Chin J Integr Med •1•

C
Available online at link.springer.com/journal/11655
hinese Journal of Integrative Medicine Journal homepage: www.cjim.cn/zxyjhen/zxyjhen/ch/index.aspx
E-mail: cjim_en@cjim.cn

Original Article
Curcuma wenyujin Y. H. Chen et C. Ling n-Butyl Alcohol
Extract Inhibits AGS Cell Helicobacter pylori CagA+VacA+ Promoted
Invasiveness by Down-regulating Caudal Type Homeobox
Transcription Factor and Claudin-2 Expression
JIN Hai-feng, DAI Jin-feng, MENG Li-na, and LU Bin

Objective:: To investigate the effects and possible mechanisms of action of Curcuma wenyujin
ABSTRACT Objective
Y. H. Chen et C. Ling n-Butyl alcohol extract (CWNAE) on repression of human gastric cancer (GC) AGS cell
invasion induced by co-culturing with Helicobacter pylori (HP). Methods
Methods:: AGS cells were cultured with HP of
positive or negative cytotoxin-associated gene A (CagA) and vacuolating cytotoxin gene A (VacA) expression
(CagA+/- or VacA+/-) and divided into 5 group. Group A was cultured without HP as a control, Group B with
HPCagA+VacA+, Group C with HPCagA-VacA-, Group D with HPCagA+VacA+ and CWNAE, and Group E with HPCagA-VacA-
and CWNAE. Methylthiazolyldiphenyl-tetrazolium bromide (MTT) and tumor invasion assays, examinations of
morphology and ultramicroscopic structures, quantitative real-time polymerase chain reaction and Western blots
were performed to measure the effects and uncover the mechanisms behind these effects of HPCagA+VacA+ and
CWNAE on the epithelial-mesenchymal transition (EMT) of AGS cells. Results
Results:: The 10% inhibitory concentration
of CWNAE against AGS cells after a 48 h incubation was 19.73±1.30 μg/mL. More AGS cells were
elongated after co-culturing with HPCagA+VacA+ than after culturing with HPCagA-VacA-. In tumor invasion assays,
HPCagA+VacA+ significantly enhanced the invasiveness of AGS cells compared to the other experimental groups
(all P value <0.05), and this effect was inhibited by CWNAE. Treatment with CWNAE normalized tight junctions
and reduced the number of pseudopodia of AGS cells co-cultured with HPCagA+VacA+. HPCagA+VacA+ up-regulated
zincfinger ebox binding homeobox 1 (ZEB1) in AGS cells after co-culturing for 24 h. Expression of caudal type
homeobox transcription factor (CDX-2) and claudin-2 was significantly increased by HPCagA+VacA+ (P <0.05), but not
by HPCagA-VacA-. Conclusions
Conclusions:: HPCagA+VacA+ promoted the invasiveness of AGS cells through up-regulation of ZEB1
transcription and claudin-2 and CDX-2 expression. CWNAE inhibited these effects of HPCagA+VacA+ on AGS cells
by down-regulating ZEB1 transcription, and CDX-2 and claudin-2 expression.
KEYWORDS Helicobacter pylori , gastric cancer, AGS, zincfinger ebox binding homeobox 1, caudal type
homeobox transcription factor, claudin-2, Chinese medicine

Gastric cancer (GC) is the fourth most common
cancer and the second leading cause of cancer deaths
worldwide.(1) A number of studies have shown that
Helicobacter pylori (HP) promotes GC cell invasiveness
in vitro , although the mechanisms of action behind this
effect remain uncharacterized. One possibility is HP may
promote growth acceleration, epithelial-mesenchymal
transition and the loss of tight connections between
GC cells.(2-6) Cytotoxin-associated gene A (cagA) is
the only known HP-protein translocated into host cells
followed by tyrosine phosphorylation through host
protein kinases, which has been linked to an increased
risk of the development of peptic ulceration and gastric
cancer in infected individuals. One strain-specific HP
locus that has been associated with an increased risk
of carcinogenesis is the VacA gene, which encodes
a secreted bacterial cytotoxin identified as VacA.
Cytotoxin VacA induces multiple structural and functional
©The Chinese Journal of Integrated Traditional and Western
Medicine Press and Springer-Verlag Berlin Heidelberg 2017
Supported by the National Natural Science Foundation
of China (No. 81202822), Fund of Zhejiang Province
Administration of Traditional Chinese Medicine, China (No.
2016ZA092/2017ZKL008), and Key Laboratory of Pathology and
Physiology of Digestive Tract Diseases in Zhejiang Province, China
Department of Gastrointerology, the First Affiliated Hospital of
Zhejiang Chinese Medical University, Hangzhou (310006), China
Correspondence to: Prof. LU Bin, Tel: 86-571-86620285, Fax:
86-571-86620286, E-mail: Lvbin@medmail.com.cn
DOI: https://doi.org/10.1007/s11655-017-2958-y
•2•
alterations in the cell in vitro , the most prominent of
which is the formation of large intracellular vacuoles.(7)
Caudal type homeobox 2 transcription factor
(CDX-2) was first discovered in Drosophila and has
since been detected in a number of organs and tissues
in the human body. However, the role of CDX-2 in
the development of GC is still controversial. Some
scholars regard it as a tumor suppressor factor, while
others have suggested it promotes tumor development
and growth.(8,9) Given that, this study investigated the
role of CDX-2 in HP-induced GC cell invasiveness.
Our previous studies have shown a Chinese herb,
Curcumin wenyujin Y. H. Chen et C. Ling, strongly
suppresses the growth and occurrence of GC, blocks
the cell cycle and promotes GC cell apoptosis.(10-13) In
addition, C. wenyujin extract suppresses inflammation
by inhibiting nuclear factor κB (NF-κB) pathway
activation. However, whether C. wenyujin prevents
HP-induced GC cell invasiveness is unknown.
METHODS
Cell Culture
AGS cells were purchased from the Shanghai
Cell Bank of the Chinese Academy of Science. The
cells were grown in F-12 medium (GIBCO, USA)
supplemented with 10% fetal bovine serum (GIBCO)
without antibiotics and incubated at 37 ℃ in 5% CO2.
Culture medium was replaced every 2–3 days, and
cells were passaged using 2.5% trypsin-ethylene
diamine tetraacetic (EDTA, GIBCO).
HP Culture
HP strain 51932 (VacA+, CagA+) was purchased
from ATCC and HP strain 1637 (VacA-, CagA-) from
the Peking Union Medical College (China). Both of
these strains were cultured on modified selective
medium in an atmosphere consisting of 85% N2, 10%
CO2, and 5% O2 at 37 ℃. For experiments, HP was
diluted to a concentration of 6×109 CFU/mL.
C. wenyujin n-Butyl Alcohol Extract Preparation
Raw C. wenyujin (1.5 kg) was washed, dried,
mechanically crushed, diluted in 24 L n-butyl alcohol
and mixed by stirring. The solution was then incubated
at room temperature for 24 h. Supernatant (5 L)
was collected and then dried in a rotary evaporator
with a water temperature of 60 ℃ and spinning at
50 r/min. When all the n-butyl alcohol evaporated, 5 L
of n-butyl alcohol was added to the residue. This drying
Chin J Integr Med
and resuspension was repeated 8 times. The extraction
was roasted in an oven for 8 h to eliminate the water and
remaining n-butyl alcohol. Finally, 150 mL C. wenyujin Y.
H. Chen et C. Ling n-butyl alcohol extract (CWNAE) was
obtained, divided into 10 bottles, sterilized and stored at
–80 ℃.
Methylthiazolyldiphenyl-tetrazolium Bromide
Assay
Approximately 5–6×103 AGS cells were seeded
into wells of 96-well plates and cultured for 24 h. Different
concentrations of CWNAE (320, 160, 80, 40, and 20 μ
g/mL) were added to the well for different experimental
groups. The blank group wells contained no cells, while
the control group wells contained cells but no CWNAE.
Each cohort was tested in triplicate. After incubating for
48 h, the absorption (A) of each well was measured. The
growth inhibition rate (GIR) was calculated using the
equation: GIR (%) = [(Acontrol – Ablank) – (Aexperiment – Ablank)/
(Acontrol – Ablank)×100%.
Tumor Invasion Assay
AGS cells (2×104) were seeded into each well
of 24-well plates and incubated for 24 h. The wells
were divided into the 5 groups, Group A was cultured
without HP or CWNAE as a control, Group B with
HPCagA+VacA+, Group C with HPCagA-VacA-, Group D with
HPCagA+VacA+ and CWNAE, and Group E with HPCagA-VacA-
and CWNAE (HP:AGS =100:1). Groups D and E were
treated with CWNAE at a dose with low toxicity based
on methylthiazolyldiphenyl-tetrazolium bromide (MTT)
results. Cells in all the groups were cultured for 48 h,
passed and reseed into transwells with madrigal inside.
After 24 h, the culture medium was removed and the
cells were fixed using 4% methanol, dyed with crystal
violet and examined under high magnification (200×).
Ten fields-of-view were chosen randomly and examined,
and the cells were counted one by one. Finally, the
average number of cells in each view of each group was
calculated.
AGS Morphology and Ultramicroscopic Structures
AGS cells were divided into groups in the same
manner as in the tumor invasion assay. Images of
the cells were taken under a microscope at 100×
magnification after culturing for 48 h with HP. Cells from
each experimental group were seeded into transwells
(2×103 per well). After culturing for 12 h, the cells
were washed 3 times for 15 min each time, fixed in 4%
glutaral for at least 48 h and then 1% osmium tetroxide
Chin J Integr Med
for 1 h, and then washed/dehydrated in 50%, 70%,
80%, 90% and then 100% alcohol, permeabilized with
a 1:1 mixture of anhydrous acetone and embedding
medium for 2 h, embedded (Epon8i2), polymerized
(thermostat), block wax, trimmed, section, dyed and
then photographed.
Quantitative Real-Time Polymerase Chain Reaction
Experimental groups were the same as in above.
AGS cells, 1.2×106, were seeded into each bottle and
then incubated for 24 h. For gene expression analysis,
total RNA was extracted and reverse-transcribed
using a RNA extraction (Takara) and cDNA synthesis
(Roche) kits, respectively. The quantitative real-time
polymerase chain reaction (qRT-PCR) assay was
performed using the SYBR Green Master kit (Roche).
cDNA levels were normalized for all the samples
against the β-actin gene. miRNA expression was
analyzed on an Applied Bio system 7900HT Fast Real
Time PCR System (ABI, USA, 7900HT) according to
the manufacturers' protocols. qRT-PCR data were
analyzed with SDS2.4 software (ABI) and relative
mRNA expression levels were calculated using the
2-△Ct formula. SYBR@ Green primers are as follows:
β-actin: forward TGGACTTCGAGCAAGAGATG,
reverse TGTTGGCGTACAGGTCTTTG;
ZEB-1: forward TGCACTGAGTGTGGAAAAGC,
reverse TGGTGATGCTGAAAGAGACG.
Western Blot
Approximately 1.2×106 AGS cells were
seeded into each bottle and incubated for 24 h.
Experimental groups were the same as described
above. Before collection, cells were washed twice
with PBS, centrifuged at 12,000 r/min for 5 min twice,
and lysed with 0.10–0.12 mL lysis buffer on ice. The
supernatants were collected, protein concentrations
were measured using a bicinchoninic acid (BCA)
protein quantifiction kit (Peking Pulilai, China), and
then the proteins were separated using sodium
dodecyl sulfate-polyacrylamide gelelectrophoresis
(SDS-PAGE, Bio-Rad, USA). Proteins were
transferred onto polyvinylidene fluoride (PVDF)
membrane (Millipore, USA), blocked in 5% skim milk,
and then the PVDF membrane was incubated in CDX-
2 and claudin-2 antibodies (MultiScience, China)
overnight. Anti-β-actin antibody (Cell signaling,
USA) was used for the loading control. Bands were
visualized in a ChemiDoc™ XRS Image Reader (Bio-
Rad, USA) using an enhanced chemiluminescence
•3•
(ECL) detection kit (Bio-Rad) after incubating in
anti-rabbit antibody for 1–2 h (MR Biotech, China).
Densitometric analysis of the protein bands was
performed using Quantity One Software (Bio-Rad,
USA). Relative expression (RE) = gray value target
protein/gray value of β-actin.
Statistical Analysis
Statistical analyses were performed using
SigmaStat17.0 (SPSS, Chicago, IL, USA). Data were
reported as mean ± standard error (x–±SE). Differences
between different sessions were assessed using
analysis of variance (ANOVA). Student's t -test was used
to investigate the difference between any two periods or
two sessions. For multiple comparisons, Tukey's post-
test was used and Spearman correlation analysis was
used to determine if there was a correlation between
CDX-2 and claudin-2 expression. P value less than 0.05
was considered statistically significant.
RESULTS
CWNAE Toxicity
CWNAE significantly inhibited AGS cell proliferation
in a dose-dependent manner as shown in Figure 1.
The AGC cells were inhibited after 48 h in 20 μg/mL
CWNAE by 10%. Therefore, the 48 h 10% inhibitory
concentration (IC10) of CWNAE was 19.73±1.30 μg/mL.
120
100
Cell prolifer ation (%)
80
60
40
20
0
320 160 80 40 20
CWNAE (μg/mL)
Figure 1. Effect of CWNAE on AGS Cell
Proliferation after 48 h ( ±SE)
Effects of HP and CWNAE on AGS Invasiveness
CWNAE significantly inhibited AGS cell
invasiveness after the cells were co-cultured with
HP CagA+VacA+. In tumor invasion assays, 1.17±0.75,
11.63±3.87, 2.47±1.12, 4.37±0.31, and 1.43±0.45
invaded cells were observed for groups A–E,
respectively, when evaluated at 200×. The number
of invasive cells in group B was notably higher
than in groups A and D (both P <0.05), indicating
that HP CagA+VacA+ promoted AGS cell invasiveness,
while CWNAE (20 μg/mL) effectively suppressed
•4• Chin J Integr Med

this effect. No significant differences were noted for
groups A, C and E (all P >0.05, Figure 2).
Effects of HP and CWNAE on AGS Morphology
Normally, AGS cells are polygonal or short
spindles as shown in Figure 3. However, after co-
culturing with HPCagA+VacA+ for 48 h, most of the AGS
cells became longer and more spindle-like, as well
as more disorderly, while co-culturing with HPCagA-VacA-
resulted in no significant changes. CWNAE (20 μg/mL)
suppressed the morphological effects of HPCagA+VacA+ as
indicated by cellular morphology of the cells in group E,
which was similar to group A.
Effects of HP and CWNAE on AGS Ultrastructure
AGS cells that were co-cultured with HPCagA+VacA+
had wider gaps between cells and fewer tight junctions
(TJs). However, the changes in phenotype seen
upon co-culture with HP CagA+VacA+ were significantly
suppressed by 20 μg/mL CWNAE. The size of the
gaps and the number of TJs between the AGS cells
were similar among groups A, D and E (Figure 4).
AGS cells typically have pseudopodia.
Interestingly, both the AGS cells co-cultured with
HP CagA+VacA+ and those with HP CagA-VacA- had more
pseudopodia than when cultured alone. When these
co-cultured cells were treated with CWNAE, there
were fewer pseudopodia than the untreated co-
cultured cells (Figure 4).
Effects of HP and CWNAE on ZEB1 Transcription
After co-culturing for 24 h with HP CagA+VacA+ ,
ZEB1 transcription was dramatically up-regulated in
group B (6.63-fold), but not in group C. Meanwhile,
ZEB1 transcription was significantly decreased
upon treatment with CWNAE in group D, and was
comparable to groups A, C and E (Figure 5). In this
study, ZEB2 was barely detectable in AGS cells.
Effects of HP and CWNAE on CDX-2 and
Claudin-2 Protein Expression
Both CDX-2 and claudin-2 expression levels
in AGS cells were significantly increased following
co-culture with HPCagA+VacA+ as group B compared to

A B C D E
Thanosome
40×
200×

Figure 2. Invasive AGS Cell Number in Different Groups Observed under

Microscope with Different Magnification Times after Dyed with Crystal Violet
Notes: Cell number refers to the average number of cells in one field-of-vision at 200× magnification.

A B C D E

Figure 3. Morphology of AGS Cells Intervened with or without HP and/or CWNAE Observed under Microscope (×40)
Notes: A–E refer to group A–E. After co-culturing with HPCagA+VacA+ for 48 h, the majority of AGS cells became longer and spindle
and were arranged in a disorderly manner in group B. However, AGS cells infected with HPCagA-VacA- were not as obvious as that in the
group B. The effect of HPCagA+VacA+ was suppressed by 20 μg/mL CWNAE as shown in group D.
Chin J Integr Med •5•

A (×10000) B (×10000) C (×10000) D (×8300) E (×10000)

TJs
Pseudopodia

Figure 4. Effect of HP and CWNAE on TJs and Pseudopodia of AGS Cell as Observed by Electron Microscope
Notes: Co-culturing of cells with HPCagA+VacA+ significantly widened the TJ gaps and decreased the number of TJs in group B
compared to group A. This phenotype was inhibited by 20 μg/mL CWNAE as shown in group D, where the gap wideness and number
of TJs was similar among other groups (white arrows indicate TJs). Treatment with either HPCagA+VacA+ and HPCagA-VacA- significantly
increased the number of pseudopodia in both groups B and C, but this effect was inhibited with 20 μg/mL CWNAE in groups D and E
(white arrows indicate pseudopodia).

12
CDX-2 and Claudin-2 Protein Expression was
10 Positively Correlated
8 Result of Spearman correlation analysis showed
ZEB1

6 that CDX-2 expression was positively correlated with

4
claudin-2 expression (P <0.05) with a coefficient of
0.73 (Figure 7).
2 △
△
2
0
A B C D E 1.8
1.6
Figure 5. ZEB1 Expressions in AGS Cells
1.4
Intervened with or without HP and/or
Claudin-2

1.2
CWNAE Detected by qRT-PCR
△ 1.0
Notes: P <0.01 vs . group A; P <0.01, vs . group B
0.8
0.6
groups A and C (both P <0.05) and was significantly 0.4
decreased upon treatment with 20 μg/mL CWNAE in 0.2
0
group D compared with group B (P <0.05). Expression 0 0.5 1.0 1.5 2.0
levels of CDX-2 and claudin-2 were similar among CDX-2

groups A, D and E (all P >0.05, Figure 6). Figure 7. Relationship of CDX-2 and Claudin-2 by
Spearman Correlation Analysis
Note: There was a strong direct relationship between
HPCagA+VacA+ – + – + – CDX-2 and claudin-2 protein expression (R2=0.73, P <0.01).
HPCagA-VacA- – – + – +
CWNAE – – – + +
Claudin-2 DISCUSSION
CDX-2 HP infection is closely correlated with the
β-Actin occurrence of GC and is considered an important
cause of GC. (14-16) However, HP infection, which
2 Claudin-2 occurs frequently, is not always associated with GC,
CDX-2
and this phenomenon has been termed the "Asian
Protein expression

2.5
enigma".(17) Moreover, a number of studies have shown
△ △ that HP virulence factors, such as CagA and VacA, play
1.0
important roles during severe HP infection mediated
0.5 gastric diseases and contribute, at least in part, to the
geographic variation in the age-standardized rate (ASR)
0 of GC.(18) Development of the invasive phenotype is
A B C D E
associated with epithelial-mesenchymal transition
Figure 6. Effect of HP and CWNAE on CDX-2 and
Claudin-2 Protein Expressions Detected By Western Blot (EMT), which can be dysregulated by HP infection to
Notes: P <0.05 vs . group A; △P <0.05, vs . group B promote the development of GC.(19)
•6•
Although treatment options have been
continuously improving, HP infection is still highly
prevalent. (20) Of HP's virulence factors, CagA and
VacA play important roles during infection and
can mediate destruction of the junctions between
the cells, induce inflammation and EMT, elongate
cells, increase proliferation and enhance motility.
Specifically, VacA promotes the formation of vacuoles,
inducing apoptosis and destroying the TJs between
cells.(21,22) Hatakeyama M(22) suggested that the cellular
elongation and loss of polarity induced by HP may be
related to the inhibition of the polarity-regulating kinase
PAR1/MARK by CagA. Meanwhile, Fedwick
demonstrated that CagA and VacA cooperate to
decrease claudin-4 and claudin-5 expression by
suppressing the myosin light-chain kinase (MLCK)
without affecting the expression of ZO-1 and JAM. Papini
E suggested that VacA had no effect on ZO-1, occluding,
cingulin, and E-cadherin. However, VacA selectively
lowers the transmembrane electric resistance (TER)
and damages TJs between cells.(23) In this study, we
also observed that infection HPCagA+VacA+ destroyed the
TJs between AGS cells and caused the cells to produce
pseudopodia, which resulted in an enhancement of the
ability of AGS cells to invade. By contrast, infection with
HPCagA-VacA- resulted in no such effects.
ZEB1, a nuclear transcription factor, was first
discovered by Costantino, et al.(24) It is involved in cell
development and controls expression of lymphatic
hematopoietic factor, transcription factor mE3, and
other nuclear transcription factors, such as NF-κB p65
and E2F transcription factor 1 (E2F-1).(25,26) In addition,
it has since been found to have a close relationship
with EMT. During EMT, ZEB1 works with other
nuclear transcription factors, like snail and bHLH to
regulate expression of proteins like E-cadherin and
vimentin. (27-29) This study showed that HP CagA+VacA+
significantly up-regulated ZEB1 transcription,
which may promote EMT in GC.
Some studies have indicated that CagA
u p - r e g u l a t e s C DX-2 via bone morphogenetic
protein (BMP).(30) CDX-2 was originally discovered
in Drosophila as a regulator of chest and limb
development. In the human body, CDX-2 is mainly
expressed in the intestines, pancreas, colon, rectum
and appendix, but not in the stomach.(6) Therefore,
theoretically, stomach cells with metaplasia may
express high levels of CDX-2, and this has been
Chin J Integr Med
demonstrated by Song, et al.(31) It was also found that
CDX-2 expressed high levels in GC cells and gastric
mucosal cells with dysplasia in a claudin-2 related
manner. Another study found colon cancer cells not
expressing CDX-2 had a much stronger proliferative
capacity.(6) On the contrary, some researchers have
considered CDX-2 to be a tumor suppression factor
and cancer cells expressing high levels of CDX-2
grew and transffered more slowly, and is indicative
of a good prognosis. (32) As a transcription factor,
CDX-2 promotes the expression of the claudin family.
A study by Satake, et al (32) uncovered that TMK-1
and CDX-2 negative cells expressed lower levels of
claudin-3 and Claudin-4, which significantly increased
upon transfection with CDX-2. Claudin-1, -7, -12,
-15, and -18 do not change during that process.(33) To
characterize the role of CDX-2 in the development
of GC, it was necessary to delineate the function
of claduin-2. Members of the claudin family are TJ
proteins. Interestingly, unlike other claudins, claudin-2
causes the formation of cation-selective channels to
make a 'tight' TJ leaky by decreasing the TER.(34)
In this study, AGS cells infected with HPCagA+VacA+
become notably elongated with wider gaps, fewer TJs,
more pseudopodia and a disorderly arrangement,
leading to stronger invasion. These changes don't
occur in other groups with the exception of a minor
increase in pseudopodia and morphologic changes in
cells infected with HPCagA-VacA-. CDX-2 and claudin-2
were also found to simultaneously increase in group
B, suggesting that CagA and VacA from HP enhances
AGS invasiveness by up-regulating CDX-2 and claudin-2
expression in a manner similar to that noted by Song,
et al.(33) However, there was no untreated control group
in their study.(23) Furthermore, our study observed an
increase in pseudopodia and morphological changes
induced by HPCagA-VacA- that were sufficient to enhance
AGS invasiveness.
C. Wenyujin is an herb frequently used in Chinese
medicine in China for the treatment of functional GI.
In our previous studies, we found that it inhibited
proliferation of GC cells and colonic cancer cells via
its toxicity and effect on cell proliferative cycle, and it
also could cause apoptosis of GC cells by activating
the caspase-3 pathway and repress the inflammatory
response in vitro induced by lipopolysaccharides in
normal epithelial cell by inhibiting the MAPK and NF-κB
pathways.(9-13) However, to our knowledge, the effect
Chin J Integr Med
of C. Wenyujin has on EMT in GC is still unknown.
In this study, statistically significant differences in
CDX-2 and claudin-2 expression, as well as differences
in invasiveness, were detected between groups of
HPCagA+VacA+ infected cells in the presence and absence
of CWNAE. This phenomenon not only confirms the
hypothesis described above, but also illustrates that
20 μg/mL CWNAE inhibits the invasiveness of AGS
cells by decreasing the otherwise high expression of
CDX-2 and claudin-2 induced by HPCagA+VacA+. Despite
this, the levels of CDX-2, claudin-2 and invasiveness
were not statistically different between the control
and HPCagA-VacA- infected in the presence or absence
of CWNAE groups, indicating CWNAE doesn't affect
the innate expression levels or invasiveness of CDX-2
and claudin-2 in AGS cells. To evaluate the expression
trends of CDX-2 and claudin-2, Spearman correlation
analysis was applied, which uncovered a positive
correlation between the expression of these proteins.
However, the exact relationship between these proteins
remains uncharacterized.
CWNAE can inhibit HPCagA+VacA+ infection induced
invasiveness of AGS cells by down-regulating
expression of ZEB1, CDX-2 and claudin-2, although
which factor(s) is/are the predominant mediator of
this phenotype remains unknown. Therefore, CWNAE
may have therapeutic potential for preventing the
development of GC.
In this study, CDX-2 and claudin-2 were not
deleted or suppressed by inhibitors or methods
of inhibition specific to these factors. CWNAE
is a mixture that may affect a number of targets
and, therefore, the relationship between AGS cell
invasiveness, and CDX-2 and claudin-2 needs to be
confirmed. In addion, while both CagA and VacA were
evaluated in this study in combination, their individual
effects on GC were not evaluated.
Conflict of Interest
The authors report no conflicts of interest in this work.
The authors do not have any financial or personal relationships
with other people or organizations that could potentially or
inappropriately influence (bias) this work or its conclusions.
Author Contributions
Jin HF and Dai JF performed all the experiments and
statistical analysis, and wrote the manuscript; Meng LN assisted
in the experiments; Lyu B designed the study, provided financial
•7•
support and vital experimental equipment, and was involved in
manuscript revisions.
REFERENCES
1. Ferro A, Peleteiro B, Malvezzi M Bosetti C, Bertuccio P,
Levi F, et al. Worldwide trends in gastric cancer mortality
(1980–2011), with predictions to 2015, and incidence by
subtype. Eur J Cancer 2014;50:1330-1344.
2. Yin Y, Grabowska AM, Clarke PA, Whelband E, Robinson K,
Argent RH, et al. Helicobacter pylori potentiates epithelial-
mesenchymal transition in gastric cancer: links to soluble
HB-EGF, gastrin and matrix metalloproteinase-7.Gut
2010;59:1037-1045.
3. Fedwick JP, Lapointe TK, Meddings JB, Sherman PM,
Buret AG. Helicobacter pylori activates myosin light-chain
kinase to disrupt claudin-4 and claudin-5 and increase
epithelial permeability. Infect Immun 2005;12:7844-7852.
4. Bae SE, Jung HY, Kang J, Park YS, Baek S, Jung JH, et al.
Effect of Helicobacter pylori eradication on metachronous
reurrence after endoscopic resection of gastric neoplasm.
Am J Gastroenterol 2014;109:60-67.
5. Dang LH, Chen F, Ying C, Chun SY, Knock SA, Appelman
HD, et al. CDX2 has tumorigenic potential in the human
colon cancer cell lines LOVO and SW48. Oncogene
2006;25:2264-2272.
6. Moskaluk CA, Zhang H, Powell SM, Cerilli LA, Hampton
GM, Frierson HF. CDX2 protein expression in normal and
malignant human tissues: an immunohistochemical survey
using tissue microarrays. Mod Pathol 2003;16:913-919.
7. El Khadir M, Alaoui Boukhris S, Benajah DA, El Rhazi K,
Ibrahimi SA, El Abkari M, et al. VacA and CagA status as
biomarker of two opposite end outcomes of Helicobacter
pylori infection (gastric cancer and duodenal ulcer) in a
moroccan population. Plos One 2017;12:e0170616.
8. Wang XT, Wei WY, Kong FB, Lian C, Luo W, Xiao Q, et
al. Prognostic significance of CDX2 immunohistochemical
expression in gastric cancer: a meta-analysis of published
literatures. J Exp Clin Cancer Res 2012;31:98-116.
9. Xu Y, Lu B, Ding ZS, Xiang BK. The extract of common
turmeric induces apoptosis of gastric carcinoma cell line
SGC-7901. Zhejiang Med J (Chin) 2004;26:503-505.
10. YU LF, LU B, XU L, Chen MT, Ni GB. Effects of Curcumae
on expression of pcna in gastric mucosa of mnng breeded
rats. Chin Arch Tradit Chin Med (Chin) 2007;25:1868-1870.
11. Yu LF, Lu B, Xu L, Chen MT, Ni GB. Effects of Curcumae
on expressions of vascular endothelial growth factor and
cyclooxygenase-2 in gastric mucosa of rats fed with MNNG.
Chin J Gastroenterol (Chin) 2007;12:140-143.
12. Xu L, Lv B, Yu LF. Chemoprevention of gastric cancer in
rats by a wetdistillation extract of Radix curcumae . World
•8•
Chin J Digestol (Chin) 2007;15:2589-2592.
13. Sheng GQ, Lu B, Jin HF. Effects of diterpenoid C from ether
extract of Radix Curcumae on nuclear factor -κB activity
in LPS-induced human gastric adenocarcinoma SGC7901
cells. Chin J Pathophysiol (Chin) 2012;28:556-559.
14. Uemura N, Okamoto S, Yamamoto S, Matsumura N,
Yamaguchi S, Yamakido M, et al. Helicobacter pylori
infection and the development of gastric cancer. N Engl J
Med 2001;345:784-789.
15. Trang TT, Shiota S, Matsuda M, Binh TT, Suzuki R, Vilaichone
RK, et al. The prevalence of Helicobacter pylori virulence
factors in Bhutan, Vietnam, and Myanmar is related to gastric
cancer incidence. Biomed Res Int 2015;2015:830813.
16. Parsonnet J, Friedman GD, Vandersteen DP, Chang Y,
Vogelman JH, Orentreich N, et al. Helicobacter pylori
infection and the risk of gastric carcinoma. N Engl J Med
1991;325:1127-1131.
17. Hiroto M, Mae F Go, Nobuhiro S. H. pylori and gastric cancer:
the Asian enigma. Am J Gastroenterol 2002;97:1106-1112.
18. Yamaoka Y. Mechanisms of disease: Helicobacter pylori
virulence factors. Nature Rev Gastroenterol Hepatol
2010;7:629-641.
19. Megraud F, Coenen S, Versporten A Kist M, Lopez-Brea M,
Hirschl AM. Helicobacter pylori resistance to antibiotics in
Europe and its relationship to antibiotic consumption. Gut
2013;62:34-42.
20. Posselt G, Backert S, Wessler S. The functional interplay
of Helicobacter pylori factors with gastric epithelial cells
induces a multi-step process in pathogenesis. Cell Commun
Signal 2013;11:77-91.
21. Sohn SH, Lee YC. The genome-wide expression profile of
gastric epithelial cells infected by naturally occurring cagA
isogenic strains of Helicobacter pylori . Environ Toxicol
Pharmacol 2011;32:382-389.
22. H a t a k e y a m a M . L i n k i n g e p i t h e l i a l p o l a r i t y a n d
carcinogenesis by multitasking Helicobacter pylori virulence
factor CagA. Oncogene 2008;27:7047-7054.
23. Papini E, Satin B, Norais N, de Bernard M, Telford JL,
Rappuoli R, et al. Selective increase of the permeability of
polarized epithelial cell monolayers by Helicobacter pylori
vacuolating toxin. J Clin Invest 1998;102:813-820.
24. Costantino ME, Stearman RP, Smith GE, Darling DS.
Chin J Integr Med
Cell-specific phosphorylation of Zfhep transcription factor.
Biochem Biophy Res Commun 2002;296:368-373.
25. Liu XY, Zhang S. The role of ZEB in the development of
carcinogenesis. Int J Pathol Clin Med 2012;32:69-73.
26. Peinado H, Olmeda D, Cano A. Snail, ZEB and bHLH
factors in tumour progression: an alliance against the
epithelial phenotype? Nat Rev Cancer 2007;7:415-428.
27. Antonio DL, Juan DM, Gema MB, Cuevas EP, Santos
V, Olmeda D. Zeb1 and Snail1 engage miR-200f
transcriptional and epigenetic regulation during EMT. Int J
Cancer 2015;136:E62-E73.
28. Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F,
Sonntag A. The EMT-activator ZEB1 promotes tumorigenicity
by repressing stemness-inhibiting microRNAs. Nat Cell Biol
2009;11:1487-1495.
29. Camilo V, Barros R, Sousa S, Magalhães AM, Lopes
T, Mário SA. Helicobacter pylori and the BMP pathway
regulate CDX2 and SOX2 expression in gastric cells.
Carcinogenesis 2012;33:1985-1992.
30. Song X, Chen HX, Shen BC, Bai AP, Wang JH, Li XY, et al.
Expression of CDX2 and claudin-2 in the multistage tissue
of gastric carcinogenesis. Oncology 2007;73:357-365.
31. Bonhomme C, Duluc I, Martin E, Chawengsaksophak K,
Chenard MP, Kedinger M. The CDX2 homeobox gene
has a tumour suppressor function in the distal colon in
addition to a homeotic role during gut. Development Gut
2003;52:1465-1471.
32. Satake S, Semba S, Matsuda Y. CDX2 transcription
factor regulates claudin-3 and claudin-4 expression during
intestinal differentiation of gastric carcinoma. Pathol Int
2008;58:156-163.
33. Song X, Chen HX, Wang XY, Deng XY, Xi YX, He Q.
H. Pylori -encoded CagA disrupts tight junctions and
induces invasiveness of AGS gastric carcinoma cells via
CDX2-dependent targeting of claudin-2. Cell Immunol
2013;286:22-30.
34. Amasheh S, Meiri N, Gitter AH, Schöneberg T, Mankertz
J, Schulzke JD, et al. Claudin-2 expression induces cation-
selective channels in tight junctions of epithelial cells. J Cell
Sci 2002:115:4969-4976.
(Received July 28, 2016)
Edited by YUAN Lin