+Model

CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS

Clinics and Research in Hepatology and Gastroenterology (2020) xxx, xxx—xxx

Available online at

ScienceDirect
www.sciencedirect.com

ORIGINAL ARTICLE

Tumor educated platelets, a promising

source for early detection of hepatocellular
carcinoma: Liquid biopsy an alternative
approach to tissue biopsy
Sidra Asghar a, Walifa Waqar a, Muhammad Umar b,
Sobia Manzoor a,∗

a
Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, H12, 44000
Islamabad, Pakistan
b
Centre for Liver and Digestive Diseases Holy Family Hospital, Rawalpindi, Pakistan

KEYWORDS
Summary
HCC;
Purpose: Liver cancer is considered to be the sixth deadliest cancer worldwide. Hepatocellular
Platelets;
carcinoma (HCC) is known to be the most prevalent type of liver cancer. The number of deaths
Tumor educated
due to HCC reported per year is on a constant rise especially in lesser developed countries.
platelets (TEP);
There are several contributing factors to this rise in number. Among other contributing factors
Liquid biopsy
is the late diagnosis of HCC. Patients are usually diagnosed when the disease reaches its advance
stage. The present study was conducted with total 30 samples. It was designed for investigating
the potential of TGF-␤, NF-␬␤, VEGF, AKT and PI3K as RNA based biomarkers in tumor educated
platelets for early detection of HCC.
Results: The results obtained from the transcriptional analysis revealed a significant high
expression of TGF-␤, NF-␬␤, VEGF by 2.48, 2.35 and 2.78 folds respectively in comparison
to the control. On the other hand, a decrease in expression by 0.6 and 0.65 folds was observed
in AKT and PI3K respectively in comparison to controls. Although all selected RNA biomarkers
showed promising potential to detect HCC however, AKT and PI3K were better able to detect
early stage HCC.
Conclusions: The results obtained clearly indicate the increased expression of TGF-␤, NF-␬␤,
VEGF in HCC patients. All these biomarkers are previously known for cancer initiation, pro-
gression and metastasis. The significant decrease in expression of AKT and PI3K in HCC patients
needs further investigation. All the selected RNA biomarkers can be used for detection of HCC as
they were able to distinguish HCC patients from controls successfully with AKT and PI3K showing

∗
Corresponding author.
E-mail addresses: sidra.asghar949@gmail.com (S. Asghar), walifawaqar@yahoo.com (W. Waqar), drumarpk@yahoo.com (M. Umar),
dr.sobiamanzoor@asab.nust.edu.pk, lcianunique@yahoo.com (S. Manzoor).
https://doi.org/10.1016/j.clinre.2020.03.023
2210-7401/© 2020 Elsevier Masson SAS. All rights reserved.

Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023
+Model
CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS
2 S. Asghar et al.

better potential to detect early stage HCC. However, translational analysis for all these RNA
biomarkers should be performed to gain further evidence for the ability of these biomarkers to
be used for early HCC detection.
© 2020 Elsevier Masson SAS. All rights reserved.

Introduction increasing the survival rate ultimately. Several studies have

Primary liver cancer is presented as sixth most commonly
occurring primary malignancy worldwide [1]. It is consid-
ered to be the reason for majority of the deaths attributed
to cancers, second only to lung cancer [2]. Hepatocellular
carcinoma (HCC) is the most prevalent type of liver can-
cer except for some parts of South East Asia [3]. Numerous
risk factors contribute to the development of HCC which
include diabetes, smoking, aflatoxin, obesity, chronic infec-
tion by Hepatitis B virus (HBV) or Hepatitis C virus (HCV) and
cirrhosis [4,5].
Another major reason for the high death rate of HCC is
the late diagnosis. Patients are usually diagnosed when the
disease has progressed to such a stage that the patient is
left with very little to zero treatment options. According
to an estimation only in United States 42,220 new patients
will be diagnosed with HCC in 2018 causing 30,200 deaths
[6]. Although the incidence rate of HCC is lower in high-
income countries yet the mortality rate due to Liver cancer
has increased as observed in the recent years in USA [7].
This rate is expected to rise in the next two decades. Male
dominance in this disease has been observed, as the number
of males being diagnosed with HCC exceeds that of females
[8]. According to another study out of the total 782, 451
cases reported of HCC globally in 2012, majority of the cases
i.e. 83% belonged to the low and middle-income countries
[2]. Pakistan also has an equally moderate to high rate of
HCC prevalence in comparison to the rest of the world [9].
Studies on HCC reveal that around 82.4% of the patients
diagnosed with HCC die within the first 5 years post diagnosis
[10]. The main reasons for the grim prognosis of HCC are
ineffective tools for early detection and limited options for
treatment as the disease has high reoccurrence rate[11,12].
It is known that all the cancers develop due to accumulation
of several genomic as well as the epigenomic alterations.
These alterations then orchestrate the abnormal expression
of the downstream molecules i.e. RNA and proteins. Hence,
Genetics based analysis of tumor can be really helpful for
managing the cancer precisely [13,14].
Current available diagnosis options include imaging tech-
niques i.e. CT scan and tissue biopsy. For cancer study,
biopsy is done on patient to obtain the tumor tissue. This
tissue is further analyzed to obtain the genetic alterations
that are either directly or indirectly associated with tumor
development [15—19]. Although many consider this method
to be a gold standard in cancer diagnosis yet the informa-
tion obtained after analyzing the tumor is limited making
it difficult to determine the heterogeneity of the disease
[20—22].
Another approach for early detection of HCC under con-
sideration is liquid biopsy. Advancements in this field hold
great promises in improvement of the early diagnosis and
evaluated the molecular signatures associated with liver
cancer i.e. methylation, other genetic alterations, RNA
expression in circulating biomarkers (CB) and circulating
tumor cells (CTCs). The tumor sources that can be exploited
for their use in liquid biopsy include cell free DNA, exo-
somes, CTC and platelets [10].
These alterations can serve as markers for cancer. Their
identification through liquid biopsy should permit not only
unambiguous screening but also detection and character-
ization of the tumor at early stage. Liquid biopsy is not
currently practiced for HCC as happening in case of breast
cancer, lung cancer and colorectal cancer. However, the
exciting applications of liquid biopsy in early detection of
cancer, accurate prediction of the prognosis and easy mon-
itoring of the recurrence of HCC hold great promises for its
future use for HCC [10].
All other sources except platelets show limitation of
being very low in number in early stages of cancer [23] thus,
hampering their use for early cancer detection. Platelets on
the other hand have no such limitation as they are read-
ily available to be used for diagnosis due to their relative
abundance in blood. Platelets carryout various important
functions of the body including vessel remodeling, immunity
and inflammation [24].
Apart from their role in performing normal body functions
these platelets also play a part in cancer progression. They
aid in progression via helping the tumor cell in metastasizing
to distant areas of the body [25—28].
Continuous evidence suggests that platelets do have the
potential to be used as effective biomarkers in early can-
cer diagnosis. The foreign material released by the tumor is
when ingested by the platelets either by vesicle dependent
or independent manner, causes certain change of events
in platelets causing them to undergo peculiar changes.
Platelets in such a state are known as being educated by
the tumor [29,30].
The mRNA repertoire of platelets gets altered by the col-
lective effect of the ingestion of foreign materials and direct
interaction with tumor. This highly dynamic mRNA repertoire
can thus be exploited for its use as a biomarker in early
cancer detection [29].
All the above stated evidences have laid to the foun-
dation of the present study. To the best of our knowledge
this is the only study of its kind where we are focusing on
exploring the mRNA profile of the platelets extracted from
HCC patients. Present study will further help in predicting
the changes which a platelet undergoes while interacting
with tumor hence assisting in prediction of HCC in the long
run. We, therefore, have selected TGF␤, NF␬B, VEGF, AKT
and PI3K to study their potential as biomarkers for early
diagnosis of HCC. All these genes are very well-known for
assisting in cell proliferation, tumor metastasis and cancer

Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023
+Model
CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS
A promising source for early detection of hepatocellular carcinoma
progression in HCC. Early diagnosis of HCC through liquid
biopsy would not only be cost effective but it would assist
in decreasing the mortality rate of HCC overall by detecting
HCC at an early stage leaving patients with more treatment
options.
Methodology
Collection of blood samples
IRB approval for the study was obtained from the parent
department ‘‘Atta-ur-Rahman School of Applied Biosciences
(ASAB) National University of Sciences and Technology Islam-
abad, Pakistan. For obtaining blood samples Rawalpindi
Medical University (RMU) Rawalpindi, Pakistan was con-
tacted. After getting an IRB approval from their ethical
committee board, samples were collected from the Cen-
ter of Liver Disease (CLD) present in Holy Family Hospital
Rawalpindi (associated with RMU). Patients were asked for
their consents before obtaining the sample. Six ml of blood
was drawn slowly with care. The blood was then shifted
immediately to the purple capped EDTA vacutainer tubes to
prevent clotting of the blood sample. Tubes were labelled
properly with patient’s name and ID. These collected sam-
ples were then transported back on ice to ASAB within 3
to 4 hours of sample collection for further processing. 10
Blood samples from both males and females (age 18yr to
65yr) were obtained according to the inclusion and exclu-
sion criteria to be used as controls. All these samples were
tested for ELISA and LFT at the diagnostic lab of ASAB before
utilization. The patients included in this study were con-
firmed HCC patients. Sampling was performed from March
2017 till June 2018. A total sample number of 30 was
used for conducting the study. All the patients were sub-
jected to the exclusion and inclusion criteria as described
in Table 1.
Separation of platelets from blood
Density gradient centrifugation with the correct speed can
lead to fractionation of blood. These fractionated blood
cells can be separated to get the pure platelets population.
6 mL of the blood present in EDTA tubes was poured into
15 mL falcon tubes. The falcon tubes were then subjected
Table 1 Table summarizes exclusion and inclusion criteria used.
Exclusion criteria
Patients of age below 18
Patients suffering from any bacterial or fungal
infectious diseases i.e. Tuberculosis would be
excluded
Patients who are not willing to be the part of
research
Patients on medication especially aspirin or
any steroids will be excluded
Patients on blood transfusions because of low
Hb levels
Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023
3
to centrifugation at 120Xg for 20 min at 4 ◦ C (Eppendorf cen-
trifuge 5810R). The acceleration and deceleration speed
were kept minimum to avoid the activation of platelets.
This centrifugation speed was enough to separate the red
blood cells and a buffy coat layer containing the lympho-
cytes from the rest of blood cells. The upper plasma was
collected without disturbing both the layers and was trans-
ferred to another 15 mL falcon. This was later given another
spin of 360Xg with zero acceleration and deceleration speed
to separate out the platelets from rest of cells. A white pal-
let of platelets can be seen at the bottom of the tube after
the spin ends. Plasma was aspirated to leave only the pallet
in the tube. 100ul of ACD buffer was used to resuspend the
pallet. ACD buffer due to its peculiar properties is helpful in
retaining the platelets in their inactive state.
Testing the purity of isolated platelets
The resuspended platelets were then visualized under
microscope to see if they had any contamination of red or
white blood cells in them. Getting 3 or 4 cells on the back-
ground of 10 million platelets was considered to be pure
enough for further processing as indicated by Sol & Wur-
dinger, 2017 [31].
RNA extraction and quantification
MagMax mirVana Total RNA isolation kit (Invitrogen) was
used for the isolation of RNA from platelets. The resus-
pended platelets were transferred to a 2 mL eppendorf tube
and the instructions mentioned in the product catalogue
were followed to extract RNA. Elution buffer containing the
extracted RNA was carefully stored at −20 ◦ C.
cDNA preparation
Extracted RNA was checked on Nano drop. All the RNA
samples were used for preparing cDNA using the reverse
transcription process with the help of oligo (dT) primers.
The PCR used for preparation of cDNA was THERMOCYCLER
GeneAmp® PCR system9700. Profile used was 25 ◦ C for 5 min,
42 ◦ C for 60 min and at 70 ◦ C for 7 min. After reaction was
complete, the PCR tubes containing the cDNA were stored
at −20 ◦ C.
Inclusion criteria
Selected patients (mixed gender) would be in
age range of 18 and above
Patients should have confirmed case of liver
cancer: BCLC staging 0 to D
Written and informed consents will be
obtained from patients
Patients of any etiology leading to liver cancer
i.e. HCC
Patients with known LFT and CT scans
+Model
CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS
4 S. Asghar et al.

Optimization on conventional PCR
0.1—1ug of cDNA was used for optimization of all the
selected biomarkers on conventional PCR. The PCR profiles
used are mentioned in Table 2. A final concentration of
2%TAE agarose gel with ethidium bromide as a stain was
made for running 10ul of PCR product mixed with 5ul of 1X
loading dye along with 100bp DNA ladder in an electrophore-
sis tank. Wealtec Dolphin Doc (S/N470883) was later used
to visualize the gel. Band size of all the biomarkers were
confirmed after comparison with the DNA ladder.
in cancer initiation, progression and metastasis. The objec-
tive of the study was to determine the potential of these
biomarkers in early stage liver cancer detection. The fold
change difference in the expression of the selected biomark-
ers was recorded in both the 20 HCC patients and the 10
control samples. Beta Actin was used as an internal control.
Results obtained from the experiments are demonstrated
below in Fig. 1.
ROC curve analysis of selected biomarkers

Receiver operating characteristic curve often abbreviated as

Optimization of real time PCR amplification
All the genes were optimized for real time PCR by using
cDNA concentration of 500 ng. PCR machine used for carrying
out the experiment was 7300 Applied Biosystem Real time
PCR. PCR profile used was preheating the reaction mixture
at 95 ◦ C for 10 min, later 40 cycles were performed with pro-
file: 95 ◦ C for 15 sec, 60 ◦ C for 60 sec. The Ct values of both
the target genes and the reference genes (housekeeping)
were observed and compared to determine the fold change
expression difference of the targeted markers in platelets
of HCC patients.
Statistical analysis
Graph pad prism version 7.0 was used for carrying out all
the statistical tests. Hypothesis was tested by using one-way
ANOVA. *P < 0.05, **P < 0.005, ***P < 0.001 was considered sig-
nificant with confidence interval = 95%.
ROC curve is used for determining the diagnostic ability of a
selected biomarker. The false positive rate i.e. specificity is
plotted on the x-axis whereas the true positive rate i.e. sen-
sitivity is plotted on the y-axis of the graph. In the present
study, ROC curve was performed for determining the poten-
tial of the selected biomarkers to successfully detect HCC
patients from controls. Moreover, ROC curve analysis was
used for analyzing the ability of these biomarkers to iden-
tify the early and late stage HCC. The results showed that
all these biomarkers were able to successfully detect the 20
HCC patients from the 10 controls as illustrated in Fig. 2.
It also illustrated that AKT and PI3K in comparison to other
biomarkers i.e. TGF-␤, NF␬␤, and VEGF were able to detect
early stage HCC with more specificity as demonstrated in
Fig. 3.
Analysis of the Expression pattern of selected
biomarkers in patients with different HCC Stages

The expression difference of TGF-␤, NF␬␤, VEGF, AKT and

Results
Transcriptional analysis of cancer biomarkers
TGF␤, NFкB, AKT, PI3K and VEGF were selected after a thor-
ough literature search for their use as potential biomarkers.
All these biomarkers are known to have a well-known role
PI3K was analyzed at various stages of HCC. Out of 20 HCC
patients 12 were diagnosed to have early to intermedi-
ate stage HCC and were grouped under ‘‘early stage HCC’’
whereas, 8 patients had advanced to end stage HCC and
hence, were grouped under ‘‘Late stage HCC’’ for the study.
The expression analysis determined a definitive change in
expression pattern of all these biomarkers as compared

Table 2 Selected primers for all the genes with their sequences, amplicon sizes and PCR profiles.

Genes Primer Sequences Product size PCR profile

FP-VEGF 5 CCCACTGAGGAGTCCAACAT3 173bp (95 ◦ C for 45sec, 60 ◦ C for 45sec,

72 ◦ C for 45sec.) 35cylces with
RP-VEGF 5 AAATGCTTTCTCCGCTCTGA3 10 min at 72 ◦ C and storage at 4 ◦ C
TGF␤1-F 5 TATCGACATGGAGCTGGTGA3 240bp (95 ◦ C for 45sec, 60 ◦ C for 45sec,
TGF␤1-R 5 TGGGTTTCCACCATTAGCAC3 72 ◦ C for 45sec) 35 cycles with
NF␬␤1-F 5 AGAGGCGTGTATAAGGGGCTA3 155bp 10 min at 72 ◦ C and storage at 4 ◦ C
NF␬␤1-R 5 TGAGGTCCATCTCCTTGGTC3
PI3KR1-F 5 CTGCCTCCTAAACCACCAAA3 153bp (95 ◦ C for 45sec, 58 ◦ C for
45sec, and 72 ◦ C for 45sec)
35cyles with 10 min at 72 ◦ C
and storage at 4 ◦ C
PI3KR1-R 5 TACCAAAAAGGTCCCGTCTG3
AKT-F 5 ACAAGGACGGGCACATTAAG3 188bp (95 ◦ C for 45sec, 57 ◦ C for 45sec,
and 72 ◦ C for 45sec) 35cylces with
AKT-R 5 ACCGCACATCATCTCGTACA3 10 min at 72 ◦ C and storage at 4 ◦ C

Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023
+Model
CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS
A promising source for early detection of hepatocellular carcinoma 5

Figure 1 Expression level of TGF-␤, NF␬␤, AKT, PI3K and VEGF in control and HCC patients. The figure demonstrates the tran-
scriptional analysis of all the selected biomarkers. According to the obtained graph the expression level of TGF-␤, NF␬␤, and VEGF
was significantly increased by 2.48, 2.35 and 2.78 folds respectively. However, a decrease of 0.6 and 0.65 folds was observed in
AKT and PI3K expression respectively in HCC patients when compared to controls. Data was analyzed by applying one-way ANOVA.
Significance: *P value < 0.05, **P value < 0.005, ***P value < 0.001.

the most prevalent when compared to other types. Several

Figure 2 ROC curve analysis of TGF-␤, NF␬␤, AKT, PI3K and
VEGF. The figure demonstrates the ROC curve analysis of all the
selected biomarkers. It shows that all the biomarkers detected
HCC with 100% sensitivity. AUC = 1.00.
to controls. The expression of all these biomarkers was
observed to increase with the advancement of HCC stage
as seen in Fig. 4.
Discussion
Cancer is a name often attributed to a characteristic abnor-
mal growth of cells originating at different parts of the body.
Liver cancer is a cancer that originates in liver organ of the
body. Liver cancer is further divided into several types which
include Hepatocellular carcinoma (HCC). HCC is known to be
contributing factors are the reason for the continuous rise in
HCC cases reported each year. One such contributing factor
is the late diagnosis of HCC. It is a common observation that
HCC cases are reported at a very late stage. Patients are
usually left with zero to no treatment options at the time of
diagnosis.
Certain imaging techniques i.e. CT scan and Tissue biopsy
are some of the current available options for detecting
tumor. Tissue biopsy although is considered to be a gold
standard for HCC diagnosis but its invasive nature is its draw-
back. Thus, there is a dire need to explore other diagnostic
measures. Liquid biopsy is emerging as a powerful tool for
cancer diagnosis due to its promising results. Furthermore,
its less invasive nature makes it a better alternative to tis-
sue biopsy. Many biomarkers are tested for their use in liquid
biopsy but most of them have the drawback of being very
less in number thus, making their detection very difficult.
However, platelets are not only abundantly found in blood
but also, they are known to interact with tumor directly or
indirectly. This interaction causes alteration in mRNA reper-
toire within platelets. This altered RNA profile can be used
for identification of HCC patients from controls. Our aim of
the study was to identify a specific biomarker for diagnosis of
HCC at an early stage as determined by related studies con-
ducted in other types of cancers i.e. Lung and Hepatobiliary
cancer [29].
The present study was designed to explore the poten-
tial of the selected biomarkers for early diagnosis of HCC
using blood samples from 20 treatment naive HCC patients.
The goal of our study was to establish a cost effective,
noninvasive and reliable way for early detection of HCC.
To achieve the goal the transcriptional analysis of all the
selected biomarkers i.e. TGF-␤, NF␬␤, VEGF, AKT and PI3K
was performed. The results indicated an increase of 2.48,
2.35 and 2.78 folds in expression of TGF-␤, NF␬␤, and VEGF.
According to researchers [32] all these biomarkers are well-
known to have a pro-tumor effect. Therefore, an increase

Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023
+Model
CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS
6 S. Asghar et al.

Figure 3 ROC curve analysis of AKT and PI3K. (a) The ROC curve analysis depicts that PI3K was able to detect early stage HCC
with AUC = 0.9286. (b) ROC curve analysis showed that AKT was able to detect early stage HCC with AUC = 0.8751.

Figure 4 Graphical analysis showing the expression of selected biomarkers in detecting early and late stage HCC. (a) TGF-␤ was
observed to be increased in all stages of HCC. (b) NF␬B was observed to be increased in all stages of HCC. (c) VEGF was observed
to be increased in all stages of HCC. (d) Expression of AKT was observed to be increased with advancement of HCC stage. (e) PI3K
was observed to be increased with advancement of HCC stage.

Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023
+Model
CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS
A promising source for early detection of hepatocellular carcinoma
in their expression level in HCC patients indicated their
possible role in assisting tumor initiation, development and
dissemination.
An increase in the expression level of TGF-␤ within
platelets may increase the release of TGF-␤ molecules from
platelets. These released molecules of TGF-␤ may then bind
to their respective receptors on the tumor cells and aid
in tumor growth [33]. These TGF-␤ molecules apart from
tumor proliferation also play a part in causing inflamma-
tion. Inflammation is further known to assist in fibrosis which
ultimately help in development of HCC. Moreover, TGF-␤
is also involved in survival of tumor by inhibiting apoptosis
[33] and causes cell motility and invasion via inducing EMT
(Epithelial mesenchymal transition) hence contributing in
tumor metastasis [34]. The results of our study are in accor-
dance with the previous findings in hepatobiliary cancer,
breast cancer, Adenocarcinoma, pancreatic and colorectal
cancer [29].
In all of the 20 HCC patients an increase in NF␬␤ expres-
sion was observed in our study. The result obtained is in
agreement with the previously reported findings in Non
small cell lung carcinoma [29]. An increase in the expres-
sion of NF␬␤ in platelets may cause the alteration of certain
pathways within platelets i.e. the ability of platelets to
more effectively bind to fibrinogen may increase due to this
enhanced expression of NF␬␤. This effective binding may
further initiate a cascade of events resulting in activation of
platelets. In addition to effective binding of platelets with
fibrinogen, high expression of NF␬␤ would also result in bet-
ter interaction between the platelets and the tumor cells
further assisting in activation of the surrounding platelets.
All these activated platelets are known to help in cloaking
the tumor from the body’s immune surveillance [35]. After
the successful activation of platelets, the release of granules
occurs from within the platelets.
These granules released by platelets contain different
molecules that carry the potential to promote the tumor
cell survival, proliferation and metastasis. VEGF is one such
molecule released among several other molecules. It is well
known for initiating angiogenesis [36]. A tumor requires
nutrition to grow and thrive. The nearby blood vessels of
the tumor act as the source of this nutrition. A tumor while
growing starts to build blood vessels around itself to meet
the nutrition requirements. The signals for this construc-
tion of blood vessels are usually carried by VEGF molecules.
VEGF molecules not only initiate angiogenesis at the primary
site of origin of the tumor but also assist in development of
blood vessels at the secondary site thus, aiding in tumor
spread by acting as the nutrition source for the tumor at
the secondary site. Interestingly an increase in expression
of VEGF molecule was also observed during the transcrip-
tional analysis in platelets of HCC patients. This increased
expression of VEGF molecule in all the 20 HCC patients in
comparison to controls indicates the positive role of VEGF
in tumor growth and metastasis. This result of our study is in
conformity of the findings reported by Hui-HsinKo [37] who
studied the VEGF mRNA level in oral squamous cell carci-
noma tissue (OSCC). The researcher also concluded that the
study of VEGF mRNA levels can be used for prognosis and
progression of OSCC.
The expression of both the selected biomarkers i.e. AKT
and PI3K was observed to be decreased in the results of
Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023
7
our study. According to the literature both AKT and PI3K
have the pro tumor effect. They inhibit apoptosis and induce
EMT (Epithelial mesenchymal transition) to assist in tumor
cell proliferation, survival and metastasis. The PI3K/AKT
pathway within platelets is usually initiated by the bind-
ing of thrombin molecule to its respective receptor. The
activation of this pathway ultimately results in activation
of platelets. Platelets upon their activation release gran-
ules containing molecules carrying the protumor potential
and the ability to further cause activation in surrounding
platelets making it a continuous cycle [38]. However, on the
contrary a decrease in the expression of AKT and PI3K in
all 20 of the HCC patients was observed in our experiment.
This downregulation in the expression could be due to sev-
eral reasons that includes the specific degradation of mRNA
population phenomenon within platelets. There is a possibil-
ity of occurrence of certain events during the platelets and
HCC interaction causing specific degradation of the mRNA
of AKT and PI3K in the platelets. Further analysis i.e. trans-
lational analysis should be performed to further explore
it.
Receiver operating characteristic curve also known as
ROC curve is used for analyzing the diagnostic ability of
a selected biomarker. The x-axis is used for plotting the
false positive rate i.e. specificity whereas the true pos-
itive rate i.e. sensitivity is plotted on the y-axis of the
graph. In the performed study ROC curve was performed
for determining the potential of the selected biomarkers to
successfully detect HCC patients from controls. Moreover,
ROC curve analysis was performed to determine the poten-
tial of all these biomarkers for detecting early and late stage
HCC. The ROC curve analysis of all the selected biomarkers
showed a successful identification of HCC patients with 100%
sensitivity. Furthermore, the expression of all the selected
biomarkers in HCC patients was also related to the different
stages of HCC. TGF-␤, NF␬␤, VEGF, AKT and PI3K expres-
sion was seen to elevate with the advancement in stage
i.e. from early to late stage of HCC as compared to the
control.
The results of our study are quite promising as all the
selected biomarkers are able to successfully detect HCC
patients from controls. Moreover, AKT and PI3K were able to
detect early stage HCC with higher significance as compared
to other selected biomarkers. However, the potential of
these biomarkers for differentiating the HCC stages should
be verified by carrying out the study on a larger scale.
Conclusion
The outcomes of our study depict that all the selected
biomarkers can be used for the detection of HCC. Fur-
thermore, the selected biomarkers i.e. AKT and PI3K, in
comparison to other biomarkers i.e. TGF-␤, NF␬B and VEGF
in the study, carry better potential to be used for detection
of early stage HCC as indicated by the results of the study.
Present study could prove to be beneficial in determining
the altered RNA levels in the platelets of HCC patients as
compared to control and can be a step forward in estab-
lishing the altered mRNA profile to be used for early HCC
detection.
+Model
CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS
8 S. Asghar et al.
However, further research should be conducted for iden-
tification of more biomarkers for HCC detection and stage
differentiation. It is necessary that the translational levels
of all the selected biomarkers are studied in detail along
with the use of a combination of different biomarkers for
the detection of HCC at an early stage at a larger scale.
Funding source
The present study was conducted as part of a research grant
approved by the Higher education commission of Pakistan
under the grant number 5977 entitled ‘‘Analyzing the Tumor
Educated Platelets (TEP) as Potential Biomarkers for Early
Diagnosis of Liver Cancer: A non-invasive Approach Alterna-
tive to Tissue Biopsy’’.
Authors’ contributions
S.M. conceived the idea, designed the study and is the recipi-
ent of research grant (5977/Federal/NRPU/R&D/HEC/2016)
sponsored by the Higher Education Commission of Pakistan.
S.A. collected blood samples, conducted the study and
wrote the manuscript under the supervision of S.M. W.W.
assisted SA in collection of clinical samples and review of
literature. M.U. facilitated in the provision of clinical sam-
ples. S.M. and S.A. did the statistical analysis. S.M. critically
reviewed the manuscript and supervised the study. All the
authors have approved the final draft of the manuscript.
Disclosure of interest
The authors declare that they have no competing interest.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at https://doi.org/10.1016/
j.clinre.2020.03.023.
References
[1] Valery PC, Laversanne M, Clark PJ, Petrick JL, McGlynn KA, Bray
FJH. Projections of primary liver cancer to 2030 in 30 countries
worldwide 2018;67(2):600—11.
[2] Ferlay J, Soerjomataram I, Ervik M, Dikshit R, Eser S, Math-
ers C, et al. GLOBOCAN 2012 v1. 0, Cancer Incidence and
Mortality Worldwide: IARC CancerBase No. 11. Lyon, France:
International Agency for Research on Cancer; 2013. p. 2015.
[3] Shin H-R, Oh J-K, Masuyer E, Curado M-P, Bouvard V, Fang Y,
et al. Comparison of incidence of intrahepatic and extrahep-
atic cholangiocarcinoma—focus on East and South-Eastern Asia
2010;11(5):1159—66.
[4] Xia J, Jiang S-C, Peng H-J. Association between liver fluke
infection and hepatobiliary pathological changes: a systematic
review and meta-analysis 2015;10(7):e0132673.
[5] Bosetti C, Turati F, La Vecchia C. Hepatocellular carcinoma
epidemiology 2014;28(5):753—70.
[6] Pal P, Singh B, Mjijomr K, Sciences H. Prediction of accuracy for
hepatocellular carcinoma patients using cluster based feature
ranking 2018;7(8):130—40.
Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023
[7] Bertuccio P, Turati F, Carioli G, Rodriguez T, La Vecchia C,
Malvezzi M, et al. Global trends and predictions in hepatocel-
lular carcinoma mortality. J Hepatol 2017;67(2):302—9.
[8] Mittal S, El-Serag HB. Epidemiology of HCC: consider the pop-
ulation. J Clin Gastroenterol 2013;47:S2.
[9] Ali SA, Donahue RM, Qureshi H, Vermund SH. Hepatitis B
and hepatitis C in Pakistan: prevalence and risk factors
2009;13(1):9—19.
[10] Su Y-H, Kim AK, Jain SJTR. Liquid biopsies for hepatocellular
carcinoma 2018.
[11] Neoplasia ICGfH. Pathologic diagnosis of early hepatocellular
carcinoma: a report of the international consensus group for
hepatocellular neoplasia. Hepatology 2009:658—64.
[12] Pomfret EA, Washburn K, Wald C, Nalesnik MA, Douglas D, Russo
M, et al. Report of a national conference on liver allocation in
patients with hepatocellular carcinoma in the United States.
Liver Transpl 2010;16(3):262—78.
[13] Diaz Jr LA, Bardelli A. Liquid biopsies: genotyping circulating
tumor DNA. J Clin Oncol 2014;32(6):579.
[14] McGranahan N, Swanton C. Clonal heterogeneity and
tumor evolution: past, present, and the future. Cell
2017;168(4):613—28.
[15] Coppedè F, Lopomo A, Spisni R, Migliore L. Genetic and epi-
genetic biomarkers for diagnosis, prognosis and treatment of
colorectal cancer. World J Gastroenterol 2014;20(4):943.
[16] Herman JG, Baylin SB. Gene silencing in cancer in asso-
ciation with promoter hypermethylation. N Engl J Med
2003;349(21):2042—54.
[17] Ozen C, Yildiz G, Dagcan AT, Cevik D, Ors A, Keles U, et al.
Genetics and epigenetics of liver cancer. New Biotechnol
2013;30(4):381—4.
[18] Sharma S, Kelly TK, Jones PA. Epigenetics in cancer. Carcino-
genesis 2010;31(1):27—36.
[19] Yoo CB, Jones PA. Epigenetic therapy of cancer: past, present
and future. Nat Rev Drug Discov 2006;5(1):37.
[20] Awad MM, Katayama R, McTigue M, Liu W, Deng Y-L,
Brooun A, et al. Acquired resistance to crizotinib from
a mutation in CD74—ROS1. N Engl J Med 2013;368(25):
2395—401.
[21] Bardelli A, Pantel K. Liquid biopsies, what we do not know
(yet). Cancer cell 2017;31(2):172—9.
[22] Siravegna G, Mussolin B, Buscarino M, Corti G, Cassingena A,
Crisafulli G, et al. Clonal evolution and resistance to EGFR
blockade in the blood of colorectal cancer patients. Nat Med
2015;21(7):795.
[23] Jiang P, Lo YD. The long and short of circulating cell-free DNA
and the ins and outs of molecular diagnostics. Trends Genet
2016;32(6):360—71.
[24] Holinstat M. Normal platelet function. Cancer Metastasis Rev
2017;36(2):195—8.
[25] Boucharaba A, Serre C-M, Grès S, Saulnier-Blache JS, Bor-
det J-C, Guglielmi J, et al. Platelet-derived lysophosphatidic
acid supports the progression of osteolytic bone metastases in
breast cancer. J Clin Invest 2004;114(12):1714—25.
[26] Belloc C, Lu H, Soria C, Fridman R, Legrand Y, Menashi S. The
effect of platelets on invasiveness and protease production of
human mammary tumor cells. Int J Cancer 1995;60(3):413—7.
[27] Goubran HA, Stakiw J, Radosevic M, Burnouf T. Platelets effects
on tumor growth. Semin Oncol 2014;41:359—69 [Elsevier].
[28] Skog J, Würdinger T, Van Rijn S, Meijer DH, Gainche L, Curry
Jr WT, et al. Glioblastoma microvesicles transport RNA and
proteins that promote tumour growth and provide diagnostic
biomarkers. Nat Cell Biol 2008;10(12):1470.
[29] Best MG, Sol N, Kooi I, Tannous J, Westerman BA, Rustenburg
F, et al. RNA-Seq of tumor-educated platelets enables blood-
based pan-cancer, multiclass, and molecular pathway cancer
diagnostics. Cancer Cell 2015;28(5):666—76.
+Model
CLINRE-1423; No. of Pages 9 ARTICLE IN PRESS
A promising source for early detection of hepatocellular carcinoma 9

[30] Nilsson RJA, Balaj L, Hulleman E, Van Rijn S, Pegtel DM, Wal-
raven M, et al. Blood platelets contain tumor-derived RNA
biomarkers. Blood 2011;118(13):3680—3.
[31] Sol N, Wurdinger T. Platelet RNA signatures for the detection
of cancer. Cancer Metastasis Rev 2017;36(2):263—72.
[32] Quintanilla M, CastilloF G.D., Kocić J, Santibañez JF. TGF-␤ and
MMPs: a complex regulatory loop involved in tumor progression
2012.
[33] Huang JJ, Blobe GC. Dichotomous roles of TGF-␤ in human
cancer 2006;44(5):1441—54.
[34] Liu R-M, Desai LP. Reciprocal regulation of TGF-␤ and reactive
oxygen species: a perverse cycle for fibrosis 2015;6:565—77.
[35] Fuentes E, Rojas A, Palomo IJ. NF-␬B signaling pathway as tar-
get for antiplatelet activity 2016;30(4):309—15.
[36] Carmeliet PJO. VEGF as a key mediator of angiogenesis in can-
cer 2005;69(Suppl. 3):4—10.
[37] Ko H-H, Lee J-J, Chen H-M, Kok S-H, Kuo M-P, Cheng S-J, et al.
Upregulation of vascular endothelial growth factor mRNA level
is significantly related to progression and prognosis of oral
squamous cell carcinomas. J Formos Med Assoc 2015:605—11.
[38] Woulfe D, Jiang H, Morgans A, Monks R, Birnbaum M, Brass LF.
Defects in secretion, aggregation, and thrombus formation in
platelets from mice lacking Akt2 2004;113(3):441—50.

Please cite this article in press as: Asghar S, et al. Tumor educated platelets, a promising source for early detection of
hepatocellular carcinoma: Liquid biopsy an alternative approach to tissue biopsy. Clin Res Hepatol Gastroenterol (2020),
https://doi.org/10.1016/j.clinre.2020.03.023