HUMAN MUTATION 23:413^419 (2004)

REVIEW

MLPA and MAPH: New Techniques for Detection

of Gene Deletions
Loryn N. Sellner1n and Graham R. Taylor2
1
Molecular Genetics Laboratory, Genetic Services of Western Australia, Princess Margaret Hospital, Perth, Australia; 2Regional Genetics Service
and Cancer Research UK, Mutation Detection Facility, St. James’s University Hospital, Leeds, United Kingdom

For the Mutation Detection 2003 Special Issue

Screening for deletions of all or part of genes poses a challenge in the diagnostic laboratory. Numerous methods
are available for detecting deletions of a few base pairs or very large deletions, but difficulties arise in detecting
deletions of a few kilobases. Two new techniques have recently been described that allow detection of such mid-
size deletions by simultaneously screening for the loss or duplication of up to 40 target sequences. These are the
multiplex amplification and probe hybridization (MAPH) and the multiplex ligation-dependent probe
amplification (MLPA). Both rely on sequence-specific probe hybridization to genomic DNA, followed by
amplification of the hybridized probe, and semi-quantitative analysis of the resulting PCR products. The relative
peak heights or band intensities from each target indicate their initial concentration. The two techniques
differ in the ease with which probes can be generated in house, and the labor intensity of performing the assay.
Hum Mutat 23:413–419, 2004 r 2004 Wiley-Liss, Inc.

KEY WORDS: MLPA; MAPH; gene dosage; deletion; duplication; mutation detection

INTRODUCTION for a significant proportion of detected mutations, such

Determination of gene dosage has many implications
in both clinical and research medicine. Detection of
alterations in gene dosage may be required for ther-
apeutic, prognostic, or diagnostic purposes. For example,
ERBB2 (Her-2) is amplified in a substantial number of
breast and ovarian cancers, and a gain in copy number of
ERBB2 is generally associated with an unfavorable
prognosis, shorter relapse time, and lower survival rate;
however, these patients may benefit from treatment with
the anti-Her-2 antibody Herceptin (trastzumab) [Harries
and Smith, 2002]. Loss of heterozygosity (LOH) analysis
using microsatellites has been used extensively in cancer
research to identify potential locations of tumor
suppressor genes, establish clonal evolution of tumor cell
populations (synchronous and metachronous), and for
many tumor types, including breast, colorectal, and liver
cancer, as potential prognostic indicators [Choi and
Mason, 2002; Nagahata et al., 2002; Nishida et al.,
2002]. An important and rapidly growing field of
application of gene dosage determination lies in diagnosis
of genetic disease. The size of DNA fragments that can
be deleted or duplicated and result in disease ranges from
a single exon (a few hundred base pairs or even less) to
entire chromosomes. A proportion of some types of
cancers are caused by inherited germline mutations in
tumor suppressor genes, and full or partial gene deletions
account for a significant number of these mutations.
There are a range of other single gene disorders where
deletion or duplication of part or all of the gene accounts
r2004 WILEY-LISS, INC.
as Duchenne muscular dystrophy, spinal muscular
atrophy, Charcot-Marie-Tooth disease, Fanconi anemia,
congenital adrenal hyperplasia, and rare metabolic
disorders such as non-ketotic hyperglycinemia. Some
examples of genes for which an estimate has been
obtained for the proportion of germline mutations that
are deletions or duplications are shown in Table 1. While
small deletions or insertions (a few base pairs) are readily
detected by the PCR and sequencing techniques and
very large deletions (in the order of megabases) are
readily detected by cytogenetic techniques, mid-size
deletions or insertions (a single gene or part of a gene)
pose a problem, as they will be missed by both PCR and
cytogenetic techniques. Due to the technical difficulties
in determining gene dosage in this size range, it is
possible that for many genes the proportion of mutations
that are deletions or duplications has in the past been
underreported. It is likely that mid-size deletions and
duplications will account for a proportion of cases
wherein a diagnosis is suspected on clinical grounds,
but no genetic cause could be identified unless these
mutations are specifically looked for.
n
Correspondence to: Loryn N. Sellner, Molecular Genetics
Laboratory, Genetic Services of Western Australia, Princess Margaret
Hospital, Roberts Road Subiaco, Perth,WA 6008, Australia.
E-mail: loryn.sellner@health.wa.gov.au
DOI 10.1002/humu.20035
Published online in Wiley InterScience (www.interscience.wiley.com)
414 SELLNER AND TAYLOR
TABLE 1. Proportion of Mutations Due to Deletions or Insertions inVarious Genes
Proportion of germline mutations
Gene Disorder that are deletions or duplications
BRCA1 Familial breast cancer
VHL Von-Hippel Lindau disease
DMD Duchenne muscular dystrophy
MSH2/MLH1 Hereditary non-polyposis
colorectal cancer
RB1 Retinoblastoma
CURRENT DETECTION METHODS
Cytogenetics and Fluorescent In Situ Hybridization
(FISH)
Standard cytogenetics is the current method of choice
when investigating aneuploidy, and can be used to detect
deletions and duplications greater than about five
megabases by G-banding. For higher resolution, FISH
can be employed using labeled probes directed to known
targets. Using FISH, deletions or duplications of single
genes can be detected, but determining part-gene
deletions is unlikely to be successful. FISH also remains
a relatively low throughput technique when compared to
other molecular genetic techniques available.
Southern Blot
Southern blotting has been the most commonly used
procedure in the molecular genetics laboratory to detect
deletions and duplications to date. Restriction fragment
size alterations may be generated by the rearrangement
and appear as novel bands on the blot. The introduction
of pulsed field gel electrophoresis (PFGE) with its
increased size range allows more scope for detection of
deletions and duplications. Alternatively, a semi-quanti-
tative approach is taken where intensity of probe
hybridization to a specific target is compared to a control
locus and a control sample. The major limitation of
Southern blotting is the low throughput—only a few
samples can be run per gel, a limited number of loci can
be queried per blot, and the tests may take several days.
Quantitative/Semiquantitative-PCR
Due to the nonlinear nature of the amplification
reaction, PCR techniques are not inherently quantita-
tive, but several modifications have been made to obtain
quantitative information from PCR based assays. One
such modification is competitive PCR, wherein a control
target of known concentration is coamplified with the
unknown target, and the concentration of the test
sample is inferred by comparison with the control.
Differential PCR also relies on coamplification of an
internal control, and the concentration of the unknown
target is obtained as a ratio to the control, and hence is
semi-quantitative rather than absolutely quantitative.
Real-time PCR can also be used as a semi-quantitative
technique when an internal amplification control is
incorporated and has the advantage of not requiring
post-PCR analysis; however, the number of targets that
can be interrogated in a reaction is limited by the number
References
4^27% Puget et al. [1999]; Gad et al. [2002];
Hogervorst et al. [2003]
20^47% Vortmeyer et al. [2002]; Shuin et al. [1995]
60% Koenig et al. [1989]
27^54.8% Gille et al. [2002];Wijnen et al. [1998];
Wagner et al. [2003]
14% Richter et al. [2003]
FIGURE 1. The MAPH technique.
of fluorophores available and the detection capabilities of
the instrument. In general, PCR-based techniques for
gene dosage determination can offer a higher through-
put, less labor intensive alternative. The disadvantages
are that the multiplexing required to interrogate a useful
number of loci can be difficult to optimize, and the cost
of buying fluorescently labeled probes for every intended
target can be prohibitive.
RECENT DETECTION METHODS
Recently, two new methods have been described for
the measurement of gene copy number; multiplex
amplifiable probe hybridization (MAPH) [Armour et al.,
2000] and multiplex ligation-dependent probe amplifica-
tion (MLPA) [Schouten et al., 2002]. Both techniques
rely on comparative quantitation of specifically bound
probes that are amplified by PCR with universal primers.
The introduction of universal primers has advantages in
that multiplexing numerous targets becomes much easier,
and when fluorescence detection of products is being
used, only one fluorescent primer is required, thus
reducing the cost compared to buying fluorescent probes
for each target.
MAPH
In the MAPH technique (see Fig. 1), genomic DNA
(1 mg) is fixed to a membrane and hybridized with a set of
probes corresponding to the target sequences to be
detected. The probes are generated by cloning the target
sequences into a plasmid vector, then amplifying the
cloned sequence using primers directed to the vector
with the result that all probes are then flanked with the
same sequence. One restriction on probe design is that

FIGURE 2. MAPH dystrophin probe sets, kindly provided byJohan den Dunnen, Leiden University. a:The two probes sets encompass-
ing all exons in normal individuals. b: A section of probe set A that demonstrates a deletion of exons 52^58 in a female and a male.
probes that are intended to be multiplexed must be of
sufficient size difference to be resolved by electrophoresis,
either slab gel or capillary. The membranes are then
washed rigorously to remove unbound probe, and the
remaining specifically bound probe will be present in an
amount proportional to its target copy number. The
probes are then stripped from the membrane and
amplified simultaneously with the universal primer pair.
Products are then separated by electrophoresis and a
relative comparison is made between the band intensities
or peak heights, depending on the detection method.
Reduced band intensities or peak heights compared to
internal control probes indicate reduction in gene copy
number (deletion) and an increase in gene copy number
(duplication) will result in increase band intensities or
peak heights. Up to 40 probes have been multiplexed and
resolved by gel electrophoresis simultaneously [Armour
et al., 2000], and reports on the application of MAPH for
detection of deletions in the DMD gene, subtelomeric
deletions, and CML tumor typing [White et al., 2002;
Sismani et al., 2001; Hollox et al., 2002; Reid et al.,
2003]. An example of a MAPH result for dystrophin
MLPA AND MAPH 415
gene analysis with fluorescent probe detection is shown
in Figure 2. The assay can be completed in 2–3 days,
requiring one overnight hybridization followed by
membrane washing, a PCR step, and a product detection
step.
MLPA
In the MLPA technique (see Fig. 3), genomic DNA is
hybridized in solution to probe sets, each of which
consists of two halves. One half consists of a target
specific sequence (20–30 nucleotides) flanked by a
universal primer sequence, and can be generated
synthetically. The other half also has a target-specific
sequence at one end (25–43 nucleotides) and a universal
primer sequence at the other, but has a variable length
random fragment in between (19–370 nucleotides) to
generate the size differences necessary in the probes to
allow electrophoretic resolution. This larger probe part is
generated by cloning the target specific sequence into
M13 derived vectors that already contain the variable
length fragments; single stranded DNA is then purified
416 SELLNER AND TAYLOR
Primer recognition site
Stuffer fragment
Target A Target B
Genomic DNA
Hybridise O/N
Ligate 15 min
Denature 5 min
PCR
Fragment analysis
A B
FIGURE 3. The MLPA technique.
from the phage particles and made double stranded at
two sites by annealing of short oligonucleotides in order
that the desired probe fragment can be liberated by
restriction enzyme digestion. The two probe halves are
designed such that the target specific sequences bind
adjacently to the target DNA and can then be joined by
use of a ligase. This generates a contiguous probe flanked
by universal primer binding sites that can then be
amplified by PCR, whereas unbound probe halves cannot
be amplified, and hence eliminates the need for removal
of excess probe by washing. The amounts of ligated probe
produced will be proportional to the target copy number,
and after PCR amplification the relative peak heights
indicate deletion or duplication of target sequence. An
example of an MLPA result using a commercially
available kit for analysis of the HNPCC genes MSH2
and MLH1 is shown in Figure 4. Up to 40 probes sets
have been multiplexed successfully, and several reports
on the use of MLPA have recently been published for
gene dosage determination in genes such as BRCA1,
MSH2, and MLH1 [Gille et al., 2002; Hogervorst et al.,
2003; Montagna et al., 2003]. A range of kits are
available commercially from MRC-Holland (www.mrc-
holland.com), with the disclaimer that they are intended
for research purposes and not diagnostic use. A list of
available kits is shown in Table 2, with kits for RB1 and
TSC2 also soon to become available.
ADVANTAGES AND DISADVANTAGES OF MAPH
AND MLPA
While MAPH and MLPA both work on similar
principles and generate similar results, they each have
some different advantages and disadvantages. In terms of
establishing a probe set in house, the generation of
probes for MAPH is far simpler than the M13 cloning
required for MLPA probe generation. It is possible to also
generate the second probe for MLPA synthetically,
although the multiplexing potential will be reduced due
to limitations on the maximum size of oligonucleotide
synthesis, although using more than one flurochrome can
increase the number of fragments analyzed. One
disadvantage of using MAPH probes rather than MLPA
probes is that MAPH probes are inherently amplifiable,
and pose more of a contamination risk than MLPA
probes, which only become amplifiable after the ligation
step. The washing steps in the MAPH technique
necessary to remove unbound probe may also introduce
a contamination risk, as amplifiable probe mix is
manipulated, and this also substantially increases the
labor intensity as does separation and identification of
the washed membranes into individual tubes before the
PCR step. MLPA being entirely liquid phase and
amenable to automated multi-well formats makes it
somewhat higher throughput than MAPH.
Another difference between the two techniques is the
amount of DNA required, although neither method
requires a prohibitive amount. MAPH requires 1 mg of
DNA, and although MLPA is reported to work with only
20 ng, we find that 100–200 ng is required for reliable
and reproducible results.
Polymorphisms or single base mutations in the probe
binding regions may affect MLPA results but are unlikely
to affect MAPH. The short length of the specific probe
region in the MLPA probes (20–30 nucleotides) means
that nucleotide mismatches at the probe binding site may
prevent probe hybridization, and hence ligation and
ultimately detection, so that single base changes may
appear as exon deletions. For this reason, we recommend
that all simple fragment deletions found by MLPA be
confirmed by an independent method, and that sequen-
cing of the target be undertaken should an independent
test not indicate deletion. MAPH probes being 100–200
bp are unlikely to be affected by single base changes;
however, if part of a region targeted by a MAPH probe is
deleted, the probe may still hybridize and the target will
be scored as being present.
FUTURE POTENTIAL OF MLPA AND MAPH
While MAPH represents a conceptual breakthrough
for the analysis of gene dosage, in practice, the handling

FIGURE 4. An example of an MLPA using the MSH2/MLH1 kit from MRC-Holland that demonstrates a deletion of exons 11^16 in
MSH2 in the bottom panel.
TABLE 2. Gene Dosage MLPA
Disorder
Familial breast cancer
Hereditary non-polyposis colorectal cancer
Hereditary non-polyposis colorectal cancer
Von-Hippel Lindau syndrome
Neuro¢bromatosis
Familial adenomatous polyposis
Multiple endocrine neoplasia
Spinal muscular atrophy
Duchenne/Becker muscular dystrophy
Leri-Weill syndrome, short stature
Canavan disease
Fanconi anaemia A
Charcot-Marie-Tooth disease
SOTOS syndrome
Williams-Beuren syndrome
Pelizaeus-Merzbacher disease
DiGeorge syndrome
Subtelomeric regions
Trisomy
ERBB2 ampli¢cation
Human chromosomal aberrations
MLPA AND MAPH 417
Kits CommerciallyAvailable from MRC-Holland
Gene/chromosome Comments
BRCA1 and BRCA2 One kit for each with probes for all exons.
MSH2 and MLH1 Single kit with probes for all exons of both genes.
MSH6 and PMS2 Single kit with probes for all exons of both genes.
VHL Contains one or two probes for each exon.
NF2 Contains one probe for each exon.
APC Contains one probe for each exon.
MEN1 Contains 5 probes for the gene.
MECP2 Contains probes for each of the 4 exons.
DMD Two kits containing probes for all 79 exons.
SHOX Contains probes for each of the 8 exons.
ASPA Contains probes for all exons.
FANCA Contains probes for all 43 exons.
PMP22 Contains probes for each of the 5 exons.
NSD1 Contains probes for 9 exons.
7q11.23 Contains probes for the ELN gene and
surrounding region.
PLP1 Contains probes for each of the 7 exons.
22q11 Contains 10 probes for this region.
All exons Two kits containing probes for all subtelomeric
regions.
Chromosomes 13,18, 21, X andY Contains 8 probes for each of 13,18, and 21, 4
probes for X, and 3 for Y.
ERBB2 (Her2-neu) Contains 3 probes for ERBB2,11 probes for
chromosome 17, and 25 probes for other
frequently lost chromosomes.
Various regions involved in tumours 3 kits with 40 probes each.
eg MYC, cyclin, P53
418 SELLNER AND TAYLOR

BRCA1 exon1
GGGTTCCCTAAGGGTTGGAGcccctgcgctcaggaggcct

TcaccctctgctctgggtaaagttTTATGGTGATCAGTCAACCACCAGGTCTAGATTGGATCTTGCTGGCAC

BRCA1 exon3
GGGTTCCCTAAGGGTTGGACccatctgtctggagttgatc

AaggaacctgtctccacaaagtgtGAGACACCTTATGTTCTATACATGCTCTAGATTGGATCTTGCTGGCAC

BRCA1 exon 13
GGGTTCCCTAAGGGTTGGAttccatcataagtgactcttc

TgcccttgaggacctgcgaaatccTCCATGCGCTTGCTCTTCATCTAGCTCTAGATTGGATCTTGCTGGCAC

TAGs

TAG Sequence Target

amplicon
CCTGGTGGTTGACTGATCACCATAA BRCA1 exon 1
GCATGTATAGAACATAAGGTGTCTC BRCA1 exon 3
GCTAGATGAAGAGCAAGCGCATGGA BRCA1 exon 13
FIGURE 5. The forward probe includes amplimer binding site (uppercase, same as MRC Holland forward primers) and half of the liga-
table probe (lowercase).The lower fragments are longer; they comprise the other half of the ligatable probe (lowercase). Next to this is
the anti-tag (italic) that will bind to the arrayed tags and ¢nally the reverse complement of the reverse primer (uppercase).The tags go
on the array: we have used acrydite-labeled tags that include linkers and arrayed onto 3D slides coated with acrylamide (Agilent)
applied using a Biorobotics microarrayer.The same probe design can be adapted for genotyping by using the 5 0 base of the down-
stream ligatable fragment to correspond to any sequence variant that is being tested.

of small filter discs is difficult and could pose sample
tracking problems in routine medium throughput use. It
may be possible to circumvent this either by using filter
manifolds or by biotin labeling of genomic DNA to
enable a liquid-phase adaptation of MAPH using biotin-
streptavidin to replace filter-binding for probe washing.
Both techniques offer a rapid means of scanning up to 40
loci for gene dosage, and are likely to be widely used in
research and diagnostic settings. They could also easily
be adapted to gene expression analysis, for example, in
tumor tissue. However, there are still some limitations.
Both systems as currently reported use cloned probes that
are time consuming to make. While PCR products can
replace cloned MAPH probes, enabling rapid and flexible
probe design, MLPA uses M13 (single stranded) probes
that are more technically challenging to construct. There
are many applications for which it would be useful to
construct probes that are unlikely to become commer-
cially available, for example, to detect deletions in
uncommon gene disorders or unique situations such as to
enable fine mapping and identification of the junction
fragments. One solution is to adapt MLPA or MAPH to
an array detection setting so that fragments were
identified by sequence rather than size. As the MLPA
probes consist of two ligatable fragments of about 50
bases, this would enable all MLPA probes to be
chemically synthesized. The use of tagged primers in
the generation of PCR-product probes for MAPH could
also be implemented. Although array manufacture can
be costly, if a zip code strategy is adopted as described by
Favis et al. [2000], standard arrays can be used to query
any products that have a zip code design included. An
example using MLPA probes is shown in Figure 5. Array
adaptations of both MAPH and MLPA could enable
much higher order multiplexes than are currently
possible. However even 40-plex assays represent a
substantial gain in the multiplex order typically available
in PCR. MAPH or MLPA could provide competition for
the array-based CGH approaches: a 96-well array of 40
probes could interrogate over 3,000 loci, representing a
better than 1 cM coverage of the entire human genome
or much higher single chromosome resolution. Both
techniques are also readily adaptable to lower technology
settings, for example, using conventional slab gels with
fewer probes, enabling wide access to the technology.
ACKNOWLEDGMENTS
We would like to thank Dr. Ruth Charlton and Dr.
Claire Taylor (HNPCC MLPA development and data
analysis), Dr. David Cockburn (MAPH assay develop-
ment and evaluation), Dr. Johan den Dunnen (dystro-
phin MAPH probe set), and Dr. Jan Schouten (advice on
MLPA).
REFERENCES
Armour JA, Sismani C, Patsalis PC, Cross G. 2000. Measurement
of locus copy number by hybridisation with amplifiable probes.
Nucleic Acids Res 28:605–609.
Choi SW, Lee KJ, Bae YA, Min KO, Kwon MS, Kim KM, Rhyu
MG. 2002. Genetic classification of colorectal cancer based on

chromosome loss and microsatellite instability predicts survival.
Clin Cancer Res 8:2311–2322.
Favis R, Day JP, Gerry NP, Phelan C, Narod S, Barany F. 2000.
Universal DNA array detection of small insertions and deletions
in BRCA1 and BRCA2. Nat Biotechnol 18:561–564.
Gad S, Caux-Moncoutier V, Pages-Berhouet S, Gauthier-Villars M,
Coupier I, Pujol P, Frenay M, Gilbert B, Maugard C, Bignon YJ,
Chevrier A, Rossi A, Fricker JP, Nguyen TD, Demange L, Aurias
A, Bensimon A, Stoppa-Lyonnet D. 2002. Significant contribu-
tion of large BRCA1 gene rearrangements in 120 French breast
and ovarian cancer families. Oncogene 21:6841–6847.
Gille JJ, Hogervorst FB, Pals G, Wijnen J, Van Schooten RJ,
Dommering CJ, Meijer GA, Craanen ME, Nederlof PM, De Jong
D, McElgunn CJ, Schouten JP, Menko FH. 2002. Genomic
deletions of MSH2 and MLH1 in colorectal cancer families
detected by a novel mutation detection approach. Br J Cancer
87:892–897.
Harries M, Smith I. 2002. The development and clinical use of
trastuzumab (Herceptin). Endocr Relat Cancer 9:75–85.
Hogervorst FB, Nederlof PM, Gille JJ, McElgunn CJ, Grippeling M,
Pruntel R, Regnerus R, van Welsem T, van Spaendonk R,
Menko FH, Kluijt I, Dommering C, Verhoef S, Schouten JP,
van’t Veer LJ, Pals G. 2003. Large genomic deletions and
duplications in the BRCA1 gene identified by a novel
quantitative method. Cancer Res 63:1449–1453.
Hollox EJ, Atia T, Cross G, Parkin T, Armour JA. 2002. High
throughput screening of human subtelomeric DNA for copy
number changes using multiplex amplifiable probe hybridisation
(MAPH). J Med Genet 39:790–795.
Koenig M, Beggs AH, Moyer M, Scherpf S, Heindrich K,
Bettecken T, Meng G, Muller CR, Lindlof M, Kaariainen H,
de la Chapelle A, Kiuru A, Savontaus ML, Gilgenkrantz H,
Recan D, Chelly J, Kaplan JC, Covone AE, Archidiacono N,
Romeo G, Liechti-Gallati S, Schneider V, Braga S, Moser H,
Darras BT, Murphy P, Francke U, Chen JD, Morgan G, Denton
M, Greenberg CR, Wrogemann K, Blonden LAJ, van Paassen
HMB, van Ommen GJB, Kunkel LM. 1989. The molecular
basis for Duchenne versus Becker muscular dystrophy: correla-
tion of severity with type of deletion. Am J Hum Genet 45:
498–506.
Montagna M, Palma MD, Menin C, Agata S, De Nicolo A,
Chieco-Bianchi L, D’Andrea E. 2003. Genomic rearrangements
account for more than one-third of the BRCA1 mutations in
northern Italian breast/ovarian cancer families. Hum Mol Genet
12:1055–1061.
Nagahata T, Hirano A, Utada Y, Tsuchiya S, Takahashi K, Tada T,
Makita M, Kasumi F, Akiyama F, Sakamoto G, Nakamura Y,
Emi M. 2002. Correlation of allelic losses and clinicopatho-
logical factors in 504 primary breast cancers. Breast Cancer
9:208–215.
Nishida N, Fukuda Y, Komeda T, Ito T, Nishimura T, Minata M,
Kuno M, Katsuma H, Ikai I, Yamaoka Y, Nakao K. 2002.
Prognostic impact of multiple allelic losses on metastatic
MLPA AND MAPH 419
recurrence in hepatocellular carcinoma after curative resection.
Oncology 62:141–148.
Puget N, Stoppa-Lyonnet D, Sinilnikova OM, Pages S, Lynch HT,
Lenoir GM, Mazoyer S. 1999. Screening for germ-line
rearrangements and regulatory mutations in BRCA1 led to the
identification of four new deletions. Cancer Res 59:455–461.
Reid AG, Tarpey PS, Nacheva EP. 2003. High-resolution analysis
of acquired genomic imbalances in bone marrow samples from
chronic myeloid leukemia patients by use of multiple short DNA
probes. Genes Chromosomes Cancer 37:282–290.
Richter S, Vandezande K, Chen N, Zhang K, Sutherland J,
Anderson J, Han L, Panton R, Branco P, Gallie B. 2003.
Sensitive and efficient detection of RB1 gene mutations
enhances care for families with retinoblastoma. Am J Hum
Genet 72:253–269.
Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F,
Pals G. 2002. Relative quantification of 40 nucleic acid
sequences by multiplex ligation-dependent probe amplification.
Nucleic Acids Res 30:e57.
Shuin T, Kondo K, Kaneko S, Sakai N, Yao M, Hosaka M, Kanno
H, Ito S, Yamamoto I. 1995. Results of mutation analyses of von
Hippel-Lindau disease gene in Japanese patients: comparison
with results in United States and United Kingdom. Acta
Urologica Japonica 41:703–707.
Sismani C, Armour JA, Flint J, Girgalli C, Regan R, Patsalis PC.
2001. Screening for subtelomeric chromosome abnormalities in
children with idiopathic mental retardation using multiprobe
telomeric FISH and the new MAPH telomeric assay. Eur J Hum
Genet 9:527–532.
Vortmeyer AO, Huang SC, Pack SD, Koch CA, Lubensky IA,
Oldfield EH, Zhuang Z. 2002. Somatic point mutation of the
wild-type allele detected in tumors of patients with VHL
germline deletion. Oncogene 21:1167–1170.
Wagner A, Barrows A, Wijnen JT, van der Klift H, Franken PF,
Verkuijlen P, Nakagawa H, Geugien M, Jaghmohan-Changur S,
Breukel C, Meijers-Heijboer H, Morreau H, van Puijenbroek M,
Burn J, Coronel S, Kinarski J, Okimoto R, Watson P, Lynch JF,
de la Chapelle A, Lynch HT, Fodde R. 2003. Molecular
analysis of hereditary nonpolyposis colorectal cancer in the
United States: high mutation detection rate among clinically
selected families and characterization of an American founder
genomic deletion of the MSH2 gene. Am J Hum Genet
72:1088–1100.
White S, Kalf M, Liu Q, Villerius M, Engelsma D, Kriek M,
Vollebregt E, Bakker B, van Ommen GJ, Breuning MH, den
Dunnen JT. 2002. Comprehensive detection of genomic
duplications and deletions in the DMD gene, by use of
multiplex amplifiable probe hybridisation. Am J Hum Genet
71:365–374.
Wijnen J, van der Klift H, Vasen H, Khan PM, Menko F, Tops C,
Meijers-Heijboer H, Lindhout D, Moller P, Fodde R. 1998.
MSH2 genomic deletions are a frequent cause of HNPCC.
Nat Genet 20:326–328.