See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/230833399

Clinicopathological findings of a natural outbreak of Theileria annulata in

cattle: An emerging disease in southern Iran

Article  in  Parasitology Research · September 2012

DOI: 10.1007/s00436-012-3114-4 · Source: PubMed

CITATIONS READS

18 3,109

5 authors, including:

Ahmad Oryan Fatemeh Namazi

Shiraz University Shiraz University
419 PUBLICATIONS   7,955 CITATIONS    59 PUBLICATIONS   282 CITATIONS   

SEE PROFILE SEE PROFILE

Hassan Sharifiyazdi Mostafa Razavi

Shiraz University Shiraz University
137 PUBLICATIONS   776 CITATIONS    68 PUBLICATIONS   917 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Bone healing and regeneration View project

Evaluation of structure, Chaperone-like activity and Allergenicityof Bovine casein View project

All content following this page was uploaded by Fatemeh Namazi on 04 January 2015.

The user has requested enhancement of the downloaded file.

Parasitol Res (2013) 112:123–127
DOI 10.1007/s00436-012-3114-4
ORIGINAL PAPER
Clinicopathological findings of a natural outbreak
of Theileria annulata in cattle: an emerging disease
in southern Iran
Ahmad Oryan & Fatemeh Namazi & Hassan Sharifiyazdi &
Mostafa Razavi & Reza Shahriari
Received: 17 July 2012 / Accepted: 31 August 2012 / Published online: 12 September 2012
# Springer-Verlag 2012
Abstract Theileriosis is an economically important hemopro-
tozoal disease with high morbidity and mortality in cattle. The
present study reported the pathological features of a natural
outbreak of tropical bovine theileriosis due to Theileria annu-
lata in Fars Province, southern Iran. T. annulata was confirmed
by the presence of T. annulata piroplasms in the blood smears
and also by polymerase chain reaction test. On necropsy, pale
mucous membranes and petechial and ecchymotic hemor-
rhages in the mucosal and serosal surfaces together with
lymphadenopathy were observed. The liver was friable, yel-
lowish, and larger than normal. Hemorrhages and punched-out
ulcers were observed in the abomasal mucous membrane.
Severe petechial hemorrhages were seen in the skin particular-
ly in the hairless areas. Pulmonary edema and emphysema
with petechial and ecchymotic hemorrhagic foci in the lungs
were evident. The main histological changes were proliferation
of lymphocytes in the lymph nodes and proliferation of macro-
phages, lymphocytes, and plasma cells in the spleen, Peyer's
patches, portal tracts of the liver, and interstitial tissue of the
kidneys. The mucous membrane of the abomasum showed
numerous multifocal areas of necrosis and ulceration, and the
submucosal area and lamina propria adjacent to these lesions
showed hyperemia and hemorrhages, with mononuclear cell
infiltration. The skin showed multifocal necrotic changes, pe-
techial and ecchymotic hemorrhages, and chronic dermatitis.
The schizonts of Theileria were evident in the cytoplasm of the
A. Oryan : F. Namazi (*) : M. Razavi : R. Shahriari
Department of Pathobiology, School of Veterinary Medicine,
Shiraz University,
Shiraz, Iran
e-mail: fnamazi@shirazu.ac.ir
H. Sharifiyazdi
Department of Clinical Studies, School of Veterinary Medicine,
Shiraz University,
Shiraz, Iran
lymphocytes and macrophages of the lymph nodes, spleen,
and skin. Molecular examination revealed that these animals
were infected with T. annulata. The present study describes the
clinicopathological findings of bovine tropical theileriosis in
an unpredictable weather condition.
Introduction
Theileriosis is a tick-borne parasitic disease caused by var-
ious species of Theileria (Brown 1990). Theileria annulata
is the main species responsible for the disease that causes
heavy economic losses and results in high mortality and
morbidity, as well as production losses in many susceptible
domestic animals specially cattle in tropical and subtropical
regions (Brown 1990; Uilenberg 1995). A high prevalence
of theileriosis has been reported in the Near East and Far
East, southern Europe, Africa, and Central Asia (Purnell
1978; Uilenberg 1981; Brown 1990, 1997).
The intracellular parasite T. annulata has a biphasic life
cycle. The first phase occurs in the arthropod vector, in most
instances Hyalomma, while the second phase occurs in the
domesticated and wild ruminants (Mehlhorn and Schein
1984). The parasite-infected ticks infect cattle through inocu-
lation of sporozoites during feeding (d’Oliveira et al. 1995).
Concurrent with activity of the vector ticks, the disease occurs
mainly in warm months of the year (Beniwal et al. 1997).
Bovine theileriosis is endemic in various parts of Iran
although its mortality is variable, and possible factors such
as animal breeds (Katzer et al. 1998), annual rainfall, and
temperature are responsible for the occurrence of enzootic
stability or instability (Darghouth et al. 1996; Mohammad
Al-Saeed et al. 2010). The clinical signs of theileriosis
include fever, nasal and ocular discharge, weakness, anorex-
ia, increased respiration, and enlargement of the lymph
nodes; the disease leads to acute anemia and jaundice
124
(Omer et al. 2003; Osman and Al-Gaabary 2007). The
mortality rate of tropical theileriosis in the indigenous and
crossbred cattle in Iran has been reported at less than 10 and
40–80 %, respectively (Hashemi-Fesharki 1991). The pres-
ent study reported the clinical and pathological features of
natural infection in an unusual outbreak of tropical bovine
theileriosis in Fars Province, southern Iran.
Materials and methods
Animals
The present study was undertaken in Fars Province, south-
ern Iran on 11 female Iranian Holstein dairy cattle 20–
24 months of age from December 2010 to January 2011.
The clinical signs were high fever, nasal discharge, lacrima-
tion, salivation, dyspnea, and rough coats with enlargement
of the superficial lymph nodes particularly the prescapular
and parotid ones. Pale mucous membranes and severe pete-
chial and ecchymotic hemorrhages throughout the skin par-
ticularly in hairless regions were evident. The study was
approved by the local ethics committee of the Veterinary
School, Shiraz University and the Iranian Veterinary
Organization legislation in accordance with the ethic stand-
ards of the “Principles of Laboratory Animal Care”.
Parasitological study
Blood samples were collected from the ear veins in vacu-
tainers containing EDTA for the preparation of thin blood
smears. All smears were then fixed with absolute methanol,
stained with Giemsa, and examined by light microscopy at
×1,000 under oil immersion for the presence of Theileria sp.
piroplasms. The blood samples were also processed for
DNA extraction.
Fig. 1 Piroplasms of T. annulata in Giemsa-stained blood smear of an
infected cattle (scale bar06 μm)
Parasitol Res (2013) 112:123–127
Fig. 2 The jaundiced and enlarged liver of a cow naturally infected
with T. annulata
Histopathological examination
Detailed necropsy examination was undertaken on different
organs of the dead animals, and samples from different
organs and tissues including the liver, abomasum, heart,
lungs, brain, prescapular and submandibular lymph nodes,
kidneys, and skin were collected for histopathological ex-
amination. The samples were fixed in 10 % neutral buffered
formalin and embedded in paraffin. Sections were made at
5 μm in thickness, stained by hematoxylin–eosin, and stud-
ied using a light microscope (Olympus, Tokyo, Japan).
DNA extraction and PCR assay
To confirm the presence of T. annulata, specific primers, T.an.
F1 and T.an. R1 (forward)–TGTTTCGGTTGGTTTGTTCG
TCT and (reverse)–TTCCTATTCCTTACGTACTCTGGCT,
were used to amplify 1,012 bp of the T. annulata cytochrome
b gene. DNA extraction and polymerase chain reaction (PCR)
Fig. 3 Hemorrhages and ulcers (arrows) were detected in the mucous
membrane of the abomasum in T. annulata-infected cattle
Parasitol Res (2013) 112:123–127
Fig. 4 Hemorrhagic areas (arrows) were observed in the skin of T.
annulata-infected animals
assay were conducted on the blood samples as the methods
previously described by Sharifiyazdi et al. (2012).
Results
The diagnosis of theileriosis was confirmed by observing
different intraerythrocytic forms including mainly signet
ring and also rod-, comma-, and dot-shaped ones on
Giemsa-stained blood smears (Fig. 1). Definitive diagnostic
forms of Babesia were not observed in these animals. On
necropsy, jaundice in the sclera, joint capsules, and mucous
membranes and petechial and ecchymotic hemorrhages in
the mucosal and serosal surfaces were the usual findings.
The liver was friable, yellowish, and larger than normal
(Fig. 2), and the lymph nodes were generally enlarged,
edematous, and hemorrhagic. The spleen was slightly
Fig. 5 Histological section of the liver from an infected animal with T.
annulata. Accumulation of bile pigments in the hepatocytes and bile
canaliculi (arrows) is seen (scale bar056 μm). Inset shows the en-
larged bile pigments in the hepatocytes
125
Fig. 6 Dermis of cattle infected with T. annulata. It shows chronic
dermatitis with infiltration of macrophages, lymphocytes, plasma cells,
and eosinophils (scale bar056 μm)
enlarged and showed severe hemorrhages. Hemorrhages,
punched-out ulcers, and multifocal necrotic foci were ob-
served in the abomasal mucous membrane (Fig. 3). Severe
petechial hemorrhages were seen in the skin particularly in
hairless areas (Fig. 4). Pulmonary edema and emphysema
with petechial and ecchymotic hemorrhagic foci in the
lungs, together with subcutaneous and intramuscular edema,
and excessive pericardial, pleural, and peritoneal effusions
were evident. The meninges were congested, and some focal
hemorrhages were present in the brain.
The main histological change was the infiltration of lym-
phocytes, plasma cells, and macrophages in the lymph
nodes, spleen, and Peyer's patches. The same cell types were
also diffusely infiltrated in the hepatic portal tracts and
kidney interstitial tissue. Chronic portal hepatitis with infil-
tration of mononuclear cells in the portal areas and accumu-
lation of bile pigments in the hepatocytes and bile canaliculi
were observed in all infected animals (Fig. 5). The abomasal
Fig. 7 Smear of a bovine lymph node showing the schizont of Thei-
leria (arrow) (Giemsa stain, scale bar06 μm)
126
mucous membrane showed numerous multifocal areas of
erosion, necrosis, and ulceration; the submucosal area and
lamina propria adjacent to these lesions showed hyperemia
and hemorrhages, and were heavily infiltrated with lympho-
cytes, plasma cells, macrophages, and eosinophils. Fibrin
thrombi were present in some abomasal blood vessels. The
epidermis, particularly that of the hairless parts of the skin,
showed multifocal necrotic areas, and the dermis beneath
these necrotic foci showed chronic dermatitis with hyper-
emia and hemorrhages together with infiltration of macro-
phages, lymphocytes, plasma cells, and eosinophils (Fig. 6).
The submandibular and prescapular lymph nodes revealed
lymphoid proliferation together with macrophage infiltra-
tion. The schizonts of Theileria were evident in the cyto-
plasm of the lymphocytes and macrophages of the lymph
nodes (Fig. 7), spleen, and skin. The muscle fibers of the
myocardium showed mild necrosis with mononuclear cell
infiltration. The lungs showed pulmonary edema and em-
physema together with hyperemia and hemorrhages. The
blood vessels, including the cerebral vessels, were
obstructed with the parasitized lymphocytes and resulted
in focal infarction. The meninges were congested, and some
multifocal hemorrhages were present in the cerebrum and
cerebellum.
Specific PCR for T. annulata amplified the expected
band of 1,012 bp from the DNA extracted from blood
samples of each of the 11 heifers suspected of suffering
from theileriosis (not shown). Negative controls in the assay
did not produce bands.
Discussion
The clinical signs and the pathological changes reported in
the Iranian Holstein dairy cattle in the present investigation
were similar to those described for T. annulata infections in
the previous studies (Gill et al. 1977; Uilenberg 1981; Omer
et al. 2002). The necropsy lesions including hepatomegaly,
cutaneous hemorrhages, and abomasal ulcers are in agree-
ment with those reported by Sandhu (1996) who indicated
severe damages to the hepatobiliary system due to hypoxia
that resulted from hemolytic anemia and jaundice. In addi-
tion, lymphoid proliferation together with infiltration of
macrophages and sinus histiocytosis was seen in the man-
dibular and prescapular lymph nodes.
Although the skin lesions have previously been reported
grossly (Sandhu 1996; El-Deeb and Younis 2009), there is
no description about the histological features of the disease
in cattle so far. In the present study, the epidermis showed
multifocal necrotic areas, and the dermis beneath these
necrotic foci showed chronic dermatitis with infiltration of
the mononuclear cells. It has been reported that the spleen
and lymph nodes of calves naturally infected with T.
Parasitol Res (2013) 112:123–127
annulata showed severe lymphoid proliferation (Hervas et
al. 1998). It has been reported that the Theileria-infected
cells of the hemopoietic system have been transformed and
proliferated (Spooner et al. 1989), and this proliferation is
related to overexpression of casein kinase II that can serve
as an oncogene (Seldin and Leder 1995).
T. annulata infection in this study was diagnosed by
observing the intraerythrocytic forms and also Koch's blue
bodies in the lymphocytes of the lymph nodes, spleen, and
skin. Molecular examination revealed that these animals
were infected with T. annulata.
Although the natural occurrence of theileriosis in this re-
gion was limited to warm season, i.e., April to October, the
present study describes an unusual outbreak of tropical thei-
leriosis in the winter. Tick infestation with Hyalomma was
confirmed in some, but not all infected animals. It seems that
vectors other than Hyalomma are possibly involved in the
transmission of T. annulata from the infected cattle to the
uninfected ones. Based on previous studies (Gharbi et al.
2006), a carrier state occurs in the recovered animals; hence,
the presence of tick and also the occurrence of carrier animals
increase the probability of natural transmission from carriers
to susceptible animals. Further studies should be performed in
order to elucidate the route of transmission in this unusual
climatic condition and to clarify the role of carriers and wild
ruminants in the epidemiology of bovine tropical theileriosis.
References
Beniwal RK, Nichani AK, Sharma RD, Rakha NK, Suri D, Sarup S
(1997) Responses in animals vaccinated with the Theileria annu-
lata (Hisar) cell culture vaccine. Trop Anim Health Prod 29(4
Suppl):109S–113S
Brown CGD (1990) Control of tropical theileriosis (Theileria annulata
infection) of cattle. Parassitologia 32:23–31
Brown CGD (1997) Dynamics and impact of tick-borne diseases of
cattle. Trop Anim Health Prod 29:1S–3S
d’Oliveira C, Vander WM, Habela MA, Jacquiet P, Jongejan F (1995)
Detection of Theileria annulata in blood samples of carrier cattle
by PCR. J Clin Microbiol 33:2665–2669
Darghouth MA, Bouattour A, Ben Miled L, Kilani M, Brown CGD
(1996) Epidemiology of tropical theileriosis (Theileria annulata
infection of cattle) in an endemic region of Tunisia: characteriza-
tion of endemicity states. Vet Parasitol 65:199–211
El-Deeb WM, Younis EE (2009) Clinical and biochemical studies on
Theileria annulata in Egyptian buffaloes (Bubalus bubalis) with
particular orientation to oxidative stress and ketosis relationship.
Vet Parasitol 164(2–4):301–305
Gharbi M, Sassi L, Dorchies P, Darghouth MA (2006) Infection of calves
with Theileria annulata in Tunisia: economic analysis and evaluation
of the potential benefit of vaccination. Vet Parasitol 137:231–241
Gill BS, Bhattacharyulu Y, Kaur D (1977) Symptoms and pathology of
experimental bovine tropical theileriosis (Theileria annulata in-
fection). Ann Parasitol Hum Comp 52:597–608
Hashemi-Fesharki R (1991) Chemotherapeutic value of parvaquone
and buparvaquone against Theileria annulata infection of cattle.
Res Vet Sci 50:204–207
Parasitol Res (2013) 112:123–127
Hervas J, Carrasco L, Gomez-Villamondos JC, de Lara FC, Sierra MA
(1998) Myocarditis associated with Theileria spp. in calves. J Vet
Med B 45:401–405
Katzer F, McKellar S, Ben Miled L, d’Oliveira C, Shiels B (1998)
Selection for antigenic diversity of Tams1, the major merozoite
antigen of Theileria annulata. Ann N Y Acad Sci 849:96–108
Mehlhorn H, Schein E (1984) The piroplasms: life cycle and sexual
stages. Adv Parasitol 23:37–103
Mohammad Al-Saeed AT, Omer LT, Abdo J, Habibi G, Salih DA,
Seitzer U, Ahmed J (2010) Epidemiological studies on tropical
theileriosis (Theileria annulata infection of cattle) in Kurdistan
Region, Iraq. Parasitol Res 106:403–407
Omer OH, El-Malik KH, Mahmoud OM, Haroun EM, Hawas A,
Sweeney D, Magzoub M (2002) Hematological profiles in pure
bred cattle naturally infected with Theileria annulata in Saudi
Arabia. Vet Parasitol 107:161–168
Omer OH, El-Malik KH, Magzoub M, Mahmoud OM, Haroun EM,
Havas A, Omar HM (2003) Biochemical profiles in Friesian cattle
naturally infected with Theileria annulata in Saudi Arabia. Vet
Res Commun 27:15–25
Osman SA, Al-Gaabary MH (2007) Clinical, hematological and ther-
apeutic studies on tropical theileriosis in water buffaloes (Bubalus
bubalis) in Egypt. Vet Parasitol 146:337–340
View publication stats
127
Purnell RE (1978) East Coast fever: some recent research in East
Africa. Adv Parasitol 15:83–132
Sandhu GS (1996) Histopathological, biochemical and hematological
studies in crossbred calves suffering from experimental tropical
theileriosis. MVSc Thesis, Punjab Agricultural University,
Ludhiana
Seldin DC, Leder P (1995) Casein kinase II alpha transgene induced
murine lymphoma: relation to theileriosis in cattle. Science
267:894–897
Sharifiyazdi H, Namazi F, Oryan A, Shahriari R, Razavi M (2012)
Point mutations in the Theileria annulata cytochrome b gene is
associated with buparvaquone treatment failure. Vet Parasitol
187:431–435
Spooner RL, Innes EA, Glass EJ, Brown CG (1989) Theileria annulata
and T. parva infect and transform different bovine mononuclear
cells. J Immunol 66:284–288
Uilenberg G (1981) Theilerial species of domestic livestock. In:
Irvin AD, Cunningham MP, Young AS (eds) Advances in
the control of theileriosis. Martinus Nijhoff, The Hague, pp
4–37
Uilenberg G (1995) International collaborative research: significance
of tick-borne hemoparasitic diseases to world animal health. Vet
Parasitol 57:19–41