J. Dairy Sci.
105:4749–4759
https://doi.org/10.3168/jds.2021-21618
© 2022, The Authors. Published by Elsevier Inc. and Fass Inc. on behalf of the American Dairy Science Association®.
This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
DNA-based qualitative and quantitative identification
of bovine whey powder in goat dairy products
Xueru Zhang, Chunyan Qiao, Shangchen Fu, Yang Jiao,
College of Food Engineering and Nutritional Science, Shaanxi Normal University, Xi’an 710062, Shaanxi, China
ABSTRACT
As one of the main ingredients in some milk powders,
whey powder is sometimes added to pure goat milk
products, which can cause health risks, economic fraud,
and unfair competition of food industries. This study is
the first to explore qualitative and quantitative meth-
ods to identify adulteration of bovine whey powder in
goat dairy products based on DNA. We extracted DNA
from whey powder using a modified DNA extraction
method; this exhibited good quality and integrity, with
purity of 1.53 to 1.75 and concentration of 122 to 179
ng/μL. Conventional PCR and real-time PCR were
compared for qualitative detection of bovine whey pow-
der; real-time PCR demonstrated sensitivity of 0.01 ng/
μL, which was higher than the 0.05 ng/μL detected by
the conventional PCR method. Furthermore, real-time
PCR was conducted for DNA quantitative detection,
with good linearity (R2 = 0.9858) obtained for bovine
whey powder contents from 0.1% to 30%. Relative er-
ror decreased with increase of the mixing proportion of
whey powder; the coefficient of variation above 0.1% of
the mixing ratio was close to or less than 5%; and the
relative standard deviation of repeatability results was
less than 5%. Considering the economic costs of test-
ing, conventional PCR could be performed first, and
samples with obvious intentional adulteration detected
can be further accurately quantified by real-time PCR.
Overall, this research provides a realistic and effective
method for qualitative and quantitative identification
of bovine whey powder in goat dairy products, thus
laying a good foundation for verification of goat dairy
product label claims and industrial control.
Key words: bovine whey powder, DNA quality, PCR,
adulteration detection
Received December 3, 2021.
Accepted February 16, 2022.
*Corresponding author: yongfeng200@​126​.com
4749
and Yongfeng Liu*
INTRODUCTION
The global dairy goat industry is currently expand-
ing rapidly. According to statistics, there are about
780 million goats in the world, and the annual produc-
tion of goat milk is approximately 12.2 million tonnes
(Ranadheera et al., 2019). According to the growth
trend of the goat milk market, an increase in goat milk
production of approximately 53% is expected by 2030
(Teixeira et al., 2021). The rapid development of the
goat milk industry could be mainly due to the beneficial
physiological effects and rich nutritional value of goat
milk, making it an indispensable raw material in the
dairy industry (Miller and Lu, 2019; Wu et al., 2020).
Recently, according to China’s regulations on in-
fant formula milk powder products, goat milk powder
manufacturers have been allowed to use bovine whey
powder instead of goat whey powder to produce goat
milk powder, but the animal origin of the raw mate-
rials for dairy products must be truthfully indicated.
Addition of whey powder to some medical nutritional
formulas and infant formulas can not only supplement
dietary protein in these formulas but can also adjust
the whey protein-to-casein ratio close to 60:40, which is
similar to that of human milk (Kassem, 2015; Gallier et
al., 2020). Although the protein composition difference
between bovine whey powder and goat whey powder is
slight, the yield between them is different (Sanmartín
et al., 2012). Most of China’s whey powder is imported
from abroad. In addition, the seasonal nature of goat
milk and the limitations of commercial production of
goat whey affect the price and output of goat whey
powder, making its price higher than that of bovine
whey powder (Roufou et al., 2021). As a result, bovine
whey powder has become an attractive target for goat
milk product adulteration (Ke et al., 2017). People
with milk allergies may be at risk if they consume pure
goat dairy products containing bovine whey powder.
At present, the detection of adulteration and con-
tamination of bovine whey powder in goat milk prod-
ucts has become one of the key points in the quality
control of goat milk products in China and abroad. In
 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS
recent years, several methods have been developed to
identify whey powder in goat milk products, includ-
ing spectroscopic techniques (de Carvalho et al., 2015;
Bilge et al., 2016; Andrade et al., 2019), electrophoresis
(de Oliveira Mendes et al., 2016), mass spectrometry
(Ke et al., 2017), and immunological strategies (Bremer
et al., 2008). All of these methods use lipids or proteins
as target analytes. However, some proteins in whey
powder are prone to denaturation during pasteuriza-
tion, evaporation, and drying (Muuronen et al., 2021).
Brick et al. (2017) found an approximately 20% loss of
identifiable proteins after pasteurization. In compari-
son, molecular biology methods targeting DNA could
maintain good sensitivity in processed dairy products
(Liao et al., 2017a). As far as we know, few studies
have focused on detecting adulteration of products with
bovine whey powder on the basis of DNA.
Considering the sensitivity and the research gap in
DNA-based identification of whey powder adulteration,
an improved method for DNA extraction from whey
powder was defined in this study, DNA quality was
evaluated, and PCR was carried out to evaluate adul-
teration of bovine whey powder in goat milk products
qualitatively and quantitatively. The accuracy and
repeatability of detection were discussed, to provide a
realistic and effective method for the qualitative and
quantitative identification of bovine whey powder in
goat dairy products.
MATERIALS AND METHODS
Sample Preparation
Fresh goat milk and bovine milk were collected from
local farm producers in Xi'an, Shaanxi province, China.
All samples were divided into 50-mL capped centrifuge
tubes under aseptic conditions and immediately trans-
ported to the laboratory in ice boxes. All milk samples
were preserved at −80°C until use. Goat whey powder
and bovine whey powder were produced referring to the
methods of Outinen et al. (2010) and Muuronen et al.
(2021). First, 200 mL of raw milk was dispensed into
10-mL centrifuge tubes and centrifuged at 1,677 × g for
30 min at 4°C to remove the upper fat and retain the
lower skim milk. Thermal sterilization was performed
at 72°C for 15 s. The pH of skim milk and goat milk
were adjusted to 4.6 and 4.1, respectively, to remove
casein. After standing at room temperature for 1 h,
the supernatant was collected by centrifugation at 604
× g for 15 min. Fat globules were filtered by 0.45-μm
microfiltration, and lactose was removed by 5,000-Da
ultrafiltration membrane. The whey obtained was im-
mersed in a water bath at 63°C for sterilization for 30
Journal of Dairy Science Vol. 105 No. 6, 2022
4750
min. Finally, whey powder was obtained by vacuum
freeze-drying and then preserved at −36°C.
The spiked models were prepared by admixtures
comprising 0.05, 0.1, 0.5, 1, 5, and 10% (wt/wt) bovine
whey powder in goat whey powder, with 3 replicates of
each sample.
DNA Extraction
Sample pretreatment procedures were based on im-
provements to our laboratory’s previous study (Liao
et al., 2017a). One gram of milk whey powder was
dissolved and diluted with purified water in a 10-mL
centrifuge tube, and centrifuged for 10 min at 1,677
× g and 4°C. After removing the upper semi-solid fat
and middle layers, the remaining sediment was washed
twice with 600 µL of PBS and centrifuged for 10 min
at 9,660 × g and 4°C in a 2-mL centrifuge tube. Then
we mixed 350 µL of extraction buffer, 50 µL of 20%
SDS, and 20 µL of proteinase K (20 mg/mL) with the
sediment, and the mixtures were incubated in a 56°C
water bath for 4 h and gently inverted every 30 min.
Afterward, the incubation fluid was wholly extracted
with an equal volume of Tris-phenol and centrifuged for
10 min at 9,660 × g and 4°C. The separated superna-
tant was extracted once with equal volumes of phenol,
chloroform, and isoamyl alcohol at a ratio of 25:24:1,
and chloroform and isoamyl alcohol at a ratio of 24:1
were extracted twice. The supernatant was centrifuged
at 4°C and 9,660 × g for 10 min. Finally, DNA was
precipitated with twice the volume of ice-cold absolute
ethanol and cooled in the −20°C refrigerator for 30 min,
followed by washing with 75% ethanol. Twenty-five
microliters of Tris-EDTA buffer was added to dissolve
DNA, and then it was preserved at −20°C.
Assessment of DNA Quality
A Nanodrop ND-1000 Spectrophotometer (Thermo
Fisher Scientific Inc.) was used to read the absorbance
at 260 nm and 280 nm to determine the concentration
and purity of total DNA. The DNA integrity was ex-
amined by agarose gel electrophoresis. Explicitly, each
DNA extract was run on a 1.0% (wt/vol) gel electropho-
resis at 100 V for 40 min. We used the bovine-specific
gene MT-ATP8 (Sangon Biotech) and the goat-specific
gene ATP6 (Sangon Biotech) to verify the amplifiable
mitochondrial DNA and the purity of the whey powder
(Table 1). The MT-ATP8 gene contains primers L8219
(forward) and H8357 (reverse). Both the MT-ATP8
primers and the ATP6 gene amplification reactions
were executed in a 10-μL mixed reaction system. The
reaction system included 3.4 μL of 2× Es Taq Master
 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS
Table 1. Primer sequences
Gene   Primer sequence (5′ to 3′)
1
MT-ATP8   Forward: GCCATATACTCTCCTTGGTGACA
Reverse: GTAGGCTTGGGAATAGTACGA
2
ATP6   Forward: TATTAGGCCTCCCCCTTGTT
Reverse: CCCTGCTCATAAGGGAATAGCCC
1
Primer sequences adopted from Tartaglia et al. (1998).
2
Primer sequences adopted from Liao et al. (2017a).
Mix TaqMan (CWBIO), 0.3 μL of specific primers, and
1 μL of template DNA, and the total volume was di-
luted up to 10 μL with DNA-free water (CWBIO). The
PCR protocol was performed with a real-time PCR
system (Bio-Rad) under the following thermal cycling
conditions: 95°C for 10 min; 30 cycles of PCR carried
out by denaturing at 94°C for 30 s; 52°C annealing for
30 s (MT-ATP8) or 60°C annealing for 30 s (ATP6);
72°C for 30 s; and a final extension at 72°C for 10 min.
Detection Sensitivity of Bovine Whey
Powder Ingredients
Using the total DNA extract of bovine whey powder,
the concentration was continuously diluted from 50 ng/
μL to 5 pg/μL to determine the detection sensitivity of
the assay. The diluted target was directly used for PCR
analysis. The reactions were conducted in triplicate.
Limit of Detection of Bovine Whey
Powder Ingredients
To verify the limit of detection (LOD) of bovine whey
adulteration, the bovine whey powder was thoroughly
blended into the goat whey powder in proportions of
10%, 5%, 1%, 0.5%, 0.1%, and 0.05%. According to
the previously described procedures, genomic DNA was
extracted from the obtained mixtures, and analysis was
carried out under conventional PCR reaction condi-
tions with 3 replicates for each sample. Pure bovine and
goat whey powders were used as positive and negative
controls, respectively.
Real-Time PCR Amplification Efficiency and LOD
To determine the sensitivity of the primer to MT-
ATP8, bovine whey powder DNA extract was diluted
in a 10-fold gradient with DNA concentration ranging
from 100 ng/μL to 0.01 ng/μL. We used the logarithm
of the initial DNA quantity as the abscissa and the cycle
threshold (Ct) values of the real-time PCR analysis as
Journal of Dairy Science Vol. 105 No. 6, 2022
4751
Fragment length (bp)
271
294
the ordinate to construct a sensitivity standard curve.
The slope of the standard curve was substituted into
the formula to obtain the amplification efficiency (E).
The reaction system containing 5 μL of 2× Ultra SYBR
Mixture (CWBIO), 0.2 μM of assay-specific primers, 1
μL of template DNA, and double-distilled H2O added
up to 10 μL, and the following amplification program
was performed: 95°C for 10 min followed by 40 cycles
of 95°C for 10 s, 60°C annealing for 30 s, and 72°C
for 30 s using a real-time PCR system (Thermo Fisher
Scientific Inc.):
E (%) = [10(−1/slope) – 1] × 100. [1]
Preparation of Quantitative Standard Curve
Binary mixing of 0.1, 0.5, 1, 5, 10, and 30% (wt/wt)
pure bovine whey powder with pure goat whey powder,
respectively, was performed, DNA was extracted, and
concentrations were normalized to 100 ng/μL. The
quantitative standard curve was constructed with loga-
rithm of percentage content of bovine whey powder as
x-axis and Ct values obtained by real-time PCR analy-
sis as y-axis. The reaction procedures were controlled
according to the previously described real-time PCR
steps.
Method Validation
The accuracy of the method was determined by re-
peated DNA analysis of 0.1%, 0.5%, and 1% binary
mixtures of whey powders (n = 10). The relative error
and coefficient of variation (CV) were calculated to re-
flect the trueness and precision of the methodology. At
the same time, Student’s t-test was performed on the
actual percentage of bovine whey powder in goat whey
powder and the measured values, to express significant
differences. In addition, 100 ng/μL DNA was continu-
ously diluted 10-fold to 0.01 ng/μL and analyzed on 3
different days, and the relative standard deviations of
Ct values were calculated to reflect the repeatability of
the method.
 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS
Referencing the analysis of adulteration detection
technique of Li et al. (2020), we performed an economic
comparison and evaluation of common technology for
DNA-based adulteration detection.
RESULTS AND DISCUSSION
DNA Yield and Purity
In molecular biology experiments, to obtain the best
results from the extracted DNA in downstream applica-
tions, specific nucleic acid concentrations and purity
levels are generally required (Boesenberg-Smith et al.,
2012). The DNA concentrations in all whey powder
samples were in the range of 122 to 179 ng/μL, and the
ratio of absorbance at 260 to 280 nm (A260/A280) was
about 1.53 to 1.75. Compared with previous experi-
mental results on milk samples (Liu et al., 2014), the
purity ratios (A260/A280) in this experimental result
were similar, and the DNA concentration ranges were
higher than those of the milk samples. McKillip et al.
(2000) found that the extraction efficiency of DNA
from whey using the phenol, chloroform, and isoamyl
alcohol method was low and the total DNA yield was
extremely poor. Although the A260/A280 for satisfac-
tory DNA is generally considered to be between 1.8
and 2.0 (Ferrara et al., 2006; Xiong et al., 2019), the
purity of bovine whey powder DNA extract was higher
than that of DNA extractions from milk powder or
milk (Liao et al., 2017a,b, 2018b) according to current
relevant studies. This might be due to the optimization
of the DNA extraction procedures to remove more con-
taminants and inhibitors, such as proteins and phenols.
Our results showed that the improved DNA extraction
method from whey powder could extract satisfactory
DNA.
DNA Integrity
The integrity of total DNA extracted from differ-
ent proportions of bovine and goat whey powder was
evaluated by agarose gel electrophoresis (Figure 1).
The obtained bands of samples were relatively clear
and bright, and they had good integrity and only slight
smearing. According to reports, autoclaving not only
significantly degraded DNA in milk (Liao et al., 2018a),
but also the DNA in reconstituted milk degraded to a
greater degree and the integrity was less after heat-
ing for 5 to 15 min (Liao et al., 2018b). Even though
the DNA in processed foods was degraded into smaller
fragments and the amount of DNA was an order of
magnitude lower than that in unprocessed food (Novak
Journal of Dairy Science Vol. 105 No. 6, 2022
4752
Figure 1. Representative results of agarose gel electrophoresis
analysis of DNA from different proportions of bovine whey powder
and goat whey powder samples. Lanes 1 to 8 represent bovine whey
powder content of 10%, 5%, 1%, 0.5%, 0.1%, and 0.05%, bovine whey
powder, and goat whey powder, respectively. M = molecular weight
marker (2,000-bp DNA ladder).
et al., 2007), the severely degraded DNA could still be
amplified (Ahmed and Meng, 2019). In this study, the
DNA in the processed whey powder could be ampli-
fied by specific primers to obtain the target fragments
(Figure 2). The obtained bands were clear and single,
without nonspecific products and primer dimers, which
indicated that DNA was broken into small pieces de-
spite acid, alkali, and heat processing, and it was still
amplified in PCR and used for species identification.
The DNA integrity in this study was better than that
of Liao et al. (2018b), which might be related to the
optimization of the extraction method. Therefore, even
if a very small amount of bovine whey powder was
adulterated, a sufficient quantity and good quality of
DNA could still be extracted to meet the subsequent
adulteration detection.
Analytical Sensitivity of Bovine Whey Powder
Strong specificity and high sensitivity are usually
required in adulteration detection. Conventional PCR
can meet these conditions. In addition, most labora-
tories can use conventional PCR because of its low
cost, and it is usually one of the preferred adulteration
detection techniques (Liao and Liu, 2020). To evaluate
the sensitivity of conventional PCR for whey powder
adulteration detection, the analysis was performed 3
times to confirm reproducibility. As shown in Figure 3,
the brightness of the target band gradually decreased
with the decrease of concentration until no band ap-
pears in lane 6. Lane 5 had a weaker target band, which
 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS
Figure 2. Representative results of purity analysis of whey powder by agarose gel electrophoresis. A and B amplify the specific primers for
bovine and goat whey powders, respectively. Lane 1 = bovine whey powder; lane 2 = goat whey powder; M = molecular weight marker (2,000-
bp DNA ladder).
meant that 0.005 ng/μL of bovine-derived components
was detected. However, the reproducibility of the re-
sults was so poor that the stable detection sensitivity of
conventional PCR was 0.05 ng/μL. The unstable detec-
tion sensitivity in lane 5 might be related to amplicon
size. Kang (2019) proposed to analyze degraded DNA
from processed food samples by amplifying small frag-
ments of multicopy DNA targets. A study has shown
that the sensitivity of safflower DNA detection using
primers targeting a 155-bp fragment was 1,000 times
that of primers targeting a 382-bp fragment (Villa
Figure 3. Representative analysis results of agarose gel electropho-
resis for the sensitivity of PCR to detect whey powder. Lanes 1–6 =
samples of bovine whey powder with DNA concentrations of 50, 5, 0.5,
0.05, 0.005, and 0.0005 ng/μL; M = molecular weight marker (2,000-
bp DNA ladder).
Journal of Dairy Science Vol. 105 No. 6, 2022
4753
et al., 2017). Coincidentally, Wang et al. (2019) also
found that shorter DNA fragments in processed foods
were more stable than longer fragments in a study us-
ing conventional PCR to monitor the components in
highly processed food. Using DNA of goat milk and
milk as templates, the bovine-specific primer targeting
584-bp fragment demonstrated a sensitivity of 100 ng/
μL (Deng et al., 2020). By comparison, the sensitivity
of conventional PCR using the MT-ATP8 primer was
better.
LOD of Bovine Whey Powder
We optimized the PCR technology to evaluate the
LOD of the binary mixture of bovine and goat whey
powder. As shown in Figure 4, the brightness of the tar-
get band decreased with decrease ratios of adulteration.
We observed no target band in the lane of the 0.05%
mixed sample. Therefore, the minimum LOD for PCR
detection was 0.1% (wt/wt). This result was the same
as the LOD of milk in a variety of raw milk studied
by Deng et al. (2020), and the minimum LOD of milk
powder has also been reported as 0.1% (Liao et al.,
2017a). For financial gain, the proportion of deliberate
adulteration exceeded 10%, and adulteration below 5%
was considered to be meaningless pollution (Cozzolino
et al., 2001; Li et al., 2019). Conventional PCR has
been confirmed to have the potential for quantitative
analysis (Mafra et al., 2007), which is cheaper than
real-time PCR technology and can be applied in most
laboratories or quality inspection departments. Con-
 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS
Figure 4. Representative analysis results of agarose gel electropho-
resis for the detection limit of PCR to detect whey powder. Lanes 1–8
= mixture of bovine and goat whey powders containing 10, 5, 1, 0.5,
0.1, and 0.05% bovine whey powder composition, negative control, and
positive control, respectively; M = molecular weight marker (2,000-bp
DNA ladder).
sidering this, conventional PCR can first be used to
semi-quantitatively assess adulteration. If obvious
intentional adulteration is found, real-time PCR quan-
titative analysis could be further carried out to judge
commercial fraud. Otherwise, it could be considered ac-
cidental pollution. These approaches could reduce the
cost of testing.
Figure 5. Standard curve obtained by real-time PCR analysis of serially diluted bovine whey powder DNA. Ct = cycle threshold.
Journal of Dairy Science Vol. 105 No. 6, 2022
4754
Detection of DNA Sensitivity and Amplification
Efficiency of Bovine Whey Powder
by Real-Time PCR
To better quantitatively analyze the adulterated bo-
vine whey powder in goat whey powder, real-time PCR
was used to analyze the sensitivity of the MT-ATP8
primers after qualitative detection by conventional
PCR. The bovine whey powder DNA extract was di-
luted 10 times from 100 ng/μL to 0.01 ng/μL, and the
real-time PCR detection results are shown in Figure 5.
Real-time PCR could detect bovine whey powder DNA
at a minimum of 0.01 ng/μL, which was higher than
the sensitivity of 0.05 ng/μL of conventional PCR. In
general, PCR is sensitive to inhibitors such as organic
and inorganic substances from food ingredients or DNA
isolation, which not only decreases the PCR sensitivity
but also increases background fluorescence in real-time
PCR analysis (Kang, 2019). However, satisfactory
results were obtained in this experiment, illustrating
that the improved DNA extraction method was able to
remove more contaminants and inhibitors from whey
powder. The slope of the standard curve was −3.155
and the amplification efficiency was 107.5%. Real-time
PCR assays with 90% to 110% amplification efficiency
are generally considered acceptable (Ban et al., 2021),
although the production of primer dimers or the pres-
ence of inhibitors in the reaction system may lead to
 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS 4755

Figure 6. Standard curves of different proportions of bovine whey powder in goat whey powder analyzed by real-time PCR. Ct = cycle
threshold.

significant increases in amplification efficiency (Peters
et al., 2004; Suslov and Steindler, 2005). The results
showed that real-time PCR using MT-ATP8 primers
had high sensitivity and could be used for quantitative
detection of adulteration.
LOD of Bovine Whey Powder in Goat Whey
Powder by Real-Time PCR
To quantify the content of bovine whey powder
in binary whey powder, a standard curve containing
models of different adulteration ratios needed to be
established. The standard curves established from the
determination of 0.1%, 0.5%, 1%, 5%, 10%, and 30%
mixed whey powder are shown in Figure 6. The con-
tent of bovine whey powder was within the range of
0.1% to 30%, and the logarithm of Ct value and bovine
whey powder content presented a good linear response
with a coefficient of determination (R2) of 0.9858. This
result was lower than the coefficient of determination
of milk powder standard curve established by Liao et
al. (2017a; R2 = 0.9984). Whey powder is processed
differently than milk powder, and it is possible that
acid, alkali, and heat processing may reduce the length
of DNA fragments and lead to a lower coefficient of
determination, as Liao and colleagues explained. How-
ever, the coefficient of determination we obtained was
much higher than that of camel milk (R2 = 0.9614;
Wang et al., 2020). The minimum performance stan-
dard for real-time PCR detection indicated that the
correlation coefficient of the standard curves should
be above 0.98 (ENGL, 2015). In addition, the LOD of
bovine whey powder was 0.1% instead of lower, which
might be linked to the DNA extraction process. The
LOD of PCR-based screening methods for ingredients
in food is directly dependent on the efficiency of the
nucleic acid extraction method employed. McKillip et
al. (2000) suggested that LOD could be improved by

Table 2. Real-time PCR reliability of detection limit of bovine whey powder in goat whey powder1

Spike Mean Relative error CV P-value

level (%) estimated (%) (trueness; %) (precision; %) (t-test)
0.1 0.06 40 55.5 0.565
0.5 0.66 38 5.54 0.019
1 0.9 −15 3.42 0.021
1
Results were obtained from the mean of 10 repeated measurements.

Journal of Dairy Science Vol. 105 No. 6, 2022

 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS 4756
Table 3. Repeatability of real-time PCR for detection of DNA extracts from continuous diluted bovine whey
powder

Mean cycle threshold values

Dilution DNA concentration Relative
factor   (pg/μL) d1 d2 d3 SD (%)
1:10 10,000 25.70 25.14 25.27 1.16
1:100 1,000 28.34 28.20 28.13 0.38
1:1,000 100 31.24 31.46 31.19 0.46
1:10,000 10 34.18 33.64 31.70 3.93

simply increasing the total amount of DNA used in
the PCR reaction. Hence, increasing the total amount
of DNA used in the PCR reactions may be considered
next to achieve a higher LOD. To sum up, the improved
DNA extraction method could meet the requirements
of adulteration detection in an analytical laboratory.
Method Validation
The MIQE guidelines not only provide technical
support for qPCR, but also propose that measures of
variation (repeatability) and precision (reproducibility)
should be reported (Bustin et al., 2010). Affected by
whey powder processing, the target analyte content was
low, which increased the difficulty of real-time PCR
quantitative detection. To determine the accuracy of
this method, 3 mixing ratios close to the LOD (0.1%,
0.5%, and 1%) were selected, and the analysis results
are shown in Table 2. The higher the proportion of
bovine whey powder, the smaller the relative error
and CV. Except for 0.1%, the CV values of all mixing
proportions were close to or less than 5%; CV values
lower than 5% are considered acceptable (Biswal et al.,
2022). The results of the analysis of very low whey
powder mixture ratios were similar to those of camel
milk (Wang et al., 2020). These results indicated a
more reliable and consistent measurement. The results
of 1-sample Student’s t-test showed that the measured
value was significantly different from the actual value
only in the case of the 0.1% ratio, which was caused by
the low concentration of the target. This indicated a
large error in quantitative detection at the 0.1% level.
It has been reported that intentional adulteration of
more than 10% is considered economically profitable
(Li et al., 2019), whereas the content of 0.1% is very
low. Based on this, qualitative detection at this adul-
teration level was more meaningful than quantitative
detection.
Table 3 shows the repeatability analysis results after
10 times continuous dilution of 100 ng/μL target ana-
lyte. The relative standard deviation of all results was
below the 5% set by the US Food and Drug Adminis-
tration (Gao et al., 2013). Even though real-time PCR
is an accurate quantitative method, some systematic
errors still come from real-time PCR itself or from the
process of DNA extraction (Li et al., 2021). However,
our experimental results showed that this method could
accurately quantify bovine whey powder in a certain
range.
In this study, bovine whey powder was able to be
qualitatively and quantitatively determined on the ba-
sis of DNA thermal stability, and it is compatible with
the most widely used PCR and real-time PCR analysis
platforms. Compared with other DNA-based analysis
methods, real-time PCR has advantages in detection
time, cost, and operation complexity (Table 4). First,
DNA extraction using a modified laboratory method
was evaluated to be cost effective in a previous study
(Liao et al., 2017b). Second, the PCR reaction volume
of this study was optimized to 10 μL instead of 25

Table 4. Comparative analysis of common DNA adulteration detection techniques

Detection Labor Detection Application

Technique   time1   requirement   cost   location
TaqMan   ++   Very easy   High   Laboratory
PCR-RFLP   +++   Easy   High   Laboratory
ddPCR   +   Easy   High   Laboratory
Conventional PCR   +++   Very easy   Low   Laboratory
Lamp   +   Easy   Low   Laboratory or on
site
DNA barcoding   +++   Easy   High   Laboratory
SYBR Green   ++   Very easy   Low   Laboratory
1
Where + indicates the level of time consumption: + to +++ indicates the time from short to long.

Journal of Dairy Science Vol. 105 No. 6, 2022

 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS
μL to minimize use of reagents, reducing the cost of
detection for a single sample by at least half. Third, al-
though SYBR Green and TaqMan technologies are the
most commonly used quantitative methods, the cost of
SYBR Green was 5 times lower than that of TaqMan
(Petersen et al., 2018). As there is no need for multispe-
cies detection of adulteration for whey powder, SYBR
Green technology was more cost effective. Velasco et
al. (2020) also proposed that the cost of real-time PCR
analysis was much lower than that of sequencing, mak-
ing it affordable for low-resource control units. The
PCR technique can detect a large number of samples
at once. Compared with other detection methods, it
is more efficient and less time consuming (Fillaux et
al., 2008). The cost of real-time PCR is higher than
that of conventional PCR because of the use of dyes
or instruments, but it makes up for the limitation of
nonquantitative analysis of conventional PCR.
In the current dairy market, the price of goat milk is
relatively high, and the production of goat whey pow-
der in China is difficult and limited. The high value of
goat whey powder unavoidably disturbs the fair trade
of the market and the safety of dairy products. In view
of the comprehensive factors we have investigated, a
cheaper and more efficient detection of bovine whey
powder by combining conventional PCR and real-time
PCR is serviceable for the development of healthful
dairy products.
CONCLUSIONS
Detection of whey powder adulteration is based on
good-quality DNA in whey powder. The improved
method obtained good DNA quality with a purity of
1.53 to 1.75 and a DNA concentration of 122 to 179 ng/
μL. In qualitative detection of bovine whey powder, the
sensitivity of real-time PCR was 0.01 ng/μL, which was
higher than the 0.05 ng/μL detected by conventional
PCR methods. Real-time PCR obtained a good linear
relationship when the content of bovine whey powder
was within the range of 0.1% to 30% in quantitative
detection (R2 = 0.9858). The relative error decreased
with increased mixing proportion. The CV values were
close to or less than 5%, and relative standard devia-
tions were less than 5%, indicating good accuracy and
repeatability. This research provides an accurate and
effective method of qualitative and quantitative identi-
fication of bovine whey powder in goat dairy products.
ACKNOWLEDGMENTS
This work was supported by Shaanxi Province Key
Research and Development Projects (Xi’an, China;
Journal of Dairy Science Vol. 105 No. 6, 2022
4757
2019ZDLNY06-05), the Fundamental Research Funds
of the Central Universities in China (Beijing, China;
GK202001002), Science and Technology Plan Projects
in Xianyang City of Shaanxi Province (Xianyang, Chi-
na; 2021ZDZX-NY-0014), Shaanxi Province Forestry
Science and Technology Plan Projects of China (Xi’an,
China; SXLK2021-0221), and the Youth Innovation
Team of Shaanxi University (Xi’an, China). The au-
thors have not stated any conflicts of interest.
REFERENCES
Ahmed, N., and M. Meng. 2019. Detection of gluten-rich cereals in
processed foods with enhanced sensitivity by targeting mitochon-
drial DNA using PCR. Food Anal. Methods 12:811–825. https:​/​/​
doi​.org/​10​.1007/​s12161​-018​-01415​-1.
Andrade, J., C. G. Pereira, J. C. Almeida Junior, C. C. R. Viana,
L. N. O. Neves, P. H. F. Silva, M. J. V. Bell, and V. C. Anjos.
2019. FTIR-ATR determination of protein content to evaluate
whey protein concentrate adulteration. Lebensm. Wiss. Technol.
99:166–172. https:​/​/​doi​.org/​10​.1016/​j​.lwt​.2018​.09​.079.
Ban, E., H. Kwon, H. S. Seo, Y. S. Yoo, and E. J. Song. 2021. Screen-
ing of miRNAs in plasma as a diagnostic biomarker for cardiac dis-
ease based on optimization of extraction and qRT-PCR condition
assay through amplification efficiency. BMC Biotechnol. 21:50.
https:​/​/​doi​.org/​10​.1186/​s12896​-021​-00710​-w.
Bilge, G., B. Sezer, K. E. Eseller, H. Berberoglu, A. Topcu, and I. H.
Boyaci. 2016. Determination of whey adulteration in milk pow-
der by using laser induced breakdown spectroscopy. Food Chem.
212:183–188. https:​/​/​doi​.org/​10​.1016/​j​.foodchem​.2016​.05​.169.
Biswal, J. K., B. R. Jena, S. Z. Ali, R. Ranjan, J. K. Mohapatra, and
R. P. Singh. 2022. One-step SYBR green-based real-time RT-PCR
assay for detection of foot-and-mouth disease virus circulating in
India. Virus Genes. https:​/​/​doi​.org/​10​.1007/​s11262​-021​-01884​-3.
Boesenberg-Smith, K. A., M. M. Pessarakli, and D. M. Wolk. 2012.
Assessment of DNA yield and purity: An overlooked detail of PCR
troubleshooting. Clin. Microbiol. Newsl. 34:1–6. https:​/​/​doi​.org/​
10​.1016/​j​.clinmicnews​.2011​.12​.002.
Bremer, M. G. E. G., A. E. M. Kemmers-Voncken, E. A. M. Boers, R.
Frankhuizen, and W. Haasnoot. 2008. Enzyme-linked immunosor-
bent assay for the detection of bovine rennet whey powder in milk
powder and buttermilk powder. Int. Dairy J. 18:294–302. https:​/​/​
doi​.org/​10​.1016/​j​.idairyj​.2007​.08​.008.
Brick, T., M. Ege, S. Boeren, A. Bock, E. von Mutius, J. Vervoort, and
K. Hettinga. 2017. Effect of processing intensity on immunologi-
cally active bovine milk serum proteins. Nutrients 9:963. https:​/​/​
doi​.org/​10​.3390/​nu9090963.
Bustin, S. A., J.-F. Beaulieu, J. Huggett, R. Jaggi, F. S. B. Kibenge,
P. A. Olsvik, L. C. Penning, and S. Toegel. 2010. MIQE précis:
Practical implementation of minimum standard guidelines for
fluorescence-based quantitative real-time PCR experiments. BMC
Mol. Biol. 11:74. https:​/​/​doi​.org/​10​.1186/​1471​-2199​-11​-74.
Cozzolino, R., S. Passalacqua, S. Salemi, P. Malvagna, E. Spina, and
D. Garozzo. 2001. Identification of adulteration in milk by matrix-
assisted laser desorption/ionization time-of-flight mass spectrom-
etry. J. Mass Spectrom. 36:1031–1037. https:​/​/​doi​.org/​10​.1002/​
jms​.206.
de Carvalho, B. M., L. M. de Carvalho, J. S. dos Reis Coimbra, L.
A. Minim, E. de Souza Barcellos, W. F. da Silva Junior., E. Det-
mann, and G. G. de Carvalho. 2015. Rapid detection of whey in
milk powder samples by spectrophotometric and multivariate cali-
bration. Food Chem. 174:1–7. https:​/​/​doi​.org/​10​.1016/​j​.foodchem​
.2014​.11​.003.
de Oliveira Mendes, T., B. L. S. Porto, M. J. V. Bell, I. T. Perrone,
and M. A. L. de Oliveira. 2016. Capillary zone electrophoresis for
fatty acids with chemometrics for the determination of milk adul-
 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS
teration by whey addition. Food Chem. 213:647–653. https:​/​/​doi​
.org/​10​.1016/​j​.foodchem​.2016​.07​.035.
Deng, L., A. Li, Y. Gao, T. Shen, H. Yue, J. Miao, R. Li, and J. Yang.
2020. Detection of the bovine milk adulterated in camel, horse,
and goat milk using duplex PCR. Food Anal. Methods 13:560–567.
https:​/​/​doi​.org/​10​.1007/​s12161​-019​-01678​-2.
ENGL (European Network of GMO Laboratories). 2015. Definition
of minimum performance requirements for analytical methods
of GMO testing. Accessed May 16, 2020. https:​/​/​gmo​-crl​.jrc​.ec​
.europa​.eu/​doc/​MPR​%20Report​%20Application​%2020​_10​_2015​
.pdf.
Ferrara, G. B., B. Murgia, A. M. Parodi, L. Valisano, C. Cerrano, G.
Palmisano, G. Bavestrello, and M. Sara. 2006. The assessment of
DNA from marine organisms via a modified salting-out protocol.
Cell. Mol. Biol. Lett. 11:155–160. https:​/​/​doi​.org/​10​.2478/​s11658​
-006​-0013​-7.
Fillaux, J., S. Malvy, M. Alvarez, R. Fabre, S. Cassaing, B. Marchou,
M. D. Linas, and A. Berry. 2008. Accuracy of a routine real-time
PCR assay for the diagnosis of Pneumocystis jirovecii pneumo-
nia. J. Microbiol. Methods 75:258–261. https:​/​/​doi​.org/​10​.1016/​
j​.mimet​.2008​.06​.009.
Gallier, S., L. Tolenaars, and C. Prosser. 2020. Whole goat milk as
a source of fat and milk fat globule membrane in infant formula.
Nutrients 12:3486. https:​/​/​doi​.org/​10​.3390/​nu12113486.
Gao, Y., M. G. Ierapetritou, and F. J. Muzzio. 2013. Determination
of the confidence interval of the relative standard deviation using
convolution. J. Pharm. Innov. 8:72–82. https:​/​/​doi​.org/​10​.1007/​
s12247​-012​-9144​-8.
Kang, T. S. 2019. Basic principles for developing real-time PCR meth-
ods used in food analysis: A review. Trends Food Sci. Technol.
91:574–585. https:​/​/​doi​.org/​10​.1016/​j​.tifs​.2019​.07​.037.
Kassem, J. M. 2015. Future challenges of whey proteins. Int. J. Dairy
Sci. 10:139–159. https:​/​/​doi​.org/​10​.3923/​ijds​.2015​.139​.159.
Ke, X., J. Zhang, S. Lai, Q. Chen, Y. Zhang, Y. Jiang, W. Mo, and Y.
Ren. 2017. Quantitative analysis of cow whole milk and whey pow-
der adulteration percentage in goat and sheep milk products by
isotopic dilution-ultra-high performance liquid chromatography-
tandem mass spectrometry. Anal. Bioanal. Chem. 409:213–224.
https:​/​/​doi​.org/​10​.1007/​s00216​-016​-9987​-9.
Li, T., J. Wang, Z. Wang, L. Qiao, R. Liu, S. Li, and A. Chen. 2021.
Quantitative determination of mutton adulteration with single-
copy nuclear genes by real-time PCR. Food Chem. 344:128622.
https:​/​/​doi​.org/​10​.1016/​j​.foodchem​.2020​.128622.
Li, T. T., Y. M. Jalbani, G. L. Zhang, Z. Y. Zhao, Z. Y. Wang, X.
Y. Zhao, and A. L. Chen. 2019. Detection of goat meat adultera-
tion by real-time PCR based on a reference primer. Food Chem.
277:554–557. https:​/​/​doi​.org/​10​.1016/​j​.foodchem​.2018​.11​.009.
Li, Y. C., S. Y. Liu, F. B. Meng, D. Y. Liu, Y. Zhang, W. Wang, and
J. M. Zhang. 2020. Comparative review and the recent progress in
detection technologies of meat product adulteration. Compr. Rev.
Food Sci. Food Saf. 19:2256–2296. https:​/​/​doi​.org/​10​.1111/​1541​
-4337​.12579.
Liao, J., and Y. Liu. 2020. Extraction and detection of DNA from
UHT milk during storage. CYTA J. Food 18:747–752. https:​/​/​doi​
.org/​10​.1080/​19476337​.2020​.1839565.
Liao, J., Y. Liu, and T. Ku. 2018a. Changes in physicochemical prop-
erties and DNA quality of milk as affected by different heat treat-
ments. Int. J. Dairy Technol. 71:333–339. https:​/​/​doi​.org/​10​.1111/​
1471​-0307​.12446.
Liao, J., Y. F. Liu, T. Ku, M. H. Liu, and Y. Huang. 2017a. Qualita-
tive and quantitative identification of adulteration of milk powder
using DNA extracted with a novel method. J. Dairy Sci. 100:1657–
1663. https:​/​/​doi​.org/​10​.3168/​jds​.2016​-11900.
Liao, J., Y. F. Liu, L. Yang, F. P. Li, and A. M. Sheppard. 2017b.
Development of a rapid mitochondrial DNA extraction method
for species identification in milk and milk products. J. Dairy Sci.
100:7035–7040. https:​/​/​doi​.org/​10​.3168/​jds​.2017​-12653.
Liao, J., L. Yang, A. M. Sheppard, and Y. F. Liu. 2018b. Comparison
of DNA quality in raw and reconstituted milk during steriliza-
Journal of Dairy Science Vol. 105 No. 6, 2022
4758
tion. J. Dairy Sci. 101:147–153. https:​/​/​doi​.org/​10​.3168/​jds​.2017​
-13461.
Liu, Y. F., J. L. Gao, Y. F. Yang, T. Ku, and L. S. Zan. 2014. Novel
extraction method of genomic DNA suitable for long-fragment am-
plification from small amounts of milk. J. Dairy Sci. 97:6804–6809.
https:​/​/​doi​.org/​10​.3168/​jds​.2014​-8066.
Mafra, I., Á. Roxo, I. M. P. L. V. O. Ferreira, and M. B. P. P. Oliveira.
2007. A duplex polymerase chain reaction for the quantitative de-
tection of cows’ milk in goats’ milk cheese. Int. Dairy J. 17:1132–
1138. https:​/​/​doi​.org/​10​.1016/​j​.idairyj​.2007​.01​.009.
McKillip, J. L., L. A. Jaykus, and M. A. Drake. 2000. A comparison of
methods for the detection of Escherichia coli O157: H7 from artifi-
cially-contaminated dairy products using PCR. J. Appl. Microbiol.
89:49–55. https:​/​/​doi​.org/​10​.1046/​j​.1365​-2672​.2000​.01079​.x.
Miller, B. A., and C. D. Lu. 2019. Current status of global dairy goat
production: An overview. Asian-Australas. J. Anim. Sci. 32:1219–
1232. https:​/​/​doi​.org/​10​.5713/​a jas​.19​.0253.
Muuronen, K., R. Partanen, H.-J. Heidebrecht, and U. Kulozik. 2021.
Effects of conventional processing methods on whey proteins in
production of native whey powder. Int. Dairy J. 116:104959. https:​
/​/​doi​.org/​10​.1016/​j​.idairyj​.2020​.104959.
Novak, J., S. Grausgruber-Gröger, and B. Lukas. 2007. DNA-based
authentication of plant extracts. Food Res. Int. 40:388–392. https:​
/​/​doi​.org/​10​.1016/​j​.foodres​.2006​.10​.015.
Outinen, M., P. Rantamäki, and A. Heino. 2010. Effect of milk pre-
treatment on the whey composition and whey powder functional-
ity. J. Food Sci. 75:E1–E10. https:​/​/​doi​.org/​10​.1111/​j​.1750​-3841​
.2009​.01382​.x.
Peters, I. R., C. R. Helps, E. J. Hall, and M. J. Day. 2004. Real-time
RT-PCR: Considerations for efficient and sensitive assay design.
J. Immunol. Methods 286:203–217. https:​/​/​doi​.org/​10​.1016/​j​.jim​
.2004​.01​.003.
Petersen, M. I., I. Alvarez, K. G. Trono, and J. P. Jaworski. 2018.
Quantification of bovine leukemia virus proviral DNA using a low-
cost real-time polymerase chain reaction. J. Dairy Sci. 101:6366–
6374. https:​/​/​doi​.org/​10​.3168/​jds​.2017​-14253.
Ranadheera, C. S., C. A. Evans, S. K. Baines, C. F. Balthazar, A.
G. Cruz, E. A. Esmerino, M. Q. Freitas, T. C. Pimentel, A. E.
Wittwer, N. Naumovski, J. S. Graca, A. S. Sant’Ana, S. Ajlouni,
and T. Vasiljevic. 2019. Probiotics in goat milk products: Delivery
capacity and ability to improve sensory attributes. Compr. Rev.
Food Sci. Food Saf. 18:867–882. https:​/​/​doi​.org/​10​.1111/​1541​
-4337​.12447.
Roufou, S., S. Griffin, L. Katsini, M. Polańska, J. F. M. Van Impe,
and V. P. Valdramidis. 2021. The (potential) impact of seasonality
and climate change on the physicochemical and microbial proper-
ties of dairy waste and its management. Trends Food Sci. Technol.
116:1–10. https:​/​/​doi​.org/​10​.1016/​j​.tifs​.2021​.07​.008.
Sanmartín, B., O. Díaz, L. Rodríguez-Turienzo, and A. Cobos. 2012.
Composition of caprine whey protein concentrates produced by
membrane technology after clarification of cheese whey. Small
Rumin. Res. 105:186–192. https:​/​/​doi​.org/​10​.1016/​j​.smallrumres​
.2011​.11​.020.
Suslov, O., and D. A. Steindler. 2005. PCR inhibition by reverse tran-
scriptase leads to an overestimation of amplification efficiency.
Nucleic Acids Res. 33:e181. https:​/​/​doi​.org/​10​.1093/​nar/​gni176.
Tartaglia, M., E. Saulle, S. Pestalozza, L. Morelli, G. Antonucci, and
P. A. Battaglia. 1998. Detection of bovine mitochondrial DNA in
ruminant feeds: a molecular approach to test for the presence of
bovine-derived materials. J. Food Prot. 61:513–518. https:​/​/​doi​
.org/​10​.4315/​0362​-028X​-61​.5​.513.
Teixeira, J. L. P., E. T. S. Caramês, D. P. Baptista, M. L. Gigante,
and J. A. L. Pallone. 2021. Rapid adulteration detection of yogurt
and cheese made from goat milk by vibrational spectroscopy and
chemometric tools. J. Food Compos. Anal. 96:103712. https:​/​/​doi​
.org/​10​.1016/​j​.jfca​.2020​.103712.
Velasco, A., G. Ramilo-Fernandez, and C. G. Sotelo. 2020. A real-
time PCR method for the authentication of common cuttlefish
 Zhang et al.: BOVINE WHEY POWDER IN GOAT DAIRY PRODUCTS
(Sepia officinalis) in food products. Foods 9:286. https:​/​/​doi​.org/​
10​.3390/​foods9030286.
Villa, C., J. Costa, M. B. P. P. Oliveira, and I. Mafra. 2017. Novel
quantitative real-time PCR approach to determine safflower (Car-
thamus tinctorius) adulteration in saffron (Crocus sativus). Food
Chem. 229:680–687. https:​/​/​doi​.org/​10​.1016/​j​.foodchem​.2017​.02​
.136.
Wang, X., T. Tang, Q. Miao, S. Xie, X. Chen, J. Tang, C. Peng, X.
Xu, W. Wei, Z. You, and J. Xu. 2019. Detection of transgenic rice
line TT51–1 in processed foods using conventional PCR, real-time
PCR, and droplet digital PCR. Food Control 98:380–388. https:​/​/​
doi​.org/​10​.1016/​j​.foodcont​.2018​.11​.032.
Wang, Z., T. Li, W. Yu, L. Qiao, R. Liu, S. Li, Y. Zhao, S. Yang, and
A. Chen. 2020. Determination of content of camel milk in adulter-
ated milk samples by normalized real-time polymerase chain reac-
tion system based on single-copy nuclear genes. J. Sci. Food Agric.
100:3465–3470. https:​/​/​doi​.org/​10​.1002/​jsfa​.10382.
Journal of Dairy Science Vol. 105 No. 6, 2022
4759
Wu, C. S., J. H. Guo, and M. J. Lin. 2020. Stability evaluation of pH-
adjusted goat milk for developing ricotta cheese with a mixture of
cow cheese whey and goat milk. Foods 9:366. https:​/​/​doi​.org/​10​
.3390/​foods9030366.
Xiong, X., M. Huang, F. Yuan, L. Lu, and X. Xiong. 2019. Develop-
ment and validation of a fast DNA extraction protocol for fish
products. Food Anal. Methods 12:1998–2008. https:​/​/​doi​.org/​10​
.1007/​s12161​-019​-01554​-z.
ORCIDS
Xueru Zhang https:​/​/​orcid​.org/​0000​-0002​-7259​-4069
Chunyan Qiao https:​/​/​orcid​.org/​0000​-0001​-7669​-6751
Yang Jiao https:​/​/​orcid​.org/​0000​-0003​-1649​-3965
Yongfeng Liu https:​/​/​orcid​.org/​0000​-0003​-3831​-848X