Circoviruses 513
See also: Fungal Viruses; Partitiviruses: General
Features.
Further Reading
Castón JR, Ghabrial SA, Jiang D, et al. (2003) Three-dimensional
structure of Penicillium chrysogenum virus: A double-stranded
RNA virus with a genuine T ¼ 1 capsid. Journal of Molecular Biology
331: 417–431.
Covelli L, Coutts RHA, Di Serio F, et al. (2004) Cherry chlorotic rusty spot
and Amasya cherry diseases are associated with a complex pattern
of mycoviral-like double-stranded RNAs. Part I: Characterization of a
Circoviruses
A Mankertz, Robert Koch-Institut, Berlin, Germany
ã 2008 Elsevier Ltd. All rights reserved.
Glossary
Apoptosis Programmed self-induced cell death.
Botryoid Grape-like appearance.
Bursa of Fabricius Specialized organ in birds, that
is necessary for B-cell development.
Chimera Virus created from two or more different
genetic sources.
Koch’s postulates Four criteria that must be fulfilled
in order to establish a causal relationship between an
agent and a disease.
Mono/polycistronic mRNA mRNA is termed
polycistronic when it contains the genetic information
to translate more than one protein, monocistronic if
only one protein is encoded.
Phylogenetic tree Depicts the evolutionary
interrelationships among species that are believed to
have a common ancestor.
Rolling-circle replication (RCR) Mechanism of
replication which takes its name from the
characteristic appearance of the replicating DNA
molecules, a special feature of RCR is the
uncoupling of the synthesis of the two DNA strands.
Circovirus Taxonomy
Circoviruses contain a covalently closed circular single-
stranded DNA (ssDNA) genome with sizes between 1759
and 2319 nt. The circular nature of their genomes, which
are the smallest possessed by animal viruses, has led
new species in the genus Chrysovirus. Journal of General Virology
85: 3389–3397.
Ghabrial SA, Jiang D, and Castón RJ (2005) Chrysoviridae. In: Fauquet CM,
Mayo MA, Maniloff J, Desselberger U, and Ball LA (eds.) Virus
Taxonomy: Eighth Report of the International Committee on
Taxonomy of Viruses, pp. 581–590. London: Academic Press.
Ghabrial SA, Soldevila AI, and Havens WM (2002) Molecular genetics
of the viruses infecting the plant pathogenic fungus
Helminthosporium victoriae. In: Tavantzis S (ed.) Molecular
Biology of Double-Stranded RNA: Concepts and Applications in
Agriculture, Forestry and Medicine, pp. 213–236. Boca Raton, FL:
CRC Press.
Jiang D and Ghabrial SA (2004) Molecular characterization of Penicillium
chrysogenum virus: Reconsideration of the taxonomy of the genus
Chrysovirus. Journal of General Virology 85: 2111–2121.
to the family being termed Circoviridae. Differences in
organization of the viral genomes and capsid morphology
led to their classification into two different genera.
Chicken anemia virus is the only species member of
the genus Gyrovirus, while the genus Circovirus currently
comprises Porcine circovirus type 1 and Porcine circovirus
type 2, Psittacine beak and feather disease virus, Pigeon
circovirus, Canary circovirus, and Goose circovirus. Duck cir-
covirus (DuCV), finch circovirus (FiCV), and gull circovirus
(GuCV) are members of tentative species in the genus,
while the circoviruses of raven (RaCV) and starling
(StCV) have been discovered only recently and are there-
fore not yet included in the taxonomic classification.
The reported size range for the chicken anemia
virus (CAV) virion is 19.1–26.5 nm, the genome is of
(–) polarity, and the open reading frames (ORFs) are over-
lapping. Only one mRNA molecule is produced from a
promoter/enhancer region; it encodes three partially
overlapping ORFs. CAV shows homology to the newly
identified ssDNA viruses in humans, torque teno virus
(TTV) and the related torque teno mini virus (TTMV),
which are members of the unassigned genus Anellovirus.
The noncoding regions of CAV and TTV are G/C-rich
and show a low level of nucleotide homology. In addition,
CAV and TTV specify structural proteins that contain
two amino acid motifs with putative roles in rolling-circle
replication (RCR) and nonstructural proteins that exhibit
protein phosphatase activity. CAV and TTV are sepa-
rately classified, since their sequence homology is
limited and only one mRNA is produced from CAV,
while splicing has been detected in TTV and TTMV.
Phylogenetic investigation of the family Circoviridae
514 Circoviruses

revealed that CAV has no close relationship to the genus homology in genome organization and protein sequences
Circovirus (Figure 1). and function to the plant-infecting viruses of the family
Members of the genus Circovirus differ in several Nanoviridae and Geminiviridae.
aspects from CAV, because they display a smaller particle
size (12–20.7 nm, Figure 2), their ambisense genomes
(Figure 3) are divergently transcribed, and splicing has Virion Structure
been reported. The viruses of the genus Circovirus show
The size for the CAV virion has been reported as
19.1–26.5 nm and 12–20.7 nm for circoviruses (Figure 2).
The virions of CAV, porcine circovirus type 1 (PCV1)
CAV rep and porcine circovirus type 2 (PCV2), are each comprised
of one structural protein, for which sizes of 50 (CAV),
GoCV rep 30 (PCV1), and 30 kDa (PCV2) have been estimated,
100 respectively. Psittacine beak and feather disease virus
DuCV rep (PBFDV) is reported to contain three proteins (26, 24,
95 and 16 kDa). The protein composition of the other avian
PCV2 rep circoviruses is not known, but putative structural proteins
100 have been identified by homology searches. All capsid
PCV1 rep proteins have a basic N-terminal region containing sev-
eral arginine residues, which is expected to interact with
StCV rep the packaged DNA. Virions do not possess an envelope.
98 Investigation of the structures of CAV, PCV1, and PCV2
FiCV rep revealed that all have an icosahedral T ¼ 1 structure
98
containing 60 capsid protein molecules arranged in 12
CaCV rep
94 pentamer clustered units. PCV2 and BFDV show similar
capsid structures with flat pentameric morphological
86 PiCV rep
units, whereas chicken anemia virus displayed protruding
BFDV rep pentagonal trumpet-shaped units.
0.1
Figure 1 Phylogenetic tree of members of the family
Circoviridae. The amino acid sequences of the Rep proteins of the
Pathogenesis of Circoviruses
members of the genus Circovirus (GoCV, DuCV, BFDV, PiCV, Circoviruses and Gyroviruses Induce Diseases
StCV, FiCV, CaCV, PCV1, PCV2) and of the only member of the
genus Gyrovirus (CAV) were compared. Analysis was performed Circoviruses are supposed to be host specific or to have
using the MacVector program package by analyzing 100 data sets. narrow host ranges. The fecal–oral route of transmission
is likely, but vertical transmission has been reported in
some cases. With the exception of PCV1, all known cir-
coviruses are pathogens, which cause immune suppres-
sion and damage in the lymphoreticular tissues.
CAV infections occur mainly in young chicken. The
main targets of CAV replication are cells in the bone mar-
row (hemocytoblasts) and precursor lymphocytes in the
thymus. Characteristic symptoms are aplastic anemia and
hemorrhagic lesions, watery blood, pale bone marrow,
lymphoid depletion, atrophy of thymus and bursa, and
swollen and discolored liver. Since macrophages recovered
from infected birds produce less interleukin 1 (IL-1) and
the pathogenicity of co-infecting viruses such as Marek’s
disease virus, infectious bursal disease virus, and Newcastle
disease virus are enhanced, immune suppression is thought
to play a role in CAV-induced pathogenesis.
Another intensively studied circoviral disease is psitta-
Figure 2 Electron microscope picture of particles of PCV1.
PCV1 particles in an immunoaggregation with a PCV1 cine beak and feather disease (PBFD). PBFD is the most
hyperimmuneserum (180 000-fold magnification, negative common disease in cockatoos and parrots and is typically
contrasting with 1% UAc). detected in young birds. Deformation of beak, claws, and
 Circoviruses 515

500 1000 1500

1 1759 PCV1

34 736 819 1756

Cap Rep

Cap
Rep
AG T
T A Rep⬘
G T
T T
C A Nick
G C
T A
C G
G C
C G
G C
T A
G C
Pos. 728 A T
A T Pos. 838
CCACGTCATCCTATAAAAGTGAAG CGGCAGCGGCAGCACCTCGGCAGCGTCAGTGAAAATGCCAAGCAAGAAAAGCGG

(a)
500 1000 1500 2000
1 2298 CAV

VP3
VP2
VP1

(b)
Figure 3 Genomic organization of PCV1 member of the type species of the genus Circovirus and CAV member of the type species of
the genus Gyrovirus. ORFs are shown in open boxes, the direction of transcription is indicated by triangles. Transcripts are indicated by
arrows, splice processes by dotted lines. (a) PCV1, the species type of the genus Circovirus, is shown. The ambisense genomic
organization is outlined, that is, both strands of the replicative form are coding for proteins. Therefore, the two major genes Rep and Cap
are divergently transcribed. Between the start points of Rep and Cap, the origin of viral replication is located. This element is drawn to a
larger scale, displaying its characteristic features, a putative hairpin, and adjacently located repeats. An arrow indicates the position
where Rep and Rep0 restrict the replicative intermediate to initiate the replication.(b) CAV is a member of the type species of the genus
Gyrovirus. Its genome is of the ‘negative-sense’ type, that is, the viral strand does not encode genetic information, it has to be converted
into a dsDNA version, from which one polycistronic mRNA is produced. Splice processes have not been observed.

feathers, lethargy, depression, weight loss, and severe ane-
mia are the most prominent symptoms.
Young pigeon disease syndrome (YPDS) is a multifac-
torial disease in which PiCV is assumed to induce immu-
nosuppression in young birds, which suffer from ill-thrift,
lethargy, anorexia, and poor race performance. Depletion
of splenic and bursal lymphocytes was seen and bacterial
agents as Escherichia coli and Klebsiella pneumoniae were
isolated more frequently from PiCV-infected birds. Inclu-
sion bodies were present in various organs, especially the
bursa of Fabricius.
In CaCV-infected neonatal canary birds, a condition
known as ‘black spot’ has been reported. It is associated
with abdominal enlargement, gall bladder congestion,
failure to thrive, dullness, anorexia, lethargy, and
feather disorder. Histological changes as lymphofollicular
hyperplasia, lymphoid necrosis, cellular depletion, and
cystic atrophy are observed in the thymus and the bursa
of Fabricius. A general feature of circovirus infection is
the formation of globular or botryoid, basophilic inclusion
bodies in the cytoplasm, in which the virus may form
paracrystalline arrays.
PCV1 and PCV2 seem to be restricted to pigs. PCV2 is
the etiological agent of a new disease in swine, the so-
called post-weaning multisystemic wasting syndrome
(PMWS), and may be involved in several other porcine
circoviral diseases (PCVDs) like porcine dermatitis and
nephropathy syndrome (PDNS) or porcine respiratory
disease complex. PMWS was first recognized in Canada
in 1991. Since then it has been described as a major
economic concern in virtually all pig-producing areas of
the world. PMWS primarily occurs in pigs between 60 and
516 Circoviruses
80 days old. Maternal antibodies confer titer-dependent
protection against PCV2 infection – higher titers are
generally protective, but low titers are not. PMWS is
characterized by wasting, respiratory signs, enlargement
of superficial inguinal lymph nodes, diarrhea, paleness of
the skin or icterus, but the clinical signs are often variable.
The most consistent feature of PMWS is a generalized
depletion of lymphocytes. Secondary infections with
opportunistic organisms are common. This indicates that
the immune system is involved in the pathogenesis of
PMWS. On affected farms, mortality may reach up to
40%, but it can be reduced, if special management plans
are implemented. In the first attempts, experimental
reproduction of the disease according to Koch’s postulates
has led to an amazing variety of results, since no symptoms
were seen as well as histopathological lesions or a full-
blown PMWS. The symptoms of the disease were aggra-
vated when piglets were infected in which the immune
system had been stimulated either by a prior vaccination
or by a co-infection with porcine parvovirus (PPV) or
porcine reproductive and respiratory syndrome virus
(PRRSV). These and other findings indicate that PMWS
is a multifactorial disease, in which not only factors such as
the status of the immune system and genetic predisposi-
tion but also practical aspects such as nutrition and vacci-
nation policy may influence the onset of the disease and
the severity of the symptoms.
Diagnosis of Circoviral Diseases
In general, diagnosis of circoviral diseases is based on de-
tection of the virus by culture, polymerase chain reaction
(PCR), immunohistochemistry or in situ hybridization, or
detection of antibodies against the circovirus by serology.
PBFD can also be diagnosed on the basis of feathering
abnormalities. PCV2 is a ubiquitous virus and also preva-
lent in healthy pigs; therefore, diagnosis of PMWS must
concurrently meet three criteria: (1) the presence of com-
patible clinical signs, (2) the presence of moderate to
severe characteristic microscopic lymphoid lesions, and
(3) the presence of moderate to high amount of PCV2
within these lesions.
PCV1 and PCV2
A striking difference is seen in the pathogenicity of PCV1
and PCV2. No disease is attributed to PCV1, while PCV2
is the etiological agent of PMWS, a new emerging disease
of swine. What may be the molecular basis for this distinct
feature? The genomes of the two strains are highly con-
served, especially the origin of replication (80% sequence
homology) and the Rep gene (82%). Exchange of replica-
tion factors between PCV1 and PCV2 did not reveal
differences, since the Rep protein of PCV1 (Rep/PCV1)
replicated its cognate origin as well as the heterotype
origin of PCV2 (and vice versa), suggesting that
pathogenesis may not be linked to the replication factors.
A higher degree of sequence deviation is found in the Cap
genes with less than 62% homology between PCV1 and
PCV2. Chimeras of PCV1 and PCV2 have been produced
and tested for their potential to induce PMWS and to
stimulate the immune answer. The chimera PCV2/1,
containing the PCV1 capsid gene cloned into the back-
bone of the pathogenic PCV2 genome, was compared to a
chimera PCV1/2, containing the PCV2 capsid gene in the
nonpathogenic PCV1 genome. Both variants displayed
similar growth characteristics in vitro. Gross lesions sig-
nificant for PMWS were not observed, but PCV1/
2 induces protective immunity to wild-type PCV2 chal-
lenge in pigs, indicating that it may be an effective vaccine
candidate. ORF3 is comprised by the rep gene and may
also contribute to the pathogenesis of PCV2, because its
sequence differs significantly in PCV1 and PCV2 and
induction of apoptosis has been reported.
Interaction with the Immune System
PCV2 provides a valuable model for gaining insight into
how ssDNA viruses interact with the host immune system
and for understanding their pathogenesis. PCV2 is intri-
guing in its ability to persist in macrophages and dendritic
cells without replication although its infectivity is
retained. When natural interferon (IFN)-producing cells
responded to an inducer of cytokine synthesis, their co-
stimulatory function, which induces myeloid dendritic
cell maturation, was clearly impaired in case of a concur-
rent PCV2 infection. Stimulation of the porcine immune
system with IFN-a and IFN-g causes increased replica-
tion of PCV2 in vivo, while no changes were observed in
IL-1-, IL-6-, tumor necrosis factor alpha (TNF-a)-,
or IL-10-treated cells. With the circumstantial evidence
compiled over the last years, one may assume that PMWS
can be considered as an acquired immunodeficiency
syndrome of pigs although direct evidence for this
hypothesis is still missing.
Molecular Biology of Circoviruses
Genome Organization of Circoviruses
The genomes of all circoviruses are composed from a
circular ssDNA molecule with a size between 1759 and
2319 nt and therefore display the smallest genomes pos-
sessed by mammalian viruses. Nevertheless, members
of the genera Circovirus and Gyrovirus show remarkable
differences in their genome organization.
The genomes of CAV isolates are either 2298 or 2319
nt in size. Part of the noncoding region of the genome is

G–C-rich and able to form putative hairpin structures.
The three genes are encoded by the viral (–)strand,
therefore CAV has a negative-sense genome organization.
One major polycistronic mRNA (2.0 kbp) is transcribed
from the circular double-stranded (ds) replication form
(RF), which is produced after infection. The nontran-
scribed region of the genome contains transcription initi-
ation and termination signals and a tandemly arranged
array of four or five 19 nt repeats with which promoter–-
enhancer activity is associated. Within this sequence,
estrogen response element consensus half-sites were
found, resembling the arrangement that can be recognized
by the nuclear receptor superfamily. Since expression
from the CAV promoter was significantly increased with
estrogen treatment, members of the nuclear receptor
superfamily may provide a mechanism to regulate CAV
activity.
The hypothesis that the circular ssDNA genome repli-
cates using the RCR mechanism is supported by the
presence of the conserved nonanucleotide motif within
the CAV genome, at which RCR is initiated in other cir-
cular ssDNA replicons, but it is not located at the apex of
a putative hairpin. The presence of two amino acid motifs
typical for enzymes involved in RCR within VP1 also
suggests that this structural protein possesses DNA repli-
cation function, while its basic N-terminus implies that
this protein is involved in capsid formation, too. This
would be highly unlike the genus Circovirus, where two
distinctly encoded proteins perform the two most ele-
mentary functions of replication and packaging of the
genome. Coding regions of the avian and porcine circo-
viruses are arranged divergently resulting in an ambisense
genome organization and creating two intergenic regions,
a larger one between the 50 ends of the two major ORFs
rep and cap and a shorter one between their 30 ends. In
case of PCV1 and PCV2, the non-coding regions between
the ATGs of the rep and cap gene comprise the origin
of viral genome replication. Similar genomic structures
are found in members of the families Geminiviridae and
Nanoviridae.
Viral ORFs and Proteins
Synthesis of three virus proteins is directed from the
CAV genome. VP1 (52 kDa) is encoded by ORF1 and
may combine the function of a structural protein as well
as the initiator of replication. VP2 (26 kDa) is a protein
phosphatase encoded by ORF2. VP2 protein phosphatase
activity is required for efficient replication. It may also have
a role as a scaffolding protein during virion assembly.
Co-expression of both VP1 and VP2 is necessary for the
induction of neutralizing antibodies. VP3 is a 14 kDa viru-
lence factor known to induce apoptosis in transformed cell
lines and has been called ‘apoptin’.
Circoviruses 517
Two major ORFs are encoded by the genomes of
PCV1 and PCV2, encoding the viral functions for replica-
tion (Rep and Rep0 ) and a structural protein (Cap). A similar
genomic structure is seen in the avian circoviruses. Several
smaller ORFs have been found by computer analyses, but
with the exception of ORF3 of PCV, which seems to be
involved in pathogenesis and apoptosis, their expression
has not been studied yet. The largest ORF of the ambisense
organized circoviruses is located on the viral plus-strand
(V1). It encodes the Rep protein (312 or 314 aa). Three
motifs conserved in enzymes mediating replication in the
RCR mode and a dNTP-binding domain have been iden-
tified. Both Rep proteins reside in the nucleus of infected
cells. Phylogenetic analyses suggest that circovirus Rep
proteins may have evolved by a recombination event
between the Rep protein of nanoviruses and an RNA-
binding protein encoded by picorna-like viruses or a heli-
case of prokaryotic origin. The second largest ORF of
all circoviruses is located on the complementary strand
(C1) and encodes the major structural protein Cap protein
(234 aa), which displays a basic N-terminus rich in arginine
residues. This suggests that this region is involved
in binding to viral DNA. Some avian circoviruses use alter-
native start codons for Cap translation. After expression in
bacteria and insect cells, Cap of PCV assembled into virus-
like particles when viewed by electron microscopy. Cap has
been shown to reside mostly in the nucleoli, but shuttling to
the cytoplasm occurs during the infectious cycle. ORF3 is
encoded counterclockwisely by ORF1. It encodes a protein
that is not essential for PCV replication but has been
reported to induce apoptosis.
Transcription of PCV
The promoter of the cap gene of PCV has been mapped
to a fragment at 1168–1428, that is, Pcap is located within
the rep gene. Pcap is not regulated by virus-encoded
proteins. The cap transcript starts at nucleotide 1238
with an untranslated leader sequence of 119 nt (1238 to
1120) joined to exon 2 of the ORF1 transcript at nucleo-
tide 737, immediately adjacent to the start point of
translation. Processing of this RNA has presumably
evolved to avoid synthesis of another protein initiated
at an internal start codon in the intron. The start of the
rep transcript of PCV1 has been mapped to nucleotide
767  10. The promoter of the rep gene, Prep, is com-
prised within a fragment, nucleotides 640–796. Prep
overlaps the intergenic region and the origin of replica-
tion. Prep is repressed by the Rep protein by binding to
hexamers H1 and H2; these elements are involved in
initation of replication, too. Mapping the rep mRNA
revealed synthesis of several transcripts in PCV1 and
PCV2. A full-length transcript directs synthesis of the
Rep protein (312 aa, 35.6 kDa). In a spliced transcript,
518 Circoviruses
removal of an intron (nucleotides 1176 to 1558) results in
synthesis of a truncated protein, which has been termed
Rep0. Rep0 is truncated to 168 aa (19.2 kDa) and, due to a
frameshift, the last 49 aa are expressed in a different
reading frame. Comparison of the ratio of Rep and
Rep0 transcript with a real-time PCR discriminating
between the two transcripts indicated a variation of the
ratio of the two transcripts in correlation to time. Repli-
cation of PCV is dependent on expression of both pro-
teins. Splicing of Rep proteins is a well-known feature in
other small ssDNA viruses (e.g., Mastrevirus), but, in
contrast to PCV, one Rep protein is sufficient for repli-
cation of these viruses.
Replication of Circoviruses
Although the main target for viral replication still remains
unknown, PCV2 was seen in vivo in a variety of cell types
including hepatocytes, enterocytes, epithelial and endo-
thelial cells, lymphocytes, smooth muscle cells, and fibro-
blasts. This broad range of cells that support PCV2
infection indicates that PCV2 does not enter the cell via
a rarely expressed receptor. When binding of PCV2 to
monocytic cells was investigated, it became evident that
surface proteins and glycosaminoglycans heparan sulfate
and chondroitin sulfate B are attachment receptors for
PCV2. This result is supported by the finding that the
heparan sulfate binding motif (XBBXBX; B ¼ basic amino
acid, X ¼ neutral/hydrophobic amino acid) is present on
the PCV2 capsid protein. PCV2 enters the cells predomi-
nantly via clathrin-mediated endocytosis and requires an
acidic environment for infection.
Replication of PCV has been studied in detail. PCVs
are supposed to replicate their genomes using a circular,
ds RF intermediate, which is produced by host cell DNA
polymerases during the S phase of cell division. The
origin of replication of PCV has been mapped to a frag-
ment comprising the intergenic region between the start
points of the two major ORFs (Figure 3).
Replication of these fragments cloned into a vector
was observed after co-transfection of porcine kidney
cells with plasmids expressing the rep gene. By sequence
alignment, analogous elements can be identified for all
other circoviruses with the exception of CAV. The origin
of replication is characterized by a potential stem–loop
structure with a nonamer (50 -TAGTATTAC; Figure 3)
in its apex. Mutagenesis of the nonamer resulted in inac-
tivation of PCV replication. Adjacent to the nonamer,
short repeats are located, which serve as the binding site
for the rep gene products. Nonamer, stem–loop, and
adjacent short repeats are conserved in all other circo-
viruses, in the families Nanoviridae and Geminiviridae,
and, although to a lesser extent, in many replicons repli-
cating via RCR. The conserved elements in the cis-acting
origin of replication as well as RCR signatures in the
trans-acting Rep protein amino acid (aa) sequence (see
below) indicate an RCR-like replication mechanism for
the circoviruses.
Functional Analyses of PCV-Encoded Proteins
Truncation of the rep gene as well as site-directed muta-
genesis of the four conserved motifs abrogated replication
of PCV, indicating that the rep gene products are indis-
pensable. The roles of Rep and Rep0 of PCV have been
analyzed in detail.
Binding to DNA. Rep and Rep0 bind in vitro to fragments
of the origin of replication containing the stem–loop
structure plus the conserved nonamer and the four hex-
amer (H) repeats (50 -CGGCAG; H1 to H4). Proteins bind
either the two inner (H1/H2) or the two outer (H3/H4)
hexamers. A minimal binding site (MBS) has been identi-
fied for Rep and Rep0 protein using truncated substrates:
the Rep MBS was mapped to the right leg of the
stem–loop plus the two inner hexamer repeats H1/H2,
while the MBS of Rep0 was composed of only the two
hexamer repeats H1/H2. Gel shift assays also revealed
presence of several complexes, indicating that variable
amount of proteins may be bound.
Replication. The covalently closed, ssDNA genome of
PCV replicates via a dsDNA replicative intermediate.
The replication occurs by RCR whereby a single-stranded
break is introduced by Rep or Rep0 leading to a free 30 -
hydroxyl group serving as a primer for subsequent
DNA synthesis. Replication does occur when Rep plus
Rep0 protein are expressed in the cells, indicating that
both proteins are essential for replication from the PCV
origin. This is in contrast to other ssDNA viruses, for
example, AAV2 or members of the genus Mastrevirus, in
which spliced Rep proteins are produced, but are not
essential for viral replication. Rep and Rep0 cleave the
viral strand between nucleotides 7 and 8 in vitro within the
conserved nonanucleotide located at the apex of a puta-
tive stem–loop structure. In addition, Rep and Rep0 join
viral ssDNA fragments, implying that these proteins also
play a role in the termination of virus DNA replication.
This joining activity is strictly dependent on preceding
substrate cleavage and the close proximity of origin
fragments accomplished by base pairing of the stem–loop
structure. This dual ‘nicking/joining’ activity associated
with Rep and Rep0 are pivotal events underlying the
RCR-based replication of porcine circoviruses in mam-
malian cells. Although presence of the palindrome plus a
single H sequence is sufficient for PCV replication, a
tandem repeat arrangement is more stable. Within the
H sequence, selected nucleotides at specific positions
are critical for Rep-associated protein recognition and
for viral DNA replication.
Repression of the Rep gene promoter Prep. When the influence
of virus-encoded proteins upon Prep was investigated, it

became apparent that Prep is repressed by its own gene
product Rep but not by Rep0 or Cap. This finding illus-
trates that Rep protein initiates replication and controls its
own transcription by binding to hexamers H1/H2. Inter-
estingly, Rep0 also binds to H1/H2, but this does not result
in repression of Prep activity. Since mutagenesis of H1/H2
decreases but does not inactivate Prep transcription, fea-
tures other than binding of Rep may be necessary for
repression of Prep, for example, interaction of Rep protein
with transcription factors. Pcap is not regulated by Cap,
Rep, and Rep0.
Interaction. Studies investigating the interaction of
PCV-encoded proteins are bemusing, because the results
were depending on the system used for expression. While
two hybrid analysis in bacteria revealed interaction of Rep
and Cap, this was not observed in yeast cells, suggesting
that post-translational modifications of Rep and Cap may
significantly modulate their function. Rep and Rep0 have
been observed to interact in yeast cells and this observa-
tion was reproduced by immunoprecipitation in mamma-
lian cells, the natural target of PCV.
Localization. Rep and Rep0 protein co-localize in the
nucleoplasm of infected cells, but no signal was seen in
the nucleoli. The localization did not change during the
infection cycle. Rep and Rep0 carry three potential
nuclear localization signals (NLSs) in their identical
N-termini. Proteins mutated in their NLSs demonstrated
that NLS1 and NLS2 mediate the nuclear import,
whereas NLS3 enhances the nuclear accumulation of
the replication proteins. In contrast to Rep and Rep0, the
localization of the Cap protein was restricted to the
nucleoli in plasmid-transfected cells. In PCV-infected
cells, Cap was localized in the nucleoli in an early stage,
while it was seen later on in the nucleoplasm and the
cytoplasm. This signifies that Cap is shuttling between
distinct cellular compartments during the infection cycle.
Since Rep, Rep0, and Cap are all located in the nucleus,
this points out that DNA replication and encapsidation
of the circular closed ssDNA probably occur in the
nucleus and not in cytoplasmic compartments. The
biological function of the early localization of Cap to
the nucleoli remains unclear. Nucleolar localization has
been described for proteins of many DNA and RNA
viruses and it has been proposed that virus proteins
enter the nucleoli to support viral transcription or influ-
ence the cell cycle.
Conclusion
Although the family Circoviridae comprises only a rela-
tively small number of viruses, the increasing number of
publications demonstrates rising interest. This may not
only be related to the fact that circoviruses induce severe
multifactorial diseases, which compromise and unbalance
Circoviruses 519
the immune system, but also to the fact that the apparent
simplicity of the circovirus genome contrasts highly with
the complex and poorly understood pathogenesis. Hope-
fully, this will induce many question-solving studies,
enabling us to improve our understanding of these
intriguing viruses in the future.
See also: Anellovirus; Nanoviruses; Plant Resistance to
Viruses: Geminiviruses.
Further Reading
Cheung AK (2004) Palindrome regeneration by template
strand-switching mechanism at the origin of DNA replication of
porcine circovirus via the rolling-circle melting-pot replication model.
Journal of Virology 78: 9016–9029.
Clark EG (1997) Post-weaning wasting syndrome. Proceedings of the
American Association of Swine Practitioners 28: 499–501.
Crowther RA, Berriman JA, Curran WL, Allan GM, and Todd D (2003)
Comparison of the structures of three circoviruses: Chicken anemia
virus, porcine circovirus type 2, and beak and feather disease virus.
Journal of Virology 77: 13036–13041.
Darwich L, Segales J, and Mateu E (2004) Pathogenesis of postweaning
multisystemic wasting syndrome caused by porcine circovirus 2: An
immune riddle. Archives of Virology 149: 857–874.
Fenaux M, Opriessnig T, Halbur PG, Elvinger F, and Meng XJ (2004)
A chimeric porcine circovirus (PCV) with the immunogenic capsid
gene of the pathogenic PCV type 2 (PCV2) cloned into the
genomic backbone of the nonpathogenic PCV1 induces protective
immunity against PCV2 infection in pigs. Journal of Virology 78:
6297–6303.
Finsterbusch T, Steinfeldt T, Caliskan R, and Mankertz A (2005) Analysis
of the subcellular localization of the proteins Rep, Rep0 and Cap of
porcine circovirus type 1. Virology 343: 36–46.
Gibbs MJ and Weiller GF (1999) Evidence that a plant virus switched
hosts to infect a vertebrate and then recombined with a
vertebrate-infecting virus. Proceedings of the National Academy of
Sciences, USA 96: 8022–8027.
Krakowka S, Ellis JA, McNeilly F, Ringler S, Rings DM, and Allan G
(2001) Activation of the immune system is the pivotal event in the
production of wasting disease in pigs infected with porcine
circovirus-2 (PCV-2). Veterinary Pathology 38: 31–42.
Mankertz A, Mueller B, Steinfeldt T, Schmitt C, and Finsterbusch T
(2003) New reporter gene-based replication assay reveals
exchangeability of replication factors of porcine circovirus types 1
and 2. Journal of Virology 77: 9885–9893.
Miller MM, Jarosinski KW, and Schat KA (2005) Positive and negative
regulation of chicken anemia virus transcription. Journal of Virology
79: 2859–2868.
Misinzo G, Delputte PL, Meerts P, Lefebvre DJ, and Nauwynck HJ
(2006) Porcine circovirus 2 uses heparan sulfate and chondroitin
sulfate B glycosaminoglycans as receptors for its attachment to host
cells. Journal of Virology 80: 3487–3494.
Segales J, Allan GM, and Domingo M (2005) Porcine circovirus
diseases. Animal Health Research Reviews 6: 119–142.
Steinfeldt T, Finsterbusch T, and Mankertz A (2006) Demonstration of
nicking/joining activity at the origin of DNA replication associated with
the Rep and Rep0 proteins of porcine circovirus type 1. Journal of
Virology 80: 6225–6234.
Tischer I, Gelderblom H, Vettermann W, and Koch MA (1982) A very
small porcine virus with circular single-stranded DNA. Nature 295:
64–66.
Todd D, Bendinelli M, Biagini P, et al. (2005) Circoviridae. In: Fauquet C,
Mayo MA, Maniloff J, Desselberger U, and Ball LA (eds.) Virus
Taxonomy: Eighth Report of the International Committee on
Taxonomy of Viruses, pp. 327–334. San Diego, CA: Elsevier
Academic Press.