BACTERIAL INFECTIONS

crossm

Positive- and Negative-Control Pathways

by Blood Components for Intermedilysin
Production in Streptococcus intermedius
Toshifumi Tomoyasu,a,b Takahiro Yamasaki,c Shinya Chiba,c Shingo Kusaka,c
Atsushi Tabata,a Robert A. Whiley,d Hideaki Nagamunea
Department of Bioscience and Bioindustry, Graduate School of Bioscience and Bioindustry, Tokushima
University Graduate School, Tokushima, Japana; Department of Resource Circulation Engineering, Center for
Frontier Research of Engineering, Tokushima University Graduate School, Tokushima, Japanb; Department of
Biological Science and Technology, Institute of Technology and Science, Tokushima University Graduate
School, Tokushima, Japanc; Department of Clinical and Diagnostic Oral Sciences, Institute of Dentistry, Bart's
and The London School of Medicine and Dentistry, Queen Mary University of London, London, United
Kingdomd

ABSTRACT Streptococcus intermedius is an opportunistic bacterial pathogen secret-

ing a human-specific cytolysin called intermedilysin (ILY) as a major pathogenic fac- Received 24 May 2017 Accepted 8 June 2017
tor. This bacterium can degrade glycans into monosaccharides using two glycosi- Accepted manuscript posted online 12
June 2017
dases, multisubstrate glycosidase A (MsgA) and neuraminidase (NanA). Here, we
Citation Tomoyasu T, Yamasaki T, Chiba S,
detected a stronger hemolytic activity mediated by ILY when S. intermedius PC574 Kusaka S, Tabata A, Whiley RA, Nagamune H.
was cultured in fetal bovine serum (FBS) than when it was grown in the standard 2017. Positive- and negative-control pathways
culture medium. FBS-cultured cells also showed higher MsgA and NanA activity, al- by blood components for intermedilysin
production in Streptococcus intermedius. Infect
though overproduction of ILY in FBS was undetectable in mutants nanA-null and Immun 85:e00379-17. https://doi.org/10.1128/
msgA-null. Addition of purified MsgA and NanA to the FBS resulted in a release of IAI.00379-17.
2.8 mM galactose and 4.3 mM N-acetylneuraminic acid; these sugar concentrations Editor Liise-anne Pirofski, Albert Einstein
College of Medicine
were sufficient to upregulate the expression of ILY, MsgA, and NanA. Conversely,
Copyright © 2017 American Society for
when strain PC574 was cultured in human plasma, no similar increase in hemolytic Microbiology. All Rights Reserved.
activity was observed. Moreover, addition of human plasma to the culture in FBS ap- Address correspondence to Hideaki
peared to inhibit the stimulatory effect of FBS on ILY, MsgA, and NanA, although Nagamune, nagamune@tokushima-u.ac.jp.
there were individual differences among the plasma samples. We confirmed that hu-
man plasma contains immunoglobulins that can neutralize ILY, MsgA, and NanA ac-
tivities. In addition, human plasma had a neutralizing effect on cytotoxicity of S. in-
termedius toward HepG2 cells in FBS, and a higher concentration of human plasma
was necessary to reduce the cytotoxicity of an ILY-high-producing strain than an ILY-
low-producing strain. Overall, our data show that blood contains factors that
stimulate and inhibit ILY expression and activity, which may affect pathogenicity
of S. intermedius.
KEYWORDS Streptococcus intermedius, blood components, gene expression,
glycosidase, intermedilysin, pathogenicity

S treptococcus intermedius is a facultative anerobic bacterium belonging to the angi-

nosus group of streptococci (AGS), which also includes Streptococcus anginosus and
Streptococcus constellatus (1). Streptococcus anginosus consists of two subspecies,
subsp. anginosus and subsp. whileyi, whereas Streptococcus constellatus contains three
subspecies, subsp. constellatus, subsp. pharyngis, and subsp. viborgensis (2, 3). S. inter-
medius is associated with oral infections including periodontal disease and implantitis,
respiratory infections including recurrent tonsillitis and pneumonia, and deep-seated
purulent infections such as brain, lung, and liver abscesses (1, 4–13).
Among AGS species, only S. intermedius produces the cytotoxin intermedilysin (ILY)
of the cholesterol-dependent cytolysin (CDC) family, encoded by the ily gene (14–17).

September 2017 Volume 85 Issue 9 e00379-17 Infection and Immunity iai.asm.org 1

Tomoyasu et al. Infection and Immunity

It has been shown that a knockout mutation of ily or inactivation of ILY using an anti-ILY
antibody results in greatly decreased cytotoxicity of S. intermedius toward the human
hepatoma cell line HepG2 (18), providing strong evidence that ILY is a crucial virulence
factor of S. intermedius for infectivity and toxicity to human cells. In contrast to other
CDC family members, ILY does not use cholesterol as a binding receptor and can
specifically recognize a glycosylphosphatidylinositol-linked human cell membrane pro-
tein, (h)CD59, which is a regulator of the terminal pathway of complement (19).
Therefore, S. intermedius is believed to be a strictly human-specific pathogen.
Two transcriptional repressors that can regulate ily expression, i.e., catabolite control
protein (CcpA) and lactose phosphotransferase system repressor (LacR), have been
reported thus far (20, 21). CcpA can regulate ily expression by binding to the catabolite-
repressible element (cre) in the ily promoter region as a part of the mechanism that
monitors the extracellular concentration of utilizable carbohydrates such as glucose,
fructose, and mannose (20). Therefore, high concentrations of these sugars in the
environment may repress ily expression. It was shown that LacR is a member of the
GntR family of transcriptional regulators (22) and can repress transcription of the lac
operon by binding to the LacR recognition element, which consists of direct repeats of
the sequence TGTTTNWTTT (N ⫽ any base; W ⫽ A or T) in the lac promoter under
galactose-limited conditions (22, 23). A pulldown assay with a biotinylated DNA probe
showed that LacR also binds to the ily promoter; however, the exact location of the
binding site in this region is still unknown (21). Therefore, it is probable that for this
reason S. intermedius can overproduce ILY when cultured in a galactose-containing
medium. Disruption of lacR in S. intermedius also causes constitutive overproduction of
ILY and consequently increases toxicity to the human hepatoma cell line HepG2 (21).
Because a loss-of-function mutation in LacR is observed in almost all ILY-high-
producing strains isolated from deep-seated abscesses, higher production of ILY seems
to be necessary for increased virulence of this bacterium. S. intermedius can control the
expression levels of ily by means of mechanisms monitoring the concentrations of
sugars, such as galactose and glucose, that are present in the habitat, thereby affecting
the pathogenicity of S. intermedius.
Among AGS, S. intermedius has a relatively wide range of glycosidase activities. It is
known that this pathogen is the only AGS species that can secrete NanA that has
neuraminidase (Neu) activity, encoded by nanA (1, 3, 24, 25). In addition, S. intermedius
and Streptococcus constellatus subsp. pharyngis are the only two AGS taxa with ␤-D-
galactosidase (␤-Gal), ␤-D-fucosidase, N-acetyl-␤-D-glucosaminidase (␤-GlcNAc), and
N-acetyl-␤-D-galactosaminidase activities (2). Recently, we showed that these four
glycosidase activities are derived from a novel secreted multisubstrate glycosidase A
(MsgA) (26). MsgA has a large molecular mass (approximately 247.6 kDa) and exogly-
cosidase activities. Neu activity that removes N-acetylneuraminic acid residues is re-
quired to initiate the degradation of glycans by MsgA, demonstrated by the require-
ment for both NanA and MsgA to effectively degrade glycans on ␣1-antitrypsin, a
human serum glycoprotein (26). Here, we show that the stimulatory factors for ILY,
MsgA, and NanA expression in fetal bovine serum (FBS) are galactose and
N-acetylneuraminic acid liberated by MsgA and NanA from glycans. We also find that
the inhibitory factors in human plasma for S. intermedius cytotoxicity are immunoglob-
ulins that neutralize ILY, MsgA, and NanA activities.

RESULTS
ILY production by FBS-cultured S. intermedius cells. Recently, we demonstrated
that MsgA and NanA can degrade glycans on human serum glycoprotein ␣1-antitrypsin
(26), suggesting that galactose liberated from glycoproteins by these glycosidases in
serum in vivo can activate ILY production through inactivation of LacR. To confirm this
possibility, an ILY-low-producing strain, PC574, was cultured in FBS. ILY is a primary
hemolytic factor; ily-null mutants completely lose hemolytic activity (18, 27). Therefore,
we compared ILY-mediated hemolytic activity in the culture supernatants of FBS- and
3-(N-morpholino)propanesulfonic acid-buffered brain heart infusion (MOPS-BHI)-

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 2

Expression Control Mechanisms of Intermedilysin Infection and Immunity

FIG 1 Hemolysis (A), ily transcription (B), and glycosidase activity (C) in FBS-cultured cells. (A) Strain
PC574 was grown in FBS (open circles) or MOPS-BHI broth (filled squares) for 24 h at 37°C to measure
hemolytic activity in the culture supernatant. The culture supernatant was collected and normalized to
the OD600 of the FBS or the MOPS-BHI culture. The standardized samples of culture supernatant were
2-fold serially diluted, and the hemolytic activity of the dilutions was determined. (B) Strain PC574 ily-Rluc
was cultured in FBS or in the MOPS-BHI broth (M-BHI) for 24 h at 37°C, and the luciferase activity
associated with the cells was measured. Each activity was normalized to OD600 and shown as the
percentage of the luciferase activity of the FBS-cultured cells. (C) Strain PC574 was cultured in FBS or the
MOPS-BHI broth for 24 h at 37°C, and cell-associated MsgA and NanA glycosidase activities were
determined. ␤-Gal, ␤-D-galactosidase; ␤-GlcNAc, N-acetyl-␤-D-glucosaminidase; Neu, neuraminidase. Rel-
ative (Rel.) glycosidase activities obtained with FBS-cultured PC574 cells are expressed relative to the
activities observed for this strain cultured in MOPS-BHI broth. Error bars show standard deviations from
at least three independent experiments.

cultured PC574 cells (Fig. 1A). Much higher hemolytic activity was observed in the
culture supernatant of FBS-cultured cells than in that of the MOPS-BHI-cultured cells
(Fig. 1A). A sandwich enzyme-linked immunosorbent assay (ELISA) using a rabbit
anti-ILY polyclonal antibody and mouse anti-ILY monoclonal antibodies was used to
confirm that the observed higher hemolytic activity was caused by increased ILY
expression (see Fig. S1A in the supplemental material). The amount of ILY secreted into
the culture supernatant by the FBS-cultured cells was approximately 40-fold higher
than that produced by MOPS-BHI-cultured cells. In addition, the expression levels of ily
in FBS- and MOPS-BHI-cultured cells were also compared using PC574 ily-Rluc, which
coexpresses the Renilla luciferase gene with ily under the regulation of the ily promoter
in an artificial ily operon. FBS-cultured cells showed much higher luciferase activity than
MOPS-BHI-cultured cells (Fig. 1B), and together these data indicate that the increased
hemolytic activity in the culture supernatant of FBS-cultured cells is due to the
activation of ily expression.
To investigate whether NanA and MsgA contributed to the increased hemolytic
activity of PC574 observed in FBS, we constructed nanA-null and msgA-null PC574
mutants. These mutations did not affect the inducibility of hemolytic activity by
galactose compared to that of the wild-type strain (data not shown). These mutant
strains were cultured in FBS, and the hemolytic activity and level of ILY in the culture
supernatants were compared with those in the culture supernatant of the wild-type

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 3

Tomoyasu et al. Infection and Immunity

FIG 2 Hemolytic activity of the ΔmsgA and ΔnanA mutants in FBS. All cells were grown in FBS for 24 h
at 37°C. The culture supernatants normalized to OD600 were 2-fold serially diluted, and the hemolytic
activity was determined. (A) Hemolytic activity of the ΔmsgA mutant. Open circles, PC574 pSETN1; filled
triangles, PC574 ΔmsgA pSETN1; open squares, PC574 ΔmsgA pmsgA. (B) Hemolytic activity of the ΔnanA
mutant. Open circles, PC574 pSETN1; filled triangles, PC574 ΔnanA pSETN1; open squares, PC574 ΔnanA
pnanA. Error bars show standard deviations from three independent experiments.

strain. Both mutant strains showed only weak hemolytic activity (Fig. 2A and B), and the
level of ILY significantly decreased (Fig. S1B and C). These phenotypes could be rescued
by trans-complementation of these genes. These results strongly suggest that NanA
and MsgA activities are crucial for higher production of ILY in FBS.
Glycosidase activities of FBS-cultured cells. Afzal et al. reported that the tran-
scriptional regulator NanR acts as an activator of nan operon I and nanA in the
presence of N-acetylneuraminic acid in Streptococcus pneumoniae D39 (28). A
homology search revealed a gene that encodes a NanR homolog (67% identity to
S. pneumoniae NanR) in the S. intermedius genome. Therefore, we cultured strain
PC574 in an N-acetylneuraminic acid-containing medium and confirmed that this
strain has a higher NanA activity (data not shown). To test whether the NanR
homolog in S. intermedius contributes to this phenotype, the nanR homolog gene
was disrupted. The nanR homolog-null strain (ΔnanR strain) did not show any
stimulation of NanA activity by N-acetylneuraminic acid, whereas a strain trans-
complemented for the disrupted gene was free of this defect (data not shown).
These results indicate that S. intermedius has a regulatory mechanism for nanA
expression similar to that in S. pneumoniae. It has also been shown elsewhere that
msgA is located in the lac operon and that galactose can activate its expression and
inactivate the LacR repressor (26).
Thus, the products of glycan degradation by NanA and MsgA (galactose and
N-acetylneuraminic acid) in FBS may activate their own synthesis in S. intermedius. To
test this possibility, we compared cell-associated MsgA and NanA activities between
FBS-cultured and MOPS-BHI-cultured S. intermedius cells. As expected, FBS-cultured
cells showed higher glycosidase activities (Fig. 1C). We also compared the expression of
msgA and nanA in FBS-cultured cells to that in MOPS-BHI-cultured cells by reverse
transcription-quantitative PCR (qRT-PCR). To avoid using cells in stationary phase, 18-h
MOPS-BHI-cultured cells and 24-h FBS-cultured cells were used for this experiment. The
levels of msgA and nanA mRNA in FBS-cultured cells were strikingly higher than those
in MOPS-BHI-cultured cells: the levels of msgA mRNA increased 107.9- ⫾ 6.8-fold and
those of nanA increased 21.5- ⫾ 2.0-fold in FBS-cultured cells compared to MOPS-BHI-
cultured cells. These results strongly suggest that sugars liberated from glycans by
MsgA and NanA activate not only ILY expression but also expression of MsgA and NanA
in strain PC574.
Quantification of the liberated sugars after glycosidase treatment. Our results
suggest that higher ILY, MsgA, and NanA activities in FBS-cultured PC574 cells were due
to the presence of galactose and N-acetylneuraminic acid liberated from glycans by
MsgA and NanA. Therefore, we degraded glycans in FBS using purified MsgA and NanA
and found that 2.8 mM galactose and 4.3 mM N-acetylneuraminic acid were produced

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 4

Expression Control Mechanisms of Intermedilysin Infection and Immunity

FIG 3 Hemolytic and glycosidase activities of the cells cultured in the mixed-sugar MOPS-BHI broth. (A) Hemolytic
activity. Strain PC574 was grown for 24 h at 37°C in MOPS-BHI broth supplemented with 5.6 mM glucose (filled
circles) or 2.8 mM galactose (gray squares) or in mixed-sugar MOPS-BHI broth (open circles) containing the mixed
sugars 2.8 mM galactose, 2.8 mM N-acetyl-D-glucosamine, 4.2 mM N-acetylneuraminic acid, and 5.6 mM glucose.
Each culture supernatant normalized to OD600 was subjected to 2-fold serial dilutions, and the hemolytic activity
in the diluted culture supernatants was determined. (B) Relative (Rel.) glycosidase activity. Strain PC574 was
cultured under the above-described conditions, and cell-associated glycosidase activities were measured. Relative
glycosidase activities are expressed relative to the activities observed for this strain cultured in MOPS-BHI broth
containing 5.6 mM glucose (Glu). Gal, MOPS-BHI broth containing 2.8 mM galactose; MS, mixed-sugar MOPS-BHI
broth. ␤-Gal, ␤-D-galactosidase; ␤-GlcNAc, N-acetyl-␤-D-glucosaminidase; Neu, neuraminidase. Error bars show
standard deviations from three independent experiments.

after 36 h of glycosidase treatment. Galactose and N-acetylneuraminic acid were not

detected in significant amounts in FBS untreated with glycosidase (data not shown).
Because MsgA has ␤-GlcNAc activity, not only galactose but also a similar amount of
N-acetyl-D-glucosamine was liberated. In addition, the FBS used in the present exper-
iments contained 5.6 mM glucose. Therefore, we also examined the utility of these
sugars for growth and found that strain PC574 could effectively utilize glucose, galac-
tose, and N-acetyl-D-glucosamine, whereas N-acetylneuraminic acid was a poor carbon
source (see Fig. S2 in the supplemental material). We also confirmed that among these
sugars, only galactose could activate ILY production, in contrast to N-acetylneuraminic
acid and N-acetyl-D-glucosamine, which did not (see Fig. S3 in the supplemental
material).
Hemolysis and glycosidase activities under glycan degradation conditions. To
determine whether the amounts of sugars liberated from FBS could activate ILY,
MsgA, or NanA activities, we cultured strain PC574 in the MOPS-BHI broth contain-
ing 5.6 mM glucose (Glc-BHI) or 2.8 mM galactose (Gal-BHI) or in a mixed-sugar
MOPS-BHI (MS-BHI) broth containing 2.8 mM galactose, 2.8 mM N-acetyl-D-
glucosamine, 4.3 mM N-acetylneuraminic acid, and 5.6 mM glucose (Fig. 3A). The
culture supernatant from both Gal-BHI- and MS-BHI-cultured cells showed much
higher hemolytic activity than the supernatant of Glc-BHI-cultured cells. We also
confirmed that the level of ILY in culture supernatant from MS-BHI-cultured cells (as
determined by sandwich ELISA) was much higher than that in culture supernatant
from MOPS-BHI-cultured cells and similar to that in supernatant from FBS-cultured
cells (see Fig. S4 in the supplemental material). The observation that the hemolytic
activities of Gal-BHI and MS-BHI culture supernatants were similar indicates that
intrinsic glucose in FBS does not seem to repress ILY production through galactose
liberation. The hemolytic activities shown in Fig. 3A are after normalization of each
culture at an optical density at 600 nm (OD600), whereas the hemolytic activity in
the culture supernatant from MS-BHI-cultured cells was actually 2.5-fold higher than
in the supernatant from Gal-BHI-cultured cells.
We also measured cell-associated glycosidase activity and found that MS-BHI-
cultured cells increased both NanA and MsgA activities (Fig. 3B). Interestingly, although
the amount of intrinsic glucose did not affect ILY production in this strain, it signifi-
cantly suppressed MsgA activity, which was induced by galactose (Fig. 3B). We also
found that the promoter region of the lac operon including msgA contains a sequence

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 5

Tomoyasu et al. Infection and Immunity

TABLE 1 Relative glycosidase activity in ΔccpA mutanta

Mean relative activity ⴞ SD in:
⌬ccpAⴙpccpA
Glycosidase ⌬ccpA mutant complemented strain
␤-D-Galactosidaseb 4.66 ⫾ 0.61 1.03 ⫾ 0.11
N-acetyl-␤-D-glucosaminidaseb 3.33 ⫾ 0.17 0.79 ⫾ 0.05
Neuraminidasec 0.83 ⫾ 0.03 0.72 ⫾ 0.01
aPC574, PC574 ΔccpA, and its complemented strain were cultured in MOPS-BHI broth with indicated
additions for 24 h. Cell-associated glycosidase activity was measured using 10 ␮l of a cell suspension
(OD600 ⫽ 1.0). Glycosidase activities are expressed relative to the activities observed with strain PC574.
bCulture broth contained 0.2% glucose.

cCulture broth contained 0.2% glucose and 0.1% N-acetylneuraminic acid.

(ATTGACAACGCTTTCAAA) highly homologous to the cre consensus sequence (29), and

ccpA-null PC574 showed higher MsgA activity (Table 1). These findings suggest that the
level of expression of msgA is controlled by glucose via catabolite repression and could
be repressed by much lower concentrations of glucose than for ily. In contrast to MsgA,
NanA activity was not influenced by disruption of ccpA (Table 1).
Expression of ily and ILY production in human-plasma-cultured cells. Because
FBS-cultured PC574 shows higher ILY production and greater MsgA and NanA activities,
we tested whether human plasma elicits the same effect as FBS. The culture superna-
tant from human-plasma-cultured cells showed low hemolytic activity, in contrast to
supernatant from FBS-cultured cells (Fig. 4A), and ILY could not be detected by
sandwich ELISA (see Fig. S5 in the supplemental material). We also compared the
expression level of ily between FBS-cultured and human-plasma-cultured cells by
monitoring the luciferase activity in PC574 ily-Rluc. As with hemolytic activity, human-
plasma-cultured cells showed only weak luciferase activity (Fig. 4B). These results
indicate that human plasma may contain a factor(s) that inhibits ily expression and/or
ILY activity.
Human immunoglobulin titers and neutralization activities toward ILY, MsgA,
and NanA. To test whether an inhibitory factor(s) for ILY-mediated hemolytic activity
is present in human plasma, strain PC574 was cultured in FBS containing 2% human
plasma (donors A to J) obtained from 10 volunteers, and the hemolytic activity in the
culture supernatant was quantified. Plasma from five volunteers (donors A to E)
completely inhibited the hemolytic activity (effective human plasma [eHP]), whereas
the other five plasma samples (from donors F to J) reduced hemolytic activity by less
than 30% (ineffective human plasma [iHP]; data not shown). These differences between
eHP and iHP might result from the amount of immunoglobulin that can neutralize ILY,
MsgA, and/or NanA activity. Therefore, we analyzed the titers of antibodies against ILY,

FIG 4 Hemolytic and ily transcriptional activities in human-plasma-cultured cells. (A) Hemolytic activity.
Strain PC574 was grown in FBS (open circles) or human plasma (filled circles) for 24 h at 37°C. The culture
supernatants normalized to OD600 were subjected to 2-fold serial dilutions, and the hemolytic activity
was determined. (B) ily transcriptional activity. Strain PC574 ily-Rluc was cultured in FBS (white bar) or
human plasma (black bar) for 24 h at 37°C, and luciferase activity of the cells was measured. Each activity
was normalized to OD600 and is presented as a percentage of the luciferase activity obtained with
FBS-cultured cells. Error bars indicate standard deviations from three independent experiments.

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 6

Expression Control Mechanisms of Intermedilysin Infection and Immunity

FIG 5 Titers of immunoglobulins against ILY, MsgA, and NanA and ILY-neutralizing activity of human
plasma. (A) Relative (Rel.) titers against ILY, MsgA, and NanA. The titers of immunoglobulins were
determined using an ELISA. Purified proteins (10 ng) and human plasma subjected to 2-fold serial
dilutions were used for the ELISA. The titers are expressed relative to the titers obtained in plasma
G against ILY, MsgA, and NanA. Black, white, and hatched bars represent the titers of immunoglob-
ulins against ILY, MsgA, and NanA, respectively. A to E, relative titers of effective human plasma
(eHP); F to J, ineffective human plasma (iHP). (B) Relative ILY-neutralizing activity. Neutralizing
activity toward ILY was determined using purified ILY and human plasma. Human erythrocytes were
added to a reaction mixture containing 2 ng of purified ILY and diluted human plasma (samples A
to J) by 2-fold serial dilutions and incubated at 37°C for 1 h. After incubation, the hemolytic activity
of each sample was determined and expressed relative to the neutralization activity of plasma A.
White bars, relative ILY-neutralizing activity of eHP; black bars, relative ILY-neutralizing activity of
iHP. Error bars are standard deviations from three independent experiments.

MsgA, and NanA and compared the relative titers of eHP and iHP samples (Fig. 5A). The
summed values of relative antibody titers for ILY, MsgA, and NanA were sorted in order
from high values (A) to low values (J). Our data revealed that eHP samples contained
significantly higher titers (P value 0.0065) of antibodies against ILY than the iHP samples
(Fig. 5A). In contrast to ILY, no statistically significant differences were observed for
relative titers of immunoglobulin against MsgA (P value ⫽ 0.14) and NanA (P value ⫽
0.22) between eHP and iHP samples (Fig. 5A). Therefore, we examined ILY-neutralizing
activities of plasma samples A to J using purified ILY protein (Fig. 5B). As predicted, eHP
samples effectively neutralized the hemolytic activity of ILY. In addition, plasma ob-
tained from volunteer A and depleted of immunoglobulin by protein L and protein G
column purification had drastically reduced ILY neutralizing activity (see Fig. S6 in the
supplemental material). Purified immunoglobulin from this plasma efficiently neutral-
ized hemolytic ILY activity (Fig. S6). These data suggest that the main reason for
hemolysis suppression by eHP samples is neutralization of ILY by an immunoglobulin
(Fig. 5A and B).
Inhibitory effects of human plasma on ily expression, glycosidase activities, and
monosaccharide production. Although no statistically significant differences were
observed in relative titers of immunoglobulins against MsgA and NanA between eHP
and iHP samples, the human-plasma-cultured cells could not activate ily expression in
PC574 ily-Rluc (Fig. 4B). This finding indicates that human plasma may contain an
immunoglobulin that can reduce the amount of galactose released from glycan by
neutralization of the MsgA and/or NanA activity. Therefore, we compared the inhibitory
effect on ily expression between plasma A, which showed the highest summed value

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 7

Tomoyasu et al. Infection and Immunity

FIG 6 Inhibitory effects of human plasma on ily expression, on glycosidase activities, and production of
monosaccharides in FBS. (A) Inhibition of ily expression. Strain PC574 ily-Rluc was cultured in FBS with or
without 2% human plasma (sample A or J) for 24 h at 37°C, and the luciferase activity of the cells was
measured. Each activity was normalized to OD600 and is presented as the percentage of the luciferase
activity in the FBS-cultured cells. Luciferase activity of the cells cultured in FBS (black bar), in the presence
of human plasma A (white bar), and in the presence of human plasma J (gray bar). (B) Inhibition of
glycosidase activities. Strain PC574 was cultured in FBS with or without 2% human plasma (sample A or
J) for 24 h at 37°C, and glycosidase activities in the culture supernatant were measured. Glycosidase
activities are shown as a percentage of the FBS-cultured cells (FBS). ␤-Gal, ␤-D-galactosidase; ␤-GlcNAc,
N-acetyl-␤-D-glucosaminidase; Neu, neuraminidase. (C) Inhibition of production of monosaccharides.
Purified NanA and MsgA were added to the reaction mixture containing 50% FBS with or without 1%
human plasma A or J, and the mixture was incubated for 24 h at 37°C. The amounts of galactose (Gal)
and N-acetylneuraminic acid (NANA) liberated from glycans were measured and expressed relative to the
amounts of Gal and NANA in glycosidase-treated FBS (FBS). Error bars denote standard deviations from
three independent experiments.

of relative antibody titers against ILY, MsgA, and NanA, and plasma J, which had the
lowest antibody titer value. PC574 ily-Rluc was cultured in FBS in the presence or
absence of 2% plasma A or J, and then luciferase activity in the cells was determined
(Fig. 6A). As expected, plasma A showed a much stronger inhibitory effect on ily
expression than plasma J. This result strongly supports our hypothesis that human
plasma contains immunoglobulins that can neutralize MsgA and/or NanA activities. To
further test this hypothesis, in vivo experiments were carried out to examine MsgA and
NanA activities in the culture supernatant of FBS-cultured cells in the presence of 2%
plasma A or J (Fig. 6B). Our data revealed that plasma A more effectively suppressed
both MsgA and NanA activities than did plasma J.
We subsequently compared the neutralizing activities toward MsgA and NanA
between plasma A and J in vitro. Purified glycosidases and human plasma A or J were
added to FBS. After incubation, the amounts of galactose and N-acetylneuraminic acid
liberated were quantified (Fig. 6C). In agreement with the in vivo data shown in Fig. 6B,
plasma A neutralized both MsgA and NanA activities more effectively than plasma J.
These data clearly indicated that human plasma contains immunoglobulins that neu-
tralize not only ILY but also MsgA and NanA activities, although some individual
differences exist.
S. intermedius toxicity to HepG2 cells: suppression by human plasma. It was
reported that the average level of ILY production by S. intermedius isolates from
deep-seated abscesses is significantly higher than that produced by the strains found
in normal habitats (14). Therefore, we compared toxicity toward HepG2 cells between
ILY-low-producing strain PC574 and ILY-high-producing strain UNS38 in FBS containing

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 8

Expression Control Mechanisms of Intermedilysin Infection and Immunity

FIG 7 Toxic effects of S. intermedius on HepG2 cells. ILY-low-producing strain PC574 (A) or ILY-high-
producing strain UNS38 (B) was used to infect HepG2 cells. Cytotoxic effects were examined by
measuring the remaining lactate dehydrogenase activity in the cells at 24 h postinfection. Black bars,
survival (%) of HepG2 cells infected and cultured in DMEM; white bars, survival (%) of HepG2 cells
infected and cultured in FBS containing the indicated concentrations of human plasma. Error bars are
standard deviations from three independent experiments.

various amounts of human plasma (Fig. 7). UNS38 was isolated from a human brain
abscess and has a point mutation (V21D) in the DNA-binding domain of LacR; this
mutation causes a loss of activity of LacR and higher production of ILY (21). PC574 was
not cytotoxic toward HepG2 cells in Dulbecco’s modified Eagle medium (DMEM) after
24 h of infection (Fig. 7A). Although this medium contained 10% FBS, this amount was
insufficient for overproduction of ILY (data not shown). In contrast to the DMEM results,
PC574 showed very significant cytotoxicity in FBS: approximately 80% of the HepG2
cells were killed after 24 h of infection. Nonetheless, addition of only 2.5% human
plasma efficiently neutralized the cytotoxicity of strain PC574. Strain UNS38 showed
much stronger cytotoxicity toward HepG2 cells than PC574, and almost all cells were
killed after 24 h of infection in the DMEM and FBS (Fig. 7B). Furthermore, for strain
UNS38 more than 10% human plasma was needed to rescue a considerable number of
HepG2 cells. These data clearly show that highly pathogenic strain UNS38 requires a
stronger immune defense to neutralize its cytotoxicity than the ILY-low-producing
strain PC574.

DISCUSSION
It has been reported that the microbiota with ␤-Gal, ␤-GlcNAc, and Neu activities
can survive dental restoration by extracting sugars (galactose, N-acetyl-D-glucosamine,
and N-acetylneuraminic acid) for nutrition from serum glycoproteins originating from
the pulp via dental tubules to the infected dentin (30). We showed that the galactose
and N-acetylneuraminic acid liberated from glycans in FBS by MsgA and NanA can
promote the production of ILY, MsgA, and NanA (Fig. 1 to 3). These data point to
“positive feedback” regulation for ILY production in S. intermedius (Fig. 8). If abundant
glucose is present in the environment, then this pathogen can suppress the production
of ILY and MsgA by catabolic repression (Table 1). Under glucose starvation conditions,
if glycans exist in the environment, S. intermedius can degrade them and liberate
monosaccharides, including galactose and N-acetylneuraminic acid, which may pro-
mote not only ILY production but also expression of MsgA and NanA. The glycosidases
produced may further promote the degradation of glycans; consequently, ILY expres-
sion may further increase, as observed in FBS (Fig. 1). This “positive feedback” regula-
tion may perform an important function in S. intermedius for its survival in the normal
habitat such as the oral cavity in being able to obtain a carbon source from human
serum.
In contrast to FBS, human plasma obtained from healthy volunteers could not
activate ily expression in S. intermedius; human-plasma-cultured cells showed only a
weak hemolytic activity (Fig. 4). In addition, the suppressive effect on hemolytic activity
of FBS-cultured cells was measured by adding 2% of individual plasma samples. We

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 9

Tomoyasu et al. Infection and Immunity

FIG 8 Schematic representation of the possible regulatory mechanism through the action of blood compo-
nents on ily expression. Gal, galactose; GlcNAc, N-acetyl-D-glucosamine; NANA, N-acetylneuraminic acid.

found that 5 of 10 blood plasma samples from healthy volunteers effectively sup-
pressed the hemolytic activity (data not shown). ELISA results revealed that effectively
suppressive human plasma (eHP) samples contain significantly higher antibody titers
against ILY than iHP samples (Fig. 5A). Conversely, the antibody titers against MsgA and
NanA were not significantly different between eHP and iHP. Therefore, the most
important factor for suppression of hemolytic activity seems to be antibodies reacting
with ILY. Indeed, eHP samples showed stronger neutralizing activity toward ILY than did
the other plasma samples (Fig. 5B). The underlying reason why eHP samples have a
higher antibody titer against ILY might be that several cholesterol-dependent cytolysins
share relatively high homology with ILY: vaginolysin from Gardnerella vaginalis (60%),
S. mitis-derived human platelet aggregation factor (Sm-hPAF) (56%), and pneumolysin
from Streptococcus pneumoniae (53%). Infection with these pathogens and exposure to
these toxins might result in an increase in antibodies cross-reactive with ILY. Another
possibility is that we estimate that ⬎50% of the human population carry S. intermedius,
as determined previously in a study of 162 subjects (31). In addition, when comparing
the oral microbiota at tumorous and nontumorous sites in 10 patients with oral
squamous cell carcinoma (32), it was found that S. intermedius was present in 70%
of patients at both nontumorous and tumorous sites. Furthermore, microbiomic
data from 16S rRNA sequences indicate that a high proportion of the population
carry S. intermedius; samples derived from the tonsillar crypts from four of five adult
patients with recurrent tonsillitis contained abundant S. intermedius populations
(2.7 to 44.1% of the total number of 16S rRNA sequences), and three of five healthy
adults also carried S. intermedius, although the proportion was low (0.006 to
0.078%) (33). Therefore, it is highly possible that persons who have a higher
antibody titer against ILY may carry or have a history of infection with this
pathogen.
Unlike antibody titers against ILY, titers against MsgA and NanA were not found to
be statistically significantly different between eHP and iHP samples; nevertheless,
human plasma neutralized both MsgA and NanA activity as shown in Fig. 6B and C. In
addition, neutralizing activities against MsgA and NanA were observed in all human
plasma samples that we examined (data not shown), although the activities were
different among the plasma samples. Among AGS taxa, S. intermedius and S. constellatus
subsp. pharyngis are the only ones in which MsgA is found, although homologous
proteins with one of two glycosidase catalytic domains (LacZ domain and CH20
domain) of MsgA are present in some other Gram-positive bacteria; for example,
proteins homologous to the LacZ domain (more than 40% identity) are found in the
human intestinal commensal bacteria Bifidobacterium bifidum and bacteria from the
Lachnospiraceae family. Proteins with ⬎50% homology to the CH20 domain are also
found in several streptococci, including from the mitis group. In addition, some of the
mitis group species (S. pneumoniae, S. mitis, and S. oralis) produce Neu with ⬎70%

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 10

Expression Control Mechanisms of Intermedilysin Infection and Immunity

TABLE 2 Plasmids and bacterial strains used in this study

Reference
Plasmid or strain Relevant characteristic or source
Plasmids
pSETN1 Streptococcus-E. coli shuttle vector 20
pnanR pSETN1 carrying nanR with its own promoter region This study
pnanA pSETN1 carrying nanA with its own promoter region This study
pmsgA pSETN1 carrying msgA with lacR promoter region 26
pccpA pSETN1 carrying ccpA with its own promoter region 20
pUHE212-1 Expression vector for N-terminal His6-tagged fusion 40
pUHE212-1 nanA pUHE212-1 carrying nanA, which encoded mature NanA This study
pN-his nanA’ pUHE212-1 carrying nanA’, which encoded C-terminus- This study
deleted NanA

S. intermedius strains
NCDO2227 Type strain 14
UNS38 ILY-high-producing strain from human brain abscess 18
PC574 ILY-low-producing strain from human dental plaque 14
PC574 ΔmsgA msgA knockout mutant derived from strain PC574 26
PC574 ΔnanA nanA knockout mutant derived from strain PC574 26
PC574 ΔnanR nanR knockout mutant derived from strain PC574 This study
PC574 pSETN1 PC574 transformed with pSETN1 21
PC574 ΔmsgA pSETN1 PC574 ΔmsgA transformed with pSETN1 26
PC574 ΔmsgA pmsgA PC574 ΔmsgA transformed with pmsgA 26
PC574 ΔnanA pSETN1 PC574 ΔnanA transformed with pSETN1 This study
PC574 ΔnanA pnanA PC574 ΔnanA transformed with pnanA This study
PC574 ΔnanR pSETN1 PC574 ΔnanR transformed with pSETN1 This study
PC574 ΔnanR pnanA PC574 ΔnanR transformed with pnanA This study
PC574 ΔccpA pSETN1 PC574 ΔccpA transformed with pSETN1 This study
PC574 ΔccpA pccpA PC574 ΔccpA transformed with pccpA This study

sequence identity with S. intermedius NanA. Subjects harboring and/or infected with
these bacteria may develop increased titers of antibodies cross-reactive with MsgA or
NanA.
It has been shown that S. intermedius is more virulent in immunocompromised
patients with diabetes, cirrhosis, and cancer than in immunocompetent individuals
(34–36). We hypothesize that the plasma from immunocompromised persons would
not effectively neutralize ILY and glycosidase activities owing to differences in antibody
levels and that this incomplete neutralization will trigger a higher production of ILY via
“positive feedback” regulation. An ILY-high-producing clinical strain required a higher
concentration of human plasma to neutralize its cytotoxicity toward HepG2 cells (Fig.
7), and therefore this strain may pose a much higher risk for a healthy person who has
iHP. Some studies have shown an association between S. intermedius and upper
respiratory tract infections such as recurrent tonsillitis and lower respiratory tract
infections such as pneumonia and lung abscesses, notably in elderly patients (5–7, 13).
This is suggestive of an age-related reduction in immunocompetence toward S. inter-
medius consequently causing a serious infection due to ILY overproduction as a result
of “positive feedback” regulation. In populations with increasing life expectancy, the
proportion of elderly, immunocompromised patients will increase. Therefore, it should
be noted that an increasing number of serious pulmonary infections caused by S.
intermedius can be anticipated.

MATERIALS AND METHODS

Bacterial strains and growth conditions. The bacterial strains used in this study are listed in Table
2. S. intermedius was cultured at 37°C under anerobic conditions (CO2:H2:N2 ⫽ 5:10:85). Brain heart
infusion (BHI) broth and 3-(N-morpholino)propanesulfonic acid-buffered BHI (MOPS-BHI) broth were
used as culture media supplemented with glucose or other sugars at the concentrations described below
(20). BHI-gal broth containing 35 g/liter BHI broth without dextrose and 2.0 g/liter galactose was used for
purification of MsgA. Escherichia coli cells were grown in Luria-Bertani (LB) broth at 37°C under aerobic
conditions. Antibiotics were used at the following concentrations: ampicillin at 100 ␮g/ml and chlor-
amphenicol (Cm) at 20 ␮g/ml for E. coli; chloramphenicol at 2 ␮g/ml, erythromycin (Em) at 1 ␮g/ml, and
spectinomycin (Spc) at 50 ␮g/ml for S. intermedius.

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 11

Tomoyasu et al. Infection and Immunity

TABLE 3 Oligodeoxynucleotides used in this study

Purpose Name Sequence (5= to 3=)
Disruption of nanR ΔnanR F GCCAACTATTGAAGAACACCGCCATATAAAACC
ΔnanR Bam R GGCTTTGGATCCTCGCCATGATACGTTGCG
ΔnanR Pst F CGCACTGCAGCACAATTTCCTATGCTACTGATG
ΔnanR R CAGTTCAAGAAAGTGGTAGAAGAAACATTTGCC
pGH EM Bam F GTTCATATTTATCAGGATCCTCTAGAGTCAC
pGH EM Pst R TTATCTGCAGTCCCTTTAGTAACGTGTAACTTTCC

Disruption of ccpA ΔccpA F AAGAATTCAAAATGCTTGAAAGTGTTTCCAATAAGTG

ΔccpA R GACTGCAGGCCTAACGGCCTCTTCTTTATTTCC

Complementation of comp nanA F GTGTTGCTAAAATTTTTCTTTGCTTAATAGAATTG

ΔnanA mutant comp nanA R GCTAGTTTTACTGTTTTCTTTTATTTATCATTGTC
In-F pSET nanA F AACAGTAAAACTAGCCCCGGGTACCGAGCTCG
In-F pSET nanA R AAATTTTAGCAACACCTGCAGGGATATATTCCGC

Complementation of comp nanR F TTTTTTATTAGTCGTTGGAGACAAGATCTATCAAC

ΔnanR mutant comp nanR R GTTTGATGCATTATTTATGTCGCCTATAATAGCC
In-F pSET nanR F AATAATGCATCAAACGAATTCACTGGCCGTCG
In-F pSET nanR R ACGACTAATAAAAAAGGATCCTCTAGAGTCGACC

Construction of ily-Rluc Rluc Eco F CAGAATTCTAAGGAGGAAGCTAGCCACC

operon Rluc Sal R CCGTCGACTTATTGTTCATTTTTGAGAAC
Em Bam F AATGGATCCCCCGATAGCTTCCGCTATTG
Em Sal R CAGTAGTCGACCTAATAATTTATCTAC
ily Rluc F CTATTAGTGTAAACTTACCGGGATTG
ily Rluc R AAGAATTCTTAATCAGTGTTATCTTTCAC
ily Em F AAGGATCCTTCATTGAACTATCTTCCATTC
ily Em R GTGTATCTTGCGCAGGACGACACC
ily-Rluc Em F GAAAGTAATCTTACAGTTGAAAATCCATCC
ily-Rluc Em R CACTCTTGTTTATCGGATTCCCTATGTGC

Cloning of nanA into nanA F AATACTAAAAAAGTTGAATCAGGGATAAATAATTC

N-his tag vector nanA R TTACTGTTTTCTTTTATTTATCATTGTCAACAATC
In-F his F AAAAGAAAACAGTAAAAGCTTAATTAGCTGAGC
In-F his R AACTTTTTTAGTATTGGATCCGTGATGGTGATGG
nanA ΔC F CAGTAACCCGGGAATTAGCTGAGCTTGGACTCCTG
nanA ΔC R CTACCTGTCCCGGGTTAGTTATGATGATTTGTCAAGAC

Probes for qRT-PCR qRT-nanA F CAGGCTTGAAACAGGTAAATACAG

qRT-nanA R CCAATTGTCTAGCATAGTAATCACG
qRT-gyrB F CTCAACTTCAAAGGAAGGACTTCAC
qRT-gyrB R GACCATCGTCGACAACCGTAATCG

Databases and sequence alignment. The nucleotide sequence of nanR (GenBank accession no.
ABJ54536.1) in Streptococcus pneumoniae was obtained from the Microbes genomic databases by an
Entrez BLAST cross-database search at the National Center for Biotechnology Information (National
Institutes of Health, USA). The nucleotide sequence of the nanR homolog was obtained from the genome
sequence of S. intermedius type strain NCDO2227 (GenBank accession no. AP010969). The protein
homology search between NanR from S. pneumoniae and the NanR homolog from NCDO2227 was
performed using the Needleman-Wunsch Global Align Protein Sequences of BLAST (National Institutes
of Health, USA). Homologous proteins to S. intermedius NanA and MsgA (LacZ domain and CH20 domain,
respectively) distributed among indigenous or pathogenic bacteria of humans were found by means of
the Standard Protein BLAST (National Institutes of Health, USA).
Generation of nanR and ccpA knockout mutants from strain PC574. The nanR knockout mutant
(ΔnanR mutant) was produced by homologous recombination. The 5= region of a nanR DNA fragment
(755 bp) was amplified from the genome of NCDO2227 using primer ΔnanR F and internal primer ΔnanR
Bam R (Table 3) and was then digested with BamHI. The 3= region of the latter (830-bp) DNA fragment
was amplified from the genome of NCDO2227 using internal primer ΔnanR Pst F and ΔnanR R (Table 3)
and was subsequently digested with PstI. An Em resistance cassette (1,090 bp) was amplified from the
thermosensitive suicide vectors pGh9:ISS1 (37) with the primers pGH Em Bam F and pGH Em Pst R (Table
3). The BamHI- and PstI-digested erythromycin cassette was ligated with the BamHI-digested 5= region
and PstI-digested 3= region, and the ligated fragment was then amplified by PCR using the primers
ΔnanR F and ΔnanR R. The amplified fragment was used to construct the ΔnanR mutant. To knock out
ccpA in strain PC574, the ΔccpA region was amplified by PCR using the primers ΔccpA F and ΔccpA R
from the UNS38 ΔccpA mutant (20) (Table 2). The resulting 3.1-kbp fragment was used to construct the
ΔccpA mutant.

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 12

Expression Control Mechanisms of Intermedilysin Infection and Immunity

The ΔnanR and the ΔccpA mutants were produced via transformation of competence-stimulating
peptide (CSP)-treated PC574 cells with each PCR amplicon according to the method described previously
(20). Colonies were selected on BHI agar containing 1 ␮g/ml Em. Disruption of nanR was confirmed by
PCR, and Neu activity was checked. Disruption of ccpA was confirmed by PCR and immunoblotting using
mouse anti-CcpA antiserum (20).
Complementation of S. intermedius PC574 ⌬nanA, ⌬nanR, and ⌬ccpA strains. To complement
the PC574 ΔnanA mutant (26), the nanA fragment (3,183 bp) that contained the nanA coding region and
its own promoter region was amplified by PCR using the primers comp nanA F and comp nanA R from
the chromosomal DNA of NCDO2227 (Table 3). The Streptococcus-E. coli shuttle vector pSETN1 (20) was
linearized by inverse PCR using the primers In-F pSET nanA F and In-F pSET nanA R (Table 3). The
linearized plasmid (5,904 bp) consisted of pSETN1 and a 15-bp extension (5=) complementary to the ends
of the nanA fragment. Subsequently, the nanA fragment was cloned into the linearized plasmid using the
In-Fusion HD Cloning kit (TaKaRa Bio Inc., Shiga, Japan). The resultant plasmid (pnanA) was transfected
into E. coli DH5␣Z1 (38).
A plasmid, pnanR, for complementation of PC574 ΔnanR was also constructed using a method similar
to the one that was used to create pnanA. The nanR fragment (1,087 bp) that contained the nanR coding
region and its own promoter region was amplified by PCR using the primers comp nanR F and comp
nanR R from the chromosomal DNA of NCDO2227 (Table 3). The pSETN1 vector was linearized by inverse
PCR using the primers In-F pSET nanR F and In-F pSET nanR R (Table 3). The linearized pSETN1 had a
15-bp extension (5=) complementary to the ends of the nanR fragment (5,906 bp). The nanR fragment
was cloned into the linearized plasmid using the In-Fusion HD Cloning kit. The resultant plasmid (pnanR)
was transfected into DH5␣Z1. Subsequently, pnanA and pnanR were extracted from DH5␣Z1 cells and
used for transformation of CSP-treated PC574 ΔnanA and ΔnanR mutants, respectively. Transformants
were selected and isolated on a BHI agar plate containing 2 ␮g/ml Cm. Complementation of mutants
ΔnanA and ΔnanR was confirmed by PCR, and the mutants were tested for Neu activity.
The ccpA trans-complemented strain of the PC574 ΔccpA mutant was created according to a method
described elsewhere (20). Transformants were selected and isolated on a BHI agar plate containing 2
␮g/ml Cm. Complementation of ΔccpA was verified by PCR and immunoblotting using mouse anti-CcpA
antiserum.
Construction of ily-Rluc operon. To estimate the expression level of ily by luciferase activity, the
Renilla luciferase gene (Rluc) was inserted just downstream of ily in the genome of S. intermedius PC574.
The Rluc locus was amplified from pZA43 Rluc (39) using Rluc Eco F and Rluc SalI R primers (Table 3). The
Em cassette was also amplified from the UNS38 B3 (18) genomic DNA using Em Bam F and Em Sal R
primers (Table 3). Amplified Rluc and Em cassettes were digested with SalI and ligated with T4 DNA
ligase. The ligated fragment (Rluc-Em) was amplified using Rluc Eco F and Em Bam F primers. Amplified
Rluc-Em was digested with EcoRI and BamHI. The 1,134-bp 3= region of ily (3=ily) was amplified from S.
intermedius UNS38 (18) genomic DNA using ily Rluc F and ily Rluc R primers (Table 3) and digested with
BamHI. A 1,275-bp downstream region of ily (Dily) was also amplified from the UNS38 genomic DNA
using ily Em F and ily Em R primers (Table 3) and then digested with EcoRI. All restriction fragments (3=ily,
Rluc-Em, and Dily) were ligated with T4 DNA ligase. Finally, the ligation product was amplified using
ily-Rluc Em F and ily-Rluc Em R primers. PC574 ily-Rluc was constructed by transformation of CSP-treated
PC574 with the final PCR amplicon. Transformed colonies were isolated on a BHI agar plate containing
1 ␮g/ml Em. The conformation of the ily-Rluc operon in PC574 was confirmed by PCR and nucleotide
sequencing, and hemolytic and luciferase activities were measured.
Luciferase activity measurements. PC574 ily-Rluc cells were grown in MOPS-BHI broth, FBS, mixed
human plasma obtained from 10 healthy volunteers, or FBS containing 2% human plasma for 24 h at
37°C. A 20-␮l aliquot of these cultures was used to determine luciferase activity using a Sirius luminom-
eter (Berthold Detection Systems, Pforzheim, Germany) and the Renilla luciferase assay system (Promega
Corporation, Madison, WI, USA). The relative luciferase activity (RLU) was normalized to the OD600 of each
culture.
Construction of an N-His-tagged NanA-expressing vector. The fragment excluding 135 bp of the
5= region for the signal sequence for nanA (2,628 bp) was amplified from genomic DNA of S. intermedius
type strain NCDO2227 using nanA F and nanA R primers (Table 3). The N-terminally His-tagged vector
pUHE212-1 (40) was linearized by inverse PCR using primers In-F his F and In-F his R (Table 3). The
linearized plasmid (2,959 bp) contained pUHE212-1 and 15-bp extensions (5=) complementary to the
ends of nanA. The nanA fragments were cloned into the linearized plasmid using the In-Fusion HD
cloning kit. The resultant plasmid (pUHE212-1nanA) was transfected into DH5␣Z1. Because the product
for this construct contained the sortase recognition signal (41) with the motif LPSTG followed by a highly
hydrophobic transmembrane sequence at the C terminus (a 74-amino-acid region), the purified protein
showed low solubility. Therefore, the sequence encoding the C-terminal region was removed from the
DNA fragment by inverse PCR. pUHE212-1 nanA was linearized by PCR using nanA ΔC F and nanA ΔC R
primers (Table 3). The amplified fragment was digested with XmaI and self-ligated with T4 ligase. The
resultant plasmid (pN-his nanA’) was transfected into DH5␣Z1. Deletion of the C-terminal region in nanA
was confirmed by nucleotide sequencing.
Purification of MsgA and recombinant NanA. MsgA was purified according to a method described
previously (26), with minor modifications. To avoid catabolite repression of msgA expression by CcpA,
BHI-galactose (BHI-gal) broth was used instead of BHI broth as the culture medium to purify secreted
MsgA from the PC574 ΔlacR::Δily double mutant. Because the LacZ domain of MsgA responsible for ␤-Gal
and ␤-D-fucosidase activity (26) showed acid lability (data not shown), the pH of the sodium acetate
buffer was changed from 5.5 to 6.0.

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 13

Tomoyasu et al. Infection and Immunity

N-His-tagged NanA was purified as follows. DH5␣Z1 cells were transformed with pN-his nanA’ and
were cultured in LB broth at 37°C for 2 h. Overexpression of a recombinant NanA was induced by adding
a final concentration of 1 mM isopropyl-␤-D-1-thiogalactopyranoside (IPTG) to mid-log-phase cells and
incubating the culture at 37°C for 3 h. The cells were harvested by centrifugation (5,000 ⫻ g, 30 min, 4°C)
and resuspended in a buffer consisting of 20 mM Tris-HCl (pH 8.0), 100 mM NaCl, and 1 mg/ml lysozyme.
The suspension was sonicated with an Astrason XL2020 ultrasonic processor (Misonix Inc., Farmingdale,
NY, USA). The resultant cell extract was centrifuged at 10,000 ⫻ g for 30 min at 4°C to remove unbroken
cells and debris, and the supernatant was subjected to the following purification. The supernatant was
loaded onto a 5-ml HisTrap FF column (GE Healthcare, Buckinghamshire, UK). The column was then
washed with 50 mM NaPO4 (pH 7.5) containing 300 mM NaCl and 20 mM imidazole. Proteins bound to
the column were eluted with a linear 20 to 250 mM gradient of imidazole in 50 mM NaPO4 (pH 7.5)
containing 300 mM NaCl. Peak fractions were 10-fold diluted with NaPO4 buffer (pH 7.5) containing 10%
glycerol and loaded onto a 5-ml HiTrap SP HP column (GE Healthcare, Buckinghamshire, UK). Proteins
were eluted with a linear 0 to 1.0 M gradient of NaCl in 50 mM NaPO4 buffer (pH 7.5) containing 10%
glycerol, and the peak fractions of the recombinant NanA were frozen and stored at ⫺80°C until use.
Detection of glycosidase activity in cell suspensions and culture supernatants. S. intermedius
PC574 and its derivative strains were cultured under various conditions at 37°C for 24 h. Assays
employing 4-methylumbelliferyl (4-MU)-linked fluorogenic substrates [4-MU-␤-D-galactopyranoside,
4-MU-N-acetyl-␤-D-glucosaminide, and 2=-(4-MU)-␣-D-N-acetylneuraminic acid sodium salt hydrate] were
performed as described previously (26).
Quantification of sugars. To quantify the N-acetylneuraminic acid and galactose released from
glycans in FBS, a reaction mixture containing 100 ␮l FBS, 1 nM purified NanA and/or 1 nM purified MsgA,
100 mM citrate buffer (pH 6.0), 200 U/ml penicillin G potassium salt and 1 mg/ml streptomycin (for
preservation purposes), and 200 ␮l of ultrapure water was prepared and incubated up to 36 h at 37°C.
MsgA- and NanA-neutralizing immunoglobulin activity was examined after incubation for 36 h at 37°C
with human plasma at 1% (vol/vol) final concentration. Galactose concentration in a 25-␮l aliquot of
reaction mixture was determined using an F-kit for lactose/D-galactose (Roche Diagnostics K.K., Basel,
Switzerland) according to the manufacturer’s instructions. After the reaction, the A340 of each sample was
measured in a spectrophotometer, BioSpec-mini (Shimadzu, Kyoto, Japan). The N-acetylneuraminic acid
concentration was determined using a sialic acid (N-acetylneuraminic acid [NANA]) colorimetric/fluoro-
metric assay kit (BioVision, CA, USA) according to the manufacturer’s instructions. The reaction mixture
was 20-fold diluted, and then NanA was inactivated by heat treatment at 100°C for 10 min. The
heat-treated sample was centrifuged for 5 min at 17,400 ⫻ g. Subsequently, 50 ␮l of the supernatant was
used to determine the amount of N-acetylneuraminic acid present. After the reaction, the A570 of each
well was measured on a microplate photometer, Multiskan FC (Thermo Fisher Scientific Inc., MA, USA).
The concentration of intrinsic glucose in FBS was determined using a Glucose CII-Test WAKO kit (Wako
Pure Chemical Industries, Osaka, Japan) according to the manufacturer’s instructions. After the reaction,
the A505 of each sample was measured in a BioSpec-mini spectrophotometer.
Hemolysis assay. S. intermedius cells were grown under various conditions at 37°C for 24 h,
anaerobically. The culture supernatant was obtained by centrifugation (5,000 ⫻ g) and standardized by
dilution with chilled phosphate-buffered saline (PBS) containing 0.1% bovine serum albumin (BSA)
(PBS-B) to attain an OD600 of 0.25 to 0.5 for the assay. Hemolysis was assayed as described by Lehrer et
al. (42), with several modifications. Briefly, erythrocytes from human blood stored in sterilized Alsever’s
solution were washed three times with chilled PBS-B at 4°C with centrifugation (1,000 ⫻ g) and were
resuspended in chilled PBS-B at 1% by volume. The culture supernatant was 2-fold serially diluted with
chilled PBS-B before each experiment. Assays were carried out in 96-well plates with a final volume of
100 ␮l/well. Each 50 ␮l of the diluted culture supernatants and erythrocyte suspension was added
to the wells. In addition, 50 ␮l of PBS-B or ultrapure water was added to each well containing the
same volume of erythrocyte suspension for the negative and positive control of hemolysis. Then, the
96-well plate was incubated in a PST-100HL plate shaker-thermostat (Biosan, Riga, Latvia) at 37°C for
1 h with shaking at 1,000 rpm. After the reaction, the A650 of each well was measured in a Multiskan
FC microplate photometer. The percentage of hemolysis was calculated as follows: hemolysis (%) ⫽
[(A650 of the sample containing only PBS-B ⫺ A650 of the sample containing diluted culture
supernatant)/(A650 of the sample containing only PBS-B ⫺ A650 of the sample completely hemolyzed
by hypotonic processing)] ⫻ 100.
Neutralizing activity of human plasma against ILY. Assays were conducted in 96-well plates; 50
␮l of 1% human erythrocyte suspension was added to each 50-␮l reaction mixture containing 2 ng of
purified ILY (43) and human plasma (A to J) diluted from 2-fold to 128-fold with PBS-B. The 96-well plate
was then incubated in a PST-100HL plate shaker-thermostat (Biosan, Riga, Latvia) as described above. The
neutralization activity was calculated as follows: neutralization activity ⫽ [dilution rate of human plasma
(A to J) showing 50% inhibition of hemolysis]/(dilution rate of human plasma A showing 50% inhibition
of hemolysis). The neutralization activity of plasma A was set to 1.0.
Enzyme-linked immunosorbent assay. To estimate the titers of anti-ILY, anti-MsgA, and anti-
NanA immunoglobulin present in the human plasma, an enzyme-linked immunosorbent assay
(ELISA) was carried out as follows. Each purified protein was diluted with PBS to 0.2 ␮g/ml. Fifty
microliters of the diluted protein was dispensed into the wells of an F96 Maxisorp Nunc-Immuno
Plate (Thermo Fisher Scientific Inc., MA, USA) and allowed to adsorb to well walls at 4°C overnight.
Subsequently, each well was blocked with 300 ␮l of Blocking One (Nacalai Tesque, Kyoto, Japan) at
room temperature for 30 min. After twice washing each well with 300 ␮l of TBS-T (20 mM Tris-HCl
[pH 7.5], 150 mM NaCl, 0.1% Tween 20), human plasma diluted from 500-fold to 64,000-fold with

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 14

Expression Control Mechanisms of Intermedilysin Infection and Immunity

TBS-T was added at 100 ␮l/well, and the plate was shaken for 30 s at 100 rpm on a PSU-2T
Mini-shaker (Biosan, Riga, Latvia). The antigen-antibody reaction between purified protein and
human plasma was conducted at room temperature for 60 min. After the reaction, each well was
washed three times with 300 ␮l of TBS-T. The bound antibody was quantified using the ELISA POD
Substrate TMB kit (Nacalai Tesque, Kyoto, Japan) according to the manufacturer’s instructions. After
the reaction, the absorbance value (OD450 ⫺ OD650) was measured using a microplate photometer.
Quantitative RT-PCR analysis. PC574 was cultured in the MOPS-BHI broth for 18 h or in FBS for 24
h at 37°C. Isolation of total RNA from the cells was performed as described previously (20). The relative
transcription of msgA and nanA was compared by real-time PCR (Thermal Cycler Dice Real Time System
Lite; TaKaRa Bio Inc.) using SYBR Premix Ex Taq II (Tli RNaseH Plus; TaKaRa Bio Inc.). Quantification of msgA
mRNA and nanA mRNA was carried out using the primer set qRT-msgA F and qRT-msgA R (26) and the
primer set qRT-nanA F and qRT-nanA R (Table 3), respectively. The primer set of qRT-gyrB F and qRT-gyrB
R was used for amplification of an internal control gyrB mRNA to normalize the amount of total RNA in
each sample (Table 3). Thermal cycling conditions were as follows: initial denaturation at 95°C for 30 s,
followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The semiquantitative comparison of the
transcription of msgA and nanA was conducted using the threshold cycle (CT) value determined by the
second derivative maximum method of the Multiplate RQ software (TaKaRa Bio Inc.). The CT value of gyrB
was used as a standard. Standard deviations were calculated from data from six independent experi-
ments.
Infection assay. Human hepatoma cell line HepG2 cells in 180 ␮l of DMEM containing 10% FBS
without antibiotics (DMEM) were dispensed into the wells of a 96-multiwell tissue culture plate (5 ⫻ 104
cells/well) and cultured overnight at 37°C in the presence of 5% CO2. PC574 and UNS38 cells were grown
in BHI broth at 37°C for 9 h under anaerobic conditions. For cell infection, bacterial cultures were
centrifuged at 13,000 ⫻ g for 5 min, and the bacterial cell pellets were resuspended at the density of 5 ⫻
105 cells per 100 ␮l of DMEM or FBS containing various amounts of the heat-inactivated mixed human
plasma from four healthy volunteers. Subsequently, the culture medium in the tissue culture plate was
completely removed, and cells were washed twice with Dulbecco’s phosphate-buffered saline (D-PBS)
with Ca2⫹ and Mg2⫹. The infection assay was started by addition of 100 ␮l of the bacterial suspension
to the HepG2 cells. After 24 h of infection, the culture medium was removed, and the cells were washed
twice with D-PBS and lysed with 100 ␮l of 1% Triton X-100 in PBS. Each lysate was centrifuged at
13,000 ⫻ g for 5 min, and the supernatant was recovered. To assess the loss of viability of HepG2 cells,
the lactate dehydrogenase (LDH) activity in the supernatant was spectrophotometrically (A492) deter-
mined using the Cytotoxicity Detection kit (Sigma-Aldrich Corporation, St. Louis, MO, USA) according to
the manufacturer’s instructions. The negative control (0% viability) was consistent with LDH activity in 1%
Triton X-100, and the positive control (100% viability) was consistent with LDH activity in 1% Triton X-100
extract from the cells which were cultured in bacterium-free DMEM or FBS. The level of cytotoxicity was
calculated as follows: viability (%) ⫽ [(A492 of the extract from infected cells ⫺ A492 of 1% Triton X-100
as the control for 0% viability)/(A492 of the extract from the control with 100% viability ⫺ A492 of 1%
Triton X-100 as the control for 0% viability)] ⫻ 100.
Statistical analysis. All data are presented as means ⫾ standard deviations (SD). The differences
were evaluated using unpaired two-tailed Student’s t test. Differences were considered significant when
the probability value was less than 5% (P ⬍ 0.05).

SUPPLEMENTAL MATERIAL
Supplemental material for this article may be found at https://doi.org/10.1128/IAI
.00379-17.
SUPPLEMENTAL FILE 1, PDF file, 0.3 MB.

ACKNOWLEDGMENTS
We thank H. Imaki, N. Yamamoto, and H. Kai for their technical assistance.
This work was supported by KAKENHI (Grants-in-Aid for Scientific Research (C)
23590510, 26460528 and 15K1101200) from the Ministry of Education, Culture, Sports,
Science, and Technology (MEXT) of the Japanese Government.
We declare that we have no conflicts of interest.
Author contributions: conception and design of the study, T.T. and H.N.; collection
and assembly of data, T.T., T.Y., S.C., and S.K.; analysis and interpretation of data, all
authors; manuscript writing, T.T.; critical revision, R.A.W. and H.N.

REFERENCES
1. Whiley RA, Fraser H, Hardie JM, Beighton D. 1990. Phenotypic differen-
tiation of Streptococcus intermedius, Streptococcus constellatus, and Strep-
tococcus anginosus strains within the “Streptococcus milleri group”. J Clin
Microbiol 28:1497–1501.
2. Whiley RA, Hall LM, Hardie JM, Beighton D. 1999. A study of small-
colony, beta-haemolytic, Lancefield group C streptococci within the
anginosus group: description of Streptococcus constellatus subsp. phar-
yngis subsp nov, associated with the human throat and pharyngitis. Int
J Syst Bacteriol 49(Part 4):1443–1449. https://doi.org/10.1099/00207713
-49-4-1443.
3. Jensen A, Hoshino T, Kilian M. 2013. Taxonomy of the Anginosus group
of the genus Streptococcus and description of Streptococcus anginosus

September 2017 Volume 85 Issue 9 e00379-17 iai.asm.org 15

Tomoyasu et al.
subsp. whileyi subsp. nov. and Streptococcus constellatus subsp. vibor-
gensis subsp nov. Int J Syst Evol Microbiol 63:2506 –2519. https://doi.org/
10.1099/ijs.0.043232-0.
4. Tanner A, Maiden MF, Lee K, Shulman LB, Weber HP. 1997. Dental
implant infections. Clin Infect Dis 25(Suppl 2):S213–S217. https://doi.org/
10.1086/516243.
5. Jerng JS, Hsueh PR, Teng LJ, Lee LN, Yang PC, Luh KT. 1997. Empyema
thoracis and lung abscess caused by viridans streptococci. Am J Respir
Crit Care Med 156:1508 –1514. https://doi.org/10.1164/ajrccm.156.5.97
-03006.
6. Takayanagi N, Kagiyama N, Ishiguro T, Tokunaga D, Sugita Y. 2010.
Etiology and outcome of community-acquired lung abscess. Respiration
80:98 –105. https://doi.org/10.1159/000312404.
7. Noguchi S, Yatera K, Kawanami T, Yamasaki K, Fukuda K, Naito K, Akata
K, Nagata S, Ishimoto H, Taniguchi H, Mukae H. 2014. Pneumonia and
empyema caused by Streptococcus intermedius that shows the diagnos-
tic importance of evaluating the microbiota in the lower respiratory
tract. Intern Med 53:47–50. https://doi.org/10.2169/internalmedicine.53
.0971.
8. Weaver E, Nguyen X, Brooks MA. 2010. Descending necrotising
mediastinitis: two case reports and review of the literature. Eur Respir
Rev 19:141–149. https://doi.org/10.1183/09059180.00001110.
9. Saito N, Hida A, Koide Y, Ooka T, Ichikawa Y, Shimizu J, Mukasa A,
Nakatomi H, Hatakeyama S, Hayashi T, Tsuji S. 2012. Culture-negative
brain abscess with Streptococcus intermedius infection with diagnosis
established by direct nucleotide sequence analysis of the 16s ribo-
somal RNA gene. Intern Med 51:211–216. https://doi.org/10.2169/
internalmedicine.51.6419.
10. Whiley RA, Beighton D, Winstanley TG, Fraser HY, Hardie JM. 1992.
Streptococcus intermedius, Streptococcus constellatus, and Streptococcus
anginosus (the Streptococcus milleri group): association with different
body sites and clinical infections. J Clin Microbiol 30:243–244.
11. Yost S, Duran-Pinedo AE, Teles R, Krishnan K, Frias-Lopez J. 2015. Func-
tional signatures of oral dysbiosis during periodontitis progression re-
vealed by microbial metatranscriptome analysis. Genome Med 7:27.
https://doi.org/10.1186/s13073-015-0153-3.
12. Gray T. 2005. Streptococcus anginosus group: clinical significance of an
important group of pathogens. Clin Microbiol Newsl 27:155–159. https://
doi.org/10.1016/j.clinmicnews.2005.09.006.
13. Noguchi S, Yatera K, Kawanami T, Yamasaki K, Naito K, Akata K, Shimabu-
kuro I, Ishimoto H, Yoshii C, Mukae H. 2015. The clinical features of
respiratory infections caused by the Streptococcus anginosus group. BMC
Pulm Med 15:133. https://doi.org/10.1186/s12890-015-0128-6.
14. Nagamune H, Whiley RA, Goto T, Inai Y, Maeda T, Hardie JM, Kourai H.
2000. Distribution of the intermedilysin gene among the anginosus
group streptococci and correlation between intermedilysin production
and deep-seated infection with Streptococcus intermedius. J Clin Micro-
biol 38:220 –226.
15. Nagamune H, Ohnishi C, Katsuura A, Fushitani K, Whiley RA, Tsuji A,
Matsuda Y. 1996. Intermedilysin, a novel cytotoxin specific for human
cells secreted by Streptococcus intermedius UNS46 isolated from a hu-
man liver abscess. Infect Immun 64:3093–3100.
16. Billington SJ, Jost BH, Songer JG. 2000. Thiol-activated cytolysins: struc-
ture, function and role in pathogenesis. FEMS Microbiol Lett 182:
197–205.
17. Palmer M. 2001. The family of thiol-activated, cholesterol-binding
cytolysins. Toxicon 39:1681–1689. https://doi.org/10.1016/S0041-0101
(01)00155-6.
18. Sukeno A, Nagamune H, Whiley RA, Jafar SI, Aduse-Opoku J, Ohkura K,
Maeda T, Hirota K, Miyake Y, Kourai H. 2005. Intermedilysin is essential
for the invasion of hepatoma HepG2 cells by Streptococcus intermedius.
Microbiol Immunol 49:681– 694. https://doi.org/10.1111/j.1348-0421
.2005.tb03647.x.
19. Giddings KS, Zhao J, Sims PJ, Tweten RK. 2004. Human CD59 is a
receptor for the cholesterol-dependent cytolysin intermedilysin. Nat
Struct Mol Biol 11:1173–1178. https://doi.org/10.1038/nsmb862.
20. Tomoyasu T, Tabata A, Hiroshima R, Imaki H, Masuda S, Whiley RA,
Aduse-Opoku J, Kikuchi K, Hiramatsu K, Nagamune H. 2010. Role of
catabolite control protein A in the regulation of intermedilysin produc-
tion by Streptococcus intermedius. Infect Immun 78:4012– 4021. https://
doi.org/10.1128/IAI.00113-10.
21. Tomoyasu T, Imaki H, Masuda S, Okamoto A, Kim H, Waite RD, Whiley RA,
Kikuchi K, Hiramatsu K, Tabata A, Nagamune H. 2013. LacR mutations are
frequently observed in Streptococcus intermedius and are responsible for
September 2017 Volume 85 Issue 9 e00379-17
Infection and Immunity
increased intermedilysin production and virulence. Infect Immun 81:
3276 –3286. https://doi.org/10.1128/IAI.00638-13.
22. van Rooijen RJ, Gasson MJ, de Vos WM. 1992. Characterization of the
Lactococcus lactis lactose operon promoter: contribution of flanking
sequences and LacR repressor to promoter activity. J Bacteriol 174:
2273–2280. https://doi.org/10.1128/jb.174.7.2273-2280.1992.
23. Barriere C, Veiga-da-Cunha M, Pons N, Guedon E, van Hijum SA, Kok J,
Kuipers OP, Ehrlich DS, Renault P. 2005. Fructose utilization in Lactococ-
cus lactis as a model for low-GC gram-positive bacteria: its regulator,
signal, and DNA-binding site. J Bacteriol 187:3752–3761. https://doi.org/
10.1128/JB.187.11.3752-3761.2005.
24. Takao A, Nagamune H, Maeda N. 2010. Sialidase of Streptococcus
intermedius: a putative virulence factor modifying sugar chains. Micro-
biol Immunol 54:584 –595. https://doi.org/10.1111/j.1348-0421.2010
.00257.x.
25. Beighton D, Whiley RA. 1990. Sialidase activity of the “Streptococcus
milleri group” and other viridans group streptococci. J Clin Microbiol
28:1431–1433.
26. Imaki H, Tomoyasu T, Yamamoto N, Taue C, Masuda S, Takao A, Maeda
N, Tabata A, Whiley RA, Nagamune H. 2014. Identification and charac-
terization of a novel secreted glycosidase with multiple glycosidase
activities in Streptococcus intermedius. J Bacteriol 196:2817–2826. https://
doi.org/10.1128/JB.01727-14.
27. Pecharki D, Petersen FC, Scheie AA. 2008. LuxS and expression of
virulence factors in Streptococcus intermedius. Oral Microbiol Immunol
23:79 – 83. https://doi.org/10.1111/j.1399-302X.2007.00395.x.
28. Afzal M, Shafeeq S, Ahmed H, Kuipers OP. 2015. Sialic acid-mediated
gene expression in Streptococcus pneumoniae and role of NanR as a
transcriptional activator of the nan gene cluster. Appl Environ Microbiol
81:3121–3131. https://doi.org/10.1128/AEM.00499-15.
29. Miwa Y, Nakata A, Ogiwara A, Yamamoto M, Fujita Y. 2000. Evaluation
and characterization of catabolite-responsive elements (cre) of Bacillus
subtilis. Nucleic Acids Res 28:1206 –1210. https://doi.org/10.1093/nar/28
.5.1206.
30. Paddick JS, Brailsford SR, Kidd EA, Beighton D. 2005. Phenotypic and
genotypic selection of microbiota surviving under dental restorations.
Appl Environ Microbiol 71:2467–2472. https://doi.org/10.1128/AEM.71.5
.2467-2472.2005.
31. Whiley RA, Freemantle L, Beighton D, Radford JR, Hardie JM, Tillotsen G.
1993. Isolation, identification and prevalence of Streptococcus anginosus,
S. intermedius and S. constellatus from the human mouth. Microb Ecol
Health Dis 6:285–291. https://doi.org/10.3109/08910609309141337.
32. Pushalkar S, Ji X, Li Y, Estilo C, Yegnanarayana R, Singh B, Li X, Saxena D.
2012. Comparison of oral microbiota in tumor and non-tumor tissues of
patients with oral squamous cell carcinoma. BMC Microbiol 12:144.
https://doi.org/10.1186/1471-2180-12-144.
33. Jensen A, Fago-Olsen H, Sorensen CH, Kilian M. 2013. Molecular map-
ping to species level of the tonsillar crypt microbiota associated with
health and recurrent tonsillitis. PLoS One 8:e56418. https://doi.org/10
.1371/journal.pone.0056418.
34. Bert F, Bariou-Lancelin M, Lambert-Zechovsky N. 1998. Clinical signifi-
cance of bacteremia involving the “Streptococcus milleri” group: 51 cases
and review. Clin Infect Dis 27:385–387. https://doi.org/10.1086/514658.
35. Jacobs JA, Pietersen HG, Stobberingh EE, Soeters PB. 1995. Streptococcus
anginosus, Streptococcus constellatus and Streptococcus intermedius. Clin-
ical relevance, hemolytic and serologic characteristics. Am J Clin Pathol
104:547–553. https://doi.org/10.1093/ajcp/104.5.547.
36. Murray HW, Gross KC, Masur H, Roberts RB. 1978. Serious infections
caused by Streptococcus milleri. Am J Med 64:759 –764. https://doi.org/
10.1016/0002-9343(78)90514-4.
37. Maguin E, Prevost H, Ehrlich SD, Gruss A. 1996. Efficient insertional
mutagenesis in lactococci and other gram-positive bacteria. J Bacteriol
178:931–935. https://doi.org/10.1128/jb.178.3.931-935.1996.
38. Lutz R, Bujard H. 1997. Independent and tight regulation of transcrip-
tional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2
regulatory elements. Nucleic Acids Res 25:1203–1210. https://doi.org/10
.1093/nar/25.6.1203.
39. Tomoyasu T, Tabata A, Ishikawa Y, Whiley RA, Nagamune H. 2013.
Small heat shock protein AgsA: an effective stabilizer of enzyme
activities. J Biosci Bioeng 115:15–19. https://doi.org/10.1016/j.jbiosc
.2012.08.001.
40. Gamer J, Bujard H, Bukau B. 1992. Physical interaction between heat
shock proteins DnaK, DnaJ, and GrpE and the bacterial heat shock
iai.asm.org 16
Expression Control Mechanisms of Intermedilysin
transcription factor ␴32. Cell 69:833– 842. https://doi.org/10.1016/0092
-8674(92)90294-M.
41. Ton-That H, Marraffini LA, Schneewind O. 2004. Protein sorting to the
cell wall envelope of Gram-positive bacteria. Biochim Biophys Acta
1694:269 –278. https://doi.org/10.1016/j.bbamcr.2004.04.014.
42. Lehrer RI, Jung G, Ruchala P, Wang W, Micewicz ED, Waring AJ, Gillespie
EJ, Bradley KA, Ratner AJ, Rest RF, Lu W. 2009. Human ␣-defensins inhibit
September 2017 Volume 85 Issue 9 e00379-17
Infection and Immunity
hemolysis mediated by cholesterol-dependent cytolysins. Infect Immun
77:4028 – 4040. https://doi.org/10.1128/IAI.00232-09.
43. Nagamune H, Ohkura K, Sukeno A, Cowan G, Mitchell TJ, Ito W, Ohnishi
O, Hattori K, Yamato M, Hirota K, Miyake Y, Maeda T, Kourai H. 2004. The
human-specific action of intermedilysin, a homolog of streptolysin O, is
dictated by domain 4 of the protein. Microbiol Immunol 48:677– 692.
https://doi.org/10.1111/j.1348-0421.2004.tb03479.x.
iai.asm.org 17