RESEARCH ARTICLE

The oxygen level determines the fermentation pattern in

Kluyveromyces lactis
Annamaria Merico1, Silvia Galafassi1, Jure Piškur2 & Concetta Compagno1
1
Dipartimento di Scienze Biomolecolari e Biotecnologie, Università degli Studi di Milano, Milan, Italy; and 2Department of Cell and Organism Biology,
Lund University, Lund, Sweden

Downloaded from https://academic.oup.com/femsyr/article/9/5/749/530806 by guest on 16 April 2022

Correspondence: Concetta Compagno,
Dipartimento di Scienze Biomolecolari e
Biotecnologie, Università degli Studi di
Milano, via Celoria, 26 20133 Milan, Italy.
Tel.:139 025 031 4913; fax: 139 025 031
4912; e-mail: concetta.compagno@unimi.it
Received 27 November 2008; revised 20
February 2009; accepted 24 April 2009.
Final version published online 4 June 2009.
DOI:10.1111/j.1567-1364.2009.00528.x
Editor: Monique Bolotin-Fukuhara
Keywords
Kluyveromyces lactis; fermentation; ethanol;
redox; hypoxia.
Abstract
Yeasts belonging to the lineage that underwent whole-genome duplication (WGD)
possess a good fermentative potential and can proliferate in the absence of oxygen.
In this study, we analyzed the pre-WGD yeast Kluyveromyces lactis and its ability to
grow under oxygen-limited conditions. Under these conditions, K. lactis starts to
increase the glucose metabolism and accumulates ethanol and glycerol. However,
under more limited conditions, the fermentative metabolism decreases, causing a
slow growth rate. In contrast, Saccharomyces cerevisiae and Saccharomyces kluyveri
in anaerobiosis exhibit almost the same growth rate as in aerobiosis. In this work,
we showed that in K. lactis, under oxygen-limited conditions, a decreased
expression of RAG1 occurred. The activity of glucose-6-phosphate dehydrogenase
also decreased, likely causing a reduced flux in the pentose phosphate pathway.
Comparison of related and characterized yeasts suggests that the behavior
observed in K. lactis could reflect the lack of an efficient mechanism to maintain a
high glycolytic flux and to balance the redox homeostasis under hypoxic condi-
tions. This could be a consequence of a recent specialization of K. lactis toward
living in a niche where the ethanol accumulation at high oxygen concentrations
and the ability to survive at a low oxygen concentration do not represent an
advantage.

maintain the cellular redox potential and the essential

Introduction mitochondrial functions (Sabová et al., 1993; Ansell et al.,
YEAST RESEARCH

The majority of eukaryotes need oxygen for their growth.
However, several yeast lineages can proliferate under
hypoxic and anaerobic conditions (Merico et al., 2007).
The ability to grow under anaerobic conditions depends on
several factors, environmental, genetic and metabolic. A
good capacity to ferment sugars to ethanol does not
necessarily imply that a yeast also has the ability to grow
under anaerobic conditions. Actually, most facultative fer-
mentative yeasts do not grow in the absence of oxygen, not
even on complex media (Visser et al., 1990). The ability to
grow at a low oxygen concentration rather represents a
metabolic skill based on specific enzymatic and transport
activities as well as specific regulatory circuits. In short,
anaerobiosis imposes a number of challenges to the cell,
ranging from the ability to synthesize essential cellular
compounds for which molecular oxygen is required, such
as sterols and unsaturated fatty acids, to the ability to
1997; Nissen et al., 2000; Rosenfeld & Beauvoit, 2003).
Saccharomyces cerevisiae as well as several other Sacchar-
omyces/Kluyveromyces yeasts can grow under anaerobic
conditions. A recent comparative study (Merico et al.,
2007) showed that especially yeasts belonging to the lineage
that underwent whole-genome duplication (WGD), an
event that occurred around 150 million years ago (Wolfe &
Shields, 1997; Kellis et al., 2004), followed by the rewiring of
transcriptional networks and by the evolution of new
proteins (Ihmels et al., 2005; Piškur et al., 2006), are capable
of an efficient fermentative and anaerobic life style. Kluyver-
omyces lactis belongs to the Saccharomyces/Kluyveromyces
complex, but it diverged from S. cerevisiae before the WGD
(Wolfe & Shields, 1997). Most K. lactis strains can grow on
glucose in the presence of respiratory inhibitors (antimycin
A, oligomycin, etc.), but fail to grow efficiently under strict
anaerobic conditions on synthetic media, even in the

FEMS Yeast Res 9 (2009) 749–756

c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
750
presence of ergosterol and unsaturated fatty acids
(Wésolowski-Louvel et al., 1996; Kiers et al., 1998). A very
slow growth has been observed under conditions of strict
anaerobiosis on complex media (Merico et al., 2007).
Saccharomyces kluyveri, a close relative of K. lactis, ferments
well and can efficiently grow under anaerobic conditions
(Møller et al., 2001, 2002). Therefore, it is not clear whether
the aerobic nature of K. lactis is an original trait or a recently
derived one.
Classical physiological and biochemical analysis as well as
more recent microarray studies in S. cerevisiae revealed that
oxygen indirectly controls the expression of a set of genes
through heme. When oxygen availability declines below a
certain level, heme synthesis stops and this results in the
deactivation of transcriptional factors such as ROX1, encod-
ing a repressor of anaerobic genes (Zitomer & Lowry, 1992;
Zitomer et al., 1997; Kwast et al., 2002). A recent transcrip-
tomic study showed that the response to oxygen depletion
consists of a short-term response, in which ‘stress-like’
factors are also involved, and a chronic response, largely
controlled by the heme-responsive transcription factors (Lai
et al., 2005, 2006). The mRNA levels of several K. lactis genes
respond to oxygen and heme availability (Kiers et al., 1998;
Destruelle et al., 1999; González-Domı́nguez et al., 2000).
Recently, a microarray study on K. lactis response to the
hypoxic stress indicated that the mRNA level of the KlROX1
gene, which has low sequence similarity to the S. cerevisiae
orthologue, seems not to decrease during hypoxia (Blanco
et al., 2007).
In order to gain more insight into the mechanism of
fermentative lifestyle evolution in the Saccharomyces com-
plex, in the present work, we investigated the fermentative
ability of K. lactis under different conditions of oxygen
availability and compared the results with other well-studied
yeasts.
Materials and methods
Yeast strains and media
Kluyveromyces lactis CBS 2359 was used throughout this
work. All experiments were performed on the defined
synthetic minimal medium described by Verduyn et al.
(1992), supplemented with nicotinic acid (3.5 mg L 1)
(Kiers et al., 1998) and, specifically to avoid nutrient
deficiency under oxygen-limited conditions, with ergosterol
(10 mg L 1), Tween 80 (420 mg L 1) and uracil (50 mg L 1)
(Merico et al., 2007). Glucose (20 g L 1) was used as the sole
carbon source.
To test yeast response to a reduced respiratory activity,
antimycin A (5 mM) was added. When specified in the text,
acetoin at a concentration of 6 g L 1 was added as well.
c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
A. Merico et al.
Shake-flask cultivations
Shake-flask cultures were run at 30 1C and 200 r.p.m. in a
rotative shaker, starting from preinocula grown on the
defined synthetic minimal medium described above. All
experiments were conducted in 100 mL of medium in
500-mL flasks, and growth parameters were calculated with-
in a biomass range from 0.1 to 1.0 OD660 nm (see Determina-
tion of cell density) to ensure fully aerobic conditions.
Batch cultivations in a fermentor
Batch cultivations were performed in a Biostat-Q-system
Downloaded from https://academic.oup.com/femsyr/article/9/5/749/530806 by guest on 16 April 2022
(B-Braun) with a working volume of 0.8 L. A temperature of
30 1C and a stirring rate of 500 r.p.m. were maintained
throughout the experiment. Automatic addition of 2 M
KOH maintained the medium pH at 5.0 during cell growth.
Foaming was controlled by the addition of a silicon anti-
foaming agent (BDH) to give a final concentration of
0.1 g L 1. Prehumidified air was injected to maintain the
dissolved oxygen concentration at 100% of air saturation
until the inoculum. Yeast cultures were started from frozen
cells, and incubated for one night in the same medium as
later used during the experiment to obtain an exponentially
growing and preadapted biomass. At time 0, the cells were
inoculated at a concentration of 0.25 OD660 nm mL 1 (low
cell concentration experiments) or 8 OD660 nm mL 1 (high
cell concentration experiments). Any direct air supply was
available during all the experiments. To avoid strict anaero-
bic conditions, nitrogen was not supplied too, and the
fermentor was equipped with silicon tubes, instead of
Norprene tubes usually used to obtain strict anaerobic
conditions. In this way, a very low amount of air could also
diffuse across the silicon tubes and thus the presence of a low
level of dissolved oxygen, facilitated by continuous stirring
in the fermentor, was promoted during all the experiments.
At the time of inoculum, the dissolved oxygen concentration
detected by the oxygen sensor was 100% of the air satura-
tion, but it declined to 0.2% in 30 min (low cell concentra-
tion) and below the oxygen sensor sensitivity in 3 min (high
cell concentration), due to cell respiration and growth.
Growth parameters were monitored for 8 h from the
inoculum.
Determination of cell density
Cell growth was monitored by measuring the OD660 nm
using a Ultraspec 2100 pro spectrophotometer (Amersham
Pharmacia Biotech). Parallel samples varied about 3–5%.
One OD unit corresponds to a dry weight of 0.295 g L 1.
Extracellular metabolites
Samples were quickly withdrawn from batch cultures during
exponential growth at appropriate intervals and centrifuged
FEMS Yeast Res 9 (2009) 749–756
Fermentation pattern in Kluyveromyces lactis
for 2 min at 15 700 g to discard cellular pellets. The concen-
trations of glucose, ethanol and glycerol in the supernatants
were determined using R-Biopharm Italia enzymatic kits
(code 716251, 176290 and 148270, respectively). All samples
were analyzed in triplicate, and the SD varied between 1%
and 2%.
Preparation of cell extracts and enzyme assays
Cell extracts were prepared essentially as described by
Postma et al. (1989), with the exception that cells were
disrupted by agitation with glass beads on a vortex (alter-
nating 1 min in ice and 1 min on vortex for five times)
instead of using sonication. The total protein content was
determined using the Bio-Rad Protein Assay kit (code 500-
0006; Bio-Rad), using bovine serum albumin as a standard.
A unit of enzyme activity is defined as 1 mmol of substrate
transformed per minute using an extinction coefficient for
NADH of 6.22 L mmol 1 cm 1. Enzyme assays were per-
formed in triplicate, and the values of SD obtained varied
between 2.5% and 6%.
Alcohol dehydrogenase (ADH), pyruvate decarboxylase,
hexokinase and glucose-6-phosphate dehydrogenase
(G6PDH) assays were performed as described by Postma
et al. (1989) and by de Jong-Gubbels et al. (1995).
For glycerol-3-phosphate dehydrogenase (GPD), cell ex-
tracts were prepared and desalted essentially as described by
André et al. (1991), with the exception that cells were
disrupted by agitation with glass beads on the vortex as
described above. The GPD assay was performed in TrED
buffer (triethanolamine 10 mM, EDTA 1 mM and dithio-
threitol 1 mM, pH 7.5), MgCl2 1 mM and NADH 0.1 mM.
The reaction was started by the addition of dihydroxyace-
tone phosphate 0.67 mM.
Total RNA isolation and semi-quantitative
reverse transcriptase (RT)-PCR
Total RNA was isolated from 1.5 mg (dry weight) of cells
using the RNeasy Mini Kit (code 74104, Qiagen) and treated
with RNAse-free DNAse I to eliminate DNA contamination
according to the manufacturer’s suggestions. An incubation
at 65 1C for 15 min ensured the inactivation of the DNAse I
before the subsequent step of purification. RNA was quanti-
fied by spectrophotometry and its quality was checked by gel
electrophoresis.
Semi-quantitative RT-PCR was performed according to
the method described by Choquer et al. (2003). mRNAs
were amplified using the Ready-to-Go RT-PCR Beads kit
(code 27-9266-01, GE-Healthcare) in a Mastercycler (Ep-
pendorf) with 10–40 ng of total RNA as a template into a
final volume of 50 mL. Primers were used in different
amounts: 25 pmol of the KlRAG1 primers (RAG1-for:
CTGCAGGTAACGCATCATG, RAG1-rev: GCCATTGCCTT
FEMS Yeast Res 9 (2009) 749–756
751
ACCCTTAAC) and 15 pmol of the KlACT1 internal control
primers (ACT1-for: CCTTCTACGTCTCTATCCAAGC, ACT1-
rev: GTGATAACTTGGCCATCTGG). Synthesis of cDNA was
performed at 45 1C for 30 min before inactivation of RT at
95 1C for 5 min. Amplification of cDNA by PCR was performed
for 1 min at 95 1C, 45 s at 52 1C and 1 min at 72 1C for 30 cycles.
Detection of contaminating DNA in all total RNA sam-
ples was performed in RT-PCR reaction mixtures in which
the RT was inactivated before the cDNA synthesis step.
Amplification efficiencies were evaluated by gel electro-
phoresis and densitometric analysis using the KODAK 1DIMAGE
ANALYSIS software (Kodak). The results, expressed in arbitrary
Downloaded from https://academic.oup.com/femsyr/article/9/5/749/530806 by guest on 16 April 2022
units  SD, are given as the mean ratio between the fluores-
cence of the target gene and the internal standard of at least
three independent experiments. The ANOVA and the P-value
were calculated using the STATADVISOR software. A calculated
P-value o 0.0001 indicated statistical significance at the
95% confidence level.
Results
Growth under conditions of reduced respiratory
activity
In our previous work, we reported that the addition of
acetoin or some amino acids allowed K. lactis to grow in the
presence of a high concentration of antimycin A (Merico
et al., 2007). This prompted us to study in more detail the
growth of K. lactis under conditions of reduced respiratory
activity. Antimycin A blocks the respiratory activity. When
5 mM antimycin A was present in the medium, K. lactis grew
at a reduced specific growth rate (0.15 h 1 in the presence
and 0.50 h 1 in the absence of antimycin A), and produced
ethanol (Table 1). Under this condition, the specific glucose
consumption rate (mmol glucose g–1 dry weight h–1) was
two times higher than in the absence of the drug, as expected
due to the fermentative metabolism (Table 1). At the same
time, glycerol formation enabled the reoxidation of the
surplus of NADH generated during the anabolic reactions
associated with the biomass production (Table 1). This
NADH could not be drained otherwise because of the
reduced activity of the respiratory chain.
The addition of acetoin, which works as a cytoplasmic
redox sink through its conversion to butanediol catalyzed by
an NADH-dependent reaction (González et al., 2000),
resulted in an increase in the specific growth rate (Table 1).
Neither the specific glucose consumption rate nor the
specific ethanol production rate increased, but a decreased
glycerol production, both in terms of the specific rate of
production and yield, was observed. As a consequence, the
biomass yield increased. Taking into consideration that
glycerol production is an energy-consuming reaction, the
positive effect of the acetoin on the growth rate did not
c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
752 A. Merico et al.

Table 1. Comparison of the growth parameters of Kluyveromyces lactis cultivated under aerobic conditions without respiration inhibitors and under
conditions of reduced respiratory activity in presence of antimycin A and in presence of antimycin A plus acetoin
1 1
Yield (g g glucose) q (mmol g dry weight h 1)
Specific rate
Growth conditions of growth (h 1) Biomass Ethanol Glycerol Glucose Ethanol Glycerol
Without respiration inhibitors 0.50 0.40 0 0 11.95 0 0
With antimycin A 0.15 0.04 0.35 0.10 23.00 31.74 4.52
With antimycin A and acetoin 0.26 0.06 0.34 0.02 23.40 31.09 0.75

Table 2. Growth parameters of Kluyveromyces lactis cultivated under conditions of oxygen limitation at low cell concentration and at high cell
concentration, with and without acetoin
1 1
Yield (g g glucose) q (mmol g dry weight h 1)
Specific rate

Downloaded from https://academic.oup.com/femsyr/article/9/5/749/530806 by guest on 16 April 2022

Growth conditions of growth (h 1) Biomass Ethanol Glycerol Glucose Ethanol Glycerol
Low cell concentration
Phase I: 0.40–0.85 OD 0.26 0.04 0.34 0.10 34.98 46.48 6.69
Phase II: 1.24–2.45 OD 0.23 0.05 0.36 0.07 27.78 38.89 3.70
Low cell concentration plus acetoin, 0.48–2.26 OD 0.31 0.10 0.29 0.04 17.18 44.09 1.82
High cell concentration, 9.12–16.70 OD 0.16 0.10 0.38 0.09 9.40 14.01 1.71
High cell concentration plus acetoin, 10.00–19.60 OD 0.23 0.13 0.38 0.03 9.88 14.62 0.59

result from a higher fermentative activity, but was likely due
to the reduced production of glycerol, which leaves more
ATP for the growth.
Growth under conditions of oxygen limitation
The growth in the presence of inhibitors of the respiratory
chain can be very different from the growth under the
condition of a real oxygen limitation. In order to investigate
the response of K. lactis under limited oxygen availability, we
performed experiments in a fermentor in the absence of air
supply and nitrogen flux, to avoid strict anaerobic condi-
tions. Furthermore, the presence of the silicon tubes and
continuous stirring in the fermentor allowed some oxygen
diffusion and the presence of a very low level of dissolved
oxygen (Visser et al., 1990; for more details, see also
Materials and methods). At the time of the inoculation, the
dissolved oxygen concentration was 100% of the air satura-
tion, but it declined to 0.2% in 30 min, due to cell respira-
tion and growth. Under these conditions, K. lactis exhibited
a respiro-fermentative metabolism and grew exponentially
at a specific rate of 0.26 h 1 (Table 2, phase I). As already
observed in the presence of antimycin A, oxygen limitation
reduced the specific growth rate, but to a lesser extent than
in the case of antimycin A. The specific glucose consump-
tion rate was almost three times higher than in aerobiosis
but also higher than in the presence of antimycin A,
resulting in a higher ethanol and glycerol production rate
(for a comparison, see Tables 1 and 2). As the biomass
increased, the condition of oxygen limitation became more
stringent in the bioreactor, because an increased number of
cells consumed the very low amount of the oxygen diffusing
across the tubes and dissolved in the medium. At this point,
the dissolved oxygen level actually declined below the
detection limit of the oxygen probe. This more oxygen-
limited condition determined a further decrease of the
growth rate and also caused, surprisingly, a decrease of the
specific glucose consumption rate (Table 2, phase II). This
could not have been due to a decreased glucose concentra-
tion in the medium, because this was still sufficiently high to
maintain the low-affinity glucose transporter RAG1 being
induced (Chen et al., 1992). As a consequence of the reduced
flux of glucose, the specific ethanol production rate de-
creased, and the glycerol production rate decreased as well
(Table 2, phase II). In terms of yields, all the parameters
(biomass, ethanol and glycerol) reached almost the same
values as already observed during growth in the presence of
antimycin A.
The addition of acetoin under these conditions elicited a
response similar to the one that occurred in the experiment
performed in the presence of antimycin A. It caused an
increase in the specific growth rate that could be maintained
throughout the experiment and a strong decrease in the
glycerol consumption rate without influencing the fermen-
tative activity (Table 2). Yields were influenced as well: lower
ethanol and glycerol yields resulted in a higher biomass yield
(Table 2).
Growth under more oxygen-limited conditions
The observation that the oxygen limitation affected glucose
metabolism and fermentative activity needed further inves-
tigations. It is known that K. lactis is unable to grow under
strict anaerobic conditions on synthetic media even in the

c 2009 Federation of European Microbiological Societies FEMS Yeast Res 9 (2009) 749–756
Published by Blackwell Publishing Ltd. All rights reserved
Fermentation pattern in Kluyveromyces lactis 753

presence of sterols and fatty acids (Kwast et al., 2002). In main effect elicited by acetoin was the reduction of glycerol
order to test the K. lactis response under more oxygen- production, in terms of both productivity and yield.
limited conditions, cells were inoculated in the fermentor at
higher cell concentrations (Fig. 1). In this set of experiments, Enzyme activities and RAG1 expression
the same level of dissolved oxygen as that described in the
To verify how the induction of the fermentative metabolism
above experiment was available, but for a higher amount of
is related to the activity of involved enzymes under the
cells, thus providing a more stressful condition of oxygen-
different conditions of growth, several of them were ana-
limited growth. Noticeably, the dissolved oxygen concentra-
lyzed (Table 3). As expected, and already reported (Kiers
tion declined below the oxygen sensor sensitivity already
et al., 1998), pyruvate dehydrogenase and ADH activities
after 3 min from the inoculation. In this way, furthermore,
increased during the growth under limited oxygen condi-
the cells grew in a fresh medium and then at the appropriate
tions. The activity of GPD increased under limited oxygen
glucose concentration for the RAG1 induction and without
conditions as well and this correlated with the observed

Downloaded from https://academic.oup.com/femsyr/article/9/5/749/530806 by guest on 16 April 2022

the presence of byproducts that could affect the growth, as
glycerol production. An increased activity of hexokinase was
actually occurs when such a concentration of cells is
detected, but only under the more oxygen-limited condi-
obtained after a prolonged growth in the same medium.
tion, despite the lower glycolytic flux observed under this
Under this condition, K. lactis grew with a specific growth
condition. It is noteworthy that G6PDH activity reduced to
rate that was lower than under the less oxygen-limited
half under the oxygen-limited condition in comparison with
condition (Table 2). The specific glucose consumption rate
the aerobic conditions (Table 3).
did not show any increase, and interestingly, it was even
The observed variations in the glucose consumption rate
lower than during the growth in the presence of antimycin A
in relation to the oxygen availability suggested that RAG1
(Tables 1 and 2). The specific ethanol and glycerol produc-
could be regulated by oxygen concentration. The analysis of
tion rates were the lowest as well (Tables 1 and 2). The same
the RAG1 transcript level indicated that a repression of
kind of results were obtained when the fermentor was
RAG1 occurred during the growth under limited availability
inoculated with half the amount of yeast cells (OD = 5, data
of oxygen. The difference in the observed values was
not shown).
approximately two times (Table 3).
The addition of acetoin also in this case helped to increase
the growth rate (Table 2), despite the fact that the glucose
consumption rate and ethanol production rate did not rise. Discussion
As observed under the less oxygen-limited condition, the A recent survey on the hypoxic and oxidative stress response
in K. lactis (Blanco et al., 2007) showed that one of the
hypoxia-induced genes is KlGCR1, coding for a positive
100 35 regulator of glycolytic genes (Neil et al., 2004). This can
Metabolites (g L–1)

30
indicate that, as in S. cerevisiae, the glycolytic flux is
Biomass (OD)

10 25
stimulated under hypoxia, as expected due to the lower
20
energetic efficiency of fermentation over respiration. Our
15
1 experiments proved that K. lactis, similar to S. cerevisiae,
10
increases its glucose metabolism and accumulates ethanol
5
0.1 0
and glycerol in response to a reduced oxygen availability/
0 2 4 6 8 10 respiratory activity (Tables 1 and 2). The glucose consump-
Time (h) tion rate was substantially higher under oxygen-limited
Fig. 1. Growth of Kluyveromyces lactis under conditions of oxygen conditions or in the presence of respiration inhibitors than
limitation inoculated at a high cell concentration: ’, biomass; under fully aerobic conditions, but this relationship seems
~, glucose; m, ethanol; and n, glycerol. to be strictly correlated to the oxygen level. In fact, when the

Table 3. Analysis of the activities of pyruvate decarboxylase (PDC), alcohol dehydrogenase (ADH), GPD, hexokinase (HXK) and G6PDH and of RAG1
expression under aerobic conditions and under conditions of oxygen limitation
Enzyme activity (U mg 1) mRNA expression (AU)

Growth conditions PDC ADH GPD HXK G6PDH RAG1

Aerobiosis 0.57  0.01 1.86  0.11 0.005  0.001 0.85  0.01 1.23  0.09 1.06  0.10
Low cell concentration 0.85  0.01 4.47  0.26 – 0.93  0.05 0.59  0.04 –
High cell concentration 1.24  0.06 7.09  0.52 0.046  0.001 1.7  0.08 0.60  0.04 0.64  0.21
P-value o 0.0001.

FEMS Yeast Res 9 (2009) 749–756

c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
754
Table 4. Comparison of growth parameters under strict anaerobic or
oxygen-limited conditions in three different yeasts (data in parentheses
obtained under aerobic conditions)
S. cerevisiae S. kluyveri K. lactis
mmax (h 1) 0.35 (0.38) 0.24 (0.47) 0.16 (0.5)
qglu (mmol g 1 dry 26.8 (13.2) 14.9 (8.7) 9.4 (11.95)
weight h 1)
qEtOH (mmol g 1 dry 35.4 (21.8) 20.5(3.4) 14 (0)
weight h 1)
qgly (mmol g 1 dry 4.17 (1.98) 3 (0.4) 1.7 (0)
weight h 1)
Biomass yield 0.08 (0.11) 0.089 (0.29) 0.1 (0.4)
(g g 1 glucose)
EtOH yield (g g 1 glucose) 0.4 (0.34) 0.35 (0.1) 0.38 (0)
Saccharomyces cerevisiae and Saccharomyces kluyveri were studied
under strict anaerobic conditions, and Kluyveromyces lactis under oxy-
gen-limited conditions. Saccharomyces kluyveri: data from Møller et al.
(2001).
availability of oxygen becomes increasingly growth limiting,
the glycolytic flux decreases (Table 2). This is in contrast to
the properties of S. cerevisiae and S. kluyveri, both of which,
under anaerobic conditions, increase their glucose metabo-
lism and therefore maintain almost the same growth as the
one under aerobic conditions (Table 4). It is noteworthy that
in K. lactis, the reduced glucose consumption rate occurred
together with a decreased level of expression of the major
glucose transporter RAG1 (Table 3). Recently, it has been
reported that KlHap1p represses the expression of RAG1,
thus reducing the glucose uptake rate (Bao et al., 2008). In
the same work, the transcription of KlHAP1 has been shown
to be increased under hypoxia. The authors have suggested
that this regulation helps to maximize the respiratory path-
way and minimize the fermentation. Furthermore, it seems
that the spectrum of the target genes regulated by KlHAP1
and its mode of regulation in K. lactis deviates from the
HAP1 gene in S. cerevisiae (Lamas-Maceiras et al., 2007; Bao
et al., 2008). In K. lactis, the transport of other sugars, such
as galactose, raffinose and maltose, has also been correlated
with a reduced uptake capacity in the presence of respiration
inhibitors, leading to the so-called Kluyver effect (Goffrini
et al., 2002; Fukuhara, 2003). Apparently, the action of
HAP1 on the sugar uptake and on several other pathways,
and its correlation with the presence of oxygen, may
represent the main and crucial difference between S. cerevi-
siae and K. lactis.
The growth under oxygen-limited condition requires the
cell to solve a second but equally strategic problem: the
maintenance of the redox homeostasis. Under the limiting
oxygen availability, S. cerevisiae achieves its redox balance by
producing glycerol (Nissen et al., 2000; Rigoulet et al., 2004).
The redox balance also needs to be maintained inside the
mitochondria, for the assimilatory reactions. To restore this
balance, when the respiration is limited by oxygen, NADH
c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
A. Merico et al.
must be transported to the cytosol and oxidized via forma-
tion of glycerol. In S. cerevisiae, different shuttle systems
have been described that generate an NAD/NADH gradient
across the inner mitochondrial membrane. One is the
dihydroxyacetone phosphate–glycerol-3-phosphate, cata-
lyzed by the cytoplasmic GPD1 product, and the mitochon-
drial GPD2 product, which has been shown to be induced
specifically under anaerobiosis (Ansell et al., 1997). The
ethanol–acetaldehyde shuttle has also been reported to be
involved and ADH3 is induced by anaerobiosis (Bakker
et al., 2000; Overkamp et al., 2000). Similarly, FRDS1 and
OSM1, coding for the cytoplasmic and mitochondrial form
Downloaded from https://academic.oup.com/femsyr/article/9/5/749/530806 by guest on 16 April 2022
of fumarate reductase, are under the control of the oxygen
presence (Camarasa et al., 2007). In the K. lactis genome, we
found only one gene with a high identity to S. cerevisiae
GPD1/2 and a single gene with a high identity to OSM1/
FRDS1. However, we observed a higher activity of GPD
under oxygen limitation, indicating that the unique copy of
KlGPD is induced by hypoxia (Table 3). Nevertheless, in
K. lactis under hypoxia, the glucose consumption rate and
the glycerol flux decrease and, as a consequence, this can
cause a redox imbalance at both the cytoplasmic and the
mitochondrial level.
On the other hand, a reduced production of glycerol in
the presence of acetoin leaves more ATP for the growth and
therefore enables a higher growth rate and a higher biomass
yield (Tables 1 and 2). These data are in agreement with our
previous observations that the presence of acetoin allows
K. lactis to grow in the presence of higher antimycin
A concentrations (Merico et al., 2007).
In K. lactis, the pentose phosphate pathway (PPP) con-
tributes substantially to glucose metabolism, more than in
S. cerevisiae (González-Siso et al., 2000). It has therefore
been proposed that the high respiratory capacity of K. lactis
serves the maintenance of an operative PPP (Tarrı́o et al.,
2006). In fact, the NADPH produced by this pathway is
reoxidized by the external NAD(P)H: ubiquinone oxido-
reductase, encoded by KlNDE1, promoting the required
NADPH/NADP turnover (Tarrı́o et al., 2005). As a conse-
quence, in Klpgi1 (rag2) mutants, fermentation becomes
respiration dependent. Furthermore, Klzwf1 mutants have
been described to be more sensitive to antimycin A and to
produce a very low level of ethanol, suggesting that PPP is
also required to achieve ethanol accumulation (Saliola et al.,
2007). We detected a reduction of G6PDH activity under
oxygen-limited conditions in comparison with the aerobic
conditions (Table 3). The reduction of the NADPH reoxida-
tion could then result in the reduction of the PPP flux.
In conclusion, the availability of oxygen determines the
fermentation pattern in K. lactis. The increase of the glucose
consumption rate in response to the reduced oxygen level is
a transient effect in this yeast, in contrast to what occurs in
Crabtree-positive yeasts. In fact, when the availability of
FEMS Yeast Res 9 (2009) 749–756
Fermentation pattern in Kluyveromyces lactis
oxygen decreases, an overall reduction of the glucose meta-
bolism occurs, which in turn leads to a reduced fermenta-
tion activity. A redox imbalance, caused by the reduced
respiratory activity and by the decreased glycolytic flux, also
results. It remains unclear at present as to what is the nature
of the signal that triggers the response to hypoxia. The
evolution of a fermentative lifestyle is undoubtedly asso-
ciated with the capacity to become independent from the
oxygen availability. This skill is strictly correlated with the
possibility to regulate gene expression and it is assisted by
the presence of multiple genes differently expressed under
aerobic/anaerobic conditions, as it occurs in S. cerevisiae.
Our observations show that K. lactis has the ability to
upregulate its fermentative metabolism under conditions of
reduced oxygen availability as S. cerevisiae, but suggest the
predominance of other regulatory mechanisms that later
lead to a reduction of the glycolytic flux. Thus, the glucose
metabolism in the presence of oxygen is preferentially
respiratory, and under very limited oxygen conditions, the
yeast’s ability to grow and proliferate is diminished. This
could be a consequence of a recent specialization of K. lactis
toward living in a niche where the ethanol accumulation at
high oxygen concentrations and the ability to survive with-
out oxygen do not represent an advantage. Alternatively,
K. lactis could exhibit the original yeast traits, which were
associated with the Crabtree-negative effect and the inability
to propagate without oxygen. However, the ability of other
closely related yeasts to grow under anaerobic conditions
(Merico et al., 2007) rather excludes this possibility.
Acknowledgement
We thank Roberto Foschino (University of Milan) for his
assistance in statistical analysis.
References
André L, Hemming A & Adler L (1991) Studies on the osmotic
induction of glycerol production and glycerol-3-phosphate
dehydrogenase (NAD1). FEBS J 286: 13–17.
Ansell R, Granath K, Hohmann S, Thevelein JM & Adler L (1997)
The two isoenzymes for yeast NAD1-dependent glycerol 3-
phosphate dehydrogenase encoded by GPD1 and GPD2 have
distinct roles in osmoadaptation and redox regulation. EMBO
J 16: 2179–2187.
Bakker BM, Bro C, Kötter P, Luttik MA, van Dijken JP & Pronk JT
(2000) The mitochondrial alcohol dehydrogenase Adh3p is
involved in a redox shuttle in Saccharomyces cerevisiae. J
Bacteriol 182: 4730–4737.
Bao W-G, Guiard B, Fang Z-A, Donnini C, Gervais M, Lopes
Passos FM, Ferrero I, Fukuhara H & Bolotin-Fukuhara M
(2008) Oxygen-dependent transcriptional regulator Hap1p
limits glucose uptake by repressing the expression of the major
FEMS Yeast Res 9 (2009) 749–756
755
glucose transporter gene RAG1 in Kluyveromyces lactis.
Eukaryot Cell 7: 1895–1905.
Blanco M, Núñez L, Tarrı́o N, Canto E, Becerra M, González-Siso
MI & Cerdán ME (2007) An approach to the hypoxic and
oxidative stress responses in Kluyveromyces lactis by analysis of
mRNA levels. FEMS Yeast Res 7: 702–714.
Camarasa C, Faucet V & Dequin S (2007) Role in anaerobiosis of
the isoenzymes for Saccharomyces cerevisiae fumarate
reductase encoded by OSM1 and FRDS1. Yeast 24: 391–401.
Chen XJ, Wésolowski-Louvel M & Fukuhara H (1992) Glucose
transport in the yeast Kluyveromyces lactis. II. Transcriptional
regulation of the glucose transporter gene RAG1. Mol Gen
Genet 233: 97–105.
Downloaded from https://academic.oup.com/femsyr/article/9/5/749/530806 by guest on 16 April 2022
Choquer M, Boccara M & Vidal-Cros A (2003) A semi-
quantitative RT-PCR method to readily compare expression
levels within Botrytis cinerea multigenic families in vitro and in
planta. Curr Genet 43: 303–309.
de Jong-Gubbels P, Vanrolleghem P, Heijnen JJ, van Dijken JP &
Pronk JT (1995) Regulation of carbon metabolism in
chemostat cultures of Saccharomyces cerevisiae grown on
mixtures of glucose and ethanol. Yeast 11: 407–418.
Destruelle M, Meneghini R, Frontali L & Bianchi MM (1999)
Regulation of the expression of the Kluyveromyces lactis PDC1
gene: carbon source-responsive elements and autoregulation.
Yeast 15: 361–370.
Fukuhara H (2003) The Kluyver effect revisited. FEMS Yeast Res
3: 327–331.
Goffrini P, Ferrero I & Donnini C (2002) Respiration-dependent
utilization of sugars in yeasts: a determinant role for sugar
transporters. J Bacteriol 184: 427–432.
González E, Fernández MR, Larroy C, Solà L, Pericàs MA, Parés X
& Biosca JA (2000) Characterization of a (2R,3R)-2,3-
butanediol dehydrogenase as the Saccharomyces cerevisiae
YAL060W gene product. Disruption and induction of the
gene. J Biol Chem 275: 35876–35885.
González-Domı́nguez M, Freire-Picos MA, Ramil E, Guiard B &
Cerdán ME (2000) Heme-mediated transcriptional control in
Kluyveromyces lactis. Curr Genet 38: 171–177.
González-Siso MI, Freire-Picos MA, Ramil E, González-
Domı́nguez M, Rodrı́guez Torres A & Cerdán ME (2000)
Respirofermentative metabolism in Kluyveromyces lactis:
insights and perspectives. Enzyme Microb Tech 26: 699–705.
Ihmels J, Bergmann S, Gerami-Nejad M, Yanai I, McClellan M,
Berman J & Barkai N (2005) Rewiring of the yeast
transcriptional network through the evolution of motif usage.
Science 309: 938–940.
Kellis M, Birren BW & Lander ES (2004) Proof and evolutionary
analysis of ancient genome duplication in the yeast
Saccharomyces cerevisiae. Nature 428: 617–624.
Kiers J, Zeeman AM, Luttik M, Thiele C, Castrillo JI, Steensma
HY, van Dijken JP & Pronk JT (1998) Regulation of alcoholic
fermentation in batch and chemostat cultures of
Kluyveromyces lactis CBS 2359. Yeast 14: 459–469.
Kwast KE, Lai LC, Menda N, James DT III, Aref S & Burke PV
(2002) Genomic analyses of anaerobically induced genes in
c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
756
Saccharomyces cerevisiae: functional roles of Rox1 and other
factors in mediating the anoxic response. J Bacteriol 184:
250–265.
Lai LC, Kosorukoff AL, Burke PV & Kwast KE (2005) Dynamical
remodeling of the transcriptome during short-term
anaerobiosis in Saccharomyces cerevisiae: differential response
and role of Msn2 and/or Msn4 and other factors in galactose
and glucose media. Mol Cell Biol 25: 4075–4091.
Lai LC, Kosorukoff AL, Burke PV & Kwast KE (2006) Metabolic-
state-dependent remodeling of the transcriptome in response
to anoxia and subsequent reoxygenation in Saccharomyces
cerevisiae. Eukaryot Cell 5: 1468–1489.
Lamas-Maceiras M, Nunez L, Rodriguez-Belmonte E, Gonzales-
Siso MI & Cerdan ME (2007) Functional characterization of
KlHAP1: a model to foresee different mechanisms of
transcriptional regulation by Hap1p in yeasts. Gene 405:
96–107.
Merico A, Sulo P, Piškur J & Compagno C (2007) Fermentative
lifestyle in yeasts belonging to the Saccharomyces complex.
FEBS J 274: 976–989.
Møller K, Olsson L & Piškur J (2001) Ability for anaerobic growth
is not sufficient for development of the petite phenotype in
Saccharomyces kluyveri. J Bacteriol 183: 2485–2489.
Møller K, Christensen B, Forster J, Piškur J, Nielsen J & Olsson L
(2002) Aerobic glucose metabolism of Saccharomyces kluyveri:
growth, metabolite production, and quantification of
metabolic fluxes. Biotechnol Bioeng 77: 186–193.
Neil H, Lemaire M & Wésolowski-Louvel M (2004) Regulation of
glycolysis in Kluyveromyces lactis: role of KlGCR1 and KlGCR2
in glucose uptake and catabolism. Curr Genet 45: 129–139.
Nissen TL, Hamann CW, Kielland-Brandt MC, Nielsen J &
Villadsen J (2000) Anaerobic and aerobic batch cultivations of
Saccharomyces cerevisiae mutants impaired in glycerol
synthesis. Yeast 16: 463–474.
Overkamp KM, Bakker BM, Kötter P, van Tuijl A, de Vries S, van
Dijken JP & Pronk JT (2000) In vivo analysis of the
mechanisms for oxidation of cytosolic NADH by
Saccharomyces cerevisiae mitochondria. J Bacteriol 182:
2823–2830.
Piškur J, Rozpêdowska E, Polakova S, Merico A & Compagno C
(2006) How did Saccharomyces cerevisiae evolve to become a
good brewer? Trends Genet 22: 183–186.
Postma E, Verduyn C, Scheffers WA & van Dijken JP (1989)
Enzymatic analysis of the Crabtree effect in glucose-limited
c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
A. Merico et al.
chemostat cultures of Saccharomyces cerevisiae. Appl Environ
Microb 55: 468–477.
Rigoulet M, Aguilaniu H, Avéret N, Bunoust O, Camougrand N,
Grandier-Vazeille X, Larsson C, Pahlman IL, Manon S &
Gustafsson L (2004) Organization and regulation of the
cytosolic NADH metabolism in the yeast Saccharomyces
cerevisiae. Mol Cell Biochem 256–257: 73–81.
Rosenfeld E & Beauvoit B (2003) Role of the non-respiratory
pathways in the utilization of molecular oxygen by
Saccharomyces cerevisiae. Yeast 20: 1115–1144.
Sabová L, Zeman I, Supek F & Kolarov J (1993) Transcriptional
control of AAC3 gene encoding mitochondrial ADP/ATP
translocator in Saccharomyces cerevisiae by oxygen, heme and
Downloaded from https://academic.oup.com/femsyr/article/9/5/749/530806 by guest on 16 April 2022
ROX1 factor. Eur J Biochem 213: 547–553.
Saliola M, Scappucci G, De Maria I, Lodi T, Mancini P & Falcone
C (2007) Deletion of the glucose-6-phosphate dehydrogenase
gene KlZWF1 affects both fermentative and respiratory
metabolism in Kluyveromyces lactis. Eukaryot Cell 6: 19–27.
Tarrı́o N, Dı́az Prado S, Cerdán ME & González Siso MI (2005)
The nuclear genes encoding the internal (KlNDI1) and
external (KlNDE1) alternative NAD(P)H: ubiquinone
oxidoreductases of mitochondria from Kluyveromyces lactis.
Biochim Biophys Acta 1707: 199–210.
Tarrı́o N, Becerra M, Cerdán ME & González Siso MI (2006)
Reoxidation of cytosolic NADPH in Kluyveromyces lactis.
FEMS Yeast Res 6: 371–380.
Verduyn C, Postma E, Scheffers WA & van Dijken JP (1992) Effect
of benzoic acid on metabolic fluxes in yeast: a continuous-
culture study on the regulation of respiration and alcoholic
fermentation. Yeast 8: 501–517.
Visser W, Scheffers WA, Batenburg-van der Vegte WH & van
Dijken JP (1990) Oxygen requirements of yeasts. Appl Environ
Microb 56: 3785–3792.
Wésolowski-Louvel M, Breunig KD & Fukuhara H (1996)
Kluyveromyces lactis. Nonconventional Yeast in Biotechnology
(Wolf K, ed), pp. 139–202. Springer-Verlag, Berlin.
Wolfe KH & Shields DC (1997) Molecular evidence for an an-
cient duplication of the entire yeast genome. Nature 387:
708–713.
Zitomer RS, Carrico P & Deckert J (1997) Regulation of hypoxic
gene expression in yeast. Kidney Int 51: 507–513.
Zitomer RS & Lowry CV (1992) Regulation of gene expression by
oxygen in Saccharomyces cerevisiae. Microbiol Rev 56: 1–11.
FEMS Yeast Res 9 (2009) 749–756