www.sciencetranslationalmedicine.

org/cgi/content/full/2/45/45ra59/DC1

Supplementary Materials for

The Four-Herb Chinese Medicine PHY906 Reduces Chemotherapy-
Induced Gastrointestinal Toxicity
Wing Lam, Scott Bussom, Fulan Guan, Zaoli Jiang, Wei Zhang, Elizabeth A. Gullen,
Shwu-Huey Liu, Yung-Chi Cheng*
*To whom correspondence should be addressed. E-mail: yccheng@yale.edu

Published 18 August 2010, Sci. Transl. Med. 2, 45ra59 (2010)

DOI: 10.1126/scitranslmed.3001270

The PDF file includes:

Materials and Methods

Fig. S1. Effect of PHY906 and loperamide on the antitumor activity and animal toxicity
of CPT-11.
Fig. S2. Effect of PHY906 treatment duration on the antitumor activity and animal
toxicity of CPT-11.
Fig. S3. Hematoxylin and eosin staining of middle jejunum sections from sample
collected at days 2 and 4 after drug treatments.
Fig. S4. Apoptosis and proliferation of intestinal cells after drug treatment.
Fig. S5. Immunohistochemical staining for phosphorylation of histone H3 at Ser10,
acetylation of histone H3 at Lys9, and trimethylation of histone H3 at Lys4 of middle
jejunum sections.
Fig. S6. Incorporation of BrdU into the intestinal cells of middle jejunum sections after
drug treatment on day 2.
Fig. S7. Effect of drug treatment on the expression of genes of Wnt/β-catenin signaling.
Fig. S8. Effect of PHY906 on Wnt3a activity of Wnt/β-catenin signaling in HEK-293
cells.
Fig. S9. Expression of genes for inflammation after drug treatment.
Fig. S10. Effect of PHY906 on NF-κB–mediated transcriptional activity.
Fig. S11. Effect of PHY906 on COX-2 enzyme activity.
Fig. S12. Effect of PHY906 on iNOS enzyme activity.
Table S1. Quantitative real-time PCR primers.
Supplementary methods

Characterization of PHY906

PHY906 is comprised of four commonly used herbs, Scutelleria baicalensis

Georgi (S), Paeonia lactiflora Pall. (P), Glycyrrhiza uralensis Fisch. (G), and Ziziphus

jujuba Mill. (Z), in the ratio of 3:2:2:2, respectively. This extract consists of a complex

mixture of multiple phytochemicals with multiple biological and pharmacological

properties. We utilized Phytomics to analyze the chemical and biological fingerprints of

the PHY906 product. The chemical fingerprint of PHY906 was determined using LC-

coupled Mass spectrometry in which chemicals were separated by a reverse phase C-18

column and detected by a QTOF-II MS instrument. The biological fingerprint of PHY906

was established using gene array and qRT-PCR. In brief, changes in 18,000 gene mRNA

levels from HepG2 cells after treatment of PHY906 were monitored with the Affymetrix

U133A chip, and then the expression of 20 candidate genes which had high

reproducibility, robustness, and sensitivity were selected to be confirmed by qRT-PCR.

Detailed experimental procedures can be found in reference 36 and 37. The preparation

PHY906 with the detailed chemical fingerprint and biological fingerprint is also available

from PhytoCeutica, Inc. for basic research.

Animal Studies

Murine Colon 38 cells (1-2x106 cells in 0.1ml phosphate-buffered saline, PBS)

were transplanted subcutaneously into four- to six-week-old female BDF1 mice (Charles

River Laboratories). Mice were maintained in accordance with the Institutional Animal

Care and Use Committee procedures and guidelines. After 10 to 14 days, mice with

tumor sizes of 150-300mm3 were selected. Unless otherwise indicated, treatment groups
each consisted of five mice. Tumor size, body weight, and mortality of the mice were

monitored daily. PHY906 was given orally (p.o.) for four days (twice per day (b.i.d.),

500mg/kg) at approximately 10:00am and 3:00pm), while CPT-11 (360mg/kg) was

administered intraperitioneally (.ip.) on day 0. On day 0, PHY906 was given 30 minutes

prior to CPT-11 administration. In the control groups, mice were administered a vehicle,

either PBS for i.p. administration or water for oral administration.

Immunohistochemistry

Mice (BDF1 bearing Colon 38 tumors) were terminated by cervical dislocation two days

or four days after initiation of drug treatment (see above). Intestinal and colon tissues

were removed, fixed in formalin, embedded in paraffin, and sectioned into 10µm. The

sections were mounted on Superfrost slides, dewaxed with xylene, and gradually

hydrated. Antigen retrieval was achieved by 10mM Sodium citrate pH6.0 with 0.02%

Tween-20 under steaming for 30 minutes. The primary antibodies were diluted using

Tris-HCl buffer containing 1% BSA and 0.5% Tween-20 and were incubated at room

temperature for one hour. As a negative control, a set of slides was processed without

primary antibody. Super-picture immunohistochemistry detection kit (Invitrogen, Inc.)

was used for detection. The slides were counterstained with hematoxylin and mounted.

Periodic-acid Schiff staining was done as follows. After dewaxing and rehydration, slides

were placed in 1% Sodium Periodate, 3% Acetic Acid for 1 hour. Slides were washed in

dH20 followed by .1% w/v sodium metabisulfite, 10mM HCL for 20 minutes two times.

Slides were then placed in Schiff reagent for one hour in dark. Slides were then washed 3

times with .1% w/v sodium metabisulfite, 10mM HCL, before being rinsed in water, and
dehydrated before adding cover slips. Information of the antibodies used are as follows;

PCNA (1:2000, Cell Signal, 2586, PCNA(PC10) Mouse mAb); Cleaved Caspase 3

(1:100, Cell Signal, 9664, Cleaved Caspase-3(Asp175) Rabbit mAb; CD3 (1:100, abcam,

ab5690, CD3 antibody (ab5690) ); Anti-lysozyme (1:5000, Dako A0099); Anti-

Chromogranin A (1:5000, Abcam ab15160). anti-Myeloperoxidase (1:3, Novus

Biologicals, NB120-15484, Rabbit Polyclonal anti-Myeloperoxidase); Rat monoclonal

[RM0029-11H3] antibody to macrophage (1:50, abcam, ab56297); Anti-acetyl-Histone

H3 (Lys9) (1:1000, Upstate, 07-352); Anti-phospho-Histone H3 (Ser10) (Mouse

monocloned IgG), clone RR002 (1;1000, Upstate, 05-598); anti-BrdU (1:50, MD5300,

Invitrogen, Murine monoclonal Antibody to Halogenated Deoxyuridine), Anti-trimethyl-

Histone H3 (lys4) (1:1000, Upstate, 07-473, Rabbit antiserum); Anti-CD44 (1:200,

Invitrogen, RM5700, Rat anti-mouse CD44); Anti-TNFα (1:50, RMF326, Antigenix

America Inc., Polyclonal goat anti-mouse TNF-Alpha).

Determination of Apoptosis

Apoptosis was quantified by the TUNEL assay for detecting DNA breaks in the

cells of the various intestinal segments (In Situ cell death detection kit from Roche

Molecular Biochemicals).

Quantitative Real-time PCR

Total RNA was isolated using a modified TRIzol® protocol. Following the

manufacturer’s instructions, we collected the aqueous phase and then added ethanol.

Before centrifuging, this slurry was added to a column (miRNAeasy, Qiagen) for further

extraction and on column and simultaneous DNA digestion (RNase-Free DNAse set,
Qiagen). cDNA was synthesized using random primers and reverse transcriptase MMLV

(New England Biolabs, Ipswich, MA). TaqMan® Probe TNF-Alpha Mm00443258 and

Sybr Green® were used to monitor changes in mRNA expression. TaqMan® Gene

Expression Master Mix (Applied Biosystems) was used for PCR reaction with TaqMan®

probe according to the manufacturer’s instructions. For PCR reaction with Sybr Green®,

Phusion DNA Polymerase (New England Biolabs) and Sybr Green® (1:20,000 at final

concentration) (Invitrogen) were used. Assays were performed using the iCycler iQ Real-

Time Thermocycler Detection System (Bio-Rad Laboratories). The primers and probes

used for the quantitative real-time PCR are shown in the following table.

Table S1. Quantitative Real-Time PCR Primers.

SYBR green primer pair

Gene Forward primer Reverse primer

Actin Tgttaccaactgggacgaca ctgggtcatcttttcacggt

Axin2 Gagtagcgccgtgttagtgact ccaggaaagtccggaagaggtatg

Lgr5 ccaatggaataaagacgacggcaaca gggccttcaggtcttcctcaaagtca

Olfm4 Cagaaggtgggactgtgtctc tagctggacatactccttcac

Ascl2 Aggacgcaataagctaagcatc agtggacgtttgcaccttcacg

Bmi1 Ccccacttaatgtgtgtcctg ttgctggtctccaagtaacg

Tcf4 Cgagatatcaacgaggctttcaag catgtgattcgctgcgtctcc

iNos Cagctgggctgtacaaacctt cattggaagtgaagcgtttcg

Cox2 Tctcccctctctacgcattcta acggattggaagttctattggc

Wnt3 Caagcacaacaatgaagcaggc tcgggactcacggtgtttctc

Fzd5 Ggcatcttcaccctgctctac tacttgagcatgagcacccag

Lrp5 Atccttagtgctctgtactcacc ccctgtcttgcacgtcttg

Lrp6 Gttggatcaacccagagctattg ataacgaagcgacttgagcca

β-Cat Gggtggaacgcagcagcagt atgggagaataaagcaactg

Apc Aagcgtgcacagcgaagaat tgctctgagatgacctctccg

Gsk3b Tggaaataataaaggtccta ggaagacctttgtccaagga

Dvl1 Gcaccagctcttcctcacta ttggcaatggtgatcttaag

Bcl9 Gatgactctgacattaaaga gggcaggagtttggccatg

Bcl9-I Attcagaggccaaagaggtg tgctacattacaattgtggg

Pygo1 Gaggtggtgacagtggact gcgtactctgacagcggag

Pygo2 Atttgcaggaagacgtagct ggcgaactccgtcagatgtg

Brg1 Cgacacattattgagaacgc aaacccttgatctggtactg

Cdc73 Aactttgagaatgtcacgtc cttccgtagttgctgggctg

Cyb1 Ctacattctttagatcggtc acggagtctgccacccactg

Gapdh Ggtgaaggtcggtgtgaacgga tgttagtggggtctcgctcctg

CCL3 Gacaagctcaccctctgtca gccggtttctcttagtcagg

CCl4 Agcaacaccatgaagctctg ctgtctgcctcttttggtca

CCl5 Caatcttgcagtcgtgtttg ggagtgggagtaggggatta

CXCL10 Caaaagtaactgccgaagca ctgagctagggaggacaagg

CXCL14 Ctgcgaggagaagatggtta actggcctggagtttttctt

Il-18 Cctgacatcttctgcaacct ttccgtattactgcggttgt

IL-1b Cccaactggtacatcagcac tctgctcattcacgaaaagg

Luciferase reporter assay

Details of luciferase reporter cell lines establishment and in vitro luciferase

reporter assay are published in our previous report. For studying β-catenin mediated

transcription, LEF/TCF luciferase reporter plasmid that carried 12 copies of LEF/TCF

binding sites (wild type:AGATCAAAGG or mutant:AGGCCAAAGG) was cloned into

pGL4.20 vector (Promega) via the NheI and HindIII restriction sites. HEK-293 cell lines
with a stable transfection of the luciferase reporter were established using a puromycin

selection. Cells were treated with Wnt3a, 25ng/ml (Millipore, Billerica, MA, USA) and

different concentration of PHY906 for 12 hour at 37°C in 5% CO2 incubation.

NF-κB mediated transcription activity was examined by using a luciferase

reporter plasmid that carried 4 copies of NF-κB binding sites (cgggaatttc) and HepG2

cells.

YCC Treatment

Botanicals were extracted in water at 100mg/ml and treated with HCl(pH 2) at

37oC for one hour. After neutralization with NaOH, the herbal extract was diluted to

50mg/ml using Tris-HCl 100mM at pH 6.8 and was incubated with β-glucuronidase,

40µg/ml at 37oC for one hour.

Cytokine Detection

After two-day or four-day drug treatment, blood was collected in a heparinzed

Pasteur pipette from the retro-orbital plexus in mice and placed on ice until centrifugation

at 2500rpm for 15 minutes. Cytokines in the plasma were measured using the BDTMCBA

(Cytometric Bead Array) and Mouse Inflammation and Mouse TH1/TH2 kit (BD

Bioscience). Flow cytometry was performed on the BD FACSCaliburTM.

Cox-2 activity Assay

Cox-2 (Cayman Chemical) enyzmatic reactions were performed according to

manufacturer’s instructions. A four-fold volume of Acetonitrile-methanol (2:1) was used

to terminate the reaction. After centrifugation, the prostanoid product of the supernatant

was quantified by LC-MS. Chromatographic separation was performed using a ZORBAX

SB-C18 column (100 ×2.1 mm, Agilent) at 30°C. The mobile phase consisted of linear
gradients of 0.05% (v/v)formic acid (A) and Methanol (B): 0.01–5.0 min, 60–60% B

(v/v); 5.0–5.5 minutes, 60–80% B; 5.5–35 minutes, 80–80% B; 35–35.5 minutes ,80–

60% B; 35.5–40 minutes, 60–60% B. The mobile phase flow rate was 0.3 mL/min. All

mass spectrometric experiments were performed on an API 4000 Q-Traq mass

spectrometer. The orthogonal Turbo-V source’s injectors were heated to 550°C to allow

connection to the HPLC without mobile-phase splitting. Ultrahigh-purity nitrogen (N2)

was used as the ion source gas (GS1, GS2), curtain gas (CUR) and collision gas (CAD)

and their flow rates were 55, 50, 35, and high, respectively. The multiple reaction

monitoring (MRM) experiments in the negative ionization were performed to detect ion

transitions at m/z: 303->259, 351.1->315 for arachidonic acid and PGE2 respectively.

The collision energies were set at -20, -26V for arachidonic acid and PGE2 respectively.

The analyst 1.4.2 software controlled the data acquisition.

iNOS Activity Assay

iNOS activity was measured by a colorimetric nitrite assay. One unit iNOS

enzyme (Cayman Chemical) was used in a 50µl reaction consisted of 2mM MgAc2,

0.2mM NADPH, 64µM tetrahydro-L-biopterin, 1mg/ml BSA, 40µM DTT, 3µM HbO2

mix in 0.1M Hepes at pH 7.3. 100µl L-arginine with or without herbal extract was then

added, and the mix was incubated for two hours at 37oC. Next, 100µl Griess reagent (1%

sulfanilamide, 0.1% N-(1-Naphthyl)-ethylenediamine dihydro, and 10% HCl) was added,

and the optical density was measured at 540nm.

Statistical Analysis
Data were analyzed by one-way or two-way ANOVA (GraphPad Prism 4), Student’s T-

test (Microsoft Office Excel), and correlation analysis (GraphPad Prism 4). The

difference was considered to be statistically significant when P < 0.05.

Supplementary Figure 1

A 1250
B 110

Control

initial body weight

1000
initial tumor size

100
Percentage of

Percentage of
CPT-11 360mg/kg
750 CPT-11+PHY906 500 mg/kg
90 CPT-11+Loperamide 2 mg/kg
500

80
250

0 70
0 2 4 6 8 10 12 14 1 2 3 4 5 6 7 8
Day Day

Supplementary Figure 1. Effect of PHY906 and Loperamide on the anti-tumor activity and the animal toxicity of CPT-11.
(A) Effect of PHY906 and Loperamide on CPT-11 against the growth of murine colon 38 allograft in BDF1 mice. (B) Effect
of PHY906 and Loperamide on protecting against body weight loss induced by CPT-11. CPT-11 (360mg/kg) was injected
via i.p. once at Day 0, PHY906 (500mg/kg, b.i.d.) was administered orally from Day 0 to Day 3 and Loperamide (2mg/kg,
b.i.d.) was administered orally daily. Error bars indicate standard deviations and N=5. Details of experimental procedures
are given in Materials and Methods.
Supplementary Figure 2

A B

Supplementary Figure 2. Effect of PHY906 treatment duration on the anti-tumor activity and the animal toxicity of CPT-
11. (A) Effect of PHY906 treatment duration on CPT-11 against the growth of murine colon 38 allograft in BDF1 mice. (B)
Effect of PHY906 treatment duration on protecting against body weight loss induced by CPT-11. CPT-11 (350mg/kg) was
injected via i.p. once at Day 0, PHY906 (500mg/kg, b.i.d.) was administered orally from Day 0 to Day 3 or from Day 0 to
Day 7. Error bars indicate standard deviations and N=5. Details of experimental procedures are given in Materials and
Methods.
Supplementary Figure 3

Control PHY906 CPT-11 CPT-11/PHY906

160m

Day 2
160m

Day 4
Supplementary Figure 3. Hematoxylin and eosin staining of middle jejunum sections from samples collected at day 2
and day 4 after drug treatments.Details of experimental procedures are given in Materials and Methods.
Supplementary Figure 4 D 100 CON CPT-11

positive cells per view

PHY906 CPT-11+PHY906

No. of TUNEL
Control PHY906 CPT-11 CPT-11/PHY906 75

Day 2
50

Day 2
25
TUNEL

0
PJ MJ DI PC
100

positive cells per view

Day 4

No. of TUNEL
75
P<0.001
P<0.001 P<0.001

Day 4
50 P<0.005

25
B

Day 2
Cleaved caspase-3

0
PJ MJ DI PC
35 CON CPT-11

positve cells per crypt

E 30
PHY906 CPT-11+PHY906

No. of PCNA
25

Day 4
20
15

Day 2
10
5
0
C PJ MJ DI PC

Day 2
P<0.001
40

positve cells per crypt

P<0.001
P<0.001
PCNA

No. of PCNA
30
Day 4
20

Day 4
P<0.001

10

0
PJ MJ DI PC

Supplementary Figure 4. Apoptosis and proliferation of intestinal cells after drug treatment. (A-C) TUNEL assay and immunohistochemical staining for
cleaved caspase-3 and Proliferating Cell Nuclear Antigen (PCNA) of middle jejunum sections from samples collected at day 2 and day 4 after drug
treatments. (D and E) The number of TUNEL positive cells per view and the number of PCNA positive cells per crypt on day 2 and day 4 in different
intestinal segments (PJ=Proximal Jejunum, MJ=Middle Jejunum, DI=Distal Ileum, PC=Proximal Colon) (3 views per sample were counted; N≥8) were
summarized. Details of experimental procedures are given in Materials and Methods.
Supplementary Figure 5
Control PHY906 CPT-11 CPT-11/PHY906

Day 2
H3 Ser10-P

Day 4
H3 lys9-acetylation

Day 2
Day 4
H3 lys4-trimethylation

Day 2
Day 4
Supplementary Figure 5. Immunohistochemical staining for phosphorylation of histone H3 at serine 10 (H3 Ser10-P) the
acetylation of histone H3 at lysine 9 (H3 lys9-acetylation) and the trimethylation of histone H3 at lysine 4 of middle jejunum
sections. Samples were collected at day 2 and day 4 after drug treatments. Details of experimental procedures are given in
Materials and Methods.
Supplementary Figure 6

Control PHY906 CPT-11 CPT-11/PHY906

40m

Day 2
Supplementary Figure 6. The incorporation of BrdU into the intestinal cells of middle jejunum sections after
drug treatments at day 2. (Samples were collected two hours after injection of BrdU) Details of experimental
procedures are given in Materials and Methods.
Supplementary Figure 7

A Wnt3
P=0.028
B Fzd5 C Lrp5
P=0.044
2.5 2.5 2.0
P=0.049
2.0 2.0
Relative mRNA expression

1.5

1.5 1.5
1.0
1.0 1.0
0.5
0.5 0.5

0.0 0.0 0.0

Control PHY906 CPT-11 CPT-11 Control PHY906 CPT-11 CPT-11 Control PHY906 CPT-11 CPT-11
/PHY906 /PHY906 /PHY906

D Pygo2 E Axin2
P=0.015 P=0.023
10 2.5

8 2.0

6 1.5

4 1.0
P=0.042
2 0.5

0 0.0
Control PHY906 CPT-11 CPT-11 Control PHY906 CPT-11 CPT-11
/PHY906 /PHY906

Supplementary Figure 7 . Effect of drug treatment on the expression of genes of Wnt/-catenin signaling. (A-E)
Quantitative real-time PCR for mRNA expression of Wnt3, Fzd5, Lrp5, Pygo2, and Axin2 of middle jejunum on day 2
and 4 after the administration of drug. In A-E, each spot represents the mean of two to three different experiments
(triplicate samples of each; N ≥ 8). Closed blue symbols are results from Day 2 and open red symbols are results from
Day 4. Details of experimental procedures are given in Materials and Methods
Supplementary Figure 8

A Mutated-TCF/Lef-Luc B Minus one of GPSZ

5 200
Relative luciferase activity

Relative luciferase activity

-G-YCC+Wnt3a
-P-YCC+Wnt3a
4 PHY906
150 -S-YCC+Wnt3a
PHY906 +Wnt3a
3 -Z-YCC+Wnt3a
PHY906YCC
100
PHY906YCC+Wnt3a
2

50
1

0 0
0 200 400 600 0 50 100 150 200 250
Conc. (g/ml) Equivalent conc. (g/ml)

Supplementary Figure 8. Effect of PHY906 on Wnt3a activity of Wnt/β-catenin signaling in HEK-293

cells. (A) Effect of PHY906 with or without YCC treatment on Wnt3a activity of Wnt/β-catenin signaling
in HEK-293 cells which are stably transfected with a mutated LEF/TCF luciferase reporter plasmid. (B)
Effect of subtracting one of G, P, S, or Z from PHY906 with YCC treatment on Wnt/β-catenin
signaling.Glycyrrhiza uralensis Fisch (G), Paeonia lactiflora Pall (P), Scutelleria baicalensis Georgi
(S), and Ziziphus jujuba Mill (Z). Equivalent concentration was added according to the ratio of G, P, S
and Z; 2:2:3:2 of PHY906. Values are means from three different experiments (duplicate samples of
each); error bars indicate standard deviations. Details of experimental procedures are given in
Materials and Methods.
Supplementary Figure 9

TNF MCP-1 P=0.019

A 30 P=0.086 B 15
25

20 10
Relative mRNA expression
15

10 5
5

0 0
Control PHY906 CPT-11 CPT-11 Control PHY906 CPT-11 CPT-11
/PHY906 /PHY906

iNos Cox-2
C 150 P=0.032 D 2.0

1.5
100

1.0

50
0.5

0 0.0
Control PHY906 CPT-11 CPT-11 Control PHY906 CPT-11 CPT-11
/PHY906 /PHY906

Supplementary Figure 9. Expression of genes for inflammation after drug treatment. (A-D)
Expression levels of TNF, MCP-1, iNOS and Cox-2 in the middle jejunum section on day 2 and day
4. In A-D, each spot is the mean from two to three different experiments (triplicate samples of each;
N≥8). Closed Blue symbols are results from day 2 and open red symbols are results from day 4.
Details of experimental procedures are given in Materials and Methods.
Supplementary Figure 10

A 12.5
B

Relative lucuferase activity

12.5

Relative luciferase activity

10.0 10.0

7.5 7.5

5.0 5.0

2.5 G 2.5 P
G-YCC P-YCC
0.0 0.0
0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5
Equivalent conc. (mg/ml) Equivalent conc. (mg/ml)

C D
12.5 12.5
Relative luciferase activity

Relative luciferase activity

10.0 10.0

P<0.0001
7.5 7.5

5.0 5.0

2.5 S 2.5 Z
S-YCC Z-YCC
0.0 0.0
0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5
Equivalent conc. (mg/ml) Equivalent conc. (mg/ml)

Supplementary Figure 10. Effect of PHY906 on NF-B-mediated transcriptional activity. (A-D) Effect
of four different herbs of PHY906 with or without YCC treatment on the TNFα-induced NF-B-
mediated transcriptional activity. Glycyrrhiza uralensis Fisch (G), Paeonia lactiflora Pall (P),
Scutelleria baicalensis Georgi (S), and Ziziphus jujuba Mill (Z). Equivalent concentrations were added
according to the ratio of G, P, S and Z; 2:2:3:2 of PHY906. Values are means from three to five
different experiments (duplicate samples of each); error bars indicate standard deviations. Details of
experimental procedures are given in Materials and Methods.
Supplementary Figure 11

A B
1.25 1.25

Relative Cox-2 activity

Relative Cox-2 activity

1.00 1.00

0.75 0.75

0.50 0.50

G P
0.25 0.25
G-YCC P-YCC
0.00 0.00
0 1 2 3 4 5 0 1 2 3 4 5
Equivalent conc. (mg/ml) Equivalent conc. (mg/ml)

C D
1.00
Relative Cox-2 activity

Relative Cox-2 activity

1.00
0.75
0.75

0.50
0.50

0.25 S 0.25 Z
S-YCC Z-YCC
0.00 0.00
0 1 2 3 4 5 0 1 2 3 4 5
Equivalent conc. (mg/ml) Equivalent conc. (mg/ml)

Supplementary Figure 11. Effect of PHY906 on Cox-2 enzyme activity. (A-D) Effect of four different
herbs of PHY906 with or without YCC treatment on Cox-2 enzyme activity. Glycyrrhiza uralensis Fisch
(G), Paeonia lactiflora Pall (P), Scutelleria baicalensis Georgi (S), and Ziziphus jujuba Mill (Z).
Equivalent concentrations were added according to the ratio of G, P, S and Z; 2:2:3:2 of PHY906.
Values are means from three to five different experiments (duplicate samples of each); error bars
indicate standard deviations. Details of experimental procedures are given in Materials and Methods.
Supplementary Figure 12

A B
1.25 1.25

Relative iNOS activity

Relative iNOS activity
1.00 1.00

0.75 0.75

0.50 0.50
G P
0.25 0.25
G-YCC P-YCC

0.00 0.00
0 1 2 3 4 5 0 1 2 3 4 5
Equivalent conc. (mg/ml) Equivalent conc. (mg/ml)
C D
1.25 1.25
Relative iNOS activity

Relative iNOS activity

1.00 1.00

0.75 0.75

0.50 0.50
P=0.0086 Z
0.25 S 0.25
S-YCC Z-YCC
0.00 0.00
0 1 2 3 4 5 0 1 2 3 4 5
Equivalent conc. (mg/ml) Equivalent conc. (mg/ml)

Supplementary Figure 12. Effect of PHY906 on iNOS enzyme activity. (A-D) Effect of four different
herbs of PHY906 with or without YCC treatment on iNOS enzyme activity. Glycyrrhiza uralensis Fisch
(G), Paeonia lactiflora Pall (P), Scutelleria baicalensis Georgi (S), and Ziziphus jujuba Mill (Z).
Equivalent concentrations were added according to the ratio of G, P, S and Z; 2:2:3:2 of PHY906.
Values are means from three to five different experiments (duplicate samples of each); error bars
indicate standard deviations. Details of experimental procedures are given in Materials and Methods.