Metabolic Engineering 57 (2020) 63–73

Contents lists available at ScienceDirect

Metabolic Engineering
journal homepage: www.elsevier.com/locate/meteng

Metabolic engineering of soybean seeds for enhanced vitamin E T

tocochromanol content and effects on oil antioxidant properties in
polyunsaturated fatty acid-rich germplasm
Anji Reddy Kondaa,b, Tara J. Nazarenusa,b, Hanh Nguyena,c, Junsi Yangd, Malleswari Gellie,
Samantha Swensona,b, Jamie M. Shippf, Monica A. Schmidtf,1, Rebecca E. Cahoona,b,
Ozan N. Ciftcid, Chunyu Zhangg, Tom Elmo Clementea,c, Edgar B. Cahoona,b,∗
a
Center for Plant Science Innovation, University of Nebraska-Lincoln, Lincoln, NE, 68588, USA
b
Department of Biochemistry, University of Nebraska-Lincoln, Lincoln, NE, 68588, USA
c
Department of Agronomy and Horticulture, University of Nebraska-Lincoln, Lincoln, NE, 68588, USA
d
Department of Food Science and Technology, University of Nebraska-Lincoln, Lincoln, NE, 68588, USA
e
Systems and Innovations for Breeding and Seed Products, Corteva Agriscience, Johnston, IA, 50131, USA
f
USDA-ARS Plant Genetics Research Unit, Donald Danforth Plant Science Center, 975 North Warson Road, St. Louis, Missouri, 63132, USA
g
National Key Laboratory of Crop Genetic Improvement and College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, 430070, China

ARTICLE INFO ABSTRACT

Keywords: Soybean seeds produce oil enriched in oxidatively unstable polyunsaturated fatty acids (PUFAs) and are also a
Vitamin E potential biotechnological platform for synthesis of oils with nutritional omega-3 PUFAs. In this study, we en-
Tocochromanol gineered soybeans for seed-specific expression of a barley homogentisate geranylgeranyl transferase (HGGT)
Tocopherol transgene alone and with a soybean γ-tocopherol methyltransferase (γ-TMT) transgene. Seeds for HGGT-ex-
Tocotrienol
pressing lines had 8- to 10-fold increases in total vitamin E tocochromanols, principally as tocotrienols, with
Oilseed
little effect on seed oil or protein concentrations. Tocochromanols were primarily in δ- and γ-forms, which were
Antioxidant
Homogentisate geranylgeranyl transferase shifted largely to α- and β-tocochromanols with γ-TMT co-expression. We tested whether oxidative stability of
Soybean conventional or PUFA-enhanced soybean oil could be improved by metabolic engineering for increased vitamin
E antioxidants. Selected lines were crossed with a stearidonic acid (SDA, 18:4Δ6,9,12,15)-producing line, resulting
in progeny with oil enriched in SDA and α- or γ-linoleic acid (ALA, 18:3Δ9,12,15 or GLA, 18:3Δ6,9,12), from
transgene segregation. Oil extracted from HGGT-expressing lines had ≥6-fold increase in free radical scavenging
activity compared to controls. However, the oxidative stability index of oil from vitamin E-enhanced lines was
~15% lower than that of oil from non-engineered seeds and nearly the same or modestly increased in oil from
the GLA, ALA and SDA backgrounds relative to controls. These findings show that soybean is an effective
platform for producing high levels of free-radical scavenging vitamin E antioxidants, but this trait may have
negative effects on oxidative stability of conventional oil or only modest improvement of the oxidative stability
of PUFA-enhanced oil.

1. Introduction polyunsaturated fatty acids (PUFAs) such as linoleic acid (~55% of

total fatty acids) and α-linolenic acid (~13% of total fatty acids)
Soybean oil is the world's second most consumed vegetable oil (Clemente and Cahoon, 2009). These fatty acids are prone to oxidation
(USDA ERS, 2019). Conventional soybean oil is rich in the and are undesirable for frying and other food processing applications

Abbreviations: HGGT, homogentisate geranylgeranyl transferase; HPT, homogentisate phytyltransferase; γ-TMT, γ-tocopherol/tocotrienol methyltransferase; ALA,
α-linolenic acid; GLA, γ-linolenic acid; SDA, stearidonic acid; PUFA, polyunsaturated fatty acid
∗
Corresponding author. Center for Plant Science Innovation & Department of Biochemistry, E318 Beadle Center, University of Nebraska-Lincoln, Lincoln, NE,
68588, USA.
E-mail address: ecahoon2@unl.edu (E.B. Cahoon).
1
Present address: The School of Plant Sciences, 1140 E. South Campus Drive, P.O. Box 210036, 303 Forbes Building, University of Arizona, Tucson, AZ 85721-
0036.

https://doi.org/10.1016/j.ymben.2019.10.005
Received 28 August 2019; Accepted 17 October 2019
Available online 23 October 2019
1096-7176/ © 2019 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
A.R. Konda, et al.
and for bio-fuels and bio-based lubricants (Danaei et al., 2009; Moser
et al., 2007). The suboptimal oxidative stability of soybean oil has
largely been addressed by development of high oleic acid/low PUFA
germplasm through suppression or mutation of FAD2 genes for the Δ12
oleic acid desaturase (Hammond and Fehr, 1983; Wilcox and Cavins,
1985; Flores et al., 2008; Mazur et al., 1999; Buhr et al., 2002; Graef
et al., 2009). Nevertheless, conventional soybean oil provides essential
polyunsaturated fatty acids for human nutrition. Soybean has also been
the target of biotechnological efforts to produce oils rich in nu-
traceutical-type fatty acids, including γ-linolenic acid (18:3Δ6,9,12, GLA)
and omega-3 fatty acids, including stearidonic acid (18:4Δ6,9,12,15,
SDA), eicosapentaenoic acid (20:5Δ5,8,11,14,17, EPA), and docosahex-
aenoic acid (22:6Δ4,7,10,13,16,19, DHA) (Eckert et al., 2006; Kinney et al.,
2004; Park et al., 2017). These modifications result in oils that have
lower oxidative stability than conventional soybean oil and promote
increased rancidity and associated off-flavors for food products. Oxi-
dative stability of these PUFA-enriched oils can be enhanced by addi-
tion of chemical antioxidants following extraction. Alternatively, bio-
fortification of PUFA-enriched seeds with lipid-soluble vitamin E
antioxidants may confer increased oil stability.
Enhancement of vitamin E tocochromanol concentrations in soy-
bean is feasible given the extensive knowledge of the biosynthetic
pathways for tocotrienols and tocopherols that comprise the two classes
of vitamin E antioxidants in plants. Tocotrienols and tocopherols differ
only in the degree of unsaturation of the isoprenoid-derived hydro-
carbon tail of these molecules (Fig. S1). The hydrocarbon tail of toco-
pherols is fully saturated, whereas the hydrocarbon tail of tocotrienols
contains three trans-double bonds (Kamal-Eldin and Appelqvist, 1996;
Hunter and Cahoon, 2007). The most effective single gene approach for
enhancement of total vitamin E antioxidants to date has been the ex-
pression of the monocot homogentisate geranylgeranyl transferase
(HGGT) (Cahoon et al., 2003). This enzyme catalyzes the condensation
of geranylgeranyl diphosphate and homogentisate, the first and com-
mitted step in the biosynthesis of tocotrienols (Cahoon et al., 2003;
Yang et al., 2011). Embryo-specific expression of barley HGGT in maize
was shown to increase total vitamin E amounts by ≤6-fold, primarily as
tocotrienols (Cahoon et al., 2003). In addition, seed-specific expression
of this enzyme in Arabidopsis yielded a five-fold increase in total vi-
tamin E tocochromanols (Zhang et al., 2013). Beyond HGGT expression,
vitamin E antioxidant increases of > 10-fold have been achieved in
soybean by introduction of multiple transgenes, including microbial
genes that bypass regulated steps in homogentisate production
(Karunanandaa et al., 2005). In addition, alterations in composition of
tocotrienols and tocopherols can be conferred by expression of VTE3
encoding 2-methyl-6 phytyl/geranylgeranyl-benzoquinol methyl-
transferase and VTE4 encoding γ-tocopherol/tocotrienol methyl-
transferase (Shintani and DellaPenna, 1998; Van Eenennaam et al.,
2003; Kim et al., 2005; Tavva et al., 2007; Arun et al., 2014). These
enzymes catalyze methylation of the aromatic head group of toco-
pherols and tocotrienols and are thus responsible for the relative dis-
tribution of α-, β-, γ-, and δ- forms of these molecules. Variations in
amounts of each of these forms can affect the relative nutritional and
antioxidant qualities of vegetable oils (Van Eenennaam et al., 2003).
Soybean seeds are rich sources of vitamin E tochromanols with ty-
pical concentrations of 250–350 μg/g seed weight (Almonor et al.,
1998; Van Eenennaam et al., 2003). Vitamin E tocochromanols occur
almost exclusively as tocopherols in soybean seeds, and ~60% is in the
γ-tocopherol form, with the remainder of the tocopherol in the δ-
(~30%), α- (5%), and β- (1%) forms (Van Eenennaam et al., 2003).
Soybean oil distillate is one of the primary commercial sources of to-
copherols, which are widely used as chemical antioxidant additives in
foods, nutraceuticals, and cosmetics and other personal care products
(Burdock, 1997). Tocopherols and tocotrienols function as antioxidants
by quenching lipid peroxy radicals, such as those formed from PUFA
oxidation. Alpha-tocopherol is considered to be the most health-pro-
moting tocopherol form because it is more readily absorbed and
64
Metabolic Engineering 57 (2020) 63–73
retained by mammalian cells compared to the less methylated γ-, β-,
and δ-forms (Kamal-Eldin and Appelqvist, 1996). However, γ- and δ-
tocopherols and especially γ- and δ- tocotrienols have been shown to
confer the greatest degree of oxidative stability to vegetable oils when
exposed to prolonged high temperatures for food frying (Wagner and
Elmadfa, 2000; Wagner et al., 2001; Warner et al., 2003). Conversely,
supplementation of vegetable oils with high concentrations of toco-
pherols or tocotrienols, has been shown to promote oxidation (Evans
et al., 2002; Huang et al., 1995; Dolde et al., 2011a, b). The pro-oxidant
effect of tocochromanols on vegetable oils has been observed to be most
significant with the α-form of tocopherols and tocotrienols (Cillard
et al., 1980; Wagner and Elmadfa, 2000; Dolde and Wang, 2011b). In
addition to their roles as antioxidants, tocotrienols have been shown to
have health-promoting properties. These include the demonstrated
roles of tocotrienols, as dietary cholesterol lowering molecules (Qureshi
et al., 1986, 1991; Pearce et al., 1992), cancer cell growth inhibitors
(Nesaretnam et al., 1998; Ling et al., 2012; Aggarwal et al., 2019), and
UV-radiation protectants (Webber et al., 1997).
In this report, we tested the ability of expression of the barley HGGT
gene to enhance vitamin E tocochromanol concentrations of soybean
seeds. We also examined the efficacy of seed-specific co-expression of
barley HGGT and soybean VTE4 for γ-tocopherol/tocotrienol methyl-
transferase to alter tocochromanol concentrations and composition
(Fig. 1).
The resulting lines were evaluated under field conditions for per-
formance of traits linked to the vitamin E transgenes and their effect on
seed oil and protein content. Enhanced vitamin E lines were crossed
into a previously described high SDA soybean line (SDA-1) containing
unlinked transgenes for the borage Δ6 desaturase and Arabidopsis FAD3
Δ15 desaturase (Eckert et al., 2006). The progeny with enhanced vi-
tamin E composition combined with segregating high GLA, ALA and
SDA oil traits were used to measure the effects of vitamin E traits on
free radical scavenging and oil oxidative stability.
2. Materials and methods
2.1. Plant material
Transgenic stearidonic acid-rich soybean line (SDA-1/535-9) was
developed by re-transformation of transgenic line (420-5) with vector
pPTN382 harboring Arabidopsis Δ15 desaturase, as reported in Eckert
et al. (2006). The line (420-5) was generated by Agrobacterium trans-
formation of soybean genotype NE3001 (University of Nebraska-Lin-
coln) with borage Δ6 desaturase and was reported by Sato et al. (2004).
As wild type controls, Jack and Thorne (Ohio State University, Co-
lumbus) were used. All lines were field-grown at the University of
Nebraska-Lincoln Plant Biotechnology Field Facility, Eastern Nebraska
Research & Education Center, Mead, Nebraska during the 2016 growing
season for data reported here.
2.2. Vector construction for expression of barley HGGT and soybean γ-TMT
genes
The open-reading frame for the barley HGGT was amplified by PCR
to introduce flanking NotI sites using the full-length cDNA as template
and the forward and reverse oligonucleotide primers: 5′-ATTGCGGCC
GCGAAGGATGCAAGCCGTCACGGCCGCCGCCGCG-3′ and 5′- ATAAGC
GGCCGCTTGTACAAATTTCACTGCACAAATG-3’ (introduced NotI sites
underlined). A silent point mutation was introduced in the forward
primer to remove a NotI site present in the coding sequence. The se-
quence-verified PCR product was cloned into NotI sites of the vector
pBetaConHyg behind the strong seed specific promoter of the gene for
α′- subunit of β-conglycinin (Doyle et al., 1986) and was designated
pBetaConHyg-HGGT. In addition to the promoter sequence, pBeta-
ConHyg-HGGT also contains the 3′UTR of the α′- subunit of β-conglycinin
gene at 3′ end of the cDNA insert. This vector contains an ampicillin
A.R. Konda, et al.
resistance gene for bacterial selection and also contains a gene for hy-
gromycin B phosphotransferase placed under control of the potato
(Solanum tuberosum) ubiquitin-3 promoter and 3′UTR for transgenic
event selection. The vector pGly/SoyTMT for seed-specific expression of
a transgene for soybean γ-TMT was generated by PCR amplification
using first strand cDNA from developing soybean seeds as template and
the forward and reverse oligonucleotide primers: 5′- TTTTGCGGCCGC
ACATGGCCACCGTGGTGAGG-3′ and 5′- TTTTGCGGCCGCCATTTATTC
AGGTTTTCGACATGTAATG-3’ (introduced NotI sites underlined). The
sequence-verified PCR product was cloned into the NotI site of the
vector pKMS3 (Nguyen et al., 2013), resulting in the γ-TMT sequence
flanked on its 5′ and 3′ ends by the strong seed-specific glycinin-1 pro-
moter (Doyle et al., 1986) and glycinin-1 3′ UTR. This vector (pGly/
SoyTMT) contains an ampicillin resistance gene for bacterial selection
and lacked a resistance gene for selection of transgenic plants.
2.3. Soybean transformation
Somatic embryos of soybean (Glycine max cv. Jack) were trans-
formed with expression constructs containing the cDNA for barley
HGGT and the cDNA for the soybean γ-TMT using particle bombard-
ment as described previously (Finer and McMullen, 1991; Cahoon et al.,
1999). The experiments involving the co-expression of cDNAs for barley
HGGT and soybean γ-TMT were carried out by simultaneously bom-
barding soybean somatic embryos with plasmids pBetaConHyg-HGGT
and pGly/SoyTMT at an approximate molar ratio of 10:1. Transgenic
embryo sectors were selected for hygromycin resistance and propagated
in a liquid soybean histodifferentiation and maturation medium
(SHaM) as described (Schmidt et al., 2005). Extracts from hygromycin-
resistant, mature somatic embryos were analyzed by HPLC for toco-
trienol production and for α- and β-tocotrienol production in the case of
pBetaConHyg-HGGT and pGly/SoyTMT co-bombardment experiments.
Trait positive somatic embryos were desiccated and germinated to
65
Metabolic Engineering 57 (2020) 63–73
Fig. 1. Vitamin E tocotrienol biosyn-
thetic pathway in plants. Red arrows
indicate enzymes that were introduced
(homogentisate geranylgeranyl trans-
ferase, HGGT) to confer enhanced to-
cochromanol and tocotrienol produc-
tion and up-regulated (γ-tocopherol/
tocotrienol methyltransferase; γ-TMT
or VTE4) for increased production of α-
and β-vitamin E tocochromanols in
soybean seeds. (For interpretation of
the references to color in this figure
legend, the reader is referred to the
Web version of this article.)
regenerate whole plants as described (Finer and McMullen, 1991). In-
tegration of transgenes such as barley HGGT and soybean γ-TMT used
in the transformation events was confirmed by PCR amplification of
genomic DNA with gene-specific primers. Selected transgenic events
with increased vitamin E content and composition were advanced to
next generation in the greenhouse with 10 h photoperiod, with a day
and night temperature of 29 °C and 24 °C respectively. Plants were ad-
vanced to homozygosity for the selected traits and were used in genetic
crossing experiments.
2.4. Soybean genetic crossing and gene stacking
To generate soybean lines with high vitamin E and high SDA, ge-
netic crosses were made between single homozygous transgenic male
parent SDA-1 containing borage Δ6 and Arabidopsis Δ15 desaturase
genes, developed by Eckert et al. (2006) and three homozygous trans-
genic female parents (VE-1/488-3, VE-2/574-4 and VE-TMT-1/774-13)
developed in the present study with expression of barley HGGT and
barley HGGT/soybean γ-TMT, respectively. The progeny lines were
grown to the T6 generation under greenhouse conditions.
2.5. Southern blot analysis and gene-specific PCR
Southern blot was done on wild type, SDA and all the transgenic
vitamin E parent and progeny lines to confirm the stable integration
and copy number of HGGT, γ-TMT, Δ6 and Δ15 desaturase genes. Total
genomic DNA was isolated from homozygous plants of both the parent
and progeny, wild type Jack and Thorne soybean lines following a
modification of the protocol described by Dellaporta et al. (1983).
Genomic DNA was digested with restriction enzymes EcoRV and sepa-
rated on 0.8% agarose gels. The gels were processed and transferred to
a nylon membrane (Zeta probe GT; Bio-Rad, Hercules, CA, USA) fol-
lowing standard procedures (Sambrook et al., 1989). Membranes were
A.R. Konda, et al.
then hybridized with HGGT, γ-TMT, borage Δ6 and Arabidopsis Δ15
desaturase open reading frame probes. The probes were labelled with
radioactive [α-32P]-deoxycytidine triphosphate ([α-32P]-dCTP) by
random prime synthesis using Stratagene's Prime It II Kit (Stratagene,
La Jolla, CA, USA), following the manufacturer's protocol. Membranes
were pre-hybridized in 1.0 M Na2HPO4 (pH 7.2), 20% sodium dodecyl
sulfate (SDS), 0.5M EDTA, pH 8 and 1% (w/v) bovine serum albumin
(BSA) solution and washed twice with 5% SDS, 40 mM Na2HPO4, fol-
lowed by a single wash with 1% SDS, 40 mM Na2HPO4 and all washing
steps were carried at 65 °C. After phosphorimaging for detection of
radioactive signals, the membranes were stripped and reused to probe
with other genes. Using the same genomic DNA, gene-specific PCR
amplification of transgenes was performed in all the events using pri-
mers shown in Table S1 to amplify the HGGT, TMT, Δ6 desaturase and
Δ15 desaturase. PCR amplification was performed under standard con-
ditions using Phusion DNA polymerase.
2.6. HPLC analysis of tocochromanol content and composition
Vitamin E tocochromanols were separated and analyzed using re-
verse- and normal-phase HPLC from extracts of freshly ground, bulked
seeds collected from field-grown soybean lines. Using HPLC with
fluorescence detection all tocochromanols were quantified relative to
the known amount of internal standard 5, 7-dimethyltocol (Matreya,
www.Matreya.com). Tocochromanol extraction was done by homo-
genization of ~30 mg seed material in 2 mL of methanol/di-
chloromethane (9:1 v/v) and prior to homogenization 100 μL of the
internal standard was added at a concentration of 100 ng/μL. Reverse-
phase HPLC analysis was conducted as previously described (Yang
et al., 2011; Zhang et al., 2013). The extract was also dried under N2
and dissolved in 1 mL of hexane for normal-phase HPLC analysis as
previously described (Siles et al., 2013 and Tan and Brzuskiewicz,
1989) using a solvent system of 5% dioxane and 95% hexane at a
continuous flow rate of 1.5 mL/min for 20 min for separation of β- and
γ-forms of tocochromanols. All tocopherols and tocotrienols were re-
solved on normal phase Spherisorb Silica column (4.6 × 250 mm
length; 5 μm particle size, COBERT Associates, XPERTEK ™) and
quantified by using fluorescence detector (excitation at 292 nm; emis-
sion at 335 nm) and using response factors determined for each toco-
pherol and tocotrienol form.
2.7. Fatty acid analysis
Seeds were ground and 30–35 mg portions were weighed in
13 × 100 mm screw-cap glass tubes. To each tube, 1.5 mL of 2.5% (v/v)
sulfuric acid in methanol with (0.01% w/v BHT) and 400 μL of toluene
were added. Before homogenization, 200 μl of tri-heptadecanoin (tri-
17:0 triacylglycerol) internal standard (Nu-Chek Prep, MN) at a con-
centration of 10 mg/mL in toluene was added. The tubes were blown
with nitrogen, tightly capped and heated at 90 °C for 1.5 h. Fatty acid
methyl esters were extracted and analyzed by gas chromatography with
flame ionization detection as described (Cahoon et al., 2006b). Oil
quantification was done by comparing detector response from the
sample derived fatty acid methyl esters relative to methyl heptade-
canoate from the tri-17:0 internal standard.
2.8. Total antioxidant capacity measurement
The total antioxidant capacity of the oils from field-grown parent
and progeny lines was determined using 2,2′-azino-bis (3-ethylben-
zothiazoline-6-sulphonic acid) (ABTS•+) free radical scavenging assay
adapted from Wang et al. (2017) and Castelo-Branco et al. (2015). This
colorimetric method measures antioxidant-mediated loss of color from
a free ABTS cation radical (ABTS•+)-containing solution by monitoring
at 734 nm using UV–Vis spectrophotometer. To generate free radical
cation (ABTS•+), potassium persulfate was dissolved at an overall
66
Metabolic Engineering 57 (2020) 63–73
concentration of 2.45 mM in the aqueous solution of 7 mM ABTS. The
mixture (ABTS•+) was allowed to stand in the dark at 25 °C for at least
12 h before every use. The ABTS•+ solution was then diluted with
ethanol to achieve an absorbance of 0.70 ( ± 0.01) cm−1 at 734 nm and
equilibrated at ambient temperature for 30 min. For the assay, 200 μL of
the 10 mg/mL oil in n-hexane was added to 1.5 mL of ABTS•+solution
previously diluted with ethanol. The mixture was incubated in the dark
at room temperature for 6 min. The mixture of 200 μL of n-hexane and
1.5 mL of the diluted ABTS•+ solution was used as control. The absor-
bance was then recorded at 734 nm using a UV–Visible Spectro-
photometer (Evolution 201, ThermoFisher, Waltham, MA, USA). Each
measurement was conducted in triplicate and the scavenging of the free
radical was calculated according to the following equation:
Absorbance of control Absorbance of sample
Scavenging activity (%) =
Absorbance of control
× 100
2.9. Oxidative stability index (OSI) measurement
Cold pressed oil was extracted from the field-grown-bulked seed of
parent and progeny lines using a mechanical press (AgOilPress,
Mondovi, WI). For every kilogram of seed pressed, approximately
100 mL of crude oil was collected. Immediately after the extraction, oil
was centrifuged at 3000×g for 15 min. The clarified oil was capped
under N2 and kept at −20 °C for long term storage and further analysis.
The oxidative stability index (OSI) of the extracted oils was measured at
the Iowa Central Fuel Testing Laboratory, Fort Dodge, Iowa. The soy-
bean oil OSI values were measured according to the EN15751 method
(European Committee for Standardization, 2014) using a Metrohm 892
Professional Rancimat (Herisau, Switzerland). The oils (7.5 ± 0.1 g)
were heated at 110 °C under an oxygen flow rate of 10 L/h. Three in-
dependent samples were measured for each oil sample.
3. Results
3.1. Seed specific expression of barley HGGT alone and in combination with
soybean γ-TMT
Transgenic soybean lines in the Jack cultivar were generated by
introduction of the barley HGGT transgene under control of the strong
seed-specific promoter of the gene for α′-subunit of β-conglycinin.
Biolistic transformation of somatic embryos was conducted with the
transgene linked to a hygromycin-resistance gene. Initially, five in-
dependent hygromycin-resistant embryo lines were selected and con-
firmed by HPLC analysis to produce tocotrienols, which were not de-
tected in non-transformed embryos. Selected somatic embryo lines were
regenerated to obtain seeds. Of these five events, we focused on 488-3,
designated as “VE-1” and 574-4, designated as “VE-2” (Table 1).
Experiments were conducted in parallel to not only increase toco-
chromanol concentrations but to also alter tocochromanol composition
by co-transformation of somatic embryos with two plasmids: one con-
taining the seed-specific transgene for barley HGGT and hygromycin
resistance gene and the second containing a transgene for soybean γ-
TMT under control of seed-specific promoter for the glycinin-1 gene. Of
the selected three events, we focused on regeneration of 774-13, de-
signated as “VE-TMT-1” that produced tocotrienols and had elevated
amounts of α- and β-tocotrienols and tocopherols relative to VE-1 and
VE-2 embryos, consistent with the activity of γ-TMT (Table 1). These
traits were also confirmed in seeds of regenerated plants. Transgenic
events were taken to homozygosity and propagated over > five gen-
erations under greenhouse conditions. VE-1 and VE-2 were confirmed
by Southern blot analysis to contain ≥three copies of the HGGT
transgene. Also, the event VE-TMT-1 was confirmed to have one copy of
HGGT and likely two copies of the transgene for γ-TMT, in addition to
A.R. Konda, et al. Metabolic Engineering 57 (2020) 63–73

Table 1
Description and genetic compositions of transgenic parent and progeny events used or developed in this study.
Line Number Line ID Genetic Background Phenotype Transgenes

Barley Soybean ϒ-TMT Borage Δ6 Arabidopsis Δ15

HGGT Desaturase Desaturase

Parents
488–3 VE-1 Jack High Vitamin E +
574–4 VE-2 Jack High Vitamin E +
774–13 VE-TMT-1 Jack High Vitamin E/High α-/β- + +
tocochromanols
535–9 SDA-1 420–5 High SDA + +
Progeny
9-67-2 GLA-1 VE-1 X SDA-1 High GLA – + –
9-67-1 VE-GLA-1 VE-1 X SDA-1 High Vitamin E/High GLA + + –
3-3-1 ALA-1 VE-2 X SDA-1 High ALA – – +
3-3-4 VE-ALA-1 VE-2 X SDA-1 High Vitamin E/High ALA + – +
3-6-12 VE-SDA-1 VE-2 X SDA-1 High Vitamin E/High SDA + + +
5-2-6 VE-TMT- VE-TMT-1 X SDA-1 High Vitamin E/High α-/β- + + + +
SDA-1 tocochromanols/High SDA
5–22 VE-TMT- VE-TMT-1 X SDA-1 High Vitamin E/High α-/β- + + + –
GLA-1 tocochromanols/High GLA

Line No; refers to the respective parent and progeny line numbers, Line ID; refers to descriptive names for lines, Genotype; refers to genetic background of each line,
Phenotype; refers to the vitamin E and fatty acid phenotype; (+) for presence and (−) for no expression due to segregation of respective transgenes.

VE-2, nearly 85% of the total vitamin E tocochromanols accumulated as

Fig. 2. Gene-specific PCR validation of transgenes in soybean events. Jack and
Thorne are non-transgenic backgrounds. From top to bottom, Panel 1; Gene-
specific PCR amplification of HGGT transgene from transgenic high vitamin E
lines (VE-1, VE-2 and VE-TMT-1) and from the progeny lines (VE-GLA-1, VE-
ALA-1, VE-SDA-1, VE-TMT-SDA-1 and VE-TMT-GLA-1). Panel 2; PCR amplifi-
cation of γ-TMT transgene from high vitamin E line (VE-TMT-1) and progeny
lines (VE-TMT-SDA-1 and VE-TMT-GLA-1), co-expressing γ-TMT/barley HGGT.
Panel 3 and 4; PCR amplification of Δ6 and Δ15desaturase transgenes from SDA-
1 and from the segregating (GLA-1, ALA-1, VE-GLA-1, VE-ALA-1 and VE-TMT-
GLA-1) and non-segregating (VE-SDA-1 and VE-TMT-SDA-1) progeny. Plasmids
containing HGGT, γ-TMT, Δ6 and Δ15desaturase genes were used as positive
controls. PCR reactions lacking added DNA were used as negative controls. PCR
reactions were conducted using genomic DNA as template. Figures are derived
from transillumination of ethidium bromide-stained agarose gels.
multiple copies of the native γ-TMT gene in the non-transformed con-
trols (Fig. S2). In addition, VE-1 and VE-2 plants were found to express
the HGGT transgene and VE-TMT1 plants expressed HGGT and the γ-
TMT transgenes, based on gene specific-PCR analysis (Fig. 2).
Seed compositional analyses were conducted on plants grown in
field plots under standard agronomic conditions in eastern Nebraska.
Seeds from VE-1 and VE-2 accumulated total vitamin E tocochromanols
up to ~2,600 μg/g and ~2,800 μg/g seed dry wt. These concentrations
were ~10-fold higher than those detected in seeds from the non-
transformed Jack background (266 μg/g seed wt). In seeds of VE-1 and
tocotrienols, which were not detected in non-transformed Jack seeds.
Tocopherol concentrations were also increased, but by only ~50% in
VE-1 and VE-2 seeds relative to Jack seeds (Fig. 3).
VE-1 and VE-2 seeds produced tocotrienols primarily in the δ- and γ-
tocotrienols, which comprised 64% and 21% of the total tocochroma-
nols, respectively, with no detectable β- tocotrienols. Also, relative
amounts of δ- tocopherol were increased by two- to three-fold in VE-1
and VE-2 seeds (Table 2).
VE-TMT-1 seeds had tocochromanol phenotypes consistent with the
co-expression of HGGT/γ-TMT transgenes. Total tocochromanols accu-
mulated in VE-TMT-1 seeds to amounts of 1664 μg/g of seed wt, which
is ~7-fold higher than those detected in seeds from the non-trans-
formed Jack background (266 μg/g seed dry wt). Tocotrienols com-
prised as much as 89% of the total vitamin E content in these seeds
(Fig. 3). Also in VE-TMT-1 seeds, α- and β-tocotrienols accumulated to
up to 187 and 739 μg/g seed wt respectively, which were not detected
in non-transformed Jack seeds. Along with the increased α- and β-to-
cotrienols, VE-TMT-1 seeds also displayed increased accumulation of α-
and β-tocopherol contents up to ~7- and 38-fold, respectively, com-
pared to non-transformed Jack seeds. In total, α- and β- tocopherols and
tocotrienols accounted for ~66% of the total vitamin E tocochroma-
nols, which were present in trace amounts in seeds of soybean en-
gineered with HGGT alone (Table 2).
3.2. Effects of tocochromanol biofortification on seed oil and protein
Analysis of the fatty acid composition of VE-1, VE-2 and VE-TMT-1
seeds revealed increased oleic acid (18:1) content by 30%–50% in the
transgenic events relative to that of the Jack control seeds (Table 3).
These increases were compensated by overall reductions in the poly-
unsaturated fatty acid (linoleic acid, 18:2; α-linolenic acid, 18:3) con-
tent in seeds of the tocochromanol bio-fortified seeds compared to Jack
seeds (Table 3).
In addition, NIR analysis of seeds from the transgenic lines showed
nearly comparable protein concentrations and small increases in total
oil content relative to Jack seeds (Fig. 4).
3.3. Introgression of transgenic high vitamin E trait into high PUFA soybean
lines
The availability of soybean lines with modified tocochromanol

67
A.R. Konda, et al. Metabolic Engineering 57 (2020) 63–73

Fig. 3. Total tocochromanol, tocopherol, and toco-

trienol concentrations of bulked seeds of soybean
events. Events: Jack and Thorne (non-transgenic),
SDA-1 (transgenic male parent), GLA-1, ALA-1 (seg-
regating progeny), VE-1, VE-2, VE-TMT-1 (trans-
genic female parents) and VE-GLA-1, VE-ALA-1, VE-
SDA-1, VE-TMT-SDA-1, VE-TMT-GLA-1 (introgres-
sion progeny) of respective crosses, as described in
Table 1 and shown in Fig. 5. Values are means ± SD
of analyses of five independent samples. Means,
standard deviation, and significance were calculated
using Tukey-Kramer HSD. Means followed by the
same letter are not significantly different from each
other (α = 0.05). Capital letters are used for toco-
pherol concentration significance, small letters for
total tocochromanol concentration significance, and
bold, capital letters are used for total tocotrienol
concentration significance.

content and composition enabled experiments to examine the effects of
these traits on oxidative stability of seed oil, including oils engineered
for enhanced polyunsaturated fatty acid content. For these experiments,
we crossed VE-1, VE-2, and VE-TMT-1 lines with a previously described
high stearidonic acid line (SDA-1), with seeds containing oil with ~27%
stearidonic acid and 7% GLA (Eckert et al., 2006, Fig. 5).
SDA-1 was a re-transformation event with unlinked transgenes for
borage Δ6 and Arabidopsis Δ15 desaturases. The resulting progeny in-
cluded those that segregated separately for each of these transgenes
that accumulated GLA (from the borage Δ6 desaturase) or ALA (from
the Arabidopsis Δ15 desaturase). Seed compositional analysis of the
homozygous progeny revealed altered fatty acid and vitamin E phe-
notypes and based on these phenotypes, these lines were designated as
follows (Table 1): line 9-67-2 with high GLA content was designated as
“GLA-1” and line 3-3-1 with high ALA content was designated as “ALA-
1”. Similarly, progeny lines 9-67-1 and 3-3-4 with high vitamin E/high
GLA and high vitamin E/high ALA were designated as “VE-GLA-1” and
“VE-ALA-1”, respectively. The progeny lines 3-6-12 and 5-2-6 with high
vitamin E/high SDA and high vitamin E/high α- and β-tocochroma-
nols/high SDA are designated as “VE-SDA-1” and “VE-TMT-SDA-1”
respectively. The progeny line 5–22 with high vitamin E tocochroma-
nols/high α- & β-tocochromanols/high GLA was designated as “VE-
TMT-GLA-1” (Table 1). In all the progeny lines, transgene expression
was confirmed by gene specific PCR amplification (Fig. 2) and the ge-
netic integrity of the locus by Southern blotting (Fig. S2). These results
indicated that in some of the progeny lines during genetic recombina-
tion the transgenes were segregated and had only one to four transgenes
(Table 1). Lines GLA-1 and ALA-1 had no HGGT transgene and had only
one copy of Δ6 and Δ15 desaturase transgenes, respectively (Fig. S2).
The line VE-GLA-1 showed multiple copies of HGGT gene similar to
parent VE-1 and one copy of Δ6 desaturase and no copy of Δ15 desa-
turase. Similarly, VE-ALA-1 and VE-SDA-1 had multiple copies of
HGGT, like parent VE-2, and VE-ALA-1 had one copy of Δ15 desaturase
gene and had no copy of Δ6 desaturase. VE-SDA-1 had one copy each of
genes for the Δ6 and Δ15 desaturases. VE-TMT-SDA-1 had single copy of
transgenes for HGGT and Δ6 and Δ15 desaturases and two copies of the
transgene for γ-TMT. VE-TMT-GLA-1 had single copy of transgenes for
HGGT, Δ6 desaturase and two copies of the transgene for γ-TMT (Fig. S2
and Table 1).
Metabolite analysis of the plants was performed using seeds from
lines grown in the field plots under standard agronomic conditions.
Progeny lines VE-GLA-1, VE-ALA-1, VE-SDA-1, VE-TMT-SDA-1 and VE-
TMT-GLA-1 showed increases in total tocochromanol concentrations.
However, progeny lines GLA-1 and ALA-1, lacking the HGGT transgene,
had no increase in total vitamin E tocochromanol concentrations
(Fig. 3, Table 2). In VE-GLA-1, VE-ALA-1 and VE-SDA-1 lines the total
vitamin E content accumulated up to 2728, 3179 and 3287 μg/g seed
wt, respectively (Table 2). These concentrations correspond to 7- to 10-
fold increase in total vitamin E content of seeds compared to those of
the SDA-1 parent and non-transformed lines. In the progeny,

Table 2
Total tocochromanol content and compositions of seeds from non-transgenic plants and transgenic parent and progeny.
Events/Form Tocotrienols (μg g-1 dry seed weight) Tocopherols (μg g-1 dry seed weight) Total Tocochromanols (μg g-1
seed dry wt)
δ- γ- β- α- Total δ- γ- β- α- Total

Jack ND ND ND ND ND 81 ± 3 173 ± 4 3 ± 0.6 9 ± 1.4 266 ± 14 266 ± 14

Thorne ND ND ND ND ND 106 ± 4 223 ± 4 4 ± 0.2 23 ± 0.4 356 ± 8 356 ± 8
SDA-1 ND ND ND ND ND 106 ± 3 293 ± 7 4 ± 0.1 18 ± 1 421 ± 11 421 ± 11
GLA-1 ND ND ND ND ND 103 ± 4 298 ± 4 3 ± 0.3 15 ± 0.6 419 ± 6 419 ± 6
ALA-1 ND ND ND ND ND 93 ± 1 304 ± 6 3 ± 0.5 14 ± 1 414 ± 5 414 ± 5
VE-1 1631 ± 121 539 ± 31 ND 11 ± 0.3 2181 ± 151 183 ± 10 191 ± 8 5 ± 0.3 12 ± 1 391 ± 24 2572 ± 169
VE-2 1780 ± 111 559 ± 23 ND 14 ± 1.3 2353 ± 133 218 ± 10 203 ± 4 7 ± 0.7 9 ± 0.6 436 ± 16 2790 ± 148
VE-TMT-1 499 ± 22 54 ± 9 739 ± 29 187 ± 11 1479 ± 56 9 ± 0.7 5 ± 0.7 112 ± 2 59 ± 3 243 ± 5 1664 ± 59
VE-GLA-1 1652 ± 84 543 ± 16 ND 19 ± 1.2 2214 ± 93 245 ± 7 249 ± 4 6 ± 0.5 14 ± 3 514 ± 16 2728 ± 100
VE-ALA-1 2084 ± 64 617 ± 17 ND 20 ± 1.6 2721 ± 78 235 ± 7 205 ± 4 8±1 10 ± 1 458 ± 13 3179 ± 88
VE-SDA-1 2135 ± 79 623 ± 27 ND 24 ± 1.6 2782 ± 105 265 ± 8 220 ± 8 8±1 12 ± 0.4 505 ± 16 3287 ± 121
VE-TMT- 341 ± 23 39 ± 4 892 ± 32 345 ± 14 1617 ± 61 4 ± 2.5 6 ± 1.5 156 ± 5 123 ± 7 289 ± 15 1906 ± 73
SDA-1
VE-TMT- 401 ± 19 57 ± 1.5 951 ± 36 483 ± 37 1892 ± 84 3 ± 1.1 4 ± 0.9 127 ± 4 144 ± 10 278 ± 13 2170 ± 78
GLA-1

Events: Jack and Thorne (non-transgenic), SDA-1 (transgenic male parent), GLA-1, ALA-1 (segregating progeny), VE-1, VE-2, VE-TMT-1 (transgenic female parents)
and VE-GLA-1, VE-ALA-1, VE-SDA-1, VE-TMT-SDA-1, VE-TMT-GLA-1 (introgression progeny) of respective crosses, as described in Table 1 and shown in Fig. 5.
Values are means ± SD of analyses of five independent samples. ND, not detected.

68
A.R. Konda, et al. Metabolic Engineering 57 (2020) 63–73

Table 3
Total fatty acid content (μg mg-1 seed wt) and composition (mol %) of seeds non-transgenic, transgenic parent and progeny soybean events.
Events/FA 16:0 18:0 18:1 Δ9 18:2 GLA 18:3 SDA Total fatty acid content (μg mg-1 seed weight)

Jack 12 ± 0.1 4 ± 0.1 19.6 ± 0.6 56.5 ± 0.6 ND 7.8 ± 0.3 ND 197 ± 1.2
Thorne 12.4 ± 0.5 3.9 ± 0.2 22.9 ± 0.4 53 ± 0.4 ND 7.9 ± 0.2 ND 208 ± 0.4
SDA-1 11.9 ± 0.1 3.4 ± 0.1 22.2 ± 0.2 4.7 ± 0.1 6.8 ± 0.1 24.4 ± 0.1 26.8 ± 0.2 218 ± 0.2
GLA-1 12.1 ± 0.2 4 ± 0.1 21.8 ± 0.5 29.7 ± 0.3 25 ± 0.5 4.8 ± 0.1 2.5 ± 0.1 224 ± 0.8
ALA-1 11.3 ± 0.1 3.3 ± 0.1 20.6 ± 0.6 10 ± 0.2 ND 54.9 ± 0.7 ND 215 ± 0.2
VE-1 11.3 ± 0.1 4.6 ± 0.1 26 ± 0.3 52 ± 0.2 ND 6.2 ± 0.1 ND 235 ± 0.2
VE-2 11 ± 0.1 5 ± 0.1 29.2 ± 0.4 49 ± 0.2 ND 6 ± 0.1 ND 225 ± 0.4
VE-TMT-1 11 ± 0.1 4.8 ± 0.1 30.7 ± 0.3 47.9 ± 0.2 ND 5.8 ± 0.1 ND 211 ± 0.6
VE-GLA-1 11.2 ± 0.1 4.5 ± 0.1 23.2 ± 0.1 29.9 ± 0.3 24.7 ± 0.2 4.5 ± 0.2 2 ± 0.1 233 ± 0.3
VE-ALA-1 10.7 ± 0.1 3.9 ± 0.1 27 ± 0.4 10.1 ± 0.6 ND 48.3 ± 0.4 ND 223 ± 0.1
VE-SDA-1 11.1 ± 0.1 3.7 ± 0.1 31 ± 0.4 4.6 ± 0.1 4.7 ± 0 24.9 ± 0.1 20.1 ± 0.3 228 ± 0.3
VE-TMT-SDA-1 11.2 ± 0.2 4 ± 0.1 28 ± 0.2 4.8 ± 0.3 6.5 ± 0.2 21.7 ± 0.3 23.9 ± 0.5 209 ± 0.5
VE-TMT-GLA-1 11.5 ± 0.1 3.7 ± 0.2 24 ± 0.8 28 ± 0.2 26.8 ± 0.8 4 ± 0.1 2.1 ± 0.1 219 ± 0.5

Events: Jack and Thorne (non-transgenic), SDA-1 (transgenic male parent), GLA-1, ALA-1 (segregating progeny), VE-1, VE-2, VE-TMT-1 (transgenic female parents)
and VE-GLA-1, VE-ALA-1, VE-SDA-1, VE-TMT-SDA-1, VE-TMT-GLA-1 (introgression progeny) of respective crosses, as described in Table 1 and shown in Fig. 5.
Values are means ± S.D of analyses of three independent samples. ND; not detected.

tocotrienols comprised 81–85% of the total seed vitamin E tocochro-
manols and mainly in δ- and γ-forms, which were not detected in seeds
from SDA-1 and non-transformed lines (Table 2). Apart from the to-
cotrienol increase, δ-tocopherol form was also increased by up to 2- to
3-fold in VE-GLA-1, VE-ALA-1 and VE-SDA-1 progeny lines compared to
SDA-1 and non-transformed lines (Table 2). Similarly, VE-TMT-SDA-1
and VE-TMT-GLA-1 seeds also showed an increase in total vitamin E
content up to 1906 and 2170 μg/g seed wt respectively (Fig. 3 and
Table 2). This is a 4.5- to 6- fold increase in tocochromanol con-
centration compared to seeds from SDA-1 parent and non-transformed
lines. Tocotrienols accounted for up to 85% of total tocochromanols.
Moreover, of the total tocochromanols, α- and β-tocotrienols comprised
up to 18–22% and 44–47%, respectively, and α- and β-tocopherols
accounted for up to 7% and 6–8%, respectively. This increased accu-
mulation of more methylated forms was due to overexpression of soy-
bean γ-TMT gene, which converts δ- and γ- forms into more methylated
β- and α- forms of tocotrienol/tocopherols, respectively. However, no
α- tocotrienol was detected in seeds of SDA-1 and non-transformed
lines, while < 1% of this tocochromanol form was detected in lines
expressing HGGT alone (Table 2).
3.4. Effects of tocochromanol biofortification on seed oil and protein in high
PUFA backgrounds
Seed fatty acid composition analysis of the progeny lines revealed
that GLA-1, VE-GLA-1 and VE-TMT-GLA-1 had GLA content of ≤27 mol
% of the total seed fatty acids. Progeny ALA-1 and VE-ALA-1 had ALA
content up to 48 and 55 mol%, respectively. The fatty acid profiles of
VE-SDA-1 and VE-TMT-SDA-1 seeds were similar to SDA-1 seeds, but
the SDA content was only 20 mol% and 24 mol% compared to 27 mol%
in SDA-1. In VE-ALA-1, VE-SDA-1 and VE-TMT-SDA-1 seeds, the oleic
acid (18:1) content was increased by 22–41% relative to that of SDA-1
and non-transformed seeds (Table 3). This increase was compensated
by overall reductions in the content of polyunsaturated fatty acids li-
noleic acid and α-linolenic acid in seeds of the tocochromanol bio-
fortified seeds compared to their respective controls ALA-1 and SDA-1
seeds (Table 3). In addition, NIR analysis of seeds from the progeny
lines showed nearly comparable protein concentrations and small in-
creases in total oil content relative to Jack and SDA-1 seeds (Fig. 4).
3.5. Antioxidant capacity of oils with enhanced vitamin E tocochromanols
in parental and high PUFA backgrounds
Experiments were performed to determine whether the increased
vitamin E content in the soybean oil improves the total antioxidant
capacity of the oil by scavenging free radicals produced during oil
oxidation. Seed oil was extracted from bulk harvested field-grown seeds
and tested for free radical scavenging activity using the 2,2′-azino-bis
(3-ethylbenzothiazoline-6-sulphonic acid) or ABTS method (Marc et al.,
2004), which spectrophotometrically measured the ability of oil

Fig. 4. Near Infrared (NIR) analysis of oil and pro-

tein content in seeds of soybean events. Events: Jack
and Thorne (non-transgenic), SDA-1 (transgenic
male parent), GLA-1, ALA-1 (segregating progeny),
VE-1, VE-2, VE-TMT-1 (transgenic female parents)
and VE-GLA-1, VE-ALA-1, VE-SDA-1, VE-TMT-SDA-
1, VE-TMT-GLA-1 (introgression progeny) of re-
spective crosses, as described in Table 1 and shown
in Fig. 5. Values are means ± SD of analyses of
three independent samples. Means, standard devia-
tion and significance were calculated using Tukey-
Kramer HSD. Means followed by the same letter are
not significantly different from each other
(α = 0.05). Capital letters are used for protein
concentration significance and non-capital letters
are used for oil concentration significance.

69
A.R. Konda, et al.
Fig. 6. ABTS free radical scavenging assay of oil extracted from bulked seeds of
soybean events. Events: Jack and Thorne (non-transgenic), SDA-1 (transgenic
male parent), GLA-1, ALA-1 (segregating progeny), VE-1, VE-2, VE-TMT-1
(transgenic female parents) and VE-GLA-1, VE-ALA-1, VE-SDA-1, VE-TMT-SDA-
1, VE-TMT-GLA-1 (introgression progeny) of respective crosses, as described in
Table 1 and shown in Fig. 5. Values are means ± SD of analyses of three in-
dependent samples. Means, standard deviation and significance were calculated
using Tukey-Kramer HSD. Means followed by the same letter are not sig-
nificantly different from each other (α = 0.05).
samples to convert the colored ABTS*+ cation radical to its neutral
state that lacks color. The assay measures the percentage of this con-
version conferred by antioxidants in the oil samples. Results showed
that the transgenic high vitamin E parents (VE-1, VE-2 and VE-TMT-1)
and the enhanced vitamin E lines in PUFA backgrounds (VE-GLA-1, VE-
ALA-1, VE-SDA-1, VE-TMT-SDA-1 and VE-TMT-GLA-1) had free radical
scavenging activity that was 6- to 9-fold and 8- to 13- fold higher than
that of seed oil from Thorne and Jack genotypes, respectively. Seed oil
from these also had similar increases in free radical scavenging activity
compared to seed oil from the SDA-1, GLA-1 and ALA-1 PUFA lines. In
these studies, the ABTS free radical scavenging of the vitamin E toco-
chromanol-enhanced oil samples ranged from 52% to 81%, whereas it
was 6%–13% in the oils from lines lacking tocochromanol enhancement
(Fig. 6).
The highest free radical scavenging activity was measured for oil
from the VE-TMT-1 line (~81%), while oil from other tocochromanol-
enhanced lines displayed activities ranging from 52% to 71%. Overall,
these results demonstrate that the high vitamin E trait is effective at
conferring increased antioxidant capacity to soybean oil, which sup-
ports its value of this trait for chemical antioxidant applications.
70
Metabolic Engineering 57 (2020) 63–73
Fig. 5. Schematic representation of introgression of
high vitamin E traits into transgenic SDA-1 soybean
event by genetic crossing. VE-1, VE-2 and VE-TMT-1
are the female parents and SDA-1 as male parent.
Introgression was done by crossing transgenic high
vitamin E lines expressing HGGT (VE-1, VE-2) and
co-expressing HGGT/γ-TMT (VE-TMT-1) with SDA
rich soybean line SDA-1, co-unlinked transgenes for
borage Δ6 and Arabidopsis Δ15 desaturases. (a) GLA-
1 and VE-GLA-1 are the progeny of a cross (VE-1 X
SDA-1). (b) ALA-1, VE-ALA-1, and VE-SDA-1 are the
progeny of a cross (VE-2 X SDA-1). (c) VE-TMT-
SDA-1 and VE-TMT-GLA-1 are the progeny of a
cross (VE-TMT-1 X SDA-1). GLA-1- and ALA-1-con-
taining lines resulted from segregation of the
transgenes for borage Δ6 and Arabidopsis Δ15 de-
saturases.
3.6. Oxidative stability indices of oils with enhanced vitamin E
tocochromanols in conventional oil and high PUFA-oil backgrounds
Experiments were conducted to assess the ability of enhanced vi-
tamin E traits to increase the oxidative stability of oil from our con-
ventional control genotypes (Jack and Thorne) and PUFA-enriched
germplasm (SDA-1, GLA-1, ALA-1). For these studies, the Oxidative
Stability Index (OSI) was measured for cold-pressed oil from seeds of
field-grown plants. OSI is value commonly used in industry to de-
termine the stability of oils against oxidation. The measurements were
conducted using an accelerated oxidative stability test that quantifies
the induction time or time required for the onset of detectable oil
oxidation products in samples heated at elevated temperatures in the
presence of excess oxygen. OSI analysis depends on the increase in
electrical conductivity, when effluent from oxidizing oils is passed
through water. Volatile carboxylic acids are generated in the oxidizing
oil and these cause the increase in electrical conductivity. The length of
time, measured in h, for the onset of oxidation is the OSI value for the
oil sample. A longer time reflects greater oxidative stability of the
sample.
OSI values measured for oil from non-transgenic Jack (7.6 h) and
Thorne seeds (7.8 h) was ~15% higher than OSI values measured for oil
from seeds of lines engineered for enhanced vitamin E concentrations
(VE-1, 6.7 h; VE-2, 6.5 h; VE-TMT-1, 6.5 h; Fig. 7) (p < 0.05).
Consistent with the degree and position of polyunsaturation, seed
oils from the PUFA-rich lines had significantly lower OSI values than oil
from non-transgenic seeds. Oil from stearidonic acid-rich SDA-1 seeds
had an OSI value of 1.1 h, oil from γ-linolenic acid (GLA)-rich GLA-1
seeds had an OSI value of 4.1 h, and oil from α-linolenic acid-rich ALA-
1 seeds had an OSI value of 2.8 h (Fig. 7). The combination of the high
vitamin E tocochromanol trait of VE-1 did not result in significant en-
hancement of OSI in VE-GLA-1 relative to the OSI of GLA-1 (p > 0.05).
The combination of the high vitamin E trait with increased α- and β-
tocochromanols resulted in no significant increase in OSI in the SDA-1
background (VE-TMT-SDA-1) and had a 32% decrease in OSI value in
the GLA-1 background (VE-TMT-GLA-1) compared to SDA-1 and GLA-
1, respectively (Fig. 7). Significant increases in OSI values were ob-
served in the oil with the combined VE-SDA-1 and VE-ALA-1
(p < 0.05). This included a 3-fold increase in OSI value of the seed oil
from VE-SDA-1 plants (3.3 h) compared to the seed oil from SDA-1
plants (1.1 h). However, it is notable that the overall polyunsaturation
of the seed oil from VE-SDA-1 and VE-ALA-1 was lower than that from
SDA-1 and ALA-1 parent lines (Table 3), which may account for the
higher OSI value in the VE-SDA-1 oil. Overall, these results indicate that
the high vitamin E tocochromanol traits negatively affect seed oils’
oxidative stability or marginally improve oxidative stability in the SDA-
1 and ALA-1 backgrounds.
A.R. Konda, et al.
Fig. 7. Oxidative Stability Index (OSI) of seed oils of soybean events. Events:
Jack and Thorne (non-transgenic), SDA-1 (transgenic male parent), GLA-1,
ALA-1 (segregating progeny), VE-1, VE-2, VE-TMT-1 (transgenic female par-
ents) and VE-GLA-1, VE-ALA-1, VE-SDA-1, VE-TMT-SDA-1, VE-TMT-GLA-1
(introgression progeny) of respective crosses, as described in Table 1 and shown
in Fig. 5. Values are means ± SD of analyses of three independent samples.
Means, standard deviation and significance were calculated using Tukey-
Kramer HSD. Means followed by the same letter are not significantly different
from each other (α = 0.05).
4. Discussion
In this report, we show that seed-specific expression of the trans-
gene for barley HGGT alone is sufficient to yield soybean seed toco-
chromanols concentrations to > 2500 μg/g seed wt. These concentra-
tions are approximately eight- to ten-fold higher than concentrations in
non-transformed seeds. This level of tocochromanol increase is, to our
knowledge, the greatest achieved in soybean seeds or any oilseed, in-
cluding canola and maize, by breeding or by use of a single transgene
(Cahoon et al., 2003). For example, expression of single transgenes for a
bacterial chorismate mutase/prephenate dehydrogenase (TyrA), Ara-
bidopsis 4-hydroxyphenylpyruvate dioxygenase (HPPD), or Arabidopsis
homogentisate phytyltransferase (HPT, VTE2) increased soybean seed
tocochromanol concentrations by ~1.3-fold (Karunanandaa et al.,
2005). Instead, a four-transgene combination, including transgenes for
Arabidopsis HPT, Arabidopsis geranylgeranyl reductase, bacterial
TYRA, and Arabidopsis HPPD, resulted in soybean seed tocochromanol
concentrations comparable to those that we achieved with a single
transgene for barley HGGT (Karunanandaa et al., 2005). Similar to our
findings, the increases in tocochromanols in this study were largely due
to production of the geranylgeranyl-diphosphate-derived tocotrienols,
rather than the phytyl diphosphate-derived tocopherols. These findings
indicate that a major limitation for tocopherol production in soybean
and likely other oilseeds are pools of phytyl diphosphate. As HGGT
alone is effective in yielding exceptionally high levels of tocotrienols,
metabolic flux that generates the HGGT substrate geranylgeranyl di-
phosphate is apparently not limiting relative to phytyl diphosphate
biosynthesis that supplies substrate for tocopherol formation. Produc-
tion of the latter metabolite has been shown in Arabidopsis to involve
an indirect pathway of geranylgeraniol incorporation on to chlorophyll,
reduction of geranylgeranyl-chlorophyll to phytyl-chlorophyll, sub-
sequent release of free phytol, and two phosphorylation steps to gen-
erate phytyl-diphosphate for tocopherol biosynthesis (Valentin et al.,
2006; Vom Dorp et al., 2015; Zhang et al., 2015). Instead, the direct
utilization of geranylgeranyl diphosphate by HGGT may relieve feed-
back inhibition of the plastid isoprenoid pathway to support high levels
of tocotrienol biosynthesis (Banerjee et al., 2013). We also show that
overexpression of the soybean γ-TMT is sufficient to shift the accumu-
lation of tocotrienols and tocopherols to β-forms by methylation of δ-
tocotrienol and δ–tocopherol and to α-forms by methylation of γ-
71
Metabolic Engineering 57 (2020) 63–73
tocotrienol and γ-tocopherol. Nearly complete conversion of toco-
trienols and tocopherols to the more nutritionally available α-forms is
likely achievable by the additional overexpression of the 2-methyl-6
phytyl/geranylgeranyl-benzoquinol methyltransferase (VTE3) (Van
Eenennaam et al., 2003).
Our findings, consistent with those of Karunanandaa et al. (2005),
indicate that soybean is a viable metabolic engineering platform for
producing high concentrations of tocochromanols. In addition to
achieving higher tocochromanol production in soybean than in other
oilseeds, we observed little effect of this trait on the total oil and protein
content in seeds of field-grown soybean plants. Though not rigorously
examined in these studies, we saw no obvious defects on seed germi-
nation or plant growth in the engineered lines under field conditions.
Moreover, the use of the HGGT transgene for tocochromanol bioforti-
fication resulted in no apparent alteration of seed pigmentation, as is
the case with previously reported high tocochromanol-producing lines
that were engineered for enhanced pool sizes of homogentisate, which
is prone to oxidation resulting in brown seed color (Karunanandaa
et al., 2005).
Notably, soybean is a major commercial source for tocopherols,
which are isolated as a co-product by distillation from the seed oil
fraction (Burdock, 1997). These isolates are used widely in nutritional
supplements and as chemical antioxidants in foods and cosmetics
(Fernandes and Cabral, 2007). In this regard, results from our ABTS
studies show that our enrichment of soybean seeds with vitamin E to-
cochromanols enhances the free-radical scavenging capacity of ex-
tracted oil by 6- to 13-fold relative to oil extract from non-engineered
seeds. The ABTS test is widely used in the food industry for assessing
antioxidant capacity. Based on the ABTS results, the traits described
here may enhance the co-product value of extracted soybean vitamin E
tocochromanols for chemical antioxidant use and for animal and
aquaculture feed markets to extend meat shelf life, as previously de-
monstrated (Liu et al., 1995; Waylan et al., 2002). The engineered seeds
also provide a ready commercial source of tocotrienols, which have
been shown to have distinct nutritional and therapeutic properties
compared to tocopherols for uses such as cholesterol-lowering, UV-ra-
diation-blocking sunscreens, and cancer prevention (Nesaretnam et al.,
1998; Osakada et al., 2004; Pearce et al., 1992; Webber et al., 1997).
For the majority of these uses, δ- and γ-tocotrienols, the primary pro-
ducts of HGGT overexpression (Cahoon et al., 2003, 2006a; Meyer,
2011), are most efficacious.
Our studies also generated a unique resource: high vitamin E to-
cochromanol trait stacked with polyunsaturated fatty acid (PUFA)-rich
oil germplasm. This is a useful resource for studying effects of the to-
cochromanol trait on functional properties such as oil oxidative stabi-
lity, as examined in this report, and seed storage longevity. Our studies
were conducted by crossing the high vitamin E tocochromanol lines
with a previously reported stearidonic acid-engineered line (Eckert
et al., 2006). The stearidonic acid trait was derived from unlinked
transgenes for the borage Δ6 desaturase and Arabidopsis FAD3. Con-
sistent with this, our crosses resulted in segregating progeny with the
combined transgenes yielding a high stearidonic acid trait and in-
dividual borage Δ6 desaturase transgene yielding a high γ-linolenic acid
(GLA) trait and FAD3 transgene yielding a high α-linolenic acid (ALA)
trait. Crosses were also made with the soybean lines containing trans-
genes for HGGT and γ-TMT. Stearidonic acid and GLA-rich oils have
been the focus of biotechnological efforts to improve the nutraceutical
properties of vegetable oils (Eckert et al., 2006). A biotechnology-de-
rived high GLA-safflower variety, for example, is now a commercial
source of GLA nutritional supplements (Flider, 2013). Crosses were
taken to homozygosity, and Southern blotting was conducted to con-
firm the retention of transgenes. Extracted oil for all of the vitamin E-
tocochromanol lines had higher free radical scavenging activities re-
lative to controls. Of the lines tested, oil from the HGGT-TMT back-
ground alone had the highest free radical scavenging activity, which
may be reflective of the altered tocochromanol composition, but this
A.R. Konda, et al.
increase relative to controls was not seen when combined with GLA or
SDA. Oxidative stability indices (OSI) for oil from lines with HGGT and
HGGT-TMT in the absence of the PUFA trait were reduced by ~15%
relative to oils from parental controls. This finding is consistent with
numerous reports, including a study using oil from HGGT-engineered
maize (Dolde and Wang, 2011a,b), that vitamin E tocochromanols at
high concentrations can confer pro-oxidant, rather than antioxidant
effects on vegetable oils (Huang et al., 1995; Evans et al., 2002). OSI
measurements with the combination of high vitamin E tocochromanols
with the PUFA-rich oils showed variable efficacies. Combinations of the
VE-1 background with the GLA trait had a neutral effect on OSI, and the
HGGT-TMT (VE-TMT-1) background with the GLA trait resulted in a
lower OSI relative to controls. Significant increases in OSI values were
observed with the combination of the VE-1 background with the ALA
trait, and especially with the SDA trait, compared to the ALA-1 and
SDA-1. However, it cannot be excluded that the OSI enhancements are
in part due to reductions in overall PUFA content in seeds of the crosses
relative to seeds of the ALA-1 and SDA-1. It must be noted that, other
minor lipid components in the oils affect the oxidative stability of oils;
therefore, the decrease in the oxidative stability cannot be attributed to
only vitamin E levels. It is also possible that impurities that are co-
extracted during seed cold-pressing or undetected HGGT-derived me-
tabolites may have negative effects on oil OSI in combination with the
high-vitamin E traits. Although OSI is used in industry for quality
control of oils, it may not assess antioxidant effectiveness for several
reasons. The results obtained at high temperatures may not correlate to
predictions of antioxidant effectiveness at lower temperatures. More-
over, volatile antioxidants may be carried out by the air flow during the
analysis (Gordon, 2001). It should be noted that antioxidant capacity
(measured by ABTS) and OSI do not necessarily correlate as antioxidant
capacity measures the thermodynamic conversion efficiency of an
oxidant probe upon reaction with an antioxidant (Apak et al., 2013).
OSI provides an assessment of oil oxidative degradation and is depen-
dent on oil composition, including minor components such as phos-
pholipids and impurities such as free fatty acids, pigments and waxes.
The limited amount of oil obtained from our field-grown plants pre-
cluded purification by refinement and bleaching of the oil, as is com-
mercially done during vegetable oil processing. It also remains to be
assessed whether the high vitamin E tocochromanol traits have sig-
nificant antioxidant properties for highly oxidation-prone eicosa-
pentaenoic acid (EPA) and docosahexaenoic acid (DHA) fish-oil traits
that are nearing commercialization in oilseeds (Napier et al., 2019).
5. Conclusions
Our findings demonstrate that soybean is a viable platform for
producing high levels of vitamin E tocochromanols using the barley
HGGT-transgene alone and variant compositions can be obtained by co-
expression of methyltransferases that modify the aromatic head group.
The enrichment of tocotrienols in these seeds may promote production
of the engineered soybeans for specialized and potentially higher-value
co-product markets. Oils from these seeds were also found to have
strongly enhanced antioxidant capacity. This property points toward
increased co-product value of tocochromanols extracted from en-
gineered seeds for chemical antioxidant markets that support food,
feed, and cosmetic applications. High levels of vitamin E tocochroma-
nols reduced oxidative stability of extracted oil and had no or marginal
efficacy for promotion of oxidative stability of GLA-, ALA- and stear-
idonic acid rich oils.
Declaration of competing interest
None.
72
Metabolic Engineering 57 (2020) 63–73
Acknowledgements
We thank Pat Tenopir and staff for field maintenance of engineered
soybean lines at the University of Nebraska-Lincoln Plant
Biotechnology Field Facility, Eastern Nebraska Research & Education
Center, Mead, Nebraska. We also thank Dr. Daniel Santana de Carvalho
for soybean images. The research was supported by grants from the
Nebraska Soybean Board to TEC and EBC, United Soybean Board to
TEC, and the United States Department of Agriculture-National Institute
of Food and Agriculture (grant no. 2015-67013-22839) to EBC.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.ymben.2019.10.005.
References
Aggarwal, V., Kashyap, D., Sak, K., Tuli, H.S., Jain, A., Chaudhary, A., Garg, V.K., Sethi,
G., Yerer, M.B., 2019. Molecular mechanisms of action of tocotrienols in cancer:
recent trends and advancements. Int. J. Mol. Sci. 20, 656.
Almonor, G.O., Fenner, G.P., Wilson, R.F., 1998. Temperature effects on tocopherol
composition in soybeans with genetically improved oil quality. J. Am. Oil Chem. Soc.
75, 591–596.
Apak, R., Gorinstein, S., Böhm, V., Schaich, K.M., Özyürek, M., Güçlü, K., 2013. Methods
of measurement and evaluation of natural antioxidant capacity/activity (IUPAC
Technical Report). Pure Appl. Chem. 85, 957–998.
Arun, M., Subramanyam, K., Theboral, J., Sivanandan, G., Rajesh, M., Kapil Dev, G.,
Jaganath, B., Manickavasagam, M., Girija, S., Ganapathi, A., 2014. Transfer and
targeted overexpression of γ-tocopherol methyltransferase (γ-TMT) gene using seed-
specific promoter improves tocopherol composition in Indian soybean cultivars.
Appl. Biochem. Biotechnol. 172, 1763–1776.
Banerjee, A., Wu, Y., Banerjee, R., Li, Y., Yan, H., Sharkey, T.D., 2013. Feedback in-
hibition of deoxy-D-xylulose-5-phosphate synthase regulates the methylerythritol 4-
phosphate pathway. J. Biol. Chem. 288, 16926–16936.
Buhr, T., Sato, S., Ebrahim, F., Xing, A., Zhou, Y., Mathiesen, M., Schweiger, B., Kinney,
A.J., Staswick, P., Clemente, T., 2002. Ribozyme termination of RNA transcripts
down-regulate seed fatty acid genes in transgenic soybean. Plant J. 30, 155–163.
Burdock, G.A., 1997. Tocopherols. In: Encyclopedia of Food and Color Additives, vol. III.
CRC Press, Boca 868 Raton, FL, pp. 2801–2803.
Cahoon, E.B., Carlson, T.J., Ripp, K.G., Schweiger, B.J., Cook, G.A., Hall, S.E., Kinney,
A.J., 1999. Biosynthetic origin of conjugated double bonds: production of fatty acid
components of high-value drying oils in transgenic soybean embryos. Proc. Natl.
Acad. Sci. U.S.A. 96, 12935–12940.
Cahoon, E.B., Hall, S.E., Ripp, K.G., Ganzke, T.S., Hitz, W.D., Coughlan, S.J., 2003.
Metabolic redesign of vitamin E biosynthesis in plants for tocotrienol production and
increased antioxidant content. Nat. Biotechnol. 21, 1082–1087.
Cahoon, E.B., Coughlan, S.J., Cahoon, R.E., Butler, K.H., 2006a. Compositions and
Methods for Altering Tocotrienol Content. United States Patent Number 7154029.
Cahoon, E.B., Dietrich, C.R., Meyer, K., Damude, H.G., Dyer, J.M., Kinney, A.J., 2006b.
Conjugated fatty acids accumulate to high levels inphospholipids of metabolically
engineered soybean and Arabidopsis seeds. Phytochemistry 67, 1166–1176.
Castelo-Branco, V.N., Santana, I., Di-Sarli, V.O., Freitas, S.P., Torres, A.G., 2015.
Antioxidant capacity is a surrogate measure of the quality and stability of vegetable
oils. Eur. J. Lipid Sci. Technol. 118, 224–235.
Cillard, J., Cillard, P., Cormier, M., 1980. Effect of experimental factors on the prooxidant
behavior of α-tocopherol. J. Am. Oil Chem. Soc. 57, 255–261.
Clemente, T.E., Cahoon, E.B., 2009. Soybean oil: genetic approaches for modification of
functionality and total content. Plant Physiol. 151, 1030–1040.
Danaei, G., Ding, E.L., Mozaffarian, D., Taylor, B., Rehm, J., Murray, C.J.L., Ezzati, M.,
2009. The preventable causes of death in the United States: comparative risk as-
sessment of dietary, lifestyle, and metabolic risk factors. PLoS Med. 6, 1–23.
Dellaporta, S.L., Wood, J., Hicks, J.B., 1983. A plant DNA mini preparation: version II.
Plant Mol. Biol. Report. 1, 19–21.
Dolde, D., Wang, T., 2011a. Oxidation of crude corn oil with and without elevated to-
cotrienols. J. Am. Oil Chem. Soc. 88, 1367–1372.
Dolde, D., Wang, T., 2011b. Oxidation of corn oils with spiked tocols. J. Am. Oil Chem.
Soc. 88, 1759–1765.
Doyle, J.J., Schuler, M.A., Godette, W.D., Zenger, V., Beachy, R.N., Slightom, J.L., 1986.
The glycosylated seed storage proteins of Glycine max and Phaseolus vulgaris: struc-
tural homologies of genes and proteins. J. Biol. Chem. 261, 9228–9238.
Eckert, H., LaVallee, B.J., Schweiger, B.J., Kinney, A.J., Cahoon, E.B., Clemente, T., 2006.
Co-expression of the borage Δ6 desaturase and the Arabidopsis Δ15 desaturase results
in high accumulation of stearidonic acid in the seeds of transgenic soybean. Planta
224, 1050–1057.
European Committee for Standardization, 2014. EN 15751-Automotive Fuels-Fatty Acid
Methyl Ester (FAME) Fuel and Blends with Diesel Fuel-Determination of Oxidation
Stability by Accelerated Oxidation Method.
Evans, J.C., Kodali, D.R., Addis, P.B., 2002. Optimal tocopherol concentrations to inhibit
soybean oil oxidation. J. Am. Oil Chem. Soc. 79, 47–51.
A.R. Konda, et al.
Fernandes, P., Cabral, J.M.S., 2007. Phytosterols: applications and recovery methods.
Plant Biotechnol. J 7 (5), 411–421.
Finer, J.J., McMullen, M.D., 1991. Transformation of soybean via particle bombardment
of embryonic suspension culture tissue. In Vitro Cell. Dev. Biol. 27, 175–182.
Flider, J.F., 2013. Development and commercialization of GLA safflower oil. Lipid
Technol. 25, 227–229.
Flores, T., Karpova, O., Su, X., Zheng, P., Bilyeu, K., Sleper, D.A., Nguyen, H.T., Zhang,
Z.J., 2008. Silencing of the GmFAD3 gene by siRNA leads to low α-linolenic acids
(18:3) of fad3-mutant phenotype in soybean Glycine max (Merr.). Transgenic Res. 17,
839–850.
Gordon, M.H., 2001. Measuring antioxidant activity. In: Antioxidants in Foods: Practical
Applications. CRC Press, Boca Raton, FL, USA, pp. 71–84.
Graef, G., LaVallee, B., Tenopir, P., Tat, M., Schweiger, B., Kinney, A., Gerpen, J.,
Clemente, T., 2009. A High-Oleic-Acid and Low-Palmitic-Acid Soybean: Agronomic
Performance and Evaluation as a Feedstock for Biodiesel.
Hammond, E.G., Fehr, W.R., 1983. Registration of A5 germplasm line of soybean. Crop
Sci. 23 (192), 2335–2350 Bioresource Technology 98.
Huang, S.-W., Frankel, E.N., German, J.B., 1995. Effects of individual tocopherols and
tocopherol mixtures on the oxidative stability of corn oil triglycerides. J. Agric. Food
Chem. 43, 2345–2350.
Hunter, S.C., Cahoon, E.B., 2007. Enhancing vitamin E in oilseeds: unraveling tocopherol
and tocotrienol biosynthesis. Lipids 42, 97–108.
Kamal-Eldin, A., Appelqvist, L.A., 1996. The chemistry and antioxidant properties of
tocopherols and tocotrienols. Lipids 31, 671–701.
Karunanandaa, B., Qi, Q., Hao, M., Baszis, S.R., Jensen, P.K., Wong, Y.H., Jiang, J.,
Venkatramesh, M., Gruys, K.J., Moshiri, F., Post-Beittenmiller, D., Weiss, J.D.,
Valentin, H.E., 2005. Metabolically engineered oilseed crops with enhanced seed
tocopherol. Metab. Eng. 7, 384–400.
Kim, Y.J., Seo, H.Y., Park, T.I., Baek, S.H., Shin, W.C., Kim, H.S., Kim, J.G., Choi, Y.E.,
Yun, S.J., 2005. Enhanced biosynthesis of α-tocopherol in transgenic soybean by
introducing γTMT gene. J. Plant Biotechnol. 7, 1–7.
Kinney, A.J., Cahoon, E.B., Damude, H.G., Hitz, W.D., Kolar, C.W., Liu, Z.B., 2004.
Production of Very Long Chain Polyunsaturated Fatty Acids in Oilseed Plants. World
Patent Application No. WO 2004/071467.
Ling, M.T., Luk, S.U., Al-Ejeh, F., Khanna, K.K., 2012. Tocotrienol as a potential antic-
ancer agent. Carcinogenesis 33, 233–239.
Liu, Q., Lanari, M.C., Schaefer, D.M., 1995. A review of dietary vitamin E supplementa-
tion for improvement of beef quality. J. Anim. Sci. 73, 3131–3140.
Marc, F., Davin, A., Deglène-Benbrahim, L., Ferrand, C., et al., 2004. Studies of several
analytical methods for antioxidant potential evaluation in food. Med. Sci. 20,
458–463.
Mazur, B., Krebbers, E., Tingey, S., 1999. Gene discovery and product development for
grain quality traits. Science 285, 372–375.
Meyer, K., 2011. Compositions and methods for altering α- and β-tocotrienol content
using multiple transgenes. United States Patent Number 7 (893), 324.
Moser, B., Haas, M.J., Jackson, M.A., Erhan, S.V., List, G.R., 2007. Evaluation of partially
hydrogenated methyl esters of soybean oil as biodiesel. Eur. J. Lipid Sci. Technol.
109, 17–24.
Napier, J.A., Olsen, R.E., Tocher, D.R., 2019. Update on GM canola crops as novel sources
of omega-3 fish oils. Plant Biotechnol. J. 17, 703–705.
Nesaretnam, K., Stephem, R., Dils, R., Darbre, P., 1998. Tocotrienols inhibit the growth of
human breast cancer cells irrespective of estrogen receptor status. Lipids 33,
461–469.
Nguyen, H.T., Silva, J.E., Podicheti, R., Macrander, J., Yang, W., Nazarenus, T.J., Nam,
J.W., Jaworski, J.G., Lu, C., Scheffler, B.E., Mockaitis, K., Cahoon, E.B., 2013.
Camelina seed transcriptome: a tool for meal and oil improvement and translational
research. Plant Biotechnol. J. 11, 759–769.
Osakada, F., Hashino, A., Kume, T., Katsuki, H., Kaneko, S., Akaike, A., 2004. α-
Tocotrienol provides the most potent neuroprotection among vitamin E analogs on
cultured striatal neurons. Neuropharmacology 47, 904–915.
Park, H., Weier, S., Razvi, F., Pena, P.A., Sims, N.A., Lowell, J., Hungate, C., Kissinger, K.,
Key, G., Fraser, P., Napier, J.A., Cahoon, E.B., Clemente, T.E., 2017. Towards the
development of a sustainable soya bean‐based feedstock for aquaculture. Plant
Biotechnol. J. 15, 227–236.
Pearce, B.C., Parker, R.A., Deason, M.E., Qureshi, A.A., Wright, J.J., 1992.
Hypocholesterolemic activity of synthetic and natural tocotrienols. J. Med. Chem. 35,
3595–3606.
73
Metabolic Engineering 57 (2020) 63–73
Qureshi, A.A., Burger, W.C., Peterson, D.M., Elson, C.E., 1986. The structure of an in-
hibitor of cholesterol biosynthesis isolated from barley. J. Biol. Chem. 261,
10544–10550.
Qureshi, A.A., Qureshi, N., Wright, J.J., Shen, Z., Kramer, G., Gapor, A., Chong, Y.H.,
DeWitt, G., Ong, A., Peterson, D.M., 1991. Lowering of serum cholesterol in hy-
percholesterolemic humans by tocotrienols (palmvitee) Amer. J. Clin. Nutr. 53,
1021s–1026s.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, NY.
Sato, S., Xing, A., Ye, X., Schweiger, B., Kinney, A., Graef, G., Clemente, T., 2004.
Production of γ-linolenic acid and stearidonic acid in seeds of marker free transgenic
soybean. Crop Sci. 44, 646–652.
Schmidt, M.A., Tucker, D.M., Cahoon, E.B., Parrott, W.A., 2005. Towards normalization
of soybean somatic embryo maturation. Plant Cell Rep. 24, 383–391.
Shintani, D., DellaPenna, D., 1998. Elevating the vitamin E content of plants through
metabolic engineering. Science 282, 2098–2100.
Siles, L., Cela, J., Munne-Bosch, S., 2013. Vitamin E analyses in seeds reveal a dominant
presence of tocotrienols over tocopherols in the Arecaceae family. Phytochemistry
95, 207–214.
Tan, B., Brzuskiewicz, L., 1989. Separation of tocopherols and tocotrienol isomers using
normal- and reverse-phase liquid chromatography. Anal. Biochem. 180, 368–373.
Tavva, V.S., Kim, Y.H., Kagan, I.A., Dinkins, R.D., Kim, K.H., Collins, G.B., 2007.
Increased α-tocopherol content in soybean seed overexpressing the Perilla frutescens
γ-tocopherol methyltransferase gene. Plant Cell Rep. 26, 61–70.
USDA ERS, 2019. [cited 31 july 2019]. [Internet]. Available at: https://www.ers.usda.
gov/topics/crops/soybeans-oil-crops/related-data-statistics/.
Valentin, H.E., Lincoln, K., Moshiri, F., Jensen, P.K., Qi, Q., Venkatesh, T.V.,
Karunanandaa, B., Baszis, S.R., Norris, S.R., Savidge, B., Gruys, K.J., Last, R.L., 2006.
The Arabidopsis vitamin E pathway gene5-1 mutant reveals a critical role for phytol
kinase in seed tocopherol biosynthesis. Plant Cell 18, 212–224.
Van Eenennaam, A.L., Lincoln, K., Durrett, T.P., Valentin, H.E., Shewmaker, C.K., Thorne,
G.M., Jiang, J., Baszis, S.R., Levering, C.K., Aasen, E.D., Hao, M., Stein, J.C., Norris,
S.R., Last, R.L., 2003. Engineering vitamin E content: from Arabidopsis mutant to soy
oil. Plant Cell 15, 3007–3019.
Vom Dorp, K., Hölzl, G., Plohmann, C., Eisenhut, M., Abraham, M., Weber, A.P.M.,
Hanson, A.D., Dörmann, P., 2015. Remobilization of phytol from chlorophyll de-
gradation Is essential for tocopherol synthesis and growth of Arabidopsis. Plant Cell
27, 2846–2859.
Wagner, K.H., Elmadfa, I., 2000. Effects of tocopherols and their mixtures on the oxi-
dative stability of olive oil and linseed oil under heating. Eur. J. Lipid Sci. Technol.
102, 624–629.
Wagner, K.-H., Wotruba, F., Elmadfa, I., 2001. Antioxidative potential of tocotrienols and
tocopherols in coconut fat at different oxidation temperatures. Eur. J. Lipid Sci.
Technol. 103, 746–751.
Wang, L., Gulati, P., Santra, D., Rose, D., Zhang, Y., 2017. Nanoparticles prepared by
proso millet protein as novel curcumin delivery system. Food Chem. 240, 1039–1046.
Warner, K., Neff, W.E., Eller, F.J., 2003. Enhancing quality and oxidative stability of aged
fried food with γ-tocopherol. J. Agric. Food Chem. 51, 623–627.
Waylan, A.T., O'Quinn, P.R., Unruh, J.A., Nelssan, J.L., Goodband, R.D., Woodworth, J.C.,
Tokach, M.C., Koo, S.I., 2002. Effects of modified tall oil and vitamin E on growth
performance, carcass characteristics, and meat quality of growing-finishing pigs. J.
Anim. Sci. 80, 1575–1585.
Webber, C., Podda, M., Rallis, M., Thiele, J.J., Traber, M.G., Packer, L., 1997. Efficacy of
topically applied tocopherols and tocotrienols in protection of murine skin from
oxidative damage induced by UV-irradiation. Free Radical Biol. Med. 22, 761–769.
Wilcox, J.R., Cavins, J.F., 1985. Inheritance of low linolenic acid content of the seed oil of
a mutant Glycine max. Theor. Appl. Genet. 71, 74–78.
Yang, W., Cahoon, R.E., Hunter, S.C., Zhang, C., Han, J., Borgschulte, T., Cahoon, E.B.,
2011. Vitamin E biosynthesis: functional characterization of the monocot homo-
gentisate geranylgeranyl transferase. Plant J. 65, 206–217.
Zhang, C., Cahoon, R.E., Hunter, S.C., Chen, M., Han, J., Cahoon, E.B., 2013. Genetic and
biochemical basis for alternative routes of tocotrienol biosynthesis for enhanced vi-
tamin E antioxidant production. Plant J. 73, 628–639.
Zhang, C., Zhang, W., Ren, G., Li, D., Cahoon, R.E., Chen, M., Zhou, Y., Yu, B., Cahoon,
E.B., 2015. Chlorophyll synthase under epigenetic surveillance is critical for vitamin
E synthesis, and altered expression affects tocopherol levels in Arabidopsis. Plant
Physiol. 168, 1503–1511.