylase when different carbon sources were used
and compared. In support, starch is known to induce
amylase production in different bacterial strains (Aiyer,
2004; Ryan et al., 2006; Asoodeh et al., 2010). The
"-amylase production is also appeared to be subjected
to catabolite repression by maltose and glucose, like
most other inducible enzymes that are affected by
substrate hydrolytic products (Bhella and Altosaar,
1985; Morkeberg et al., 1995). Other carbon sources
have been found to be strongly repressive although
they supported good growth.
Among nitrogen sources, organic nitrogen sources
have been preferred for the production of "-amylase,
with ammonium acetate as an exception. It was re-
corded that organic nitrogen sources supported maxi-
mum "-amylase production by various bacteria and
fungi due to their high nutritional amino acids and
vitamins content (Gupta et al., 2003). The role of
amino acids and vitamins in enhancing the "-amylase
production in different microorganisms have been
reported to be highly variable (Gupta et al., 2003).
Tryptone was the best nitrogen source that increased
the productivity of "-amylase by 26.5 fold comparing
to KNO3. Ammonium chloride induced a significant
increase in the enzyme yield that is higher than that
of the ammonium acetate. Similar effect of ammo-
nium chloride was obtained for B. subtilis DM-03
(Das et al., 2004). Although the different nitrogen
sources had a variable effect on "-amylase activity,
they did not produce different isozymal profile. This
indicate that they have no effect on the isozymal
"-amylase over expression.
Most raw starch degrading enzymes had optimum
pH in the acidic to neutral range (Pandey et al., 2000;
Sun et al., 2010). In the present work, "-amylase from
T. vulgaris showed a pH activity profile with a flat
top which retaining more than 75% of the enzyme
activity in the pH range 5.0–9.0, despite it was com-
pletely inhibited at pH 4.0. This pH profile could
be attributed to the limitation of the enzyme catalysis
by protonation of the nucleophile at low pH and by
deprotonation of the hydrogen donor at high pH values
(Nielsen et al., 2001). At reaction temperature of 60°C,
the enzyme expresses maximum activity whereas it
showed less than 50% of its activity at 30°C. This
reduced activity might be attributed to the reduced
molecular flexibility of the thermophilic protein under
mesophilic conditions. Although the enzyme showed
only 4% of its activity at 80°C, it showed more than
20% of its activity at 50°C after being kept at 80°C
for 4 hrs indicating inhibition of the enzyme catalysis
70 Abou Dobara M.I. et al.
at 80°C rather than inactivation of the enzyme. In gen-
eral, "-amylase from T. vulgaris, in the present work,
is fairly stable at 50°C over 6 hrs and with a half-life
of about one hour at both 60°C and 70°C.
It is proposed that "-amylases belong to a new
class of metallo-enzymes characterized by a prosthetic
group, i.e., an alkaline-earth metal rather than a tran-
sition element, and which plays primarily a structural
role (Prakash and Jaiswal, 2010). At different concen-
tration of CoCl2, a significant inhibition in the enzyme
activity was recorded. The Co2+ effect was explained
by Leveque et al., (2000) to be a result of competition
between the exogenous cations and the protein-asso-
ciated cation. In spite of the important role of both
calcium and sodium ions to retain the structure and
function of "-amylases (Prakash and Jaiswal, 2010),
"-amylase in the present study was strongly inhibited
by both 1 mM CaCl2 and NaCl. Similar inhibitory
effect of CaCl2 was reported to amylase of Aspergillus
oryzae EI 212 (Kundu et al., 1973). Calcium inde-
pendent "-amylase is suitable for the manufacture of
fructose syrup, where Ca2+ is an inhibitor of glucose
isomerase (Tonkova, 2006).
Increasing the concentration of CaCl2 and NaCl
was found to retain the enzyme activity, assuming that
Cl– ion has a stabilizing role. Chloride ions have been
found mainly in the active site of mammalian "-amy-
lases, which have been shown to enhance the cata-
lytic efficiency of the enzyme (Prakash and Jaiswal,
2010). In accordance with retaining the enzyme
activity at high concentration of CaCl2 and NaCl, the
enzyme yield when using ammonium chloride was
found to be 3.3 fold of that using other sources of
ammonium i.e., NH4NO3 and ammonium acetate.
Regarding to the effect of EDTA, the enzyme retained
almost 100% activity when 0.1 mM EDTA was added
to the reaction mixture. But 0.5 mM EDTA inhibited
the enzyme activity retaining only 53% of its activity.
The inhibitory effect of EDTA was also documented
by many studies (Gupta et al., 2003). Although the
molecular weights of microbial "-amylases are usually
range between 50 to 60 kDa (Vihinen and Mantsala,
1989), the present result revealed a highly molecular
weight of two "-amylase isozymes (135–145 kDa).
In support, Thermoactinomyces vulgaris R-47 was
reported to produce two "-amylases, TVAI and TVAII
with molecular weights of 71 kDa and 67.5 kDa
respectively (Ohtaki et al., 2003). However, molecular
weight of some "-amylases was found to rise owing
to carbohydrate moieties (Gupta et al., 2003). In con-
clusion, the present results indicated a new active
highly molecular weight, thermostable and calcium
independent "-amylase of T. vulgaris which could be
of importance for the starch-processing industries.
Further work is in progress to purify the "-amylase of
T vulgaris and characterize the purified enzyme.
1
Literature
Aiyer P.V.D. 2004. Effect of C: N ratio on alpha amylase production
by Bacillus licheniformis SPT 27. African J. Bacteriol. 3: 519–522.
Asoodeh A., J. Chamanic and M. Lagzian. 2010. A novel ther-
mostable, acidophilic "-amylase from a new thermophilic “Bacil-
lus sp. Ferdowsicous” isolated from Ferdows hot mineral spring
in Iran: Purification and biochemical characterization Int. J. Biol.
Macromol. doi:10.1016/j.ijbiomac.2010.01.013
Behnke U., H. Ruttloff and R. Kleine. 1982. Preparation and
characterization of proteases from Thermoactinomyces vulgaris.
V. Investigations on autolysis and thermostability of the purified
protease. Z. Allg. Mikrobiol. 22: 511–519.
Bhella R.S. and I. Altosaar. 1985. Purification and some proper-
ties of the extracellular "-amylase from Aspergillus awamori. Can.
J. Microbiol. 31: 149.
Bradford M.M. 1976. A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the prin-
ciple of protein dye binding. Anal. Biochem. 72: 248–254.
Das K., R. Doley and A.K. Mukherjee. 2004. Purification and
biochemical characterization of thermostable, alkaliphilic, extracel-
lular "-amylase from B. subtilis DM-03, a strain isolated from the
traditional food of India. Biotechnol. Appl. Biochem. 40: 291–298.
Garcia-Gonzalez M.D., J.F. Martin, T. Vigal and P. Liras.
1991. Characterization, expression in Streptomyces lividans, and
processing of the amylase of Streptomyces griseus IMRU 3570:
Two different amylases are derived from the same gene by an
intracellular processing mechanism. J. Bacteriol. 173: 2451–2458.
Gupta R., G. Paresh, H. Mohapatra, V.K. Goswami and
B. Chauhan. 2003 Microbial "-amylases: a biotechnological per-
spective. Process Biochem. 38: 1599–1616.
Herbert R. A. 1992. Molecular biology and biotechnology of
extremophiles. Herbert R.A. and T.J. Sharp (eds). Blackie, Glasgow
and London, pp. 1–43.
Ito K., S. Ito, k. Ishino, A. Shimizu-Ibuka and H. Sakai. 2007.
Val326 of Thermoactinomyces vulgaris R-47 amylase II modu-
lates the preference for alpha-(1,4)- and alpha-(1,6)-glycosidic
linkages. Biochimica et Biophysica Acta 1774: 443–449.
Kundu A.K., S. Das and T.K. Gupta. 1973. Influence of culture
and nutritional conditions on the production of amylase by the
submerged culture of Aspergillus oryzae. J. Ferment. Technol.
51:142–150.
Kuo M.J. and P.A. Hartman. 1966. Isolation of amylolytic
strains of Thermoactinomyces vulgaris and production of thermo-
philic actinomycete amylases. J. Bacteriol. 92:723–726.
Lacey J. 1971. Thermoactinomyces sacchari sp. nov., a thermophilic
actinomycete causing bagassosis. J. Gen. Microbiol. 66: 327–338.
Lacey J. and T. Cross. 1989. Genus Thermoactinomyces Tsiklin-
sky 1899, 501AL. pp. 2574–2585. In: Williams S.T., M.E. Sharpe
and J.G. Holt (eds). Bergey’s Manual of Systematic Bacteriology,
vol. 4. Baltimore, Williams & Wilkins.
Laemmli U.K. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227: 680–685.
Leveque E., S. Janecek, B. Haye and A. Belarbi. 2000. Ther-
mophilic archaeal amylolytic enzymes. Enzyme Microbiol.
Technol. 26: 3–14.
Lonsane B.K. and M.V. Ramesh (eds). 1990. Production of bac-
terial thermostable "-amylase by solid state fermentation: a poten-
tial tool for achieving economy in enzyme production and starch
hydrolysis. pp. 1–56. In: Advances in applied microbiology,
vol. 35. San Diego: California Academic Press.
Morkeberg R., M. Carlsen and J. Neilsen. 1995. Induction and
repression of "-amylase production in batch and continuous cul-
tures of Aspergillus oryzae. Microbiology. 141: 2449–2454.
Murthy P.S., M.M. Naidu and P. Srinivas. 2009. Production of
"-amylase under solid-state fermentation utilizing coffee waste.
J. Chem. Technol. Biotechnol. 84: 1246–1249.
1 Extracellular "-amylase from Thermoactinomyces vulgaris
Nielsen J., T. Borchert and G. Vriend. 2001. The determinants
of "-Amylase pH-activity profiles. Protein Engineering 14:
505–512.
Ohtaki A., A. Iguchi, M. Mizuno, T. Tonozuka, Y. Sakano and
S. Kamitori. 2003. Mutual conversion of substrate specificities
of Thermoactinomyces vulgaris R-47 "-amylases TVAI and
TVAII by site-directed mutagenesis. Carbohydrate Research 338:
1553–1558.
Palanivelu P. 2001. Analytical Biochemistry and separation
Techniques. Kalamani Printers, Madurai, India.
Pandey A., P. Nigam, C.R. Soccol, V.Y. Soccol, D. Singh and
R. Mohan. 2000. Advances in microbial amylases. Biotechnol.
Appl. Biochem. 31: 135–152.
Prakash O. and N. Jaiswal. 2010. "-amylase: An ideal repre-
sentative of thermostable enzymes. Appl. Biochem. Biotechnol.
DOI 10.1007/s12010-009-8735-4
Ryan S.M., G.F. Fitzerald and D. Sinderen. 2006. Screening
and identification of starch-, amylopectin-, and pullulan-degrad-
ing activities in Bifidobacterial strains. Appl. and Environmen.
Microbiol. 72: 5289–5296.
71
Shimizu M., M. Kanno, M. Tamura and M. Suckane. 1978.
Purification and some properties of a novel "-amylase produced
by a strain of Thermoactinomyces vulgaris. Agric. Biol. Chem.
42: 1681–1688.
Sun H., P. Zhao, X. Ge, Y. Xia, Z. Hao, J. Liu and M. Peng.
2010. Recent advances in microbial raw starch degrading enzymes.
Appl. Biochem. Biotechnol. 160: 988–1003.
Tonkova A. 2006. Microbial starch converting enzymes of the
"-Amylase family. In: Ray R.C. and wards O.P. (eds.), pp. 421–472,
Microbial Biotechnology in Horticulture, Science Publishers,
Enfield, New Hampshire, USA.
Vihinen M. and P. Mantsala. 1989. Microbial amylolytic en-
zymes. Crit. Rev. Biochem. Mol. Biol. 24: 329–418.
Waksman S.A. 1959. Strain specificity and production of anti-
biotic substances. X. characterization and classification of species
within the Streptmyces griseus Group. Proc. Natl. Acad. Sci. USA
45: 1043–1047.
Wang J.P., A.W. Zeng, Z. Liu and X.G. Yuan. 2006. Kinetics
of glucoamylase hydrolysis of corn starch. J. Chem. Techn. and
Biotechn. 81: 727–729.
72 Abou Dobara M.I. et al. 1
Polish Journal of Microbiology
2011, Vol. 60, No 1, 73–78

ORIGINAL PAPER

Halomonas sp. nov., an EPA-Producing Mesophilic Marine Isolate

from the Indian Ocean
DIPTI SALUNKHE1, NEHA TIWARI1, SANDEEP WALUJKAR2 and RAMA BHADEKAR1*

1 Department of Microbial Biotechnology, Rajiv Gandhi Institute of IT and Biotechnology

Bharati Vidyapeeth Deemed University, Katraj, Pune 411 046, Maharashtra, India
2 National Center of Cell Sciences, University of Pune, Ganeshkhind, Pune 411 007, Maharashtra, India

Received 18 May 2010, revised 19 January 2011, accepted 20 January 2011

Abstract

Marine samples from the Indian Ocean were used to isolate and characterize the organisms with respect to their fatty acid profiles. Six
mesophilic isolates (MBRI 6, MBRI 8, MBRI 9, MBRI 10, MBRI 12 and MBRI 13) were obtained from three different water samples.
They were i) Gram-negative, ii) catalase positive, iii) produced acid from glucose and maltose, iv) tolerated 5 to 15% NaCl v) except
MBRI 9, showed pH tolerance in the range of 5.0 to 9.0 with optimum pH 7.0 to 8.0 v) grew well at 30oC and were able to grow in the range
of 15 to 45oC. EPA, an essential omega-3 fatty acid, was produced by these isolates in the range of 12 to 60% at 30oC. MBRI 12 was found
to be a potential source as it produced 60% EPA. This isolate was further identified by partial 16S rDNA sequencing and phylogenetic
analysis revealed that the strain belonged to Gammaproteobacteria and was closely related to Halomonas bolviensis (96% sequence
similarity, 570 bp). Thus a new genus of Halomonas may be included in earlier reported EPA- producing prokaryotic genera affiliated to
the Gammaproteobacteria.

K e y w o r d s: Gammaproteobacteria, Halomonas bolviensis, Alpha-linoleic acid, nutraceuticals, polyunsaturated fatty acid

Introduction (LA)/ALA in our diet influences the ratio of omega-6/

Long chain polyunsaturated fatty acids (LC-PUFAs)
are essential components of membrane lipids of various
organisms (Berge and Barnathan, 2005). They are well
documented for their beneficial physiological effects
in human health including i) lowering of plasma cho-
lesterol and triglycerols ii) prevention of certain car-
diovascular diseases (atherosclerosis and thrombosis)
and iii) reducing the risk of breast, colon and pancre-
atic cancer (Robert et al., 2009). Alpha-linoleic acid
(ALA), ecosapenthaenoic acid (EPA) and docosahe-
xaenoic acid (DHA) are the major LC-PUFAs of ge-
neral nutritional importance, suggested by numerous
nutritional bodies (Simopoulos et al., 1999). Although
the recommended ratio of dietary omega-6 and omega-3
fatty acids is 5:1 (Sargent, 1997), it has shifted heavily
towards omega-6 acids in the current western diet and
by some estimate, is up to 30-fold too high (Simopoulos,
1999). The main reason being an increase in the con-
sumption of vegetable oils rich in omega-6 fatty acids.
Since omega-6 and omega-3 fatty acids are not inter-
convertible in the human body, the ratio of linoleic acid
* Corresponding author: R. Bhadekar, phone: 020-24365713; fax: 91-20-24379013; e-mail: neeta.bhadekar@gmail.com
omega-3 fatty acids LC-PUFAs. To correct this imbal-
ance, the needed omega-3 LC-PUFAs, can be obtained
in our diet from external sources such as fish oil.
The current commercial sources of EPA and DHA
are restricted to fish and algal-derived oils. Problems
exist with both of these sources. Commercial fish
stocks are likely to decline in the future, since the
demand for fish oil in the aquaculture industry alone is
estimated to exceed the supply by 2010 due to increase
in global population (Meyers and Worm, 2003). Be-
sides the concern for the presence of contaminants,
such as mercury and polychlorinated biphenyls, in
some fish oils, makes it evident that alternative sources
of LC-PUFAS must be found (Jacobs et al., 2004).
Algal-derived oils require a relatively high investment
in technology compared to bacterial fermentation,
although bacteria contain a lower proportion of lipid
(Nichols et al., 1996). A key advantage of bacte-
rial PUFA production is that only a single PUFA is
produced, rather than the complex mixture yielded
from fish or algal oils (Russell and Nichols, 1999).
Thus bacterial sources of PUFA remove the expense
74 Salunkhe D. et al.
of preparative purification in the production of high-
purity PUFA oils. In addition to their potential use
as “cell factories” bacteria in particular offer the bio-
technological opportunity to study the structure and
regulation of the genes and enzymes responsible for
PUFA production.
Numerous bacterial species of marine origin pro-
ducing PUFAs are particularly prevalent in high-pres-
sure, low temperature and deep-sea habitats (Yano
et al., 1997). This is an important adaptation for coun-
tering the effects of hydrostatic pressure and low tem-
perature on fluidity or phase of membrane lipid (Allen
and Bartlett, 2002). Halophilic organisms are also
known to be good sources of different bioactive com-
pounds (Margesin and Schinner, 2001). Recently we
have reported halotolerant organisms from different
food samples (Jadhav et al., 2010a) as well as from
wall scrapings of historical building in India (Jadhav
et al., 2010b). They were novel owing to their abili-
ties to fix atmospheric nitrogen and produce industri-
ally important enzymes.
Considering the significance of PUFA in human
health and limitations in using fish oils, microorgan-
isms prove the best suitable alternative. However use
of psychrophilic or piezophilic organisms producing
EPA, necessitates the need of low temperature and
high pressure facilities (Gentile et al., 2003). Hence
use of organisms producing these nutraceuticals at
room temperature will be efficient and reasonably
priced. The present work was aimed at isolation of
marine organisms from the Indian Ocean and charac-
terizing them with respect to their fatty acid profiles.
Being mesophilic in nature, high PUFA producing
isolates could be conveniently used for pilot scale pro-
duction and for further scale-up. To our knowledge
this is the first report of a high EPA- producing ma-
rine isolate from the Indian Ocean.
Experimental
Material and Methods
Sampling. Water samples were collected during
summer 2008 from different locations in the Indian
Ocean (Table I). All chemicals were procured from
Himedia and Merck, India. All were of A.R. grade.
Table I
Different sampling locations
Depth Tempera-
Location Latitude Longitude pH
(m) ture (°C)
6NT/LT/BOT 18°48”52”N 72°46’30”E 13 8.02 30.4
2NT/LT/BOT 15°33.01”6”N 73°56.58”E 9.5 7.62 31.8
2ST/LT/BOT 15°33.01”6”N 73°56.58”E 11 7.62 31.8
1
Isolation and characterization of microorgan-
isms. 10 ml of each individual sample were inocu-
lated in 100 ml Marine Salt Medium (MSM) (Compo-
sition per litre: 81.0 g NaCl, 10.0 g yeast extract, 9.6 g
MgSO4, 7.0 g MgCl2, 5.0 g protease peptone no 3,
2.0 g KCl, 1.0 g glucose, 0.36 g CaCl2, 0.06 g NaHCO3
and 0.026 g NaBr with pH adjusted to 7.0 ± 0.2) and
incubated at 30°C, 120 rpm for 48 hrs. After 48 hrs,
0.1 ml of each sample was spread on MSM agar plates
and incubated for another 48 hrs. The isolated colo-
nies were maintained on MSM agar slants.
The isolates were characterized morphologically,
physiologically and biochemically. Acid production
was studied by using different sugars (glucose, fruc-
tose, sucrose, lactose, mannitol and maltose). They
were also studied qualitatively for their ability to
secrete extracellular enzymes (amylase, catalase, ure-
ase, protease, and gelatinase) (Collee et al., 1989).
MSM broth supplemented with various concentra-
tions of NaCl (ranging from 1–25%) was used to
examine salt-tolerance of the isolates. The cultures
were incubated at 30°C, 120 rpm for 24 hrs and cell
growth was determined by measuring the absorbance
at 660 nm. Temperature tolerance was examined by
incubating the cultures at temperatures 15°C, 30°C
and 45°C for 24 hrs. Further these isolates were
screened for pH tolerance in MSM broth adjusted
to pH 5.0–11.0. The media at different pH were in-
oculated with overnight grown inoculum (107 cells/ml).
Cell growth was determined by measuring the absor-
bance at 660 nm.
Preparation of fatty acid methyl esters (FAMES).
10% inoculum of all the isolates was used to inocu-
late MSM and incubated at 30°C in an orbital shaker
(Remi, India) at 120 rpm. Cells were harvested after
24 hrs by centrifugation (Plastocraft, India) at 10,000
rpm for 12 mins. Following centrifugation, the super-
natant was discarded, the cell pellet resuspended in
1.0% NaCl (w/v), and recentrifuged. Each bacterial
culture tube was capped and stored at 4°C. Cells were
reweighed, to which a fresh solution of the trans-
esterification reaction mix (methanolic HCl (0.6 N)
4 ml) was added in the tubes (Carrapiso and Garcia,
2000). The tubes were capped tightly and the solu-
tions were vortexed for 5 s to 10 s and heated in an
80°C ± 2°C water bath for 2 hrs. The tubes were then
cooled quickly in ice.
Conducti- D.O.
Salinity Isolates
vity (ms) (mg/l)
71.61 974.7 3.98 MBRI 9, MBRI 10 and MBRI 12
27.05 412.4 4.72 MBRI 8
27.05 412.4 4.72 MBRI 6 and MBRI 13
1 High EPA producing novel Halomonas sp.
The resultant FAMES were extracted twice by
adding 2 volumes of hexane and then 1 volume of
hexane by centrifugation at 5000 rpm for 15 mins.
The upper phase of hexane layer was separated and
stored for gas chromatography analysis.
Gas chromatography analysis of bacterial ex-
tracts. Analyses of the FAMES were performed with
a Chemito GC 1000 equipped with a 50 m× 0.25 mm
internal diameter cross-linked methyl silicone fused-
silica CP – SIL 88 capillary column and flame ioniza-
tion detector. Samples were injected at 100°C in the split
mode. After 5 mins the oven was temperature-program-
med from 100°C to 198oC at the rate of 1.5°C min–1
and hold for 9 mins. Nitrogen was used as a carrier
gas, and the injector and detector were maintained at
225 and 250°C respectively. Peak areas were quanti-
fied using chromatography software (IRIS 32, India).
16S rDNA sequencing. The isolate producing
high amount of PUFA was used for identification by
16S rDNA sequencing. The genomic DNA was iso-
lated as described by Ausubel et al. (1987). The PCR
assay was performed using Applied Biosystems, model
9800 with 1.5 µl of DNA extract in a total volume
of 25 µl. The PCR master mixture contained 2.5 µl of
10X PCR reaction buffer (with 1.5 M MgCl2), 2.5 µl
of 2 mM dNTPs, 1.25 µl of 10 pm/µl of each oligo-
nucleotide primers 27f (5’CCAGAGTTTGATCGT
GGCTCAG3’), 1488r(5’CGGTTACCTTGTTACGA
CTTCACC 3’), 0.24 µl of Taq DNA polymerase and
15.76 µl of glass distilled PCR water.
Initially denaturation accomplished at 94°C for
3 min. Thirty-five cycles of amplification consisted of
denaturation at 94°C for 1 min, annealing at 55°C for
1 min and extension at 72°C for 1 min. A final exten-
sion phase at 72°C for 10 min was performed. The
PCR product was purified by PEG-NaCl method. The
sample was mixed with 0.6 times volume PEG-NaCl
[20% PEG (MW 6000), 2.5 M NaCl] and incubated
for 40 min at 37°C. The precipitate was collected by
centrifugation at 3,800 rpm for 28 min. The pellet was
washed with 70% ethanol, air dried and sequenced
using 96 well sequencing plate as per manufacturer’s
instructions.
The thermocycling for the sequencing reactions
was performed with a 9800 PCR model (Applied
Biosystems). It began with an initial denaturation at
94°C for 2 min, followed by 35 cycles of PCR con-
sisting of denaturation at 94°C for 10 sec, annealing
at 50°C for 10 sec and extension at 68°C for 4 min.
The samples were purified using standard proto-
cols described by Applied Biosystems, Foster City,
USA. To this, 10 µl of Hi-Di formamide was added
and vortexed briefly. The DNA was denatured by
incubating at 95°C for 3 min, kept on ice for 5–10 min
and was sequenced in a 3730 DNA analyzer (Applied
Biosystems) following manufacturer’s instructions.
75
Nucleotide sequence accession number. The par-
tial 16S rDNA sequence generated in this study was
deposited in Gen Bank + EMBL+ DDBJ+ PDB under
the accession number GU593323. Sequence was com-
pared with the compilation of 16S rDNA genes avail-
able in the Gen Bank + EMBL+ DDBJ+ PDB library
by BLASTN 2.2.17 searching.
Results and Discussion
Isolation and characterization. Total six bacterial
isolates were isolated from the three samples of Indian
Ocean (Table I). The isolates were grown and mainta-
ined on MSM. They were named as MBRI 6, MBRI 8,
MBRI 9, MBRI 10, MBRI 12 and MBRI 13. All
6 MBRI isolates were characterized morphologically,
biochemically and physiologically. They i) were Gram-
negative ii) produced catalase, iii) produced acid from
glucose and maltose, iv) tolerated 5 to 15% of salt, v)
except MBRI 9, showed pH tolerance in the range of
5.0–9.0 with optimum pH of 7.0–8.0, vi) grew well at
30°C and v) were able to grow in the range of 15 to
45°C. MBRI 6, MBRI 8, MBRI 9 and MBRI 10 pro-
duced acid from fructose while MBRI 6, MBRI 8 and
MBRI 13 used lactose. Only MBRI 11 was able to uti-
lize sucrose as carbon source. MBRI 10 and MBRI 12
could grow on citrate as carbon source. MBRI 9 tol-
erated a wide pH range of 6.0–9.0.
Fatty acid profile. All six isolates were analysed
for their fatty acids profiles (Table II). The results indi-
cated that total saturated fatty acids, monounsaturated
fatty acids and polyunsaturated fatty acids were in the
range of 21 to 100%, 11 to 30% and 1 to 62% respec-
tively. Interestingly, MBRI 10 did not show presence
of unsaturated fatty acids. Linoleic acid was the only
omega-6 fatty acid detected in MBRI 8, MBRI 9 and
MBRI 12. It was detected in the range of 1 to 6%,
while omega-3 fatty acids were ALA and EPA (0.5 to
16% and 12.0 to 60%, respectively). Arachinoidic
acid and docosahexanoic acid were not detected in
any of the isolates. Trans-fatty acids were also not
detected in these isolates. So far, EPA has mainly been
reported to occur in eukaryotes and some peizophilic
or psychrophilic microorganisms (Freese et al., 2009).
Bacteria are known to alter the composition of their
phospholipid fatty acids side-chains in order to main-
tain appropriate membrane organization and function
(Suutari and Laakso, 1994). At low temperatures or
high pressures, the content of unsaturated fatty acids
often increases with a concomitant decline in satu-
rated fatty acids (Allen et al., 1999). Polyunsaturated
fatty acids (PUFAs), such as EPA and DHA, are
particularly effective in the adjustment of membrane
fluidity due to their low melting points (Hazel, 1995).
Hence several EPA producing marine organisms isolated
76 Salunkhe D. et al. 1

Table II
Fatty acid profile of MBRI isolates

Fatty acids MBRI 6 MBRI 8 MBRI 9 MBRI 10 MBRI 12 MBRI 13

C 4:0 0.2 7.7 11.6 21.9 6.8 19.3
C 6:0 0.4 2.2 2.7 8.4 2.0 7.3
C 8:0 2.2 4.5 8.3 2.5 N.D. 2.4
C 10:0 0.5 0.7 3.8 5 1.2 N.D.
C 11:0 0.7 0.8 1.2 6.1 1.4 1.1
C 12:0 0.8 1.0 N.D. N.D. N.D. 0.8
C 13:0 N.D. N.D. 1.4 N.D. N.D. N.D.
C 14:0 18.1 34.3 8.7 14.1 1.7 4.1
C 15:0 N.D. N.D. N.D. N.D. N.D. 1.9
C 16:0 25.1 19.7 22.0 42.1 8.5 8.1
C 17:0 N.D. 0.9 0.9 N.D. N.D. 4.8
C 18:0 7.2 11.7 0.8 N.D. N.D. 2.5
Total Saturated Fatty acids 55.3 83.5 61.4 100 21.6 52.3
C 16:1 1.6 2.7 25.7 N.D. 12.1 10.7
C 18:1 6.9 0.9 2.7 N.D. 4.7 2.5
C 22:1 0.6 N.D. N.D. N.D. N.D. N.D.
C 17:1 2.3 11.7 1.1 N.D. N.D. N.D.
Total Unsaturated Fatty Acids 11.4 15.3 29.5 N.D. 16.8 13.2
C 18:2 n6t N.D. 1.1 5.9 N.D. 1.5 N.D.
C 18:2 n6c 4.7 N.D. 0.8 N.D. N.D. N.D.
C 18:3 n6 15.9 N.D. 2.5 N.D. 0.7 N.D.
C 20:5 n3 12.8 N.D. N.D. N.D. 59.5 34.4
Total Polyunsaturated Fatty Acids 33.8 1.1 9.2 N.D. 61.7 34.4

N.D. – Not detected

were psychophilic and peizophilic from polar regions
and deep sea, as mentioned earlier. However the recent
isolation of mesophilic EPA-producing Shewanella
species from a temperate estuary (Skerratt et al., 2002)
and from shallow seawater samples (Frolova et al.,
2005; Freese et al., 2008) suggested that EPA may
not be restricted to psychrophiles and piezophiles.
Figure 1 shows the comparison of % EPA pro-
duced by our isolates with that of microalgae and
mesophilic bacterial cultures. Vazhappilly and Chen
(1998) have reported upto 34.2% EPA in various
microalgae at 25°C. However recovery of EPA from
these sources is difficult along with poor yields.
Freese et al. (2009) have documented up to 1.2% EPA
in various organisms at 30°C (Fig. 1). Different sp. of
Shewanella were reported to produce EPA up to 6.5%
at 28°C (Ivanova et al., 2003; Ivanova et al., 2004;
Hirota et al., 2005), probably indicating that tempera-
ture sensitive enzymes were involved in biosynthesis.
Thus our isolates appear novel owing to their ability
to produce high EPA at 30°C. Also these studies con-
tradict the notion that only barophilic or cold-adapted
species are able to produce significant levels of
PUFAs such as EPA.
Oleaginous fungi are also known to store large
amounts of lipid, mainly triglycerols, and Mortierella
spp. are noteworthy for the n-3 and n-6 PUFA contents
of their stored lipid. Typically up to 40% of the fungal
dry weight may be triacylglycerol in which the acyl
chains are up to 15% EPA or 55% AA (Singh and
Ward, 1997). Our results are comparable to these
observations besides the advantage of rapid cultivation
and easy recovery.
Branched chain fatty acids (BCFAs) have re-
peatedly been reported to promote cold adaptations
(Chattopadhyay and Jagannadham, 2001). Our results
showing comparatively low levels (1 to 34%) of
BCFAs in all the isolates except MBRI 10 support
these observations. However in some other bacteria
no clear changes in BCFAs with varying growth tem-
perature were observed (Nichols et al., 2002).
Phylogeny. MBRI 12, the highest EPA producing
isolate was identified using partial 16S rDNA sequenc-
ing. The sequence was deposited in EMBL+ Genbank
under accession number GU593323. BLAST analysis
of partial 16S rDNA sequence revealed that the strain
belonged to Gammaproteobacteria and was closely
related to Halomonas bolviensis (96% sequence simi-
larity, 570 bp). All so far known EPA-producing
prokaryotes affiliate with only a few genera within
two bacterial phyla: The Gammaproteobacteria (e.g.
genera Shewanella, Moritella, Colwellia, Alteromonas,
1 High EPA producing novel Halomonas sp.
Fig. 1. Comparison of % EPA produced by MBRI isolates
(this work) with other mesophilic marine bacteria and microalgae.
1. MBRI 12 ; 2. MBRI 13; 3. Monodus subterraneus UTEX 151,
4. Chlorella minutissima UTEX 2341, 5. Phaeodactylum tricornutum
UTEX 642 (Vazhappilly and Chen, 1998); 6. MBRI 6 ; 7. Shewanella
pneumatophori (Hirota et al., 2005); 8. Shewanella waksmanii (Ivanova
et al., 2003); 9. Shewanella pacifica (Ivanova et al., 2004); 10. Photo-
bacterium sp. SAMA2, 11. Vibrio sp. NB73, 12. Shewanella sp. NB72
(Freese et al., 2009).
and Photobacterium) and the Bacteroidetes (e.g Flexi-
bacter and Psychroserpens). Therefore, EPA may be
a potentially useful marker for these genera in environ-
mental microbial communities (Freese et al., 2009).
Our results suggest that a new genus of Halomonas
may be added to earlier reported EPA producing
prokaryotic genera belonging to Gammaproteobacteria.
Conclusions. 1. The occurrence of high levels of
EPA in MBRI isolates (present work) with MBRI 12
being highest producer of EPA which could be com-
mercially exploited. 2. This is probably the first
report of Halomonas sp. producing EPA at 30°C in
the presence of high salt-concentration.
Acknowledgements
This work is financially supported by the Department of Bio-
technology, New Delhi, Government of India. We are thankful
to Honorable Dr. Shivajirao Kadam, V.C., Bharati Vidyapeeth
Deemed University and Dr. R.M. Kothari, Principal, Rajiv Gandhi
Institute of IT and Biotechnology, (BVDU) for providing facilities
to undertake this work. We are also thankful to Dr. D.P. Nerkar
and Ms. V. V. Jadhav for their assistance.
Literature
Allen E.E. and D.H. Bartlett. 2002. Structure and regulation
of the omega-3 polyunsaturated fatty acid synthase genes from
the deep-sea bacterium Photobacterium profundum strain SS9.
Microbiology 148: 1903–1913.
77
Allen E.E. and D.H. Bartlett. 1999. Monounsaturated but not
polyunsaturated fatty acids are required for growth of the deep-sea
bacterium Photobacterium profundum SS9 at high pressure and
low temperature. Appl. Environ. Microbiol. 65: 1710–1720.
Ausubel F.M., R. Rrent, R.E. Kingston, D.D. Moore,
J.G. Seidman, J.A. Smith and K. Struhl. 1987. Current Proto-
cols in Molecular Biology. Wiley, New York.
Berge J.P. and G. Barnathan. 2005. Fatty acids from lipids
of marine organisms: molecular biodiversity, role as biomarkers,
biologically active compounds and economical aspects. Adv.
Biochem. Eng. Biotechnol. 96: 49–125.
Carrapiso A.I., and C. Garcia. 2000. Development in lipid
analysis: some new extraction techniques and in situ transesteri-
fication. Lipids 5(11): 1167–77.
Chattopadhyay M.K. and M.V. Jagannadham. 2001. Mainte-
nance of membrane fluidity I Antarctic bacteria. Polar. Biol. 24:
386–388.
Collee J.G., J.P. Duguid, A.G. Fraser and B.P. Marmion. 1989.
Practical Medical Microbiology. Churchill Livingstone, Medical
Division of Longman Group UK Ltd., New York.
Freese E., J. Koster and J. Rullkoter. 2008. Origin and compo-
sition of organic matter in tidal flat sediments from the German
Wadden Sea. Org. Geochem. 39: 820–829.
Freese E., H. Rutters, J. Koster, J. Rullkoter and H. Sass.
2009. Gammaproteobacteria as a possible source of ecosapen-
tanoic acid in anoxic intertidal sediments. Aqu. Microbiol. 57:
444–454
Frolova G.M., K.G. Pavel, A.A. Shparteeva, O.I. Nedashkov-
skaya, N.m. Gorhkova, E.P. Ivanova, and V.V. Mikhail. 2005.
Lipid composition of novel Shewanella species isolated from far
eastern seas. Microbiology 74: 664–669.
Gentile G., V. Bonasera, C. Amico, L. Giuliano and M.M.
Yakimov. 2003. Shewanella sp. GA-22, a psychrophilic hydrocar-
bonoclastic antarctic bacterium producing polyunsaturated fatty
acids. J. Appl. Microbiol. 95: 1124–1133
Hazel J.R. 1995. Thermal adaptation in biological membranes: is
homeoviscous adaptation the explanation? Annu. Rev. Physiol. 57:
19–42
Hirota K.Y. Nodasaka, Y. Orikasa, H. Okuyama and I. Yumoto.
2005. Shewanella pneumatophori sp. nov., an eicosapentaenoic
acid producing marine bacterium isolated from the intestines of
Pacific mackerel (Pneumatophorus japonicus). Int. J. Syst. Evol.
Microbiol. 55: 2355–2359
Ivanova E.P., N.M. Gorshkova, J.P. Bowman, A.M. Lysenko,
N.V. Zhukova, A.F. Sergeev, V.V. Mikhailov and D.V.N. 2004.
Shewanella pacifica sp. nov., a polyunsaturated fatty acid-produc-
ing bacterium isolated from sea water. Int. J. Syst. Evol. Microbiol.
54: 1083–1087.
Ivanova E.P., O.I. Nedashkovskaya, N.V. Zhukova, D.V. Nicolau,
R. Christen and V.V. Mikhailov. 2003. Shewanella waksmanii
sp. nov., isolated from a sipuncula (Phascolosoma japonicum) Int.
J. Syst. Evol. Microbiol. 53: 1471–1477.
Jacobs M.N., A. Covaci, A. Gheorghe and P. Schepens. 2004.
Time trend investigation of PCBs, OCPs, and PBDEs in n-3 poly-
unsaturated fatty acid-rich dietary fish oil & vegetable oil supple-
ment; Nutritional relevance for human essential n-3 fatty acid
requirement. J. Agri. Food. Chem. 52: 1780–1788.
Jadhav G.G., D.S. Salunkhe, D.P. Nerkar and R.K. Bhadekar.
2010a. Isolation and characterization of salt-tolerant nitrogen-
fixing microorganisms from food. Eur. J. Biosci. 4: 33–40
Jadhav G.G., D.S. Salunkhe, D.P. Nerkar and R.K. Bhadekar.
2010b. Novel Staphylococcus sp. isolated from wall scrapings of
a historical building in India. Ann. Microbiol. 60: 197–201.
78 Salunkhe D. et al.
Margesin R. and F. Schinner. 2001. Potential of halotolerant and
halophilic microorganisms for biotechnology. Extremophiles 5(2):
73–83
Meyers R.A. and B. Worm. 2003. Rapid worldwide depletion of
predatory fish communities. Nature 432: 280–283.
Nichols D.S., P. Hart, P.D. Nichols and T.A. McMeekin. 1996.
Enrichment of the rotifer Brachinous plicatilis fed an Antarctic
bacterium containing polyunsaturated fatty acid. Aquaculture 147:
115–125.
Nichols D.S., K.A. Presser, J. Olley, T. Ross and T.A. McMeeekin.
2002. Variation of branched-chain fatty acids marks the normal
physiological range for growth in Listeria monocytogenes. Appl.
Environ. Microbiol. 68: 2809–2813
Robert S.S., J. R. Petrie, X. Zhou, M. P. Mansour,
S.I. Blackburn, A.G. Green, S.P. Singh and P.D. Nichols. 2009.
Isolation and characterization of a )5-fatty acids elongase from the
marine microalgae Pavlova salina. Mar. Biotechnol. 11: 410–418.
Russell N.J., and D.S. Nichols. 1999. Polyunsaturated fatty acids
in marine bacteria – a dogma rewritten. Microbiology 145: 767–779.
Sargent J.R. 1997. Fish oils and human diet. Br. J. Nutr. 78:
Suppl. 1, 5–13.
1
Simopoulos A.P., A. Leaf and N., Jr Salem. 1999. Workshop on
the essentiality of and recommended dietary intakes for omega-6
and omega-3 fatty acids. Food. Aust. 51: 332–333.
Simopoulos A.P. 1999. Essential fatty acids in health and chronic
disease. Am. J. Clin. Nutr. 70(3): 560S–569S.
Singh A. and O.P. Ward. 1997. Microbial production of
docosahexaenoic acid (DHA, 22:6) Adv. Appl. Microbiol. 45:
271–312.
Skerratt J.H., J.P. Bowman and P.D. Nicholas. 2002. Shewa-
nella olleyana sp. nov., a marine species isolated from a temperate
estuary which produces high levels of polyunsaturated fatty acids.
Int. J. Syst. Evol. Microbiol. 52: 2101–2106.
Suutari M. and S. Laakso. 1994. Microbial fatty-acids and ther-
mal adaptation. Crit. Rev. Microbiol. 20: 285–328
Vazhappilly R and F. Chen. 1998. Eicosapentaenoic acid and
docosahexaenoic acid production potential of microalgae and their
heterotrophic growth. J. Am. Oil Chem. Soc. 75(3): 393–397
Yano Y., A. Nakayama and K. Yoshida. 1997. Distribution of
polyunsaturated fatty acids in bacteria present in intestines of deep-
sea fish and shallow-sea poikilothermic animals. Appl. Environ.
Microbiol. 63: 2572–2577.
Polish Journal of Microbiology
2011, Vol. 60, No 1, 79–83

SHORT COMMUNICATION

Yersinia Species in the Dunnock (Prunella modularis) in Sub-alpine Habitats

of the Western Carpathians
JANA KISKOVÁ* , ZUZANA HREHOVÁ, MARIÁN JANIGA, MARTIN LUKÁÒ, MARTINA HAAS
and MARTINA JURÈOVIÈOVÁ

Institute of High Mountain Biology, University of Žilina, Tatranská Javorina, Slovakia

Received 29 August 2010, revised 5 December 2010, accepted 15 December 2010

Abstract

The study presents the prevalence of Yersinia species in dunnok Prunella modularis from the sub-alpine zone of the Western Carpathians.
Bacteria were detected from cloacal and pharyngeal swabs from 97 specimens using PCR assay. Yersinia enterocolitica showed the
highest prevalence (47.4%) from among the determined Yersinia species. Yersinia species (except Y. frederiksenii) were detected more
frequently in pharyngeal than cloacal samples. The highest prevalence of yersiniosis was detected in April (Yersinia spp. – 80%,
Y. enterocolitica – 70%). No statistically differences were observed in the prevalence of Yersinia spp. between males and females and
between juveniles and adult birds. Bacterial contamination did not affect body weight or tarsus length.

K e y w o r d s: Yersinia spp. Yersinia enterocolitica, Dunnock Prunella modularis

The genus Yersinia is a highly heterogeneous group
of the family Enterobacteriaceae comprising acknowl-
edged pathogens and a variety of strains that are widely
distributed in nature in both aquatic and terrestrial
ecosystems (Cover and Aber, 1989). Many species
such as Yersinia enterocolitica are psychrophilic bacte-
ria capable of persisting and growing in cold environ-
ments (Kato et al., 1985; Gill and Reichel, 1989).
The wild-living birds, due to their great mobility,
may play a significant role as effective spreaders
of Yersinia through faecal contamination of pastures
and surface waters (Kaneuchi et al., 1989; Niskanen
et al., 2003).
There are only a few studies on bacteria living in
wild birds in the extreme environments of the subal-
pine and alpine vegetation levels. Janiga et al. (2007)
identified the composition of microflora in the diges-
tive tract of the alpine accentor (Prunella collaris) as
a typical species of alpine environments. Novotný
et al. (2007) specifically discussed the ecology of
Yersinia spp. in relation to alpine accentors consider-
ing that the genus Yersinia may play an important role
in the ecology of this bird species.
The objective of this study was to continue research
of yersiniosis in lower sub-alpine habitats in the West
Carpathians. The dunnock (Prunella modularis) is
a dominate bird species of the dwarf-pine ecosystem
(950–1 700 m a.s.l) and as the alpine accentor is the
member of the family Prunellidae, therefore it was
chosen as experimental host species for this micro-
biological study.
From April 2007 to July 2009, 97 free-living
dunnocks were captured with mist nets in the local
mountains of the Slovakian part of the Western
Carpathians – The West, High, Low and Belianske
Tatras, Great and Small Fatra, Babia hora, and Choè
(from 1 000 to 1 750 m a.s.l). Captured birds were
identified as adults or juveniles (age ≤ 2 months).
Adult birds were sexed by the presence of a cloacal
protuberance in males (Nakamura, 1990). They were
weighed with 0.2 g accuracy using a Pesola spring
scale and standard morphometric measurements were
taken. Two types of samples were collected from each
bird – pharyngeal and cloacal swabs. Samples were
taken using sterile transport swabs suitable for both
aerobes and anaerobes (DispoLab, Copan Italia,
Brescia, Italy).
Isolated bacterial cultures from cloacal and pharyn-
geal swabs were enriched in Tryptone-soya broth at
26–28°C for 48 hours (Nikolova et al., 2001). Enriched

* Corresponding author: J. Kisková, Institute of High Mountain Biology, Tatranská Javorina 7, 059 56, Slovakia; phone: (+421)
51-449-91-08; e-mail: jakiskova@gmail.com
80 Kisková J. et al. 1

cultures were plated on CIN agar presented as highly
selective medium for Yersinia spp. (Schiemann, 1979)
and cultivated at 26–28°C for 48 hours (Neubauer
et al., 2000; Hussein et al., 2001).
Bacterial DNA was extracted and then Yersinia
species were identified among isolated bacterial cul-
tures using the PCR method developed by Neubauer
et al. (2000). The authors designed primers Y1 and
Y2 for amplification of the specific region of the 16S
rRNA gene of the genus Yersinia. Primers A1 and A2
were used to amplify a 430 bp fragment of the ail
gene, found exclusively in pathogenic Yersinia spp.
strains (Wannet et al., 2001). For the identification
of Yersinia spp. a reference strain (CCM 5671) of
Y. enterocolitica subsp. enterocolitica, serovar 0:3,
biovar 4 was obtained from the Czech collection of
microorganisms, Masaryk University, Brno. The PCR
products were independently sequenced in both direc-
tions on the Genome Lab GeXP Single genetic ana-
lyzer (Beckman Coulter Inc.) The obtained sequences
were subjected to BLAST searches in sequence data-
base GenBank for species identification.
Y. pseudotuberculosis was also independently
examined in all samples. The AmpliSens Yersinia
pseudotuberculosis kit (Russia) was used for the iden-
tification.
A P2 statistics (STATISTICA 8.0) was used to test
the hypothesis of independence of frequencies of
selected factors (prevalence, sex, age and season)
which may influence the occurrence of bacteria. Mor-
phometric data were compared by one-way ANOVA.
From 97 examined birds, a total of 47.4% indi-
viduals were Yersinia positive (28.9% of pharyngeal
and 27.8% of cloacal samples). Seven Yersinia species
were detected by comparison of PCR-product’s to the
nucleotide sequences in BLAST (GenBank, Table I).
Y. enterocolitica showed the highest total incidence
(34.0%) of the genus Yersinia, therefore it is consid-
ered in this study as separate species. The higher
prevalence of Y. enterocolitica tended to be in cloacal
(20.6%) than in pharyngeal (16.5%) samples. Also other
Yersinia species (except Y. fredericksenii) were detected
more frequently in pharyngeal than cloacal swabs.
The differences were not statistically significant.
A seasonal variation in the distribution of Yersinia
spp. was observed. The highest prevalence of Yersinia
species was detected in April (80%). Even, the con-
tamination of Y. enterocolitica reached a statistically
significant value compared to other months (P ≤ 0.05),
in which the prevalence of bacteria decreased signifi-
cantly (Table II).
Comparison of the total prevalence of Yersinia
spp. between males and females did not show signifi-
cant differences but in females was nearly 10% higher
than in males. A much lower frequency of infection
in juveniles than in adult individuals was found but
the difference didn’t reach the statistical significance
value (P≥ 0.05, Table II).
Table III shows the potential relation between
the occurrence of Yersinia spp., resp. Y. enterocolitica
and morphological features of the adult birds.
Measurements of body weight and tarsus length were

Table I
Species and prevalence of pharyngeal and cloacal bacteria in Dunnocks
in the Western Carpathians, Slovakia

Prevalence (n = 97)
Strain according
Bacteria species GenBank Total Pharynx Cloaca
N (%) N (%) N (%)
Yersinia spp. 46 (47.4) 28 (28.9) 27 (27.8)
Y. enterocolitica 8081 33 (34.0) 20 (20.6) 16 (16.5)
FE 80735
KM 1
PO/Y/1-3
ARCTIC-P11
Y. kristensenii ATCC 33638 10 (10.3) 10 (10.3) 6 (6.2)
N1SF35
Y 160
Y. molareti H279-36/86 2 (2.1) 2 (2.1) 1 (1)
Y. intermedia H9-36/83 2 (2.1) 2 (2.1) 0 (0)
253
Y. aleksici 991 2 (2.1) 2 (2.1) 0 (0)
Y 388
Y. bercovieri H632-36/85 2 (2.1) 2 (2.1) 1 (1.0)
Y. frederiksenii WS 52/02 2 (2.1) 0 (0) 2 (2.1)

n – number of examined birds

N – number of Yersinia positive samples with relative value in the brackets
1 Short communication 81

Table II
The prevalence of bacterial genera (species) in dunnocks according to the season
years, the host sex and age

Yersinia positive Yersinia negative

Variable (n) P
N (%) N (%)
Y. enterocolitica April (10) 7 (70) 3 (30)
May (32) 13 (40.6) 19 (59.4)
0.03
June (25) 6 (24) 19 (76)
July (30) 7 (23.3) 23 (76.7)
Yersinia spp. April (10) 8 (80) 2 (20)
May (32) 15 (46.9) 17 (53.1) NS
June (25) 10 (40) 15 (60)
July (30) 13 (43.3) 17 (56.7)
Y. enterocolitica Females (45) 17 (37.8) 28 (62.2)
NS
Males (35) 13 (37.1) 22 (62.9)
Yersinia spp. Females (45) 25 (55.6) 20 (44.4)
NS
Males (35) 16 (45.7) 19 (54.3)
Y. enterocolitica Adults (80) 30 (37.5) 50 (62.5)
NS
Juveniles (17) 3 (17.7) 14 (82.4)
Yersinia spp. Adults (80) 41 (51.3) 5 (29.4)
NS
Juveniles (17) 39 (48.8) 12 (70.6)
n – number of examined birds
N – number of Yersinia positive (+) or negative (–) samples with relative value in the brackets
NS – not significant P > 0.05 (Chi-square test)

Table III
Morphological characters of adult dunnocks examined for yersiniosis

Morphological Yersinia Number of adult

Bacteria Mean ± SE P
variables +/– individuals
Y. enterocolitica Body weight (g) + 25 19.7 ± 0.8
NS
– 46 19.1 ± 0.6
Tarsus length (mm) + 29 24.9 ± 0.2
NS
– 48 24.8 ± 0.1
Yersinia spp. Body weight (g) + 34 19.6 ± 0.7
NS
– 37 19.1 ± 0.6
Tarsus length (mm) + 39 24.8 ± 0.2
NS
– 38 24.9 ± 0.2

NS – not significant, P > 0.05 (one – way ANOVA test)

considered. No significant relationships were found
between the Yersinia spp., resp. Y. enterocolitica infec-
tion and tarsus length or body weight of hosts.
When the dunnock sex and infestation by yer-
siniosis were considered as independent variables, no
statistically significant difference was found in preva-
lence of Yersinia between males and females (Table II).
Therefore, both sexes were pooled together and tested
against Yersinia as one group.
Y. pseudotuberculosis was not detected in any of
pharyngeal and cloacal swabs. The presence of the ail
gene associated with the pathogenic strains of Yersinia
was not confirmed in any of the examined samples.
Recently, PCR method is widely used to identify
specimens and studying the relationship of bacteria.
However, the target sequences of both primers Y1 and
Y2 using in this study are presented in more members
of the genus Yersinia; it was possible to determinate
more Yersinia species by using only one PCR array
(Neubauer et al., 2000).
In this study, a lower occurrence of yersiniosis was
found in subalpine habitats compared to the alpine
zone in previous study (Novotný et al., 2007). The
authors showed that in alpine accentors there is an
unusually high prevalence of yersiniosis in compari-
son to many other bird species. The authors attribute
this to high adaptability of Yersinia species to cold
environment. For example, Gill and Reichel (1989)
referred to the ability of Y. enterocolitica to grow at
–2°C. This might be the reason for its successful
82 Kisková J. et al.
expansion in high mountain environments and for its
higher prevalence in alpine accentors than in dunnocks.
In this study we have confirmed that Y. enterocolitica
is the most common yersinia in dunnocks in compari-
son with other Yersinia species. Similar findings were
reported in other species of birds (Niskanen et al.,
2003; Novotný et al., 2007). Also other species of
Yersinia (no pathogenic environmental species e.g.
Y. intermedia, Y. frederiksenii or Y. kristenseni ect.)
were frequently found in other species of birds
(Niskanen et al., 2003; Janiga et al., 2007).
As our results show that distribution of yersiniosis
in dunnock is seasonally dependent. Prevalence of
avian bacterial infections is known to have seasonal
dynamics where social and other behaviours have
been hypothesized to be a factor shaping these dy-
namics (Faustino et al., 2004). The high occurrence
of Y. enterocolitica in cold months was confirmed in
many studies. For example, Kato et al. (1985) reported
significantly higher incidence of Y. enterocolitica in
birds in the spring than in the summer or autumn
months. The highest prevalence of all Yersinia spe-
cies in the dunnock was detected in April. In this
month, the dunnock breeding season begins and birds
begin to mate. Avian copulation involves cloacal
contact, which has been documented to host rich bac-
terial communities (Lombardo, 1998; Lucas and
Heeb, 2005). So, the risks of bacterial transmission
during copulations in birds are expected to be high.
Dunnocks have a variable mating system from mo-
nogamy through polyandry to polygynandry (Davies,
1985) and copulation with multiple partners further
increases the risk of avian infection. It seems bird diet
may also influence the occurrence of bacterial infec-
tion. The dunnock is an insectivorous species and in
April, when the occurrence of insects increases in the
mountains, the risk of infection is higher. In the next
months (outside the mating period) the prevalence of
bacterial infection declines gradually. In July, when
the juveniles have left the nests, the bacterial infec-
tion may be slightly increased again. This phenom-
enon is probably associated with reduced body con-
dition of birds. The birds are exhausted after breeding
and subsequent moulting may also have a significant
impact on the physiological status of the individuals.
Colonisation of nestlings by environmental mi-
crobes begins soon after hatching. Mills et al. (1999)
detected cloacal microorganisms in nestlings of the
tree swallow (Tachycineta bicolour) two days after
hatching. The inoculation of nestlings by microbes
may occur from the environment via ingestion of adult
saliva, from food provided by the parents or from nest
materials (Mills et al., 1999; Berger et al., 2003). In
our study, we detected about 20% fewer contamination
of Yersinia in juveniles than in adult birds. The low
infection of juveniles during whole research period
1
indicates that infection of juveniles by Yersinia occurs
later. We therefore suggest that young birds are in-
fected by bacteria mainly during the breeding season
in the following year.
To conclude, we confirmed that the prevalence of
bacterial infections in dunnocks shows seasonal dy-
namics. In early spring, the high occurrence of Yersinia
contamination may be associated with changes in diet,
but is most likely a consequence of the increased risk
of contamination during mating. We observed that
the sex of birds did not influence the distribution of
Yersinia spp. in the dunnock and that bacterial occur-
rence in birds increases with nestling age and stabi-
lizes in adults. We didn’t found relationship between
morphological parameters (tarsus length and body
weight) and Yersinia infestation, therefore we assume
that bacteria do not affect health and body condition
of individuals. Our findings support the idea that the
Yersinia species are surely a common member of bac-
terial microflora in dunnocks.
Literature
Berger S., R. Disko and H. Gwinner. 2003. Bacteria in starling
nests. J. Ornithol. 144: 317–322.
Cover T.L. and R.C. Aber. 1989. Yersinia enterocolitica. New
Engl. J. Med. 321: 16–24.
Davies N.B. 1985. Cooperation and conflict among dunnocks,
Prunella modularis, in variable mating system. Anim. Behav. 33:
628–648
Faustino C.R., C.S. Jennelle, V. Connolly, A.K. Davis,
E.C. Swarthout, A.A. Dhondt and E.G. Cooch. 2004. Myco-
plasma gallisepticum infection dynamics in a house finch popula-
tion: seasonal variation in survival, encounter and transmission
rate. J. Anim. Ecol. 73: 651–669.
Gill C.O. and M.P. Reichel. 1989. Growth of the cold-tolerant
pathogens Yersinia enterocolitica, Aeromonas hydrophila and
Listeria monocytogenes on high-pH beef packaged under vacuum
or carbon dioxide. Food Microbiol. 6: 223–230.
Hussein H.M., S.G. Fenwick and J.S. Lumsden. 2001. A rapid
and sensitive method for the detection of Yersinia enterocolitica
strains from clinical samples. Lett. Appl. Microbiol. 33: 445–449.
Janiga M., A. Sedlárová, R. Rigg and M. Novotná. 2007. Pat-
terns of prevalence among bacterial communities of Alpine
Accentors (Prunella collaris) in the Tatra Mountains. J. Ornithol.
148: 135–143.
Kaneuchi Ch., M. Shibata, T. Kawasaki, T. Kariu, M. Kanzaki
and T. Maruyama. 1989. Occurrence of Yersinia spp. in migra-
tory birds, ducks, seagulls and swallows in Japan. Jpn. J. Vet. Res.
51: 805–808.
Kato Y., K. Ito, Y. Kubokura, T. Maruyama, K. I. Kaneko
and M. Ogawa. 1985. Occurrence of Yersinia enterocolitica in
wild-living birds and Japanese Serows. Appl. Env. Microbiol. 49:
198–200.
Lombardo M.P. 1998. On the evolution of sexually transmitted
diseases in birds. J. Avian Biol. 29: 314–321.
Lucas F.S. and P. Heeb. 2005. Environmental factors shape cloa-
cal bacterial communities in great and blue tit nestlings. J. Avian
Biol. 36: 510–516.
Mills T.K., M.P. Lombardo and P.A. Thorpe. 1999. Microbial
colonization of the cloacae of nestling tree swallows. Auk 116:
947–956.
1 Short communication
Nakamura M. 1990. Cloacal protuberance and copulation
behavior of the Alpine Accentor (Prunella collaris). Auk 107:
284–295.
Neubauer H., A. Hensel, S. Aleksic and H. Meyer. 2000. Iden-
tification of Yersinia enterocolitica within the genus Yersinia. Sys.
Appl. Microbiol. 23: 1–5
Nikolova S., Y. Tzvetkov, H. Najdenski and A. Vesselinova.
2001. Isolation of pathogenic Yersiniae from wild animals in Bul-
garia. J. Vet. Med. 48: 203–209.
Niskanen T., J. Waldenström, A.M. Fredriksson, B. Olsen and
H. Korkeala. 2003. virF-Positive Yersinia pseudotuberculosis
83
and Yersinia enterocolitica found in migratory birds in Sweden.
Appl. Env. Microbiol. 69: 4670–4675.
Novotný M., M. Feèková, M. Janiga, M. Lukáò, M. Novotná
and Z. Kovalèíková. 2007. High incidence of Yersinia enteroco-
litica (Enterobacteriaceae) in Alpine Accentors Prunella collaris
of the Tatra Mountains. Acta Ornithol. 42: 137–143
Schiemann D.A. 1979. Synthesis of a selective agar medium for
Yersinia enterocolitica. J. Microbiol. 25:1298.
Wannet W.J.B., M. Reessink, H.A. Brunings and H.M.E. Maas.
2001. Detection of pathogenic Yersinia enterocolitica by rapid and
sensitive duplex PCR Assay. J. Clin. Microbiol. 39: 4483–4486.
84 Kisková J. et al. 1
Polish Journal of Microbiology
2011, Vol. 60, No 1, 85–87

SHORT COMMUNICATION

First Report of Serratia plymuthica Causing Onion Bulb Rot in Poland

BEATA KOWALSKA*, URSZULA SMOLIÑSKA and MICHA£ OSKIERA

Institute of Horticulture, Skierniewice, Poland

Received 6 January 2010, revised 18 December 2010, accepted 20 December 2010

Abstract

Specific bacterial disease symptoms were observed on onion bulbs in almost all regions in Poland. For the purpose of identification of
agents causing disease, bacteria were isolated from the symptomatic plants. Their pathogenicity was confirmed by using pathogenicity test
on onion scales. These bacteria were identified biochemically and molecularly as Serratia plymuthica.

K e y w o r d s: Serratia plymuthica, bacterial disease, onion

Onion (Allium cepa L.) is one of the major vege-
table crops grown in Poland. Since the onion harvest-
ing period often coincides with rainy weather and dur-
ing cultivation it may hail, complex bacterial and
fungal diseases often occur. In the last years especially
bacterial diseases of onion cause very serious prob-
lems in Poland. These diseases may cause significant
economic losses because they are difficult to control.
Bacterial soft of onion bulbs is the most frequent
and it can appear during cultivation, storage or trans-
portation. It is common knowledge that in Poland,
bacterial diseases of onion are caused by Burkhol-
deria gladioli, Burkholderia cepacia, Pectobacterium
carotovorum subsp. carotovorum (Sobiczewski and
Schollenberger, 2002). Foreign reports conclude that
bacteriosis of onion can also be caused by Pseudo-
monas marginalis (Kim et al., 2002; El-Hendawy,
2004), Pseudomonas syringae, Pseudomonas viridif-
lava (Gitaitis et al., 1998), Pantoea ananatis (Gitaitis
et al., 2002), Enterobacter cloacae (Schroeder et al.,
2009; Schwartz and Mohan, 2008), Burkholderia
ambifaria and Burkholderia pyrrocinia (Jacobs et al.,
2008). Also bacterium Serratia spp. was noted as an
onion pathogen in Brasil (Beriam, 2007). The libera-
lization of policies concerning border protection and
intense trade favor transmission of pathogens from
foreign countries.
During the summer and autumn of 2003, 2006
and 2007, disease symptoms of unknown origin were
observed on onion (Allium cepa L.) bulbs in the field
and storage houses in different places in Poland.
These symptoms were typical for bacterial disease
– water soaked and pale brown lesions appeared on
the internal scales, they enlarged and extended to
external scales with an associated sour smell. Bacte-
ria from the infected bulb tissues were isolated and
purified on nutrient agar. About forty isolates were
obtained and these isolates were examined for the
ability to macerate onion tissue. The pathogenicity
test was conducted on healthy onion bulbs cv.
Grabowska. The bulbs were peeled, washed with run-
ning water and sterilized in 70% ethanol for 30 sec
and in 0.5% NaOCl for 5 min. The bulbs were washed
in sterile water and cut lengthwise into two parts.
Three onion pieces were placed, cut side down, into
a Petri dish (180 mm in diameter). The outer scale
of each piece was wounded with the microbiolo-
gical needle and inoculated by 20-µl aliquot of bac-
terial suspension of density 1.0–2.5× 108 cfu/ml. For
each isolate three Petri dishes were included. Con-
trol treatment remained uninoculated. The Petri
dishes were incubated 4 days at 28°C. Nine of forty
isolates expressed rot symptoms on the scales. These
isolates were studied by using biochemical and
molecular methods.
Biochemical identification of the isolates were per-
formed by using the API 20E system (bioMerieux)
which gave a bacterial code of 1207763 (Table I)

* Corresponding author: B. Kowalska, Institute of Horticulture, Konstytucji 3 Maja 1/3; 96-100 Skierniewice, Poland; e-mail:
beatakow@iwarz.pl
86 Kowalska B. et al. 1

Table I
Biochemical profile of tested isolates conducted using identification system API 20E

ONPG

MAN

AMY
ADH

ODC

RHA

MEL

ARA
TDA

GLU
URE
LDC

GEL

SOR

SAC
IND

INO
CIT
H2S

OX
VP
+ – – – + – – – – + + + + + + – + + + + –

test reactions / enzymes

ONPG $-galactosidase
ADH arginine dihydrolase
LDC lysine decarboxylase
ODC ornithine decarboxylase
CIT citrate utilization
H2S H2S production
URE urease
TDA tryptophane deaminase
IND indole production
VP acetoin production
GEL gelatinase
GLU fermentation / oxidation (glucose)
MAN fermentation / oxidation (mannitol)
INO fermentation / oxidation (inositol)
SOR fermentation / oxidation (sorbitol)
RHA fermentation / oxidation (rhamnose)
SAC fermentation / oxidation (saccharose)
MEL fermentation / oxidation (melibiose)
AMY fermentation / oxidation (amygdalin)
ARA fermentation / oxidation (arabinose)
OX cytochrome oxidase

(% identity = 59.6; T = 1.0). The numerical profile cal tests were conducted. The microorganisms were
showed a correct identification of all examined strains Gram-negative, catalase positive, oxidase negative and
as Serratia plymuthica. Additionally, some biochemi- grew in anaerobic condition.

AJ233433.1 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGG--CAGTG
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
HM596429.1 361 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTTCAGTG 420
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
AY394724.1 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTAGTGTG

AJ233433.1 TTAATAGCACAT-TGCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG
|||||||||| | | | |||||||||||||||||||||||||||||||||||||||||||
HM596429.1 421 TTAATAGCAC-TGTRCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG 479
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
AY394724.1 TTAATAGCACAT-TRCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG

AJ233433.1 AGAA-TT-CGCTAGAGATAGCTTAGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC
|||| || | | |||||| | || ||||||||||||||||||||||||||||||||||||
HM596429.1 960 AGAACTTTC-C-AGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC 1017
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AY394724.1 AGAACTTTC-C-AGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC

Fig. 1. Homology sequence alignment of the 16S rRNA region of type strain S. plymuthica DSM 4540 acc. no. AJ233433.1, tested
isolate 466 acc. no HM596429.1, strain of the nearest BLAST match S. plymuthica RVH1 acc. no AY394724.1. Sequences were
retrieved from the GenBank (National Center for Biotechnology Information) database under the accession numbers indicated.
1 Short communication
Table II
BLAST search results for 16S rRNA gene sequence of representative isolate 466
S. plymuthica isolate Accession no
DSM 4540 – type strain AJ233433.1
466 – tested isolate HM596429.1
RVH1 AY394724.1
The identity of the isolates was confirmed by mo-
lecular techniques – 16S rRNA sequence analysis.
DNA was isolated by “Genomic mini” kit according
to producent’s clues (A & A Biotechnology). The 16S
rDNAs were amplified by using universal primers
fD1 (5’AGAGTTTGATCMTGGCTC3’) and rP2
(5’ACGGCTACCTTGTTACGACTT3’) (Weisburg
et al., 1991). Additional sequensing primers were
used: 800f (5’ATTAGATACCCTGGTAG3’) and 800r
(5’CTACCAGGGTATCTAAT3’) (Fouad et al., 2002).
The amplified PCR products, lenght 1500 bp, were
separated by 1.5% agarose gel electrophoresis, then
extracted and purified from gel with the DNA Frag-
ment Purification Kit (A & A Biotechnology). DNA
sequences were compared to NCBI database (www.
ncbi.nlm.nih.gov) using BLAST program (Basic Local
Alignment Search Tool), demonstrated that 16S rRNA
gene of the studied isolates of bacteria shared high
identities (99.7%) with Serratia plymuthica RVH1,
NCBI GenBank database accession no. AY394724.1
(Fig. 1, Table II). The 16S rRNA sequence of the
one representative isolate (466) has been deposited
in the GenBank database under the accession number
HM596429.1.
The biochemical test data along with sequence
analysis of a portion of the 16S rRNA gene confirmed
all the isolates to be Serratia plymuthica. According
to our knowledge, this is the first report of S. plymu-
thica causing a bulb rot of onion in Poland.
Acknowledgments
This work was supported by grant NN 310299734
87
Country Identity Match
Germany 98.9% 1449/1465
Poland 100% 1460/1460
Belgium 99.7% 1456/1461
Literature
Beriam L.O. S. 2007. Palestra doencas bacterianas em hortalicas.
Biologico 69: 81–84.
El-Hendawy H.H. 2004. Association of pectolytic fluorescent
pseudomonads with postharvest rots of onion. Phytopathol.
Mediterr. 43: 369–376.
Fouad A.F., J. Barry, M. Caimano, M. Clawson, Q. Zhu,
Carver R., K. Hazlett and J.D. Radolf. 2002. PCR-based iden-
tification of bacteria associated with endodontic infections.
J. Clin. Microbiol. 40: 3223–3231.
Gitaitis R., G. MacDonald, R. Torrance, R. Hartley,
D.R. Sumner, J.D. Gay and W.C. Jahnson. 1998. Bacterial
streak and bulb rot of sweet onion: II. Epiphytic survival of
Pseudomonas viridiflava in association with multiple weed hosts.
Plant Dis. 82: 935–938.
Gitaitis R., R. Walcott, S. Culpepper, H. Sanders, L. Zolobow-
ska and D. Langston. 2002. Recovery of Pantoea ananatis, casual
agent of center rot of onion, from weeds and crops in Georgia,
USA. Crop Protect. 21: 983–989.
Jacobs J.L., A.C. Fasi, A. Ramette., J.J. Smith, R. Hammer-
schmidt and G.W. Sundin. 2008. Identification and onion patho-
genicity of Burkholderia cepacia complex isolates from the onion
rhizosphere and onion field soil. Appl. Environ. Microbiol. 74:
3121–3129.
Kim Y.K., S.D. Lee, C.S. Choi, S.B. Lee and S.Y. Lee. 2002.
Soft rot of onion bulbs caused by Pseudomonas marginalis under
low temperature storage. Plant Pathol. J. 18: 199–203.
Schroeder B.K., L.J. du Toit and H.F. Schwartz. 2009. First
report of Enterobacter cloacae causing onion bulb rot in the
Columbia Basin of Washington State. Plant Dis. 93: 323.
Sobiczewski P. and M. Schollenberger. 2002. Bacterial deseases
of horticulture plants (in Polish). pp. 64–67; 54–57. Pañstwowe
Wydawnictwo Rolnicze i Leœne. Warszawa.
Schwartz H.F. and S.K. Mohan. 2008. Compendium of onion and
garlic diseases and pests. APS PRESS, St. Paul, Minnesota, USA.
Weisburg W.G., S.M. Barns, D.A. Pelletier and D.J. Lane.
1991. 16S ribosomal DNA amplification for phylogenetic study.
J. Bacteriol. 173: 697–703.
88 Kowalska B. et al. 1
Polish Journal of Microbiology
2011, Vol. 60
Instruction to Authors
(modified, effective Vol. 60, 2011)
Scope
Polish Journal of Microbiology publishes descrip-
tions of all aspects of basic and applied research that
focuses on topics of basic research and practical value
in microbiology. Topics that are considered include
microbiology in the area of basic biological properties
of bacteria and archaea, viruses, and simple eukaryotic
microorganisms, genetics and molecular biology,
microbial ecology, medical bacteriology, public health
as well as food microbiology, industrial microbiology
and bacterial biotechnology.
A manuscript of the original paper (full length
paper and short communication) submitted to Pol.
J. Microbiol must present reports of original research
that have not been previously published and is not
being considered for publication elsewhere. All authors
of manuscripts areresponsible for their content and
it is assumed that they all have contributed substan-
tially to the presented research, read and approved
the manuscript.
Minireviews in areas of particular interests and
importance in microbiology are also published. They
are usually invited, but authors wishing to submit
a mini-review should contact the Editor in Chief
directly for further information
How to Submit Manuscripts
Submit via e-mail the electronic version (text and
tables as a Word 7 attachment, with figures in jpg/pdf
format saved individually) to the address: pjm@pzh.
gov.pl, The manuscript should be accompanied by
a cover letter stating the postal address, phone and
fax numbers and e-mail of the corresponding author
who is responsible for the all correspondence regard-
ing the submitted paper. Receipt of each manuscript
will be confirmed by e-mail to the corresponding
author within five business days. It will be given
a PJM number which the corresponding author is
asked to refer to in correspondence with the editors.
Correspondence is by e-mail.
Beside the main title of the paper include in the
cover letter the proposed “running title” of the manu-
script (about 50 characters in length, including spaces).
Before writing a manuscript authors are advised
to consult a current issue of Polish Journal of Micro-
biology and carefully read the Instructions to Authors
(available at www.microbiology.pl/pjm and printed in
the first issue of the volume) in order to be familiar
with the general form of papers published.
The manuscript should be written in English.
Grammar, syntax and spelling must be carefully
checked before submission of the paper. Authors who
are unsure of proper English usage should have their
manuscript checked by someone proficient in both the
English language and biological terminology. Manu-
scripts may be rejected on the basis of poor English
or lack of conformity to accepted standards of style
before the review process.
Junior scientists submitting his/her paper must have
the submitted manuscript accepted by the head of the
scientific unit where the research was carried out.
Illustrations may be supplied as PDF/jpg files for
reviewing purposes only on initial submission. After
receiving the Letter of Acceptance, please submit
illustration at their intended publication size in tiff
format (with LZW compression) at the correct reso-
lution: 300 dpi for grayscale and color, 600 dpi for
combination art (lettering and images) and 1,200 dpi
for line art. Halftone images (those with various den-
sities or shades) must be prepared in tiff, not bitmap
or jpg. For instructions on creating acceptable tiff
files, refer to the Cadmus digital art website.
There is no page charge for publication in PJM,
except to color illustrations.
The Review Process
All manuscripts are subjected to pre-screening by
the Editor in Chief and can be rejected at this stage
or returned for corrections before evaluation (if they
do not meet the criteria given in the Instruction to
Authors, including language quality or are out of
scope of PJM). After passing the pre-screening stage
the manuscripts are processed by one of the editors
and sent to at least one qualified outside referee, but
the editors may also act as reviewers.
Authors may suggest, in the cover letter, the names
(together with contact details) up to 5 potential referees
which may be used at the discretion of the editor. When
a manuscript is returned to the authors for modifica-
tion, it should be returned to the editorial office within
3 months; otherwise it may be considered withdrawn.
90 Instruction to Authors
While the paper is accepted for publication the
transfer of copyright to the Publisher becomes effec-
tive. The papers are generally printed in no more than
three months after returning the corrected version and
obtaining its final acceptance.
Preparation of Manuscripts
Regular paper
The manuscript of the full length original paper in
general should not exceed 20 typed pages (up to 1800
letters per page) including tables and figures. Type
every portion of the manuscript double-spaced using
12 points Times New Roman. Do not use bolded fonts
except for subtitles or italics except for microor-
ganism names (Escherichia coli), genetic loci (repA)
or Latin words like: in vivo, et al., etc., journal title
abbreviations (J. Bacteriol.) and book titles (not titles
of the chapters). No part of the manuscript should
be underlined and written using CAPITAL letters).
Number all pages in sequence, including abstract,
tables, figures and figure legends.
The full length paper should be divided into the
following sections written in sequence: Title, Abstract,
Introduction, Experimental: Materials and Methods,
Results, Discussion, Acknowledgments, Literature.
Title
The title should describe the contents of the paper
in a concise but attractive for readers way. Below the
title of the manuscript include: full name (including
first name and middle initial) of each author, name
of the institution(s) at which the work was performed,
or each co-author’s affiliation if different.
Street address, telephone/fax number and e-mail
address should be given only for the corresponding
author and placed in the footnote at the bottom of
the first page.
Abstract
Limit the abstract to 250 words or fewer. Because
the abstract will be published separately by abstract-
ing services, it must be complete and understandable
without reference to the text. It should be written
in an impersonal form. Abbreviations, diagrams and
references are not allowed.
Key words
Up to five key words or short phrases should be
given and placed below the abstract. If names of mi-
croorganisms are used, they should precede the key
1
words, and be followed by the latter in alphabetical
order. All key words should be relevantly connected
with the subject matter (avoid common terms like:
bacteria, medium, soil, temperature etc.) as they will
be used for indexing purposes.
Introduction
The introduction should provide background infor-
mation to allow the reader to understand and evaluate
the results of the present study and describe the pur-
pose of the undertaken research. However, broad
“academic lectures” on the subject and extensive
literature reviews should be avoided.
Experimental
Materials and Method
This section should contain description of materials
(biological and others) used and sufficient technical
information so that the experiments can be repeated.
For commonly used materials and methods (e.g. com-
monly used media, protein determination) a simple
reference is sufficient. Novel or modified procedures
should be described in detail.
When a large number of microbial strains or mu-
tants were used in a study, include strain tables identi-
fying the sources and properties of the strains, mutants,
bacteriophages, plasmids, etc.
For names of microorganisms, follow the guide-
lines of the International Nomenclature Committee
(up to date names available as validation list of Inter-
national of the Systematic and Evolutionary Micro-
biology). Species names are written in full the first time
the name appears in text; subsequently, only use the
first letter of the genus name followed by the species
epithet (e.g. Escherichia coli, then E. coli). Genetic
loci are italicized (repA), protein products of the loci
are not italicized (RepA).
The source of materials (media or chemicals) should
be indicated if critical for the validity of experimental
results. For centrifugation conditions preferably give
the centrifuge forces in “g” (10 000×g) rather than rpm.
Units of measurement should be used in SI system,
but for practical reasons, some exceptions to SI units
are allowed; e.g. for liter use “l” not “L” (1 l not 1 L,
20 mg/ml not 20 mg/ml). Always include the space
between the number and the unit (2 mM not 2 mM).
Results
In the “Results” section, include only the results
of the experiments; reserve extensive interpretation of
the results for the “Discussion” section. While justified
1 Instruction to Authors
by the nature of the paper the ,,Results” and ,,Discus-
sion” sections may be combined (e.g. “Results and
Discussion”). Present the results as concisely as
possible and illustrate them with tables or figures if
applicable (presentation of the same results in both
tables and figures is not acceptable). Avoid the use of
graphs to present data that might be more concisely
presented in the text. Limit illustrative materials to
those that are absolutely necessary to demonstrate
the original experimental findings. Number figures
(Arabic numerals) and tables (Roman numerals) in the
order in which they are cited in the text, and be sure
to cite all figures and tables.
Tables. Each table must be typed on separate pages
and numbered with Roman numerals (Table I., etc.)
in the order they are cited in the text. The headings
should be sufficiently clear so that the data will be
understandable without reference to the text. Explana-
tory footnotes are acceptable. Prepare your tables as
simple as possible in Word not in Excel, no “decora-
tive” frames should be made.
Figures (graphs, diagrams etc.) should be submit-
ted ready for reproduction, each on a separate sheet
(or as a separate document on a floppy disc or CD).
The preferred graphic application is Photoshop or
CorelDraw saved in tiff format (with LZW compres-
sion). Figures should be numbered as in the text
(Arabic numerals, Fig. 1., etc.) and marked with the
name of the first author. Figures should be under-
standable without referring to the text. Original
recorder tracing (outprints) of NMR, IR, ESR spectra
etc. are not acceptable for reproduction; they should
be redrawn. Figure titles and legends must be listed
on a separate page. Photographs need to be in good
quality with proper resolution used (minimal resolu-
tion are 300 for halftones and 600 dpi for combina-
tion of photos with lettering). Color illustration can
be made only at the author’s expenses (further details
are available at the Editorial Office).
New nucleotide sequences must be accompanied
by the accession number obtained from proper data-
bases and should be included in the text.
Discussion
The “Discussion” should provide an interpretation
of the obtained results in relation to previously pub-
lished work and to the experimental system at hand
and should not contain extensive repetition of the
,,Results” section or reiteration of the introduction.
In some papers the Results and Discussion can be
combined into one section as mentioned above.
Acknowledgements
Acknowledgements for financial support and for
a personal assistance (with the permission of person
91
named) are given in two separate paragraphs below
the main text.
Literature
It is the responsibility of authors to verify each ref-
erence against the original article as well as make sure
that each paper cited in the text is included in the
list. Keep the number of citations reasonable, avoid
exhaustive citations of “historical” papers except if
absolutely necessary.
In the text references should be cited by the names
of the authors and the year of publication, e.g. Nowak
and Kowalski (1999) stated that...; as previously
described (Nowak and Kowalski, 2000; Nowak,
2005). When a paper has more than two authors, the
first author’s name should be followed with et al. and
the year of publication, e.g. Nowak et al., 2002. While
references occur that are not identified by the authors’
names and year, use a, b etc. after the year (Nowak
et al., 2002a; 2002b).
The list of the papers cited (Literature) must be
arranged alphabetically according to the last name
of the first author and not numbered. Papers with
one only author are listed in chronological order (the
earliest first); papers with two authors are listed
alphabetically according to the last name of the first
author and by the last name of the second author;
paper with three or more authors appear as those with
two authors and are listed chronologically. When the
paper has more than ten authors state the names of the
first ten, followed by .. ..and others. For citations
of books, books chapters, thesis, printed conference
proceedings etc. see examples given below.
Please follow the punctuations, brackets, capital
letters etc. exactly as shown. Put and not & before
the last author’s name. Use the proper journal titles
abbreviations (ISO) as indicated in the PubMed
Journal Database.
Examples of literature citations
Books and book chapters:
Sambrook J., E.F. Fritsch and T. Maniatis. 1989.
Molecular Cloning; a Laboratory Manual, 2nd ed. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory.
Snyder L. and W. Champness. 2003. Molecular Gene-
tics of Bacteria. 2nd ed. ASM Press, Washington, D.C.
Funnel B.E. and G.J. Phillips (eds). 2004. Plasmid
Biology. ASM Press, Washington, D.C.
Belfort M., V. Derbyshire, M.M. Parker, B. Cousi-
neau and A.M. Lambowitz. 2004. Mobile introns:
pathways and proteins, pp. 761–783. In: Funnel B.E.
and G.J. Philips (eds). Plasmid Biology. ASM Press,
Washington, D.C.
92 Instruction to Authors
Journal articles:
1 author:
Eckhardt T. 1978. A rapid method for identification
of plasmid desoxyribonucleic acid in bacteria. Plasmid
1: 584–588.
2 authors:
So³yga A. and D. Bartosik. 2004. Entrapment vectors
– how to capture a functional transposable element.
Pol. J. Microbiol. 53: 139–144.
3 to 10 authors:
Bartosik D., M. Szymanik and J. Baj. 2004. Iden-
tification and distribution of insertion sequences of
Paracoccus solventivorans. Appl. Environ. Microbiol.
69: 7002–7008.
More than 10 authors
Roberts R.J., M. Belford, T. Bestor, A.S. Bgagwat,
T.A. Bickle, J. Bitinaite, R.M. Blumenthal, S.K.
Degtyarey, D.T. Dry den, K. Dybyig and others.
2003. A nomenclature for restriction enzymes. DNA
methyl-transferases, homing endonucleases and their
genes. Nucleic Acids Res. 31: 1805–1812.
Papers in a language different than English – the title
should be translated into English and the original lan-
guage should be stated in parenthesis.
Bartosik D. 2001. Bacterial plasmids stability (in
Polish). Post. Biochem. 47: 138–145.
Ph.D. Thesis
Szymanik M. 2006. Ph.D. Thesis, (title optional).
Warsaw University. Warsaw. Poland
Conference materials (exceptionally)
Dziewit L., M. Jazurek, L. Drewniak, J. Baj and
D. Bartosik. 2006. Identification of a novel family of
addiction systems. Abstracts of International Plasmid
Biology Conference. Plasmid Biology 2006. Fallen
Leaf Lake, South Lake Tahoe California. USA. p. 163.
Papers in press or personal communication and un-
published results should not be included in the Lit-
erature citation list.
Short communications
A short communication is intended for the presen-
tation of brief observations that do not warrant a full-
length paper. Submit it in the same way as a full-length
paper. Each Short communication must have an ab-
stract of no more than 100 words. Do not use sections
heading in the body of the text. All the required for-
mation (introduction, methods, results and discussion)
1
except for the Literature must be given in single sec-
tion. Total length cannot exceed 8 double printed
pages including illustrative material (in total no more
than 3 figures and tables). They undergo the same
review process as full length papers and are not printed
more quickly.
Minireviews
Minireviews are published in areas of particular
interest and importance. They are usually invited, but
authors wishing to submit a minireview should contact
the Editor in Chief directly for further information.
Authors need to be experts on the topic reviewed
documented with published achievements in the field.
Proofs
The text for proof will be e-mailed (as .pdf file) to
the corresponding author. It should be printed out and
after introducing necessary corrections, returned by
priority mail to the postal address of editorial office as
soon as possible. If the required corrections are minor,
the author (especially foreign) may list them and e-mail
directly to the address pjm@pzh.gov.pl (do not forget
to state the paper title and given editorial number of
the manuscript).
Reprints
Beginning 2007 the Journal has not provided free
reprints. The corresponding author will be provided
with a pdf of his article by the Editorial Office.
If printed copies of the article are required they can
be ordered (in multiples of 20) together with return
of the corrected proof. The reprints will be mailed
after receiving payment (conditions of payment may
be obtained at secret@cls.edu.pl, Ms Beata Mazinska).
Free of charge copies are available at
www.microbiology.pl/pjm
Copyrights
Submission of the manuscript implies that the
research presented has not been published before
(except in the form of a conference abstract or a part
of PhD thesis). Transfer of copyrights to the publisher
becomes effective if and when the article is accepted
for publication. All articles published in Polish Journal
of Microbiology are protected by copyrights which
cover the exclusive rights to reproduce and distribute
the article as well as the translation. No part of the
published material can be reproduced without obtain-
ing written permission from the publisher.
 POLISH JOURNAL OF MICROBIOLOGY
(founded in 1952 as Acta Microbiologica Polonica)

www.microbiology.pl/pjm

EDITOR-in-CHIEF: Stanis³awa TYLEWSKA-WIERZBANOWSKA

EDITORS: Izabela SITKIEWICZ

Waldemar SIUDA
Anna SKORUPSKA

EDITORIAR OFFICE: Ilona M¥CZKA

EDITORIAL SECRETARY: Anna KRACZKIEWICZ-DOWJAT

POSTAL ADDRESS: Polish Journal of Microbiology

Chocimska 24
00-791 Warsaw, POLAND

CONTACT: Phone / Fax: (48 22) 5421250

E-mail: Editorial Office (pjm@pzh.gov.pl)
Editor-in-Chief (stylewska@pzh.gov.pl)

EDITORIAL BOARD

President: Andrzej PIEKAROWICZ (Warsaw, Poland)

Agata Budkowska (Paris, France) Teresa Lagergård (Göteborg, Sweden)

Hanna Dam (Olsztyn, Poland
Estera Dey (Lund, Sweden)
Jaros³aw Dziadek (£ódŸ, Poland)
Waleria Hryniewicz (Warsaw, Poland)
Katarzyna Jagusztyn-Krynicka (Warsaw, Poland)
Donovan P. Kelly (Coventry, UK)
Józef Kur (Gdañsk, Poland)
Wanda Ma³ek (Lublin, Poland)
Zdzis³aw Markiewicz (Seattle, USA)
Barbara Ró¿alska (£ódŸ, Poland)
Geoffrey Schild (Potters, Bar, UK)
Wac³aw Szybalski (Madison, USA)
Torkel Wadström (Lund, Sweden)
Krystyna I. Wolska (Warsaw, Poland)

PUBLISHER: POLISH SOCIETY OF MICROBIOLOGISTS

Published quarterly with the financial support of the Ministry of Science and Higher Education

SUBSCRIPTION:
For information for Polish subscribers contact Secretary of Polish Society of Microbiologists,
Che³mska 30/34, 00-725 Warsaw, Poland; phone: (48) 22 8413367, fax: (48) 22 8412949,
e-mail: sekret@cls.edu.pl

For information for foreign subscribes contact “Ars Polona” – e-mail: arspolona@arspolona.com.pl;
phone: + 48 (22) 5098661-5 also www.arspolona.com.pl

Cover illustration: Setose of C. dematium in SEM (Photo M. Wróbel).

ZOFIA MACHOWICZ-STEFANIAK: Occurrence and characterization
of Colletotrichum dematium (Fr.) Grove, in: Polish J. Microbiology 59, 3, 191–200

Typesetting and print: Publishing House Letter Quality, 01-216 Warsaw, Brylowska 35/38
Circulation: 300
Polish Journal of Microbiology, founded in 1952 as Acta Microbiologica Polonica, is a broad-based inter-
national microbiological journal covering: general microbiology, bacterial physiology, molecular biology
and genetics, virology, clinical bacteriology, environmental microbiology and biotechnology.

Polish Journal of Microbiology publishes mainly original research articles including short communica-
tions, but also minireviews, book reviews and press releases. All the papers should be prepared according
to “Instruction to Authors” which is included in the first issue of every volume and also available at
www.microbiology.pl/pjm. The papers appear usually within 3 months after final acceptance.

Abstracts and full texts of the papers (as pdf-s) are available under www.microbiology.pl/pjm directly after
the printed version appears.

Polish Journal of Microbiology is currently covered by Science Citation Index Expanded (ISI) and
Journal Citation Reports (JCR)/Science Edition, Thomson Master Journals List, Biological Abstracts,
BIOSIS Previews, EMBASE/Excerpta Medica, Index Medicus/MEDLINE, Cambridge Scientific
Abstracts, SCOPUS, Index Copernicus.

Submissions of manuscripts in various areas of microbiology are very welcome.

After acceptance of the paper the copyrights are reserved to the Publisher. No part of the publication may be
reproduced in any form without prior written permission of the Publisher, Polish Society of Microbiologists.

Subscription information for Polish subscribers under sekret@cls.edu.pl, for foreign subscribers
under www.arspolona.com.pl or arspolona@arspolona.com.pl

Advertising offer

The Editorial Office of the Polish Journal of Microbiology encourages our Readers to place advertisements
in our quarterly. Our journal reaches scientists working in various research and educational institutions and
involved in different fields of microbiology.
We ensure rapid appearance of the ad.

Price of black and white ad on inside cover: half of page = 150 PLN, full page = 300 PLN
Price of ad inside an issue: half page = 75 PLN, full page 150 PLN.

Please send file with graphical layout directly to the editorial office
of the journal or contact us at pjm@pzh.gov.pl.

The Editorial Office and Publisher do not take any responsibility for the contents of advertisement
and announcements.

ISSN – 1733-1331
Index – 35119