International Journal of Biological Macromolecules 83 (2016) 50–60

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules

journal homepage: www.elsevier.com/locate/ijbiomac

High level production of active streptokinase in Pichia pastoris

fed-batch culture
Adivitiya, Vikas Kumar Dagar, Nirmala Devi, Yogender Pal Khasa ∗
Department of Microbiology, University of Delhi South Campus, New Delhi 110 021, India

a r t i c l e i n f o a b s t r a c t

Article history: Streptokinase is a biological macromolecule involved in dissolution of fibrin blood clot and favourably
Received 26 May 2015 used in various clinical applications. This protein is poorly expressed in soluble form due to its toxic
Received in revised form effects on host physiology. The extracellular expression of recombinant streptokinase (SK) with and
21 November 2015
without 6xHis tag was obtained by cloning its gene under the ␣-mating factor signal sequence and alcohol
Accepted 23 November 2015
inducible AOX1 promoter. Host-vector combinations were optimized to select a hyper producer. From
Available online 26 November 2015
shake flask optimization studies, a maximum expression of 582 mg/L of rSK (non-tagged) and 538 mg/L of
rSK-His (His-tagged) protein was obtained when cells were induced at OD600 of 20. The high cell density
Keywords:
Pichia pastoris
fermentation increased the volumetric product concentration of rSK-His to a level of 4.25 g/L with a 7.9
Streptokinase folds increase from shake flask results. The specific product yield (YP/X ) was 49.75 mg/g DCW along with
Secretory expression a high volumetric productivity of 57.43 mg/L/h. The protein was predicted to have 15.43% ␣-helix and
Glycosylation 26.43% ␤-sheet with tryptophan emission maxima of around 347 nm. The highest specific activity of rSK-
AOX1 promoter His was 64,903 IU/mg with 1.48 folds purification whereas specific activity of rSK was 55,240 IU/mg with
Fed-batch fermentation 1.22 folds purification.
© 2015 Elsevier B.V. All rights reserved.

1. Introduction fed-batch production of streptokinase using E. coli has been

Circulatory disorders like ischaemic stroke, acute myocar-
dial infarction, pulmonary embolism and deep-vein thrombosis
develop due to the formation of a blood flow impeding clot in
the vessels. One of the major treatment options for such cases is
the intravenous administration of thrombolytics [1,2]. Streptoki-
nase (SK) has emerged as a valuable biomolecule for thrombolytic
therapy due to its low cost and longer in vivo half-life than other
molecules such as urokinase (UK) and tissue plasminogen activator
(tPA) [2,3]. Streptokinase is a 47 kDa (414 amino acids) single chain
polypeptide produced extracellularly as a catabolic byproduct by
various strains of hemolytic streptococci [4]. It does not possess
any enzymatic activity of its own but a 1:1 stoichiometric complex
of streptokinase and plasminogen has a trypsin-like serine protease
activity involved in dissolution of the fibrin blood clot [3].
The streptokinase gene from Streptococcus equisimilis strain
H46A has been cloned and expressed in several heterologous hosts
due to the pathogenicity of its natural isolate. In Escherichia coli
shake flask culture, the streptokinase expression has been reported
in the range of 100 U/mL to 5000 IU/mL [5–7]. The large scale
∗ Corresponding author.
E-mail addresses: yogi110@gmail.com, yogipal@gmail.com (Y.P. Khasa).
reported with improved expression yields up to 1120 mg/L [8–11].
Yazdani and Mukherjee [12] obtained ∼20,000 IU/mL of streptok-
inase in continuous culture studies of E. coli. The Challis strain of
Streptococcus sanguis secreted ∼1500 U/mL of recombinant strep-
tokinase in large scale fermentation experiments while Proteus
mirabilis produced 24,000 U/mL of streptokinase in batch fermen-
tation [13,14]. However, the recombinant streptokinase production
in E. coli has been reported to be associated with problems of high
plasmid instability rates and loss of cell viability due to its toxic-
ity towards the expression host [9,12]. The expression of this toxic
protein has been shown to have an adverse effect on cell biomass
thereby reducing the final expression yields whereas inclusion
body formation inside the cell makes downstream processing very
costly [8,9,15].
To circumvent these problems, different yeast systems have
been used for the expression of this thrombolytic protein. In Pichia
pastoris expression system, the gene of interest can be stably inte-
grated into the genome of the expression host to overcome the
problem of plasmid instability [16]. Being a eukaryotic host, it car-
ries out post-translational modifications and has high amenability
to high cell density fermentation [16,17]. Another major reason
for popularity of this expression host is the presence of efficient
and tightly regulated strong promoters such as alcohol oxidase
1 (AOX1) and glyceraldehyde 3-phosphate dehydrogenase (GAP)

http://dx.doi.org/10.1016/j.ijbiomac.2015.11.062
0141-8130/© 2015 Elsevier B.V. All rights reserved.
 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60
with highly specific secretion efficacy for recombinant proteins to
make downstream processing simple and cost effective [16,17].
The secretion of glycosylated streptokinase has been reported in P.
pastoris (3200 IU/mL) with an improved proteolytic resistance and
stability [18]. A mutant of Schizosaccharomyces pombe defective in
extracellular protease activity produced streptokinase without any
glycosylation and degradation at a level of 4133 IU/mL [19]. How-
ever, these expression levels were not satisfactory for commercial
production of this immensely important therapeutic molecule.
Therefore in this work, we report the development of a highly
efficient recombinant Pichia system for the secretory expression of
streptokinase at large scale. Host-vector combinations were opti-
mized at shake flask level to screen a hyper producer strain along
with its purification from culture supernatant. Biophysical char-
acterization of purified protein was done using far-UV CD and
fluorescence spectroscopy. This is the first report of a high level pro-
duction of bioactive streptokinase in P. pastoris at bioreactor level
where 4.25 g/L of streptokinase was achieved with a volumetric
productivity of 3727 IU/mL/h i.e. 57.43 mg/L/h.
2. Materials and methods
2.1. Host strains, plasmids and chemicals
E. coli DH5␣ strain from Amersham Biosciences (USA) was used
for cloning and plasmid propagation. Plasmids were isolated by
standard alkaline lysis method. All media constituents were pur-
chased from HiMedia (India) and chemical reagents were from
Fisher Scientific (USA). Low salt LB medium was used to grow E.
coli cultures. Agar was added at a concentration of 2% to make
agar media plates. The P. pastoris expression system including
the host strain X-33 and GS115 (his4) and the expression vec-
tors pPICZ␣A and pGAPZ␣A were obtained from Invitrogen (USA).
YPD (Yeast extract Peptone Dextrose medium), BMGY (Buffered
Glycerol complex medium), BMDY (Buffered Dextrose complex
medium) and BMMY (Buffered Methanol complex medium) used
for Pichia expression studies were made according to the instruc-
tions given in the EasySelectTM Pichia Expression Kit (Instruction
Manual from Invitrogen, USA). Zeocin antibiotic (Invitrogen, USA)
was added at a final concentration of 25 mg/L in E. coli cultures. All
enzymes for molecular biology were purchased from New England
Biolabs (USA). The primers used in this work were synthesized by
Sigma–Aldrich (India). Gel extraction kit and RNase A was pur-
chased from Bio Basic (Canada) and T4 DNA ligase was of Thermo
Scientific (UK).
2.2. Construction of the expression cassette
The 1242 bp streptokinase (skc) gene encoding the mature 414
amino acid SK protein was PCR amplified from the construct pRSET
B-skc already available in the lab using the forward primer Skc-
EcoRI-F (5 -GCCGAATTCATTGCTGGACCTGAGTGGCTGC TAGAC-3 )
and the reverse primer Skc-NotI-R (5 -AAGCGGCCGCTTAT
TTGTCGTTAGGGTTATCAGG-3 ). EcoRI and NotI sites were
introduced into the forward and reverse primer respectively for
directional cloning. A second reverse primer, Skc-NotI-R (C-His) (5 -
AAGCGGCCGCTTAATGATGATGATGATGATGTTTGTCGTTAGGGTTA
TCAGG-3 ) was designed to incorporate a C-terminal polyhistidine
tag (6xHis tag) downstream of the streptokinase gene to facilitate
downstream processing. The PCR conditions were: an initial
denaturation at 95 ◦ C for 5 min followed by denaturation at 94 ◦ C
for 1 min, primer annealing at 55 ◦ C for 45 s and extension at 72 ◦ C
for 1.5 min after which a final extension was given of 10 min at
72 ◦ C for a total of 35 cycles. The amplified PCR product was double
digested using EcoRI and NotI restriction enzymes and ligated
51
with the Pichia expression vector pPICZ␣A bearing compatible
sticky ends. After overnight ligation at 16 ◦ C, the ligated product
was transformed into competent E. coli DH5␣ cells. Plating was
done on low salt LB agar plates containing Zeocin. The expression
construct so developed was named as pPICZ␣A-skc having skc gene
downstream of the ␣-mating factor signal sequence of S. cerevisiae.
Similarly, another construct pPICZ␣A-skc-His was generated with
C-terminal His tag using reverse primer Skc-NotI-R (C-His). Two
constructs under GAP promoter were also developed to have
constitutive expression (pGAPZ␣A-skc and pGAPZ␣A-skc-His).
In-frame fusion and accuracy of the expression constructs were
confirmed by double digestion and DNA sequencing (Central
Instrumentation Facility, University of Delhi South Campus, New
Delhi).
2.3. Transformation of P. pastoris and screening of recombinant
clones
To develop streptokinase producing recombinant Pichia strains,
the recombinant constructs pPICZ␣A-skc-His and pPICZ␣A-skc
were linearized with SacI restriction enzyme and transformed into
competent P. pastoris strain X-33 and GS115 via electroporation
(25 ␮F, 200 , 2 kV) using a Bio-Rad Micropulser Electroporator
(Bio-Rad, CA, USA). The constructs under GAP promoter were lin-
earized with AvrII restriction enzyme and similarly transformed.
The transformed Pichia cells were plated on YPDS agar plates (1%
yeast extract, 2% peptone, 2% dextrose, 1 M sorbitol and 2% agar)
having 100 mg/L Zeocin. To ensure isolation of multi-copy inte-
grants, recombinant colonies were further patched on YPDS agar
plates containing higher concentration of Zeocin (upto 2000 mg/L)
and these colonies were screened for the presence of expression
cassette using colony PCR strategy employing gene and vector spe-
cific primers as described in the EasySelectTM Pichia Expression Kit.
Preliminary expression studies were conducted in 5 mL medium in
culture tubes to select streptokinase hyper producers.
2.4. Shake flask expression studies
For optimization of extracellular recombinant SK expression, a
single colony of the highest streptokinase producing recombinant
P. pastoris strain X-33 was inoculated into 10 mL YPD broth as the
primary inoculum and incubated at 30 ◦ C and 200 rpm for 24 h. For
shake flask expression studies, 20 mL BMGY medium was further
inoculated to a final OD600 of 0.1 from the primary inoculum. The
cells were grown till the OD600 of ∼8–10. For AOX1 promoter induc-
tion, the cells were harvested by centrifugation (2500 × g, 5 min)
and resuspended in BMMY medium containing methanol and incu-
bated further at 30 ◦ C and 200 rpm. AOX1 induction was sustained
by adding methanol (0.5% v/v) at every 12 h intervals till 120 h.
1 mL samples were collected every 12 h to monitor the cell growth
and recombinant SK expression. Screening and expression studies
under GAP promoter were done in YPD medium. To study alternate
carbon source for growth, the glycerol in BMGY medium was sub-
stituted with 1% dextrose and named as BMDY medium. Shake flask
expression studies were conducted in different working culture
volumes of 20 mL in 100 mL flask and 500 mL in 2 L flask.
2.5. SDS-PAGE and western blot analysis
Different hour culture samples were centrifuged at 5000 × g for
5 min to separate the supernatant and pellet fraction. 15 ␮L culture
supernatant was analyzed on a 12% SDS-PAGE to check SK expres-
sion in culture broth. Disruption of Pichia cells was carried out using
(0.5 mm diameter) acid-washed glass beads (Biospec, USA) as per
the protocol mentioned in the EasySelectTM Pichia Expression Kit
to check for any residual intracellular expression. For western blot
52 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60
analysis, the SDS-PAGE gel was incubated in 1X western transfer
buffer (24 mM Trizma base; 192 mM glycine and 20% methanol)
for 30 min. The protein bands were electrophoretically transferred
onto a methanol charged PVDF membrane (Millipore Corporation,
USA) at 25 V for 30 min using the Trans-Blot® Semi-Dry appara-
tus from Bio-Rad (USA). The western blot was developed as per the
protocol described earlier using mouse primary anti-His antibodies
and anti-mouse HRP-conjugated secondary antibodies produced in
goat [20].
2.6. Purification of recombinant streptokinase
2.6.1. Ni-NTA affinity chromatography
The 6xHis tagged recombinant SK was purified using Ni-NTA
affinity chromatography (Novagen, USA). 30 mL of the culture
supernatant was concentrated using a 10 kDa cutoff centrifugal
device (Pall Corporation, USA). This sample was then dialyzed
against Ni-NTA equilibration buffer (50 mM NaH2 PO4 , 300 mM
NaCl, 10 mM imidazole, pH 8.0) using a 14 kDa cutoff cellulose
dialysis tubing (Sigma–Aldrich, USA). 4.65 mL of the dialyzed
sample containing 14.32 mg of protein was loaded onto the
pre-equilibrated Ni-NTA column. The column was washed with
5 column volumes of wash buffer (50 mM NaH2 PO4 , 300 mM
NaCl, 20 mM imidazole, pH 8.0). Recombinant streptokinase was
eluted as 4 × 1 mL fractions using elution buffer containing 50 mM
NaH2 PO4 , 300 mM NaCl and 300 mM imidazole (pH 8.0).
2.6.2. Size exclusion chromatography
To purify non-tagged SK using size exclusion chromatography,
30 mL culture supernatant was concentrated initially to 2 mL using
a 10 kDa cutoff centrifugal device (Pall Corporation, USA). This sam-
ple was further vacuum concentrated to 0.25 mL (14.28 mg) and
loaded onto a (2.5 cm × 50 cm) Sephadex G-100 column (GE Health-
care, UK) pre-equilibrated with 20 mM Tris–HCl, pH 8.0 buffer for
size exclusion chromatography. The protein was eluted as 7 × 1 mL
elution fractions using degassed 20 mM Tris–HCl (pH 8.0).
2.7. Deglycosylation analysis
To remove N-linked oligosaccharides from the glycosylated pro-
tein, the purified streptokinase was treated with PNGase F as
described earlier [20]. 10 ␮g (22.5 ␮L) of purified sample was mixed
with 2.5 ␮L of 10X glycoprotein denaturing buffer and boiled at
100 ◦ C for 10 min. The mixture was brought to room temperature
after which 5 ␮L of 10X G7 buffer, 5 ␮L of 10% NP-40, 1 ␮L of PNGase
F (NEB, USA) and 14 ␮L of sterile milliQ water was added to it
and incubated overnight at 37 ◦ C. The deglycosylated sample was
then analyzed using SDS-PAGE. All the buffers for deglycosylation
reaction were supplied with the PNGase F enzyme.
2.8. Protein estimation, streptokinase activity and zymogram
analysis
2.8.1. Protein estimation
The total protein concentration in the culture supernatant was
estimated by Bradford dye method (Bio-Rad, USA) using bovine
serum albumin (BSA) as standard. Briefly, 160 ␮L of appropriately
diluted sample containing streptokinase was mixed with 40 ␮L of
dye reagent concentrate in a microtitre plate and incubated at room
temperature for 5 min in dark after which absorbance was mea-
sured at 595 nm. The assay was done in triplicates and an average
value has been reported.
2.8.2. Streptokinase activity
The biological activity of recombinant streptokinase was quan-
titated using Chromozym PL (Roche, Germany) as substrate for
plasmin [21]. Briefly, equimolar concentrations of streptokinase
and plasminogen were incubated in sample dilution solution (pH
2.5) at 37 ◦ C for 5 min to convert plasminogen to plasmin. Plasmin
activity was then measured using the synthetic chromogenic sub-
strate Chromozym PL according to the instructions given in the
technical notes supplied by Roche. E. coli produced commercial
streptokinase (Lifokinase) was taken as the standard to calculate
streptokinase specific activity as WHO standard was not available.
The culture supernatant of wild type P. pastoris X-33 acted as the
negative control.
2.8.3. Zymogram analysis
To further check its biological activity, zymogram analysis was
carried out after resolving the streptokinase band on a 12% SDS-
PAGE. The gel was treated with 2% Triton X-100 for 10 min and
then washed with water to remove the SDS. After equilibrating the
gel in the assay buffer (50 mM Tris–HCl, pH 8.1) for 10 min it was
overlaid with 9 mL of assay buffer containing 150 mM NaCl, 90 mg
agarose, 50 ␮g of human plasminogen and 1 mL of (0.6%) skimmed
milk. The plate was incubated at 37 ◦ C for 4 h to visualize bands
with SK activity. Culture supernatant from wild type P. pastoris X-
33 was used as the negative control while Lifokinase acted as the
positive control.
2.9. Biophysical characterization of recombinant streptokinase
2.9.1. Circular dichroism (CD) and fluorescence spectroscopy
A far-UV CD spectrum of recombinant streptokinase was
recorded using a JASCO CD polarimeter (J-815 CD spectrometer)
at the CIF, UDSC, New Delhi as per the protocol described earlier
with slight modifications [22]. Briefly, purified protein at a concen-
tration of 0.15 mg/mL was dialyzed in 20 mM sodium phosphate
buffer (pH 7.0). Measurements were recorded in the far-UV range
from 190 to 260 nm in a 0.1 cm path length quartz cuvette at a
scan rate of 50 nm/min and a response time of 1 s. The final scan
was an average of 10 scans with the buffer baseline subtracted
from the protein spectra. K2D2 software was used to predict pro-
tein secondary structure from the CD spectral data [23]. Similarly,
the CD spectra was also recorded for 3 commercial recombinant
streptokinases produced in E. coli (GlanikinaseTM , R-THROMBO and
Lifokinase) and compared.
Fluorescence spectra of recombinant streptokinase was also
recorded using the JASCO spectrofluorometer FP-8300 according
to the method of Welfle et al. [24] with slight modifications. The
purified protein was dialyzed against 20 mM sodium phosphate
buffer, pH 7.0. For spectroscopic studies, the excitation wavelength
was set as 295 nm for selective excitation of tryptophan and the
emission spectrum was recorded between 300 and 600 nm using
1 cm quartz cuvettes. The injection powders of the three commer-
cial streptokinases were solubilized in the same buffer and spectra
measurements were recorded as described above.
2.9.2. Protein stability and tandem mass spectrometry
Purified streptokinase bands resolved on a 12% SDS-PAGE were
excised and trypsin hydrolyzed for peptide mass spectrometry
analysis (CIF, UDSC) using the AB (Applied Biosystems) 4800
MALDI-TOF/TOFTM Analyzer with 4000 Series Explorer v3.5 soft-
ware. Peptide masses were searched in MASCOT engine with NCBI
and Swiss Prot database for the identification of proteins. Stability
analysis was done as per earlier reports [18].
3. Fermentation studies
The fermentation studies were conducted in a 2.5 LElectro-
lab (FerMac 310/60) bioreactor (UK) using computer controlled
Electrolab Fermentation Manager SCADA software at 1 L working
 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60
volume. The batch media used for fermentation studies consisted
of 2% yeast extract, 4% peptone and 5% dextrose, 100 mM potas-
sium phosphate buffer (pH 6.0) and 0.67% YNB. The culture pH was
maintained at 6.0 using 28% liquor ammonia and 50% orthophos-
phoric acid. Primary inoculum was prepared in YPD broth while
the inoculum for fermenter runs was made in 500 mL erlenmeyer
flasks containing 100 mL BMDY medium. The cultivation tempera-
ture was maintained at 30 ◦ C. Biomass production was carried out
in the batch mode until the available dextrose got depleted as indi-
cated by a DO spike. The glucose concentration was also measured
by a glucose meter (Accu Check, Roche, Germany). The cells were
induced using 100% methanol containing 12 mL/L PTM1 trace salts
solution (6 g/L CuSO4 ·5H2 O, 0.08 g/L NaI, 3 g/L MnSO4 ·H2 O, 0.2 g/L
Na2 MoO4 ·2H2 O, 0.02 g/L H3 BO3 , 0.5 g/L CoCl2 , 20 g/L ZnCl2 , 65 g/L
FeSO4 ·7H2 O, 0.2 g/L Biotin, 5 mL/L H2 SO4 ). The methanol feed rate
was controlled between 3.3 mL/L/h and 10.69 mL/L/h to avoid its
accumulation to toxic level. It is always crucial to keep methanol
concentration below the inhibitory level to avoid non-specific pro-
tein secretion with protease activation [25]. To check methanol
limiting cell growth, the DO spike strategy was used. Sampling was
done at an interval of 3 h where 1 mL culture broth was centrifuged
in pre-weighed tubes. Supernatant was stored at 4 ◦ C while pellet
samples were centrifuged again to remove any remaining super-
natant and weighed to calculate the wet cell weight (WCW g/L). The
pellet samples were then dried at 60 ◦ C for 4 days after which their
dry cell weight (DCW g/L) was calculated. All the measurements
were done in quadruplicates and an average has been reported with
±5% experimental error.
4. Results
4.1. Construction, transformation and screening of recombinant
Pichia clones
Streptokinase is a key biological macromolecule involved in
blood clot dissolution. The mature streptokinase gene of 1242 bp
was cloned under AOX1 and GAP promoter having N-terminus
␣-mating factor signal sequence for its extracellular expression.
Constructs having C-terminus 6xHis tag were also generated to
facilitate downstream processing of the recombinant streptoki-
nase. The schematic representation of all the constructs has been
given in Fig. 1. The streptokinase protein without tag is denoted as
rSK while that with C-terminus His tag is denoted as rSK-His in all
the results described.
All the constructs were transformed into P. pastoris X-33 and
GS115 strain and plated on YPDS agar plate containing Zeocin.
To further screen multicopy integrants, 100 recombinant colonies
from each transformant were selected on high Zeocin concentra-
tion of 2000 mg/L. Integration of the skc gene expression cassette
into the Pichia genome was confirmed by various colony PCR strate-
gies. Copy number of the streptokinase producing recombinant
Pichia clones was not determined since a high titre of streptoki-
nase was an ultimate target. Therefore, to screen a streptokinase
hyper producer, 10 PCR confirmed recombinant Pichia clones from
high Zeocin concentration were picked and protein expression was
checked till 120 h post methanol induction in 5 mL medium in
culture tubes. 12% SDS-PAGE analysis showed that recombinant
Pichia colonies secreted rSK into the culture medium from 12 h post
methanol induction at a range of 25–375 mg/L (data not shown).
Cell lysis revealed that the protein was not being retained in the
cytoplasm (data not shown). The best producer was picked for fur-
ther shake flask optimization studies. Similarly recombinant Pichia
strain having streptokinase gene with tag were screened and stud-
ied for streptokinase expression. The protein expression under GAP
promoter was exceptionally low in the range of 10–50 mg/L so it
53
was not selected for further studies (data not shown). Both P. pas-
toris X-33 and GS115 strains gave comparable protein expression.
However X-33 clones were chosen further due to GS115 auxotro-
phy for histidine. Therefore, all future experimental studies were
done with X-33 recombinant clones having methanol inducible
AOX1 promoter.
4.2. Shake flask expression and optimization studies
4.2.1. Expression studies in glycerol medium
Expression studies of the highest SK producing recombinant
Pichia clones were carried out initially in BMGY medium in 20 mL
shake flask culture, where cells were induced at a cell OD600 of 10
using methanol (0.5% v/v). The growth and product profile was fol-
lowed till 120 h post induction. The streptokinase producing clones
had almost similar growth rate as of the wild type culture indicat-
ing that SK production had no deleterious effect on the Pichia cells
(Fig. 2A). Recombinant Pichia colonies secreted SK into the culture
medium from 12 h post induction. The protein expression in culture
supernatant peaked after 72 h post induction at a level of 432 mg/L
and 350 mg/L for rSK and rSK-His respectively (Fig. 2B). In all the
shake flask experiments, the maximum biomass stabilized at an
OD600 of 21–23 after 48 h of induction. The culture supernatant of
the recombinant Pichia X-33 strain harbouring skc expression cas-
sette was run on a 12% SDS-PAGE where a diffused band of slightly
higher molecular weight rather than a 47 kDa discrete band of
streptokinase was observed along with a smaller truncated protein
fragment (Fig. 2C).
4.2.2. Expression studies in dextrose medium
Glycerol is a complex carbon source while dextrose is a sim-
ple sugar and hence is easily metabolizable. In our laboratory,
means for measuring and controlling dextrose concentration in
broth cultures was available; therefore expression studies were
also conducted in BMDY medium where dextrose was used as a
carbon source in place of glycerol. In shake flask studies, the use of
an alternate carbon source supported a slightly higher cell biomass,
where a maximum cell OD600 of ∼24–27 was obtained (Fig. 2A).
A maximum protein yield of 473 mg/L rSK and 406 mg/L rSK-His
was obtained after 72 h of induction which was 10–16% higher
as compared to the value obtained in glycerol medium (Fig. 2B).
A few non-specific bands, similar to BMGY expression were also
observed from SDS-PAGE analysis (Fig. 2C). These bands could be
because of non-specific secretion or degradation of recombinant
product.
4.2.3. Effect of temperature on streptokinase expression
Expression studies were also conducted at a lower tempera-
ture of 20 ◦ C to study its effect on production and degradation
of recombinant streptokinase in BMDY medium. In this experi-
ment, the culture flasks were transferred to 20 ◦ C upon methanol
induction while the initial biomass generation was carried out at
30 ◦ C. Expression studies at lower temperature produced lower
titres of streptokinase as compared to the values obtained at 30 ◦ C.
The maximum protein yields were at a level of 322 mg/L (rSK)
and 233 mg/L (rSK-His) after 72 h of induction in BMDY (Fig. 2B).
These expression levels were significantly marginalized where
∼32–43% lower expression of streptokinase was achieved without
any improvement in secretion pattern as evident from SDS-PAGE
analysis (Fig. 2C). From growth profile, no adverse effect of pro-
tein production on cell health was observed and recombinant cells
grew unhampered as of wild type X-33 (Fig. 2D). Hence, all further
experiments were conducted in BMDY medium at 30 ◦ C and culture
was harvested after 72 h of induction.
54 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60

Fig. 1. Schematic representation of different expression constructs under AOX1 and GAP promoter. (A). pPICZ␣A-skc-His; (B). pGAPZ␣A-skc-His; (C). pPICZ␣A-skc; and (D).
pGAPZ␣A-skc.

4.3. Scale up of streptokinase expression
To increase the volumetric product concentration of recombi-
nant streptokinase, expression studies were carried out in 2 L flasks
containing 500 mL BMDY medium. The maximum biomass pro-
duced after 72 h of induction was OD600 of 26–30, when cells were
induced at OD600 of 10. From growth profile, an uninterrupted cell
growth was observed indicating no detrimental effect of protein
production on cell health post methanol induction (Fig. 3A). The
recombinant protein expression in culture broth was at a level of
452 mg/L rSK and 420 mg/L of rSK-His indicating that scale-up of
culture volume did not undermine the secretion efficacy of the
system (Fig. 3B). A pre-induction higher biomass was expected to
support higher protein production, therefore shake flask expres-
sion studies were conducted where cells were grown till OD600 of
20 and subsequently induced using 0.5% methanol. The cell biomass
grew to a maximum OD600 of approximately 34–37 (Fig. 3A) which
resulted a highest streptokinase of 582 mg/L rSK and 538 mg/L

Fig. 2. Expression of recombinant streptokinase in Pichia X-33 strain having pPICZ␣A-skc and pPICZ␣A-skc-His expression cassette in glycerol and dextrose medium. (A).
Growth profile in BMGY & BMDY medium at 30 ◦ C; (B). Streptokinase volumetric product concentration at 30 ◦ C and 20 ◦ C after 72 h of induction; (C). SDS-PAGE expression
profile of recombinant streptokinase where (a). rSK (BMGY, 30 ◦ C); (b). rSK-His (BMGY, 30 ◦ C); (c). rSK (BMDY, 30 ◦ C); (d). rSK-His (BMDY, 30 ◦ C; (e). rSK (BMDY, 20 ◦ C); and
(f). rSK-His (BMDY, 20 ◦ C); and (D). Growth profile in BMDY medium at 20 ◦ C. rSK is streptokinase without any tag & rSK-His is streptokinase with 6xHis tag.
 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60 55

Fig. 3. Optimization of induction OD600 for higher streptokinase expression (with and without His tag) at shake flask level in dextrose medium using Pichia X-33 strain. (A).
Growth profile post-induction at an OD600 of 10 and 20 using wild type Pichia X-33 strain as control; (B). Product profile at an induction of OD600 10 and 20; and (C). 12%
SDS-PAGE analysis of recombinant streptokinase where (a). rSK (OD600 20 induction); and (b). rSK-His (OD600 20 induction).

rSK-His respectively after 72 h of induction (Fig. 3B). In both the times higher in both cases as compared to OD600 10 induction.
cases the protein accumulation in culture supernatant continued Moreover, even at higher OD600 induction the non-specific secre-
till 72 h of induction after which it tapered off. The streptoki- tion of proteins in culture broth remained negligible as evident
nase production achieved at higher OD600 induction was ∼1.28 from SDS-PAGE profile (Fig. 3C). The highly specific secretion of

Fig. 4. Purification, deglycosylation and western blot analysis of recombinant streptokinase on 12% SDS-PAGE (A). Ni-NTA affinity chromatography of His-tagged protein where
Lane M: MW marker, Lane 1: dialyzed culture supernatant, Lane 2: flow through, Lane 3: wash, Lanes 4–6: elution fractions from 1 to 3; (B). Size exclusion chromatography
of non-tagged protein where Lane M: MW marker, Lane 1: crude supernatant, Lane 2: vacuum concentrated sample, Lanes 3–9: elution fractions from 12 to 18; (C).
Deglycosylation of affinity purified recombinant protein using PNGase F enzyme where Lane M: MW marker; Lane 1: purified rSK-His, Lanes 2–5: 5, 10, 15 and 25 ␮L
deglycosylated sample; Lane 6: E. coli streptokinase. Asterisk (*) denotes PNGase F enzyme; and (D). Western blot analysis using anti-His antibody where Lane M: prestained
MW marker, Lane 1: positive control (hIL-7); Lane 2: crude rSK-His 72 h culture supernatant where (a). SDS-PAGE and (b). Western blot.
56 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60

Table 1
Purification of recombinant streptokinase from culture supernatant.

Purification step Volume (mL) Total protein (mg) Total activity (IU) Specific activity (IU/mg) Purification fold Protein recovery yield (%)

Ni-NTA affinity chromatography (rSK-His)

Crude culture supernatant 30 16.20 707,850.90 43,694.50 1.00 100
Concentrated and dialyzed 4.65 14.32 752,117.33 52,522.16 1.20 88.39
Ni-NTA affinity chromatography 4.0 11.44 742,490.32 64,903.00 1.48 70.62

Gel filtration chromatography (rSK)

Crude culture supernatant 30 17.40 788,098.20 45,293.00 1.00 100
Concentrated (10 kDa + vacuum) 0.25 14.28 653,631.30 45,772.50 1.01 82.07
Gel filtration chromatography 7.0 11.34 626,417.82 55,240.00 1.22 65.17

recombinant SK in culture broth would make the purification pro-

cess cost effective. The SDS-PAGE analysis also showed the presence
of two prominent bands where high molecular weight band con-
tributed the major fraction.

4.4. Purification of recombinant streptokinase

Recombinant streptokinase with a C-terminal 6xHis tag was

purified using Ni-NTA affinity chromatography as described in
materials and methods. 14.32 mg of concentrated and dialyzed
streptokinase was loaded onto the Ni-NTA matrix and eluted using
300 mM imidazole. 11.44 mg of purified protein was recovered and
was found to be active. From SDS-PAGE analysis of purified protein,
the recovery of the small SK fragment was not observed because
it could be devoid of C-His tag due to proteolytic cleavage during
secretion process (Fig. 4A). The Ni-NTA affinity chromatography
gave protein recovery yield of 70.62% with 1.48 folds purification
(Table 1). The protein recovery yield was high due to specific secre-
tion of recombinant streptokinase in culture supernatant.
The non-tagged rSK was also purified in a single step by gel
filtration chromatography using Sephadex G-100 matrix and the
purified product was found to possess plasminogen activating abil-
ity. The protein recovery yield from the crude culture supernatant
was 65.17% with 1.22 folds purification (Table 1). In size exclu-
sion chromatography, the C-terminus cleaved smaller SK protein
fragment was also recovered as evident from SDS-PAGE analysis
(Fig. 4B). The protein purity levels were fairly high at a level of
∼85–90% in both purification strategies.

4.5. Deglycosylation and western blot analysis of recombinant

streptokinase

The amino acid sequence of streptokinase protein possesses

three potential N-glycosylation sites at Asp 14 (NNSQ), Asp 265
(NNTD) and Asp 377 (NASY). From shake flask experiments, a
slightly high molecular weight band of SK was observed due to dif-
ferential glycosylation pattern. Therefore deglycosylation of SK was
done using PNGase F, an amidase from Flavobacterium meningosep-
ticum that was reported to remove high mannose and complex
N-linked glycans from glycoproteins. The purified streptokinase
(rSK-His) when treated with PNGase F resulted in a discrete band
of streptokinase showing similar molecular weight as of the non-
glycosylated counterpart produced in E. coli (Fig. 4C). The 6xHis
tagged protein was also confirmed by western blot using anti-His
antibodies which gave a positive blot on the PVDF membrane where
laboratory produced human interleukin-7 (hIL-7) was used as pos-
itive control (Fig. 4D). The smaller C-terminus truncated fragment
of rSK was not observed due to cleavage of His-tag from C-terminus.
4.6. Biological activity and zymogram analysis
The biological activity of streptokinase was tested using the
synthetic substrate Chromozym PL and the maximum level of
activity achieved in crude culture supernatant was estimated to
Fig. 5. Activity assay and zymographic analysis of recombinant streptokinase. (A).
Activity assay using Chromozym PL as synthetic substrate; and (B). Zymographic
analysis of recombinant streptokinase where Lane M: MW marker, Lane 1: wild
type X-33 culture supernatant (negative control), Lane 2: crude rSK-His (72 h), Lane
3: crude rSK (72 h), Lane 4: Lifokinase (commercial positive control).
be 43,694.5 IU/mg for rSK-His and 45,293 IU/mg for rSK (Table 1).
The specific activity of His-tagged protein was slightly better than
the non-tagged protein. 1 mg of partially purified rSK-His was esti-
mated to have 64,903 IU while rSK contained 55,240 IU where
Lifokinase was taken as standard control. The delay in complex for-
mation decreased with increase in purity level of product as evident
from Fig. 5A. During SK:Plasminogen complex formation, Pichia SK
behaved better as compared to E. coli produced commercial SK as
evident from time scan for activity assay.
The plasminogen activating ability of recombinant streptok-
inase was also confirmed by a caseinolytic assay. Zymographic
analysis of the purified streptokinase showed a clear zone of
 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60 57

Fig. 6. Biophysical characterization and stability analysis of recombinant streptokinase. (A). Far-UV CD spectra in 20 mM sodium phosphate buffer (pH 7.0); (B). Fluorescence
spectra of streptokinase; (C). Stability analysis of lyophilized Pichia culture supernatant (Lanes 1–4) having recombinant streptokinase on storage at −20 ◦ C for more than
one year using 12% SDS-PAGE where Lane M: MW marker; Lane 1: rSK-His (BMGY); Lane 2: rSK-His (BMDY); Lane 3: rSK (BMGY); Lane 4: rSK (BMDY); Lane 5: rSK-His fresh
sample; Lane 6: rSK fresh sample; and (D). Comparative stability analysis of glycosylated (Pichia) and non-glycosylated (E. coli) streptokinase using 12% SDS-PAGE where
Lane M: MW marker; Lanes 1–3: three commercial streptokinase, i.e., Lifokinase, GlanikinaseTM and R-THROMBO, Lane 4: purified rSK-His.

caseinolysis corresponding with the stained band on the SDS-PAGE
(Fig. 5B). The zymogram results confirmed that both tagged and
non-tagged streptokinase retain their plasminogen activating abil-
ity and converted plasminogen to plasmin which in turn lysed the
casein in skimmed milk. The wild type X-33 culture supernatant
when used as negative control did not show any zone of caseinoly-
sis further confirming the fact that the zone was not being produced
by any protease if present in the culture supernatant.
4.7. Biophysical characterization of recombinant streptokinase
4.7.1. CD and fluorescence spectroscopy
Secondary structure content of glycosylated recombinant strep-
tokinase was determined using far-UV CD experiments where 10
scans for each sample were performed to measure the percentage
of ␣-helix and ␤-sheet in the protein. The recombinant streptoki-
nase produced from Pichia and the commercial streptokinases from
E. coli were predicted to contain 15.43% ␣-helix and 26.43% ␤-sheet
using the K2D2 software (Fig. 6A). The fall in intensity of spectral
curve at ∼208 nm strongly suggested the ␣+␤ nature of streptoki-
nase.
The conformational properties of streptokinase were con-
firmed by fluorescence emission spectra recorded over a range of
300–600 nm. Streptokinase has a single tryptophan residue that
was excited at 295 nm. Intrinsic fluorescence of the recombinant
streptokinase produced in Pichia and the commercial streptoki-
nases from E. coli was compared and the emission maxima was
recorded to be around 347 nm which corroborated well with liter-
ature reports (Fig. 6B) [24].
4.7.2. Protein stability and tandem mass spectrometry analysis
To check the storage stability of recombinant streptokinase,
the crude culture supernatant from shake flask was lyophilized
and stored at −20 ◦ C for more than 1 year. The lyophilized strep-
tokinase was compared with freshly produced streptokinase. The
SDS-PAGE profile showed insignificant degradation of recombi-
nant streptokinase when stored at lower temperature of −20 ◦ C
(Fig. 6C). Pichia produced streptokinase showed improved stability
in comparison with commercial streptokinase from E. coli. Pichia
produced purified streptokinase showed reduced degradation than
the lyophilized injection powders of commercial streptokinase
upon storage at the recommended temperature (Fig. 6D).
The peptide sequences obtained after mass spectrometry
(MALDI-TOF/TOF) were compared to the NCBI and Swiss Prot
database using the MASCOT search algorithm. The protein was
identified with a significant protein score (p < 0.05) and showed
homology with Streptococcus dysgalactiae subsp. equisimilis strep-
tokinase. Both the full length streptokinase and the C-terminal
truncated fragment were analyzed by MALDI-TOF/TOF. 15 and 8
peptide matches were obtained for SK and truncated SK respec-
tively with a score of 395 and 378 for rSK and C-terminal truncated
rSK. There was no hit on the C-terminus of truncated SK fragment
confirming the truncation of protein from C-terminus (Fig. 7A–D).
4.8. Fermentation studies
For high level production of active streptokinase, fed-batch
fermentation studies were carried out using X-33 Pichia strain
harbouring skc expression cassette (pPICZ␣A-skc-His). Cells were
58 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60

Fig. 7. MALDI-TOF/TOF analysis of recombinant streptokinase. (A). 12% SDS-PAGE of culture supernatant showing two prominent bands of streptokinase excised for mass
spectrometry analysis; (B). MALDI-TOF/TOF spectra of tryptic digest of high molecular weight streptokinase band; (C). Matched peptides showing identity with S. dysgalactiae
subsp. equisimilis SK in high molecular weight protein; and (D). Matched peptides showing identity with S. dysgalactiae subsp. equisimilis SK in low molecular weight truncated
protein fragment.

Fig. 8. Production of recombinant streptokinase at bioreactor level. (A). Time profile of growth (WCW & DCW) and methanol feed rate in batch cultivation; (B). Plot showing
growth (ln DCW), volumetric and specific product concentration (YP/X ) of recombinant streptokinase in Pichia X-33 strain; and (C). 12% SDS-PAGE showing expression profile
of His-tagged streptokinase till 72 h of induction where Lane M: MW marker; Lanes 1–7: rSK-His from 0 to 72 h of induction. 2 ␮L of sample was loaded.
 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60
grown in 1 L batch medium till a WCW of 132 g/L after which culture
was induced by initiating a methanol feed at a rate of 3.3 mL/L/h.
The maximum biomass reached to a level of 318 g/L WCW and then
subsequently fell down to 290 g/L (Fig. 8A). During the batch phase,
the culture grew at a specific growth rate of 0.27 h−1 . However,
it gradually declined to a level of 0.023 h−1 within 32 h of induc-
tion and then to 0.019 h−1 . The methanol feed rate was accordingly
adjusted with cell growth to avoid excessive feeding to prevent its
accumulation beyond toxic level. The product accumulation in cul-
ture supernatant kept increasing till 48 h of induction regardless of
specific growth rate to a maximum level of 4.25 g/L indicating that
proteolytic degradation was not a significant problem. The specific
product yield (YP/X ) also increased with fermentation time till 48 h
after which it remained constant at ∼49.75 mg/g DCW (Fig. 8B). At
this point, the highest volumetric productivity of the process was
at a level of 68.55 mg/L/h whereas overall volumetric productiv-
ity was 57.43 mg/L/h. From SDS-PAGE analysis, a specific build up
of recombinant streptokinase was observed in culture supernatant
with induction time (Fig. 8C).
5. Discussion
Cardiovascular diseases (CVDs) are one of the biggest global
killers in the present health scenario where streptokinase can be
a molecule with immense therapeutic value to the developing
countries [1,2]. It has been produced in several heterologous hosts
with varying degrees of success [5,13,14,18,19,26]. Therefore, we
have attempted to resolve the problem of its poor expression in
eukaryotic hosts via host-vector combination followed by biopro-
cess optimization. The inaccurate monitoring of residual glycerol
concentration during fermentation could lead to AOX1 promoter
repression which in turn could result in lower transcription and
protein production [27,28]. Therefore, expression studies were con-
ducted using Pichia X-33 in glycerol and dextrose medium where
dextrose supported slightly higher titre of protein. Cultivation at
20 ◦ C produced ∼32–43% less protein than expression at 30 ◦ C, this
could be because of reduced protein synthesis rate at low tempera-
ture. The protein profile obtained on SDS-PAGE revealed no change
in band pattern even at lower temperature. Induction at higher
OD600 of 20 produced ∼1.28 folds increase in protein concentration
indicating favourable contribution of pre-induction higher biomass
on final volumetric yields. The constitutive expression under GAP
promoter was also attempted; however, expression yields were sig-
nificantly compromised due to its toxicity towards expression host.
The toxicity of SK expression was also reported in E. coli [9,12].
The secretory expression using inducible AOX1 promoter had no
derogatory effect on host physiology as recombinant cultures grew
similarly as of wild type X-33 further substantiating our claim of
reduced toxicity. The recombinant protein expression supported by
P. pastoris GS115 (his4) was comparable to P. pastoris X-33 strain
however it did not find any favour in large scale fermentation stud-
ies due to histidine auxotrophy. The production of both tagged and
non-tagged streptokinase was optimized at shake flask level to ana-
lyze any effect of fusion tag on its biological activity as reported in
case of other therapeutic proteins [29,30].
Soluble expression of streptokinase has been reported to be
associated with C-terminal protein truncation with two strep-
tokinase populations [7,13,14,26,31]. In our case too, a smaller
fragment of streptokinase was also observed which was in agree-
ment with earlier reports in P. pastoris [18]. The protein truncation
was further confirmed by Ni-NTA affinity chromatography where
the C-terminal truncated streptokinase lacking histidine tag failed
to bind the column whereas in size exclusion chromatography both
bands were recovered. In addition, the MALDI-TOF/TOF analysis of
truncated streptokinase did not show any hit near the C-terminus
59
of the protein. Pichia produced SK was more stable than E. coli
produced commercial protein when kept at the recommended tem-
perature of 4 ◦ C. Lyophilized crude culture supernatant stored at
−20 ◦ C prevented any degradation of protein during long term
storage. The delay in Pichia produced streptokinase:plasminogen
activator complex formation decreased with an increase in purity
level of protein and performed better than commercial streptok-
inase. The addition of fusion tag did not show any adverse effect
on its biological activity. The specific activity of His-tagged protein
was slightly better than the non-tagged protein. 1 mg of partially
purified rSK-His contains 64,903 IU of streptokinase while the spe-
cific activity of rSK was 55,240 IU/mg. This may be due to the fact
that both full length and truncated SK bands were getting purified
during gel filtration chromatography thereby this increase in the
total protein concentration could have decreased its specific activ-
ity. From CD spectroscopy analysis, streptokinase was classified as
an ␣+␤ protein with approximately 15.43% ␣-helical and 26.43%
␤-sheet content. The fluorescence spectroscopy results matched
with the spectra obtained for commercial streptokinases produced
in E. coli and gave emission maxima at 347 nm. These spectroscopic
results were well in agreement of earlier literature reports [24,32].
Streptokinase was produced in culture broth as a glycosylated
polypeptide of slightly higher molecular weight where transloca-
tion of nascent peptide through endoplasmic reticulum and the
Golgi complex added additional mannose sugars [33]. These results
were well anticipated as SK protein possessed three putative N-
linked glycosylation sites at Asp 14, 265 and 377. The glycosylated
streptokinase has been shown to have enhanced stability and
improved proteolytic resistance [18]. Furthermore, the biological
function of this macromolecule was not impeded due to glycosyl-
ation as the functional core region could have remained free and
interacted with plasminogen to liberate plasmin. After the enzy-
matic removal of glycans from streptokinase by using PNGase F,
the protein moved at a MW similar to E. coli produced protein.
The high cell density fermentation studies allowed us to design
an optimal production process with a maximum product con-
centration of 4.25 g/L with a specific streptokinase yield of (YP/X )
of 49.75 mg/g DCW. The volumetric productivity was very high
due to higher biomass and reduced cultivation time at bioreactor
level. The higher biomass concentrations and shorter fermentation
time helped us to achieve an enhanced volumetric productivity of
57.43 mg/l/h with a 7.9 folds increase in the final product con-
centration when compared to shake flask results. Summing up,
we demonstrated an effective strategy for the production of func-
tionally accurate recombinant streptokinase with its purification,
biophysical characterization and process optimization at bioreactor
level.
6. Conclusions
The recombinant proteins’ toxicity towards expression host
remains a significant deterrent for their large scale production. In
this study, the expression of recombinant SK, which is toxic to its
host, was enhanced many folds by the simple expedient of get-
ting the product in the culture supernatant. The highest product
accumulation in culture supernatant was 4.25 g/L in high cell den-
sity fermentation. The high purity and expression yield achieved
for this therapeutically important macromolecule provided us an
attractive and cost effective production process. This is the highest
reported yield of soluble streptokinase in Pichia system.
Authors’ contribution
Adivitiya participated in all the experiments and executed
cloning, shake flask optimization and biophysical characterization
60 Adivitiya et al. / International Journal of Biological Macromolecules 83 (2016) 50–60
work with manuscript writing. VKD worked on bioprocess opti-
mization work and ND helped in carrying out the activity assay.
YPK conceived the study and participated in drafting and editing of
the manuscript. All authors read and approved the final manuscript
without any conflict of interests.
Acknowledgements
This work was financially supported by R&D grant of University
of Delhi. Adivitiya, Vikas Kumar Dagar, and Nirmala Devi are the
recipients of senior research fellowship from Council of Scientific
and Industrial Research (CSIR), Indian Council of Medical Research
(ICMR), and University Grants Commission (UGC), Govt. of India,
New Delhi, respectively.
References
[1] V. Kunadian, C.M. Gibson, Thrombolytics and myocardial infarction,
Cardiovasc. Ther. 30 (2012) e81–e88.
[2] A. Banerjee, Y. Chisti, U.C. Banerjee, Streptokinase – a clinically useful
thrombolytic agent, Biotechnol. Adv. 22 (2004) 287–307.
[3] A. Kunamneni, T.T.A. Abdelghani, P. Ellaiah, Streptokinase – the drug of choice
for thrombolytic therapy, J. Thromb. Thrombolysis 23 (2007) 9–23.
[4] H. Malke, B. Roe, J.J. Ferretti, Nucleotide sequence of the streptokinase gene
from Streptococcus equisimilis H46A, Gene 34 (1985) 357–362.
[5] H. Malke, J.J. Ferretti, Streptokinase: cloning, expression and excretion by
Escherichia coli, Proc. Natl. Acad. Sci. U. S. A. 81 (1984) 3557–3561.
[6] J.H. Ko, D.K. Park, I.C. Kim, S.H. Lee, S.M. Byun, High-level expression and
secretion of streptokinase in Escherichia coli, Biotechnol. Lett. 17 (1995)
1019–1024.
[7] J. Pratap, K.L. Dikshit, Effect of signal peptide changes on the extracellular
processing of streptokinase from Escherichia coli: requirement for secondary
structure at the cleavage junction, Mol. Gen. Genet. 258 (1998) 326–333.
[8] M.P. Estrada, L. Hernandez, A. Perez, P. Rodriguez, R. Serrano, R. Rubiera, A.
Pedraza, G. Padrón, W. Antuch, J.D.L. Fuente, L. Herrera, High-level expression
of streptokinase in Escherichia coli, Nat. Biotechnol. 10 (1992) 1138–1142.
[9] Y. Pal, J.C. Gupta, K.J. Mukherjee, Optimizing recombinant protein expression
in the T7 system under the control of the proUp promoter, Biotechnol. Lett. 23
(2001) 41–46.
[10] S. Ramalingam, P. Gautam, K.J. Mukherjee, G. Jayaraman, Effects of
post-induction feed strategies on secretory production of recombinant
streptokinase in Escherichia coli, Biochem. Eng. J. 33 (2007) 34–41.
[11] D. Goyal, G. Sahni, D.K. Sahoo, Enhanced production of recombinant
streptokinase in Escherichia coli using fed-batch culture, Bioresour. Technol.
100 (2009) 4468–4474.
[12] S.S. Yazdani, K.J. Mukherjee, Continuous-culture studies on the stability and
expression of recombinant streptokinase in Escherichia coli, Bioprocess.
Biosyst. Eng. 24 (2002) 341–346.
[13] H. Malke, D. Gerlach, W. Kohler, J.J. Ferretti, Expression of a streptokinase
gene from Streptococcus equisimilis in Streptococcus sanguis, Mol. Gen. Genet.
196 (1984) 360–363.
[14] F. Laplace, J. Muller, J. Gumpert, H. Malke, Novel shuttle vectors for improved
streptokinase expression in streptococci and bacterial L-forms, FEMS
Microbiol. Lett. 65 (1989) 89–94.
[15] X.W. Zhang, T. Sun, X.N. Huang, X. Liu, D.X. Gu, Z.Q. Tang, Recombinant
streptokinase production by fed-batch cultivation of Escherichia coli, Enzyme
Microb. Technol. 24 (1999) 647–650.
[16] M. Ahmad, M. Hirz, H. Pichler, H. Schwab, Protein expression in Pichia
pastoris: recent achievements and perspectives for heterologous protein
production, Appl. Microbiol. Biotechnol. 98 (2014) 5301–5317.
[17] G. Potvin, A. Ahmad, Z. Zhang, Bioprocess engineering aspects of heterologous
protein production in Pichia pastoris: a review, Biochem. Eng. J. 64 (2012)
91–105.
[18] J. Pratap, G. Rajamohan, K.L. Dikshit, Characteristics of glycosylated
streptokinase secreted from Pichia pastoris: enhanced resistance of SK to
proteolysis by glycosylation, Appl. Microbiol. Biotechnol. 53 (2000) 469–475.
[19] R. Kumar, J. Singh, Expression and secretion of a prokaryotic protein
streptokinase without glycosylation and degradation in Schizosaccharomyces
pombe, Yeast 21 (2004) 1343–1358.
[20] Y. Pal, A. Khushoo, K.J. Mukherjee, Process optimization of constitutive human
granulocyte-macrophage colony-stimulating factor (hGM-CSF) expression in
Pichia pastoris fed-batch culture, Appl. Microbiol. Biotechnol. 69 (2006)
650–657.
[21] S.S. Yazdani, K.J. Mukherjee, Overexpression of streptokinase using a
fed-batch strategy, Biotechnol. Lett. 20 (1998) 923–927.
[22] J. Parrado, F. Conejero-Lara, R.A.G. Smith, J.M. Marshall, C.P. Ponting, C.M.
Dobson, The domain organization of streptokinase: nuclear magnetic
resonance, circular dichroism, and functional characterization of proteolytic
fragments, Protein Sci. 5 (1996) 693–704.
[23] C. Perez-Iratxeta, M.A. Andrade-Navarro, K2D2: estimation of protein
secondary structure from circular dichroism spectra, BMC Struct. Biol. 8
(2008) 25.
[24] H. Welfle, R. Misselwitz, H. Fabian, W. Damerau, W. Hoelzer, D. Gerlach, N.N.
Kalnin, S.Y. Venyaminov, Conformational properties of streptokinase –
secondary structure and localization of aromatic amino acids, Int. J. Biol.
Macromol. 14 (1992) 9–18.
[25] S. Kim, M.D. Anjou, K.J. Lanz, C.E. Evans, E.R. Gibson, J.T. Olesberg, M. Mallem,
I. Shandil, A. Nylen, E.J. Koerperick, D.W. Cooley, G.A. Brower, G.W. Small, M.A.
Arnold, Real-time monitoring of glycerol and methanol to enhance antibody
production in industrial Pichia pastoris bioprocesses, Biochem. Eng. J. 94
(2015) 115–124.
[26] S.L. Wong, R. Ye, S. Nathoo, Engineering and production of streptokinase in a
Bacillus subtilis expression-secretion system, Appl. Environ. Microbiol. 60
(1994) 517–523.
[27] M. Inan, M.M. Meagher:, Non-repressing carbon sources for alcohol oxidase
(AOX1) promoter of Pichia pastoris, J. Biosci. Bioeng. 92 (2001) 585–589.
[28] K. Weinhandl, M. Winkler, A. Glieder, A. Camattari, Carbon source dependent
promoters in yeasts, Microb. Cell Fact. 13 (2014) 5.
[29] S.A. Stifter, J.A. Gould, N.E. Mangan, H.H. Reid, J. Rossjohn, P.J. Hertzog, N.A.D.
Weerd, Purification and biological characterization of soluble, recombinant
mouse IFN␤ expressed in insect cells, Protein Expr. Purif. 94 (2014) 7–14.
[30] M.Z. Czogalla, C. Stumpp, E. Bonifacio, R. Paul, Comparison of the purification
of biologically active IL-7 cytokine expressed in Escherichia coli and Pichia
pastoris, Protein Expr. Purif. 110 (2015) 65–71.
[31] S.K. Park, B.R. Lee, S.M. Byun, The leader sequence of streptokinase is
responsible for its post-translational carboxyl-terminal cleavage, Biochem.
Biophys. Res. Commun. 174 (1991) 282–286.
[32] J.T. Radek, F.J. Castellino, Conformational properties of streptokinase, J. Biol.
Chem. 264 (1989) 9915–9922.
[33] K.D. Schutter, Y.C. Lin, P. Tiels, A.V. Hecke, S. Glinka, J.W. Lehmann, P. Rouze,
Y.V.D. Peer, N. Callewaert, Genome sequence of the recombinant protein
production host Pichia pastoris, Nat. Biotech. 27 (2009) 561–566.