International Biodeterioration & Biodegradation 70 (2012) 117e125

Contents lists available at SciVerse ScienceDirect

International Biodeterioration & Biodegradation

journal homepage: www.elsevier.com/locate/ibiod

A multiphasic approach for investigation of the microbial diversity and its

biodegradative abilities in historical paper and parchment documents


Lucia Kraková a, Katarína Chovanová a, Samy A. Selim b, Alexandra Simonovicová c, Andrea Pu
skarová a,


Alena Maková d, Domenico Pangallo a, e, *
a
Institute of Molecular Biology, Slovak Academy of Sciences, Dubravska cesta 21, 845 51 Bratislava, Slovakia
b
Microbiology Section, Botany Department, Faculty of Sciences, Suez Canal University, Ismailia, Egypt
c
Department of Soil Science, Faculty of Natural Sciences, Commenius University, Bratislava, Slovakia
d
Slovak National Archives, Department of Archival Preservation, Bratislava, Slovakia
e
Caravella, s.r.o., Bratislava, Slovakia

a r t i c l e i n f o a b s t r a c t

Article history: The microbial diversity of different kinds of stains present on the surface of 14 historical documents (nine
Received 31 October 2011 parchments and five paper letters) was evaluated through a combination of cultural and molecular
Received in revised form methods. The samples were recovered using adhesive tape and swabs and were afterwards treated in
16 January 2012
two different ways: (1) direct inoculation on agar plates; or (2) suspension in physiological solution and
Accepted 16 January 2012
plating in specific plates for the growth of bacteria and fungi. The isolated microorganisms, before
Available online xxx
identification, were selected by two different PCR-based methods e f-ITS and f-CBH, for bacteria and
fungi, respectively. The f-ITS method is based on the amplification of the internal transcribed sequence
Keywords:
Multiphasic approach
between the bacterial 16S and 23S rDNA. The f-CBH method is a new molecular selection tool oriented to
Microbial community the fungal cellobiohydrolase gene. Both PCR selection methods produced typical profiles, which clustered
Parchment the isolates in order to reduce them for subsequent sequencing identification through the amplification
Historical documents of the fungal 28S rRNA and the bacterial 16S rRNA genes. The cellulolytic and proteolytic abilities were
f-CBH screened through the use of three plate assays, the Ostazin Brilliant Red H-3B (OBR-HEC), milk agar, and
gelatin agar. Massilia timonae, Lysobacter dokdonensis, and strains belonging to the genus Bacillus sp.,
Microbacterium sp., and Curtobacterium sp. with different fungal members such as Aspergillus fumigatus,
Penicillium commune, Mucor spinosus, and Phoma herbarum (all recovered from paper) displayed both
biodegradative activities. The parchment isolates with a marked proteolytic activity were Bacillus cereus,
Staphylococcus epidermidis, Pseudomonas oryzihabitans, Virgibacillus sp., Micromonospora sp., and again
members of the fungal genera Penicillium, Mucor, and Phoma.
Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction Other studies have looked at the development of preservation

Archives, museums, and libraries worldwide conserve many
historical document collections of important cultural value for all
humankind. These documents may be composed of paper, but the
oldest may be made of parchment.
The paper documents have received particular attention in the
past, primarily for an unaesthetic staining phenomenon called
foxing, which some authors consider a result of microorganism
contamination (Arai, 2000; Montemartini Corte et al., 2003).
* Corresponding author. Institute of Molecular Biology, Slovak Academy of
Sciences, Dubravska cesta 21, 845 51 Bratislava, Slovakia. Tel.: þ421 259307439;
fax: þ421 259307416.
E-mail address: domenico.pangallo@savba.sk (D. Pangallo).
methods able to reduce the microbial contamination risk by the
use of different antimicrobial agents (Del Pilar Ponce-Jiménez
et al., 2002; Rakotonirainy and Lavedrine, 2005; Willemsen
et al., 2011).
Various techniques have also been developed for determining
the causes of deterioration in paper, and its degree (Strli
c et al.,
2009; Clark et al., 2011). Moreover, in recent years several works
have focused on investigating microflora isolated from paper
manuscripts, once again highlighting microbial contamination as
an important parameter in establishing the correct conservation
conditions for paper documents and books (Pinzari et al., 2006;
Zotti et al., 2008; Mesquita et al., 2009; Reis-Menezes et al., 2011).
For this reason different molecular biological approaches (mainly
culture-independent techniques) were applied to study the

0964-8305/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ibiod.2012.01.011
118 L. Kraková et al. / International Biodeterioration & Biodegradation 70 (2012) 117e125

microbial community on less (Michaelsen et al., 2010) or more
famous (Principi et al., 2011) historical books. If, on one hand, the
molecular techniques can contribute to obtaining a better view of
the microflora present on paper items, on the other hand, at the
moment, their use does not make it possible to glean any infor-
mation about biodegradation ability on the basis of the DNA of the
microbial community. In this way the analysis remains incomplete
without any real data on the biodegradation power of the identified
microflora.
Parchment hasn’t received as much interest as paper docu-
ments; investigations into parchment have regarded mostly its
chemical and physical characteristics, and its identification (Dolgin
et al., 2009; Pangallo et al., 2010; Bicchieri et al., 2011). The studies
on microbial contamination of parchment are limited, with some
exceptions (Mesquita et al., 2009), or they have referred mainly to
the microbial degradation of leather (Strzelczyk et al., 1989; Orlita,
2004). Therefore, it should be of value to investigate the micro-
flora responsible for the biodeterioration of parchment, in order to
expand our knowledge related to this writing support, which was
an important vehicle of culture principally during the Middle
Ages.
In this study a multistep approach was applied to different
paper and parchment documents. The approach included microbial
cultivation, selection, and identification of isolated microflora and
determination of their microbial deterioration abilities by the use of
various agar plate assays.
The isolated microorganisms were selected through two kinds
of fluorescence PCRs oriented to the internal transcribed spacer of
bacterial ribosomal DNA (Pangallo et al., 2008, 2009a) and to the
fungal cellobiohydrolase gene (f-CBH). The f-CBH PCR was applied
here for the first time to the fungal microflora isolated from
historical documents.
2. Materials and methods
2.1. Sampling and microorganism cultivation
The samples included nine parchment and five paper historical
documents conserved in the repository of the Slovak National
Library, Martin, Slovakia (Table 1).
The microorganisms were recovered from paper documents by
two sampling strategies: (1) Using a direct method, the sterile swabs
were inoculated onto disks of sterile filter paper that had been placed
on minimal agar plates (Cel-A) (Pangallo et al., 2007); (2) by sterile
swabs which were immersed in physiological solution and then
spread on agar plates specific for bacteria: R2A (Oxoid, Basingstoke,
UK), Cel-A and Champignon agar [(CA) Pangallo et al., 2007]; and for
fungi: Dichloran Rose Bengal Chloramphenicol (DRBC) and Sabour-
aud Dextrose Agar (SAB); these media were purchased from Hi-
Media (Bombay, India). All the plates were incubated at room
temperature (22e26  C) for about 10 days to 2 weeks.
The microorganisms from parchment were isolated by the two
strategies (direct and swab method) described above [for bacteria
isolation instead of Cel-A and CA, casein mineral medium was used
as suggested by Pangallo et al. (2007)] and, when possible, also by
a method using adhesive tape (MAT; SDL, Des Plaines, IL, USA) (Urzi
and De Leo, 2001). Strips of adhesive tape were gently applied to
the parchment surface, in those parts where writing and decora-
tions were not present, and the strips were then immediately
placed on sterile glass microscope slides and kept in a box until
arrival in the laboratory. In order to culture the microorganisms, the
adhesive tape was streaked on petri dishes containing cultural
media for fungi (DRBC; SAB) and bacteria (R2A; casein mineral
medium, CM) and incubated at room temperature (22e26  C) for
about 10 days to 2 weeks.

Table 1
Historical documents of the Slovak National Library investigated in this study and the corresponding isolated microflora.

Identification number, material and age Sampling area
69G6/Paper/1925 Blackebrown stain
42CC1/Paper/1914 Blackebrown stain
J1197/1/Paper/1768 Black stain which is
diffused in the whole surface
J1626/Paper/1802 Black and pink stain
J1038/Paper/1832 Black and pink stain
M117B14/Parchment/1866 Brown-yellowish stain
C405/Parchment/XV century Blackebrown stain on
the edge of the parchment
RHKS2636/Parchment/XVIII century Black and pink stain
C412/Parchment/Unknown Brown-yellowish stain
J2044/1/Parchment/XIII century Brown-yellowish stain
C413/Parchment/1594 Redebrown stain in the
centre of parchment in
the scripture
J555-1/Parchment/XII century Green stain in the scripture
J975/Parchment/1431 Beigeegrey stain
J2015/Parchment/XV century Blackebrown stain
Isolated microflora (colour of the isolated strains on agar plate)
Bacillus sp. (yellow); Pseudomonas stutzeri (intense yellow); Aspergillus fumigatus
(blueegreen or grey)
Bacillus sp. (yellow); Curtobacterium sp. (yellow); Massilia timonae (bright yellow);
Penicillium commune (green); Phoma herbarum (greenegrey dark)
Microbacterium sp. (greyebrown); Lysobacter dokdonensis (pinkesalmon); Aspergillus
fumigatus (blueegreen)
Bacillus sp. (pink) and Aspergillus fumigatus (blueegreen) isolated from black and
pink stains; Brevibacterium pityocampae (yellow) and Mucor spinosus (beige)
isolated only from black stain
Massilia timonae (yellowebrown), Aspergillus fumigatus (grey), M. spinosus
(light olive grey) and P. herbarum (greenegrey dark) isolated from black stain
Microbacterium paraoxydans (yellow); Staphylococcus pasteuri (bright yellow);
Virgibacillus sp. (bright yellow); Penicillium camemberti (blueegreen);
Penicillium funiculosum (browneorange)
Pseudomonas oryzihabitans (yellow); Aspergillus niger (dark black);
Penicillium funiculosum (browneorange)
Sporosarcina globispora (beigeeyellow); P. funiculosum (white, light pink)
Virgibacillus sp. (bright yellow); Corynebacterium tuscaniense (mat beige);
Brevundimonas sp. (bright yellow); Staphylococcus epidermidis (whitish);
Staphylococcus sp. (mat beige); Bjerkandera adusta (beige); Mucor racemosus
(brownebeige)
Virgibacillus sp. (bright yellow); Bacillus galactosidilyticus (bright beige)
Micromonospora sp. (redeorange); Corynebacterium sp. (mat whitish)
Bacillus cereus (whiteebeige); Pseudomonas plecoglossicida (mat beige);
Staphylococcus sp. (bright yellow); Cladosporium coralloides (dark olive);
Penicillium funiculosum (white, light pink)
Rhodococcus fascians (yelloweorange); P. funiculosum (white, light pink);
P. herbarum (greenegrey dark)
Staphylococcus sp. (mat beige); Penicillium chrysogenum (greenegrey);
Penicillium viridicatum (greenegrey)
 L. Kraková et al. / International Biodeterioration & Biodegradation 70 (2012) 117e125
After the selection of pure colonies, the fungi were maintained
on malt extract agar slants (MEA; Hi-Media, Bombay, India), the
bacteria from paper documents on plates of CA without paper disks,
while the bacterial strains from parchment were maintained on CM
plates.
2.2. DNA extraction
Fresh bacterial colonies were collected from the plates of CA or
CM, and their DNA was extracted with the InstaGene Matrix (Bio-
Rad, Hercules, CA, USA) following the producer’s instructions.
The fungal strains were inoculated in Sabouraud broth at 28  C
until growth; then they were separated from the broth by filtration
through sterile filter paper, after which the DNA was extracted by
the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany),
according to the enclosed protocol for animal and vegetable tissue
(DNeasy Handbook, July 2006).
2.3. Selection of isolated microflora
Bacterial and fungal strains were selected by fluorescence ITS
PCR (f-ITS) and fluorescence cellobiohydrolase PCR (f-CBH),
respectively. The internal transcribed spacer (ITS) between the 16S
and 23S rRNA gene was amplified, followed by separation of fluo-
rescently labelled PCR products by capillary electrophoresis. Briefly,
the PCR mixture contained 10 pmol of L1 and G17 (FAM labelled)
primers (Table 2), 200 mmol/l dNTP, 1.5 U HotStarTaq plus DNA
polymerase (Qiagen), 1x PCR buffer, and 6 ml of template DNA in the
total reaction volume of 25 ml. The temperature program consisted
of the initial denaturation at 95  C for 5 min, 35 cycles (95  C for
30 s, 54  C for 30 s, 72  C for 1 min) and a final polymerization at
72  C for 8 min.
The PCR reaction mix for the f-CBH included 10 pmol of each
primer CbH-fw (FAM labelled) and CbH-Rv (Table 2), 200 mmol/l
dNTP, 1.5 U HotStarTaq plus DNA polymerase (Qiagen), 1x PCR
buffer, 2 mM Mg2þ, and 3 ml of template DNA in the total reaction
volume of 25 ml. The temperature program consisted of the initial
denaturation at 95  C for 5 min, 35 cycles (95  C for 1 min, 55  C for
1 min, 72  C for 1 min and 30 s) and a final polymerization at 72  C
for 8 min.
Resulting f-ITS and f-CBH products were separated on the
automatic genetic analyzer ABI Prism 3100 Avant (Applied Bio-
systems, Foster City, CA, USA). DNA fragments were sized using the
LIZ-600 DNA standard and GeneMapper 3.7 software (Applied
Biosystems).
2.4. Microbial identification
The fungal isolates, selected through their CBH fluorescence
profiles, were identified by the amplification of the 28S rDNA using
the primers NL1 and NL4 (Table 2).
Table 2
PCR primers used in this study.
Primers Target gene Source
27f: AGAGTTTGATCCTGGCTCAG 16S rDNA Lane, 1991
685r: TCTACGCATTTCACCGCTAC
G17: FAM-GTGAAGTCGTAACAAGG Bacterial ITS This work
L1: CAAGGCATCCACCGT Jensen
et al., 1993
NL1: GCATATCAATAAGCGGAGGAAAAG 28S rDNA Kurtzman and
NL4: GGTCCGTGTTTCAAGACGG Robnett, 1998
CbH-fw: FAM-TCGAYGCSAACTGGCGCTGG Cellobiohydrolase This work
CbH-rv: TGGCYTCCCAGAYATCCATCTC
119
Bacteria, selected on the basis of their f-ITS profiles, were
identified by partial sequencing of 16S rDNA by the use of the PCR
method with primers 27F and 685R (Table 2).
The fungal and bacterial PCR products were purified using
ExoSAP-IT (Affymetrix, Cleveland, OH, USA) and sequenced for both
strands by a commercial facility (Macrogen, Seoul, South Korea). The
sequences were compared directly with those in GenBank by BLAST
search (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The sequences
obtained were deposited in the GenBank database under accession
numbers JQ388720eJQ388759.
2.5. Biodegradative plate assays
The proteolytic activity of isolated microflora was tested by
cultivation on milkenutrient agar (MilkeNA) and gelatin agar
plates (R2A-Gel). The MilkeNA medium was prepared with
skimmed milk (250 ml) that was sterilized by fractional sterili-
zation at 100  C for 30 min (daily for 3 days). Warmed sterilized
Nutrient Agar No. 2 (750 ml; Biomark, Pune, India) was added to
sterilized milk and well shaken. After cooling to circa 45  C, the
medium was poured into petri dishes. The gelatin medium was
prepared mixing autoclaved R2A agar with 0.4% sterilized gelatin
(SigmaeAldrich, Germany). After the growth of the microorgan-
isms, in order to have a better visualization of the hydrolysis zone,
a 10% tannin solution was flooded on the agar plates (Saran et al.,
2007). All proteolytic assays were performed in triplicate using
60-mm plates incubated at room temperature (22e26  C) gener-
ally for 5e7 days.
The cellulolytic ability was checked using Czapek-Dox agar,
without any carbon source, supplemented with 0.2% hydrox-
yethylcellulose containing 13.5% (w/w) of covalently linked Ostazin
Brilliant Red H-3B (OBR-HEC, Institute of Chemistry, Slovak
Academy of Sciences, Bratislava, Slovakia) as suggested by Pangallo
et al. (2007). On one agar plate it was possible to test six strains at
the same time, and a clear zone appeared around the cellulolytic
microorganisms. For several fungal isolates it was necessary to add
to the medium 0.5% (v/v) of Triton X-100 in order to partially inhibit
their growth. The plates were incubated at room temperature
(22e26  C) generally from 5 to 7 days.
3. Results
3.1. Bacterial selection and identification
The f-ITS allowed the selection of 22 different species from 45
bacterial isolates; 16 from paper documents and 29 from parch-
ments (Tables 1 and 3).
The 16 bacterial strains from paper documents produced eight
different profiles (IppeVIIIpp), while the 29 parchment strains
were divided into 16 diverse f-ITS profiles (IpreXVIpr). For the
bacteria isolated from paper, the number of peaks of the f-ITS
profiles varied from three to six, with sizes from 108 bp to
606 bp. The parchment bacterial strains formed f-ITS profiles
having from two to six peaks, with a bp range from 103 to 688.
The selection power of the f-ITS approach was principally indi-
cated by various bacterial strains, such as Bacillus sp., Massilia
timonae, Virgibacillus sp., and Staphylococcus sp., which showed
the same species-specific f-ITS profile, but they were isolated
from different samples; this is also supported by the evidence
that each f-ITS profile corresponded to one specific bacterial
species (Table 3).
The members of the genus Bacillus, with seven strains, were the
bacteria isolated most often from paper; their presence was mainly
detected in the document J1626 from both black and pink stains.
Document 42CC1 presented the largest bacterial diversity, which
120 L. Kraková et al. / International Biodeterioration & Biodegradation 70 (2012) 117e125

Table 3
Sampling approaches, f-ITS selection, and DNA identification used to investigate the bacterial strains isolated from paper and parchment documents.

Strain (isolation method) Sequenced strain f-ITS profile bp Sequence similarity No. of isolates
Paper documents
69G6-C (swab) 69G6-C Ippa: 213; 232; 457 EF158823 Bacillus sp. e 99% 3
69G6-D (swab)
42CC1-C (swab)
69G6-E (swab) 69G6-E IIpp: 317; 588; 606 FJ869915 Pseudomonas stutzeri e 99% 1
J1197-1.2A (swab) J1197-1.2A IIIpp: 213; 232; 262; 457; 496; 547 AB023370 Microbacterium sp. e 97% 2
J1197-1.2B (swab)
J1197-1.2C (swab) J1197-1.2C IVpp: 232; 501; 548 EF100698 Lysobacter dokdonensis e 98% 1
42CC1-A (swab) 42CC1-A Vpp: 255; 293; 317; 431; 516 FJ823026 Curtobacterium sp. e 99% 1
J1626-pink-A (swab) J1626-pink-A VIpp: 256; 293; 317; 431 FJ898306 Bacillus sp. e 99% 4
J1626-pink-B (swab)
J1626-pink-C (swab)
J1626-black-A (swab)
J1626-black-B (direct) J1626-black-B VIIpp: 462; 478; 525 EU484189 Brevibacterium pityocampae e 99% 1
J1038-black-D (direct) J1038-black-D VIIIpp: 232; 255; 317; 431; 557; 578 AY157759 Massilia timonae e 99% 3
J1038-black-E (swab)
42CC1-B (direct)
Parchments
RHKS2636-2 (swab) RHKS2636-2 Iprb: 103; 180; 214; 232 EF459543 Sporosarcina globispora e 99% 1
J2044/1-C (direct) J2044/1-C IIpr: 180; 291; 314; 474 HE577174 Virgibacillus sp. e 99% 10
J2044/1-D (direct) J2044/1-B
J2044/1-E (direct) C412-F
C412-A (direct) M117B14-E
M117B14-E (direct)
M117B14-F (direct)
M117B14-G (swab)
J2044/1-B (swab)
C412-G (direct)
C412-F (swab)
C412-B (direct) C412-B IIIpr: 314; 550; 570; 585 AY677186 Corynebacterium tuscaniense e 97% 1
C412-C (direct) C412-C IVpr: 314; 329; 371; 599 DQ413170 Brevundimonas sp. - 100% 1
C413-A (direct) C413-A Vpr: 292; 314; 452; 598 FM992779 Micromonospora sp. e 100% 1
C413-B (direct) C413-B VIpr: 624; 661 FN295567 Corynebacterium sp. e 97% 1
J555-1-A (direct) J555-1-A VIIpr: 621; 688 DQ095907 Pseudomonas plecoglossicida e 98% 1
J2044/1-A (swab) J2044/1-A VIIIpr: 392; 424; 478; 482; 596 AJ535638 Bacillus galactosidilyticus e 97% 1
J975-A (swab) J975-A IXpr: 180; 386; 421; 430; 437 Y11196 Rhodococcus fascians e 100% 1
J555-1-B (swab) J555-1-B Xpr: 173; 232 EU187485 Bacillus cereus e 100% 1
J2015-A (swab) J2015-A XIpr: 385; 404 EF419336 Staphylococcus sp. e 99% 1
M117B14-A (MAT) M117B14-B XIIpr: 423; 430; 463; 512 FJ613579 Staphylococcus pasteuri e 100% 2
M117B14-B (MAT)
M117B14-C (MAT) M117B14-D XIIIpr: 149; 466; 501 EU714373 Microbacterium paraoxydans e 100% 2
M117B14-D (MAT)
C405-A (MAT) C405-A XIVpr: 618; 631; 646 GQ250598 Pseudomonas oryzihabitans e 100% 2
C405-B (MAT)
C412-D (MAT) C412-D XVpr: 327; 350; 443 JF784030 Staphylococcus epidermidis e 99% 1
J555/1-A (MAT) J555/1-A XVIpr: 148; 211; 423; 431; 463; 512 AJ746143 Staphylococcus sp. e 100% 2
C412-H (MAT)
a
pp e f-ITS profiles from paper documents.
b
pr e f-ITS profiles from parchments.

was composed of strains of Bacillus (42CC1-C), Curtobacterium
(42CC1-A), and M. timonae (42CC1-B) (Tables 1 and 3).
The most isolated bacterial strains (10 isolates) from parchment
were the members of the genus Virgibacillus; they were recovered
from three different samples: J2044/1, C412, and M117B14. Parch-
ments C412 and M117B14 displayed the richest bacterial diversity;
Virgibacillus and strains belonging to Corynebacterium tuscaniense
(C412-B), Brevundimonas sp. (C412-C), Microbacterium paraoxydans
(M117B14-C and D), Staphylococcus sp. (C412-H), Staphylococcus
pasteuri (M117B14-A and B), and Staphylococcus epidermidis (C412-
D) (Tables 1 and 3) were isolated from these two parchments.
3.2. Fungal selection and identification
The new fluorescence PCR-based approach oriented to the
cellobiohydrolase gene demonstrated its usefulness to cluster and
select the filamentous fungi, which in a second step were identi-
fied through the amplification and sequencing of the 28S rDNA.
The cbh gene produced different species-specific polymorphism
able to group all 27 fungal isolates. The filamentous fungi isolated
from paper documents and parchments produced four and eight f-
CBH profiles, respectively. The number of peaks per profile varied
from one to five and the range of the peak size was 199e910 bp
(Table 4). Fungal members belonging to the same species (such
as Aspergillus fumigatus Fresen., 1863; Mucor spinosus Tiegh., 1878;
Phoma herbarum Westend., 1852; and Penicillium funiculosum
Thom, 1910) produced their typical species-specific f-CBH profile
and, moreover, they were isolated from different samples; these
two findings indicated the good discriminatory power of this new
PCR approach.
The identification of the isolated fungal microflora evidenced
the presence of the strain A. fumigatus in almost all the paper
documents investigated, and it was recovered from both black and
pink stains (Tables 1 and 4). In the parchment samples the most
diffused fungal contaminant was P. funiculosum; generally the
Penicillium (Link, 1809) strains were isolated from parchments. The
parchments exhibited a more varied fungal diversity than the paper
samples (Tables 1 and 4).
 L. Kraková et al. / International Biodeterioration & Biodegradation 70 (2012) 117e125 121

Table 4
Sampling approaches, f-CBH selection, and DNA identification used to investigate the fungal strains isolated from paper and parchment documents.

Strain (isolation method) Sequenced strain f-CBH profile bp Sequence similarity No. of isolates
Paper documents
F-J1197e1.2 (swab) F-J1197e1.2 Icppa: 547; 663; 910 FM179606 Aspergillus fumigatus 100% 8
F-J1626-pink-D (swab) F-J1038-C
F-J1038-black-F (swab) F-69G6-B
F-J1626-black-F (swab)
F-J1038-black-C (swab)
F-69G6-A (swab)
F-69G6-B (swab)
F-J1038-black-A (swab)
F-42CC1-D (swab) F-42CC1-D IIcpp: 597; 655 AY213617 Penicillium commune 100% 1
F-J1038-black-E (swab) F-J1038-E IIIcpp: 596; 604 EU736322 Mucor spinosus 100% 2
F-J1626-black-E (swab)
F-42CC1-E (direct) F-42CC1-E IVcpp: 605; 671 AY293788 Phoma herbarum 99% 2
F-J1038-black-B (swab)
Parchments
F-J975-2-A (swab) F-J975-2-A IVcpp: 605; 671 AY293788 P. herbarum 99.1% 1
F-J2015-2-A (swab) F-J2015-2-A Icprb: 494; 546 AF033390 Penicillium viridicatum 98% 1
F-J2015-2-B (swab) F-J2015-2-B IIcpr: 501; 550 GQ241341 Penicillium chrysogenum 99.5% 1
F-M117B14-2S (MAT) F-M117B14-2S IIIcpr: 553; 661 AF033474 Penicillium camemberti 99.8% 1
F-RHKS2636-B2 (MAT) F-RHKS2636-B2 IVcpr: 199; 574; 627; 676; 860. GQ337424 Penicillium funiculosum 99.8% 6
F-M117B14-1S (MAT) F-J555-1.2
F-J975-1
F-RHKS2636-B1 (MAT)
F-C405-1 (MAT)
F-J555-1.2 (MAT)
F-C405-2 (MAT) F-C405-2 Vcpr: 585; 644 GQ169752 Aspergillus niger 99% 1
F-C412-1 (MAT) F-C412-1 VIcpr: 667 AY213712 Mucor racemosus 100% 1
F-C412-2 (MAT) F-C412-2 VIIcpr: 590; 607 FN298244 Bjerkandera adusta 97% 1
F-J555-1.1 (MAT) F-J555-1.1 VIIIcpr: 551; 591; 825 AB100658 Cladosporium coralloides 99.8% 1
a
cpp e f-CBH profiles from paper documents.
b
cpr e f-CBH profiles from parchment.

3.3. Biodegradative characteristics
Forty-one bacterial strains from 45 isolates exhibited at least
one biodegradative ability; the bacterial strains were screened for
their cellulolytic activity and their proteolytic properties were also
investigated by the use of two different media. The combination of
the results of these three assays produced seven types of degra-
dative profiles (IDeVIID; Table 5).
All the 16 bacterial strains isolated from paper documents dis-
played one degradative characteristic. The three M. timonae, and
two Bacillus strains isolated from document J1626, and the strains
Microbacterium sp. and Lysobacter dokdonensis recovered from
document J1197/1 were the most active and displayed positive
results in all three assays (degradative profile ID). Of the paper
isolates, 73% were able to degrade the cellulose on Czapek-Dox-
OBR-HEC agar.
Four bacterial strains (two strains each of Staphylococcus sp. and
S. pasteuri) isolated from parchment samples didn’t exhibit any
degradative ability. The most active strains isolated from parch-
ment, displaying the degradative profile ID, were three members of
the genus Virgibacillus; the other Virgibacillus isolates produced
positive results on Czapek-Dox-OBR-HEC and gelatin agar,
expressing the degradative profile VID (Table 5). It is evident that
the proteolytic activity was a widely-shared characteristic by the
strains isolated from parchment. In addition, the agar R2A-gel was
the most suitable medium for these strains; in fact, 76% of the
parchment isolates had a positive result with this assay, as opposed
to the 31% recorded through the MilkeNA test.
The screening of filamentous fungi included the cellulolytic test
and only one proteolytic assay employing the R2A-gel agar
(Table 6). Three degradative profiles were shown by the fungal
microflora (F-IDeF-IIID). Sixty-seven percent of isolated fungal
strains produced positive results for both biodegradative tests
(profile F-ID); two P. funiculosum strains (F-M117B14-1S and
F-C405-1) together with one A. fumigatus (F-J1197-1.2) and one
Aspergillus niger (Tiegh., 1867; F-C405-2) were exclusively
proteolytic (profile F-IIID). The cellulolytic profile F-IID was only
displayed by one A. fumigatus (F-69G6-B) strain and by Bjerkan-
dera adusta (Willd., P. Karst. 1879; F-C412-2). Only three fungal
strains appeared not to possess any biodegradative activity:
A. fumigatus (F-J1038-black-F), M. spinosus (F- J1038-black-E), and
Cladosporium coralloides (W. Yamam. ex Dugan, K. Schub. &
U. Braun 2004; F-J555-1.1).
4. Discussion
This study revealed the presence of bacterial and fungal strains
in both paper documents and parchments. On paper items the
number of isolates of these two kinds of microorganisms is almost
the same, while on parchment the number of bacterial isolates is
double that of the fungal isolates. In addition, in both kinds of
historical documents the bacterial microflora has a higher degree of
diversity than the fungal.
Up to now, the filamentous fungi have been considered a major
contamination agent of paper and parchment; in 1997 Zyska
prepared a list of the kinds of microorganisms which had been
isolated from these writing supports. More recent research has
focused mainly on fungal contamination (Montemartini Corte et al.,
2003; Zotti et al., 2008; Mesquita et al., 2009); in fact information
about the potential role of bacterial flora on the degradation of
historical documents, except for a few cases (Michaelsen et al.,
2010; Principi et al., 2011) is scarce.
In this study we preferred to investigate the cultivable portion of
contaminating microflora, because it is already evident, from other
work (Donachie et al., 2007) that the culture-independent and
culture-dependent methods gave different results from the same
sample; in practice, the culture-independent approaches alone are
not able to describe in a complete way the microbial diversity of the
122 L. Kraková et al. / International Biodeterioration & Biodegradation 70 (2012) 117e125

Table 5
Biodegradative characteristics of bacterial strains isolated from historical documents of paper and parchment and comparison between their f-ITS profiles and their degra-
dative profiles (D-profile).

Strain/f-ITS profile/D-profile Cella MilkeNA R2A-gel Material

69G6-C Bacillus sp./Ipp/IID þ þ Paper
69G6-D Bacillus sp./Ipp/IID þ þ Paper
42CC1-C Bacillus sp./Ipp/IID þ þ Paper
69G6-E Pseudomonas stutzeri/IIpp/IVD þ Paper
J1197-1.2A Microbacterium sp./IIIpp/ID þ þ þ Paper
J1197-1.2B Microbacterium sp./IIIpp/ID þ þ þ Paper
J1197-1.2C Lysobacter dokdonensis/IVpp/ID þ þ þ Paper
42CC1-A Curtobacterium sp/Vpp/IIID þ þ Paper
J1626-pink-A Bacillus sp./VIpp/ID þ þ þ Paper
J1626-pink-B Bacillus sp./VIpp/ID þ þ þ Paper
J1626-pink-C Bacillus sp./VIpp/IID þ þ Paper
J1626-black-A Bacillus sp./VIpp/IIID þ þ Paper
J1626-black-B Brevibacterium pityocampae sp./VIIpp/IID þ þ Paper
J1038-black-D Massilia timonae/VIIIpp/ID þ þ þ Paper
J1038-black-E Massilia timonae/VIIIpp/ID þ þ þ Paper
42CC1-B Massilia timonae/VIIIpp/ID þ þ þ Paper
RHKS2636-2 Sporosarcina globispora/Ipr/VD þ Parchment
M117B14-E Virgibacillus sp./IIpr/ID þ þ þ Parchment
M117B14-G Virgibacillus sp./IIpr/ID þ þ þ Parchment
C412-F Virgibacillus sp./IIpr/ID þ þ þ Parchment
J2044/1-D Virgibacillus sp./IIpr/VID þ þ Parchment
J2044/1-C Virgibacillus sp./IIpr/VID þ þ Parchment
C412-G Virgibacillus sp./IIpr/VID þ þ Parchment
J2044/1-E Virgibacillus sp./IIpr/VID þ þ Parchment
M117B14-F Virgibacillus sp./IIpr/VID þ þ Parchment
J2044/1-B Virgibacillus sp./IIpr/VID þ þ Parchment
C412-A Virgibacillus sp./IIpr/VID þ þ Parchment
C412-B Corynebacterium tuscaniense/IIIpr/VD þ Parchment
C412-C Brevundimonas sp./IVpr/VD þ Parchment
C413-A Micromonospora sp./Vpr/IID þ þ Parchment
C413-B Corynebacterium sp./VIpr/VD þ Parchment
J555-1-A Pseudomonas plecoglossicida/VIIpr/IVD þ Parchment
J2044/1-A Bacillus galactosidilyticus/VIIIpr/VIID þ Parchment
J975-A Rhodococcus fascians/IXpr/VIID þ Parchment
J555-1-B Bacillus cereus/Xpr/IID þ þ Parchment
J2015-A Staphylococcus sp./XIpr/VD þ Parchment
M117B14-C Microbacterium paraoxydans/XIIIpr/VD þ Parchment
M117B14-D Microbacterium paraoxydans/XIIIpr/VD þ Parchment
C405-A Pseudomonas oryzihabitans/XIVpr/IID þ þ Parchment
C405-B Pseudomonas oryzihabitans/XIVpr/IID þ þ Parchment
C412-D Staphylococcus epidermidis/XVpr/IID þ þ Parchment

Degradative profiles: ID: positive results for all three assays; IID: positive results for both proteolytic assays; IIID: positive results for both cellulolytic and MilkeNA assays;
IVD: positive results only for MilkeNA assay; VD: positive results only for R2A-gel assay; VID: positive results for both cellulolytic and R2A-gel assays; VIID: positive results only
for cellulolytic assay.
a
Cellulolytic plate assay.

studied environment. The DNA markers used thus far for molecular
microbial analysis, principally based on rRNA gene detection, are
not able to give any information about the biodegradative potential
of detected molecular clones. In addition, this kind of molecular
analysis refers to DNA fragments, which cannot attest to the pres-
ence of live microorganisms in the studied items.
Our sampling strategy was based on three different isolation
methods: swab, direct, and MAT. The results showed that it is best
to combine these three approaches in order to have a better chance
at capturing the diverse range of microorganisms. The swab
method was very useful for isolating bacterial and fungal microflora
from paper documents; with the direct method only a few micro-
organisms were isolated from this writing material.
The MAT sampling was tried only to recover microflora from
parchments, and it was useful for isolation of bacterial and fungal
strains. Swab and direct sampling from parchment seemed to be
suitable for fungal and bacterial microflora, respectively. Therefore
the MAT, used here for the first time as a microbial sampling
method for parchment, appeared the most successful, mainly for
the fungal isolation, but it is evident that it alone cannot recover
diverse microflora, especially in the bacterial arena.
The two selection molecular methods, f-ITS and f-CBH, were
able to differentiate the isolated microflora in an early selection
step. A crucial point of environmental microbiology comes after the
isolation step, when microbiologists need to choose among several
microorganisms possessing similar morphology. In this case
methods such as f-ITS and f-CBH can help in the choice. The f-ITS
has already been tested for other kinds of microorganisms and
environments (Pangallo et al., 2008, 2009a), and its usefulness in
selecting isolated bacterial microflora was confirmed here again.
The f-CBH is a new selection approach for fungal microflora and has
been demonstrated to be as suitable as the f-ITS method. In addi-
tion, f-CBH has a double value; on one hand it is able to select the
fungal isolates, and on the other it detects the cellobiohydrolase
gene and therefore the potential cellulolytic ability of fungal
isolates. The amplification of the cbh gene was confirmed by the
sequencing of the expected band (Pangallo et al., unpublished
data).
The fungal strains isolated in this study from paper documents
have been shown to be different from those strains detected in
other recently published works using culture (Mesquita et al.,
2009) or molecular detection approaches (Michaelsen et al., 2010;
 L. Kraková et al. / International Biodeterioration & Biodegradation 70 (2012) 117e125 123

Table 6 The biodegradation of parchment by bacterial microflora has not

Biodegradative characteristics of fungal strains isolated from historical documents of been adequately studied; only a few papers are present in the
paper and parchment and comparison between their f-CBH profiles and the
degradative profiles (D-profile).
literature (Strzelczyk, 2004), and therefore it is difficult to compare
the results reported here with others’ reports. The bacterial strains
Strain/f-CBH profile/D-profile Cella R2A-gel Material isolated from parchment documents belonged mainly to the phyla
F-69G6-A Aspergillus fumigatus/Icpp/F-ID þ þ Paper Firmicutes and Actinobacteria. The Firmicutes here were repre-
F-69G6-B Aspergillus fumigatus/Icpp/F-IID þ Paper
sented by a more diversified community (Virgibacillus, Staphylo-
F-J1197-1.2 Aspergillus fumigatus/Icpp/F-IIID þ Paper
F-J1626-pink-D Aspergillus fumigatus/Icpp/F-ID þ þ Paper coccus, Bacillus, and Sporosarcina globispora) with respect to the
F-J1626-black-F Aspergillus fumigatus/Icpp/F-ID þ þ Paper paper counterpart. Also, from parchment samples taxonomically
F-J1038-black-A Aspergillus fumigatus/Icpp/F-ID þ þ Paper interesting strains were isolated that displayed a high degree of 16S
F-J1038-black-C Aspergillus fumigatus/Icpp/F-ID þ þ Paper rDNA similarity with relatively new species such as Brevibacterium
F-42CC1-D Penicillium commune/IIcpp/F-ID þ þ Paper
F-J1626-black-E Mucor spinosus/IIIcpp/F-ID þ þ Paper
pityocampae (Kati et al., 2010), C. tuscaniense (Riegel et al., 2006),
F-J1038-black-B Phoma herbarum/IVcpp/F-ID þ þ Paper Bacillus galactosidilyticus (Heyndrickx et al., 2004), M. paraoxydans
F-42CC1-E Phoma herbarum/IVcpp/F-ID þ þ Paper (Laffineur et al., 2003), S. globispora (Yoon et al., 2001), Pseudo-
F-J975-2-A Phoma herbarum/IVcpp/F-ID þ þ Parchment monas plecoglossicida (Nishimori et al., 2000), and Virgibacillus
F-J2015-2-A Penicillium viridicatum/Icpr/F-ID þ þ Parchment
(Heyndrickx et al., 1998).
F-J2015-2-B Penicillium chrysogenum/IIcpr/F-ID þ þ Parchment
F-M117B14-2S Penicillium camemberti/IIIcpr/F-ID þ þ Parchment It is also interesting to discuss the isolation of different kinds of
F-RHKS2636-B1 Penicillium funiculosum/IVcpr/F-ID þ þ Parchment microorganisms from a specific stain. The most widely found
F-RHKS2636-B2 Penicillium funiculosum/IVcpr/F-ID þ þ Parchment microbial contaminants on paper samples seemed to be members
F-M117B14-1S Penicillium funiculosum/IVcpr/F-IIID þ Parchment of the Bacillus group and A. fumigatus; indeed, they were isolated
F-J975-1 Penicillium funiculosum/IVcpr/F-ID þ þ Parchment
F-C405-1 Penicillium funiculosum/IVcpr/F-IIID þ Parchment
from almost all kind of stains (blackebrown, black, and pink), and
F-J555-1.2 Penicillium funiculosum/IVcpr/F-ID þ þ Parchment by their growth and acid production they could be the microbial
F-C405-2 Aspergillus niger/Vcpr/F-IIID þ Parchment agents responsible for these unpleasant effect on paper surfaces. It
F-C412-1 Mucor racemosus/VIcpr/F-ID þ þ Parchment is necessary to stress that they were, generally, co-isolated with
F-C412-2 Bjerkandera adusta/VIIcpr/F-IID þ Parchment
others microorganisms; they were found alone only in the pink
Degradative profiles: F-ID: positive results for both biodegradative assays; stain of paper J1626 (Table 1).
F-IID: positive results only for cellulolytic assay; F-IIID: positive results only for More different types of stains were found on parchment
proteolytic assay.
a
Cellulolytic plate assay.
samples than in paper documents. Firmicutes strains belonging to
the genera Virgibacillus, Bacillus, and Staphylococcus were mainly
isolated from the brown-yellowish stains. The Virgibacillus strains
were isolated only from this kind of stain and using different
Principi et al., 2011). In fact our principal contaminating fungal sampling approaches, this showed that the bacterium Virgibacillus
agent was A. fumigatus, which was isolated only in one sample by could be considered a common contaminant of parchment,
Mesquita et al. (2009). The abovementioned clone libraries particularly from the brown-yellowish stain. Another common
(Michaelsen et al., 2010; Principi et al., 2011) didn’t have this kind of contaminant was P. funiculosum; it was isolated from different kind
microorganism. The common fungal contaminants isolated by of stains, but principally through MAT sampling. Two Actino-
Mesquita et al. (2009) were members of Cladosporium cladospor- bacteria, Micromonospora sp. and Corynebacterium sp., were iso-
ioides and Chaetomium globosum, which were not isolated during lated from the red stain of parchment C413; the Micromonospora
our investigation. Further, other studies (Michaelsen et al., 2010; strain showed a redeorange pigmentation on agar plate, and
Principi et al., 2011) have displayed the presence of others kinds of perhaps this kind of pigmentation was one of the factors that
fungal species, but none of these corresponded to our isolates produced that unaesthetic effect on the parchment surface. A
M. spinosus and P. herbarum. This brief comparison showed the similar stain has already been described by Strzelczyk (2004), who
important fact that each item studied has its own history and its also isolated members of the Actinobacteria phylum from both
own specific contamination, which depend on the conservation paper and parchment. The green stain of parchment J555-1 was
environment, material conditions, and age; to these, others vari- colonized by different fungal and bacterial strains such as C. cor-
ables should be added, e.g., the sampling method and the analysis alloides, P. funiculosum, Bacillus cereus, P. plecoglossicida, and
strategy. Therefore each object should be considered as a unique Staphylococcus sp. The green ink used on parchment J555-1
exemplar with its peculiar characteristics. revealed the highest concentration of copper in any of the parch-
The phyla of our bacterial strains isolated from paper documents ment samples (76,018 ppm; Makova, personal communication).
corresponded to the molecular clones obtained by previous Consequently, it is possible to suppose that such green stains were
investigations (Michaelsen et al., 2010; Principi et al., 2011): Fir- produced by copper oxidation, and the isolated strains demon-
micutes, Proteobacteria, and Actinobacteria. Also, in our investi- strated their adaptation to these kinds of conditions; this is also
gation the Firmicutes members represented the predominant supported by past findings attesting to the copper sorption ability
isolates and belonged, mainly, to the genus Bacillus. In addition, two of different members of these isolated genera (Ilhan et al., 2004;
Proteobacteria strains displayed high 16S rDNA similarity with the Gadd, 2009).
relatively new species L. dokdonensis (Oh et al., 2011) and M. tim- Beyond their potential sorption ability, the bacterial strains from
onae (La Scola et al., 1998), and their presence in ancient paper parchment J555-1 also showed their proteolytic activity, and
documents was revealed here for the first time. therefore their responsibility in parchment degradation. These
Although few studies have treated the microbial contamination bacteria were not the only isolates displaying such characteristics;
of parchment, our fungal isolates generally reflected the finding of in fact, proteolytic activity was shown by many other bacterial
previous works (Zyska, 1997; Mesquita et al., 2009), where strains isolated from paper documents and parchments. The
members of the genus Penicillium, Aspergillus, and Cladosporium bacteria were screened as the first microbial group, and for this
were isolated from this kind of material. The isolation of P. herba- reason we tried two kinds of proteolytic agar assays, the milk agar
rum and the Basidiomycota B. adusta from historical parchment are and the animal gelatin agar. In the beginning of our investigation
the first reported occurrence of these species. only the milk agar was used, but when the parchment isolates were
124 L. Kraková et al. / International Biodeterioration & Biodegradation 70 (2012) 117e125
analyzed, it was noted that many of them did not possess proteo-
lytic ability. Thus we decided to develop and use another type of
agar assay with animal gelatin (R2A-gel), because the gelatin
seemed to have characteristics closer to parchment than did the
milk. The new agar assay immediately demonstrated its usefulness
and it was used also for the screening of the fungal microflora.
Comparison of the fluorescence selection profiles (f-ITS and
f-CBH) and the biodegradative profiles showed a certain degree of
discordance between them. If, for example, we considered the 10
Virgibacillus isolates, it is evident that they belong to a unique f-ITS
profile, IIpr, but to two biodegradative profiles, ID and VID. This is
similar to the A. fumigatus isolates, which displayed one f-CBH
profile, but three biodegradative patterns. Therefore, there is not
a correspondence between the profiles of the molecular selection
methods and the biodegradative properties of the strains; this
discordance has also been confirmed in the past using others kinds
of DNA fingerprint techniques (Pangallo et al., 2009b).
In conclusion, our investigation showed another kind of
approach for the analysis of fungal and bacterial microflora,
a multiphasic one, which combined different types of sampling
procedures, microbiological media, molecular selection tools,
molecular identification methods, and biodegradation plate assays.
This report has increased knowledge about the microbial commu-
nities colonizing ancient library materials, especially in relation to
parchment. A novel PCR-based method (f-CBH) was applied here
for the preliminary selection of fungal microflora from historical
documents. The f-CBH method has been shown to be useful and
reliable, and can be used for the selection of microfilamentous fungi
isolated from other kinds of environments and also in culture-
independent DNA approaches that study the cellulolytic property
of fungal microflora present in a specific sample. Finally, the
different biodegradative characteristics of isolated microflora were
demonstrated, and a novel proteolytic plate assay (R2A-gel) was
developed.
Acknowledgements
This work was financed mainly by the VEGA Agency, project
number 2/0179/11: ‘‘Biodeterioration of natural and synthetic
polymers in historical and contemporary art collections.’’ We are
grateful to the company Caravella s.r.o. for its support, which was
necessary for the finalization of our work.
References
Arai, H., 2000. Foxing caused by fungi: twenty-five years of study. International
Biodeterioration and Biodegradation 46, 181e188.
Bicchieri, M., Monti, M., Piantanida, G., Pinzari, F., Sodo, A., 2011. Non-destructive
spectroscopic characterization of parchment documents. Vibrational Spectros-
copy 55, 267e272.
Clark, A.J., Calvillo, J.L., Roosa, M.S., Green, D.B., Ganske, J.A., 2011. Degradation
product emission from historic and modern books by headspace SPME/GCeMS:
evaluation of lipid oxidation and cellulose hydrolysis. Analytical and Bio-
analytical Chemistry 399, 3589e3600.
Del Pilar Ponce-Jiménez, M., López-Dellamary Toral, F.A., Gutierrez-Pulido, H., 2002.
Antifungal protection and sizing of paper with chitosan salts and cellulose
Ethers. Part 2, antifungal effects. Journal of the American Institute for Conser-
vation 41, 255e268.
Dolgin, B., Bulatov, V., Schechter, I., 2009. Application of synchronous fluorescence
to parchment characterization. Analytical and Bioanalytical Chemistry 395,
2151e2159.
Donachie, S.P., Foster, J.S., Brown, M.V., 2007. Culture clash: challenging the dogma
of microbial diversity. ISME Journal 1, 97e99.
Gadd, G.M., 2009. Biosorption: critical review of scientific rationale, environmental
importance and significance for pollution treatment. Journal of Chemical
Technology and Biotechnology 84, 13e28.
Heyndrickx, M., Logan, N.A., Lebbe, L., Rodriguez-Diaz, M., Forsyth, G., Goris, J.,
Scheldeman, P., De Vos, P., 2004. Bacillus galactosidilyticus sp. nov., an alkali-
tolerant beta-galactosidase producer. International Journal of Systematic and
Evolutionary Microbiology 54, 617e621.
Heyndrickx, M., Lebbe, L., Kersters, K., De Vos, P., Forsyth, C., Logan, N.A., 1998.
Virgibacillus: a new genus to accommodate Bacillus pantothenticus (Proom and
Knight 1950). Emended description of Virgibacillus pantothenticus. International
Journal of Systematic Bacteriology 48, 99e106.
Ilhan, S., Nourbakhsh, M.N., Kilicarslan, S., Ozdag, H., 2004. Removal of chromium,
lead and copper ions from industrial waste waters by Staphylococcus sapro-
phyticus. Turkish Electronic Journal of Biotechnology 2, 50e57.
Jensen, M.A., Webster, J.A., Straus, N., 1993. Rapid identification of bacteria on the
basis of polymerase chain reaction-amplified ribosomal DNA spacer poly-
morphisms. Applied and Environmental Microbiology 59, 945e952.
Kati, H., Ince, I.A., Demir, I., Demirbag, Z., 2010. Brevibacterium pityocampae sp. nov.,
isolated from caterpillars of Thaumetopoea pityocampa (Lepidoptera, Thaume-
topoeidae). International Journal of Systematic and Evolutionary Microbiology
60, 312e316.
Kurtzman, C.P., Robnett, C.J., 1998. Identification and phylogeny of ascomycetous
yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial
sequences. Antonie van Leeuwenhoek 73, 331e371.
Laffineur, K., Avesani, V., Cornu, G., Charlier, J., Janssens, M., Wauters, G., Delmée, M.,
2003. Bacteremia due to a novel Microbacterium species in a patient with
leukemia and description of Microbacterium paraoxydans sp. nov. Journal of
Clinical Microbiology 41, 2242e2246.
Lane, D.,J., 1991. 16S/23S rRNA sequencing. In: Stackenbrandt, E., Goodfellow, M.
(Eds.), Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons,
New York, pp. 115e148.
La Scola, B., Birtles, R.J., Mallet, M.N., Raoult, D., 1998. Massilia timonae gen. nov., sp.
nov., isolated from blood of an immunocompromised patient with cerebellar
lesions. Journal of Clinical Microbiology 36, 2847e2852.
Mesquita, N., Portugal, A., Videira, S., Rodriguez-Echeverria, S., Bandeira, A.M.L.,
Santos, M.J.A., Freitas, H., 2009. Fungal diversity in ancient documents. A case
study on the Archive of the University of Coimbra. International Biodeteriora-
tion and Biodegradation 63, 626e629.
Michaelsen, A., Piñar, G., Pinzari, F., 2010. Molecular and microscopical investigation
of the microflora inhabiting a deteriorated Italian manuscript dated from the
thirteenth century. Microbial Ecology 60, 69e80.
Montemartini Corte, A., Ferroni, A., Salvo, V.S., 2003. Isolation of fungal species from test
samples and maps damaged by foxing, and correlation between these species and
the environment. International Biodeterioration and Biodegradation 51, 167e173.
Nishimori, E., Kita-Tsukamoto, K., Wakabayashi, H., 2000. Pseudomonas pleco-
glossicida sp. nov., the causative agent of bacterial haemorrhagic ascites of ayu,
Plecoglossus altivelis. International Journal of Systematic and Evolutionary
Microbiology 50, 83e89.
Oh, K.H., Kang, S.J., Jung, Y.T., Oh, T.K., Yoon, J.H., 2011. Lysobacter dokdonensis sp.
nov., isolated from soil. International Journal of Systematic and Evolutionary
Microbiology 61, 1089e1093.
Orlita, A., 2004. Microbial biodeterioration of leather and its control: a review.
International Biodeterioration and Biodegradation 53, 157e163.


Pangallo, D., Simonovi

cová, A., Chovanová, K., Ferianc, P., 2007. Wooden art objects
and the museum environment: identification and biodegradative characteris-
tics of isolated microflora. Letters in Applied Microbiology 45, 87e94.
Pangallo, D., Drahovská, H., Harichová, J., Karelová, E., Chovanová, K., Aradská, J.,
Ferianc, P., Turn
a, J., Timko, J., 2008. Evaluation of different PCR-based
approaches for the identification and typing of environmental enterococci.
Antonie van Leeuwenhoek 93, 193e203.
Pangallo, D., Chovanova, K., Drahovska, H., De Leo, F., Urzi, C., 2009a. Application of
fluorescence internal transcribed spacer-PCR (f-ITS) for the cluster analysis of
bacteria isolated from air and deteriorated fresco surfaces. International
Biodeterioration and Biodegradation 63, 868e872.


Pangallo, D., Chovanová, K., Simonovi

cová, A., Ferianc, P., 2009b. Investigation of
microbial community isolated from indoor artworks and air environment:
identification, biodegradative abilities, and DNA typing. Canadian Journal of
Microbiology 55, 277e287.
Pangallo, D., Chovanova, K., Makova, A., 2010. Identification of animal skin of
historical parchments by polymerase chain reaction (PCR)-based methods.
Journal of Archaeological Science 37, 1202e1206.
Pinzari, F., Pasquariello, G., De Mico, A., 2006. Biodeterioration of paper: a SEM
study of fungal spoilage reproduced under controlled conditions. Macromo-
lecular Symposia 238, 57e66.
Principi, P., Villa, F., Sorlini, C., Cappitelli, F., 2011. Molecular studies of microbial
community structure on stained pages of Leonardo da Vinci’s Atlantic Codex.
Microbial Ecology 61, 214e222.
Rakotonirainy, M.S., Lavedrine, B., 2005. Screening for antifungal activity of essential oils
and related compounds to control the biocontamination in libraries and archives
storage areas. International Biodeterioration and Biodegradation 55, 141e147.
Reis-Menezes, A.A., Gambale, W., Giudice, M.C., Shirakawa, M.A., 2011. Accelerated
testing of mold growth on traditional and recycled book paper. International
Biodeterioration and Biodegradation 65, 423e428.
Riegel, P., Creti, R., Mattei, R., Nieri, A., von Hunolstein, C., 2006. Isolation of Cory-
nebacterium tuscaniae sp. nov. from blood cultures of a patient with endo-
carditis. Journal of Clinical Microbiology 44, 307e312.
Saran, S., Isar, J., Saxena, R.K., 2007. A modified method for the detection of
microbial proteases on agar plates using tannic acid. Journal of Biochemical and
Biophysical Methods 70, 697e699.
Strli

c, M., Thomas, J., Trafela, T., Cséfalvayová, L., Kralj Cigi
c, I., Kolar, J., Cassar, M.,
2009. Material degradomics: on the smell of old books. Analytical Chemistry 81,
8617e8622.
 L. Kraková et al. / International Biodeterioration & Biodegradation 70 (2012) 117e125
Strzelczyk, A.B., 2004. Observations on aesthetic and structural changes induced in
Polish historic objects by microorganisms. International Biodeterioration and
Biodegradation 53, 151e156.
Strzelczyk, A.B., Kuroczkin, J., Krumbein, W.E., 1989. Studies on the microbial
degradation of ancient leather book bindings. Part 2. International Biodeterio-
ration 25, 39e47.
Urzi, C., De Leo, F., 2001. Sampling with adhesive tape strips: an easy and rapid
method to monitor microbial colonization on monument surfaces. Journal of
Microbiological Methods 44, 1e11.
Willemsen, E., Luyten, R., Castelijns, W., Beentjes, G., 2011. Innovation in low-O2
technology: a solution for conservation, protection and treatment. Restaurator
32, 13e26.
125
Yoon, J.H., Lee, K.C., Weiss, N., Kho, Y.H., Kang, K.H., Park, Y.H., 2001. Sporosarcina
aquimarina sp. nov., a bacterium isolated from seawater in Korea, and transfer of
Bacillus globisporus (Larkin and Stokes 1967), Bacillus psychrophilus (Nakamura
1984) and Bacillus pasteurii (Chester 1898) to the genus Sporosarcina as Spor-
osarcina globispora comb. nov., Sporosarcina psychrophila comb. nov. and Spor-
osarcina pasteurii comb. nov., and emended description of the genus Sporosarcina.
International Journal of Systematic and Evolutionary Microbiology 51, 1079e1086.
Zotti, M., Ferroni, A., Calvini, P., 2008. Microfungal biodeterioration of historic
paper: preliminary FTIR and microbiological analyses. International Biodeteri-
oration and Biodegradation 62, 186e194.
Zyska, B., 1997. Fungi isolated from library materials: a review of the literature.
International Biodeterioration and Biodegradation 40, 43e51.