Introduction to Clinical Microbiology: Key Concepts

Introduction to
Clinical Microbiology
Prepared By: Michelle Gie Cabarde-Obial, RMT
OBJECTIVES:
1. Define important terms related to clinical bacteriology
2. Enumerate the development of science with emphasis on person/scientists and their contributions
3. Explain the divisions of clinical microbiology
4. Define and differentiate sterilization, disinfection, and antiseptic.
5. List the factors that influence the effectiveness of disinfectants in the microbiology laboratory.
6. Describe methods used for the disposal of hazardous waste, including physical and chemical methods,
and the material and/or organisms effectively eliminated by each method.
7. Define chemical hygiene plan
8. Describe the process of Universal or Standard Precautions in the microbiology laboratory
9. Define Biosafety levels 1 through 4, including the precautions required for each , and identify a
representative organism for each.
10. Outline the basic guidelines for packing and shipping infectious substances.
11. Describe the management and response required during a biologic or chemical exposure incident in the
laboratory
Historical Development
Girolamo Fracastoro or Hieronymous Fracastorius
• Wrote a treatise on the germ theory of disease entitled “de Contagione”
Robert Hooke
• Made key observations on microscopic organisms
Anton van Leeuwenhoek
• Credited with first identifying microorganisms, or “little animals or
animacules”, using his newly developed microscope in 1677.
• Accurate description of bacteria: He first accurately described the different
shapes of bacteria as cocci (spheres), bacilli (rods) and spirochetes (spiral
filaments) and communicated them to Royal Society of London in 1683.
SPONTANEOUS GENERATION (ABIOGENESIS)
• From the earliest times, people believed and supported spontaneous
generation that living organisms could develop from nonliving matter.
Ignaz Semmelweis (1818 – 1865)
• Advocated hand washing using dilute, chlorinated lime solution to
help stop the spread of disease.
John Snow (1813-1858)
• Published a pamphlet in which he speculated that cholera was a
waterborne or foodborne, intestinal illness.
• Considered as the “Founding Father of the field of Epidemiology”.
• Recommended a number of sanitation maneuvers, such as
washing the clothes and bed linens of cases, isolation of sick
people from healthy ones, and boiling water supplies to help curtail
the cases of cholera.
Louis Pasteur (1822-1895)
• Convincingly demonstrated that microorganisms were responsible
for the fermentation of fluids thus proving the germ theory of
disease.
• Showed that heat sterilization, chemical sterilization, or filtration of
air and water could maintain organic materials in sterile conditions
indefinitely without microbial growth. Techniques of sterilization and
“Pasteurization” of dairy products were soon introduced.
• Established the Pasteur Institute which later became the
International Center For Microbiology, Immunology, And Medicine.
• Coined the term “vaccine”.
• Other works: discovery of attenuation and chicken cholera vaccine,
developed live attenuated anthrax vaccine, developed rabies vaccine
and noticed Pneumococci.
• Charles Chamberland - Invented the autoclave and developed Pasteurella vaccine
• Alexandra Yersin - Co-discoverer of plague bacillus
• Emile Roux - Discovered diphtheria toxin and antitoxin
• Jules Bordet - Discovered whooping cough bacillus and complements
• Ilya Metchnikoff - Discovered the process of phagocytosis and provided the initial description of innate
immunity.
• Albert Calmette - Discovered cobra antivenin and developed Bacillus-Calmette-Guerin, the first effective
tuberculosis vaccine
Joseph Lister (1827-1912)
• “Father of Modern Surgery”
• Developed a system of antiseptic surgery – designed to prevent microorganisms from entering wounds.
This approach was remarkably successful and transformed surgery after Lister published his findings in
1867. It also provided strong evidence for the role of microorganisms in disease because phenol, which
killed bacteria, also prevented wound infections.
• He established the guiding principles of antisepsis for good surgical practice and was milestone in the
evolution of surgical practice from the era of “laudable pus” to modern aseptic techniques.
Robert Koch (1843-1910)
• “Father of Bacteriology”
• Identified anthrax bacilli in the blood of infected sheep and successfully transmitted the infection into
healthy experimental animals. Using careful photomicroscopy and detailed drawings, he accurately
described the life cycle of anthrax and the process of endospore formation.
• He also pioneered a number of laboratory techniques such as the use of oil immersion microscope to study
bacteria; developed new staining methods for bacterial identification; and invented procedures for the
isolation of pure bacterial cultures (Koch plate technique) on solid media facilitated by the use of agar as
the solidifying agent in flat “Petri” dishes, named after the inventor Richard Petri.
• Discovered the microbial etiology of tuberculosis. Using differential staining techniques, careful microscopy
and solid agar methods, he isolated the causative agent Mycobacterium tuberculosis, in pure culture.
Discovered also the causal agent of cholera.
• Developed the Koch’s Postulates (a set of criteria) which states that: the pathogen accounts for the clinical
and pathological features of the disease and must be found in every case in which the disease occurs; the
pathogen is not found in other diseases as a non-pathogen; after being isolated from the body and
repeatedly passed in pure culture, the pathogen can induce the disease in animal models; and the same
pathogen must be re-isolated from the experimental animal.
• He was the first to use the Hanging Drop Method by studying bacterial motility.
• Paul Ehrlich – co-discoverer of antibodies, antigens, and
chemotherapy for infectious diseases
• Richard Pfieffer – discovered bacterial endotoxin, the
phenomenon of bacteriolysis, and played a major role in the
development of killed typhoid vaccines
• Emil von Behring – discoverer of serum therapy for
diphtheria and tetanus
• Oswald Avery, Maclyn MacCarty, and Colin MacLeod –
identified the “holy grail” of genetics in 1944 with their finding
that the “transforming principle” or genetic material of
Streptococcus pneumoniae was DNA, not protein as previously
postulated.
Divisions of Clinical Microbiology
MYCOLOGY
▪ Is the study of fungi, their relationship to each
other and other organisms, and the unique
biochemistry which sets them apart from other
groups.
VIROLOGY
▪ Is the scientific discipline concerned with the
study of the biology of viruses and viral disease,
including the distribution, biochemistry,
physiology, molecular biology, ecology, evolution,
and clinical aspects of viruses.
Divisions of Clinical Microbiology
PARASITOLOGY
▪ The scientific discipline concerned with the study of the biology
of parasite and parasitic disease, including the distribution,
biochemistry, physiology, molecular biology, ecology, evolution
and clinical aspects of parasites, including the host response
to these agents.
BACTERIOLOGY
▪ Defined as the science and study of bacteria and their relation
to medicine and to other areas such as agriculture and
industry.
Definition of Terms
1. Acid-fastness – ability of bacteria, such as the Mycobacterium spp., to retain dye when treated with mineral acid
or an acid-alcohol solution
2. Aerotolerant anaerobes – microorganism that grows best in the absence of oxygen but can tolerate low
concentrations of oxygen
3. Autotrophs – organisms that produce organic compounds from carbon dioxide as a carbon source
4. Bacteria – also referred to as eubacteria; single celled microorganisms that lack a true cell nucleus and multiply
by binary fission.
5. Bacterial interference – potential pathogens inhibited by the nonpathogenic resident microbiota.
6. Biological agent – any microorganism or infectious substance, or any naturally occurring, bioengineered, or
synthesized component of any such microorganism or infectious substance, capable or causing death, disease,
or other biological malfunction in a human, animal, plant, or other living organism
7. Capnophilic – used to describe microorganisms that require an increased concentration of CO2
8. Capsule –organelle in some prokaryotic cells, such as a bacterial cell located outside the cell wall of bacteria. It
is usually made up of polysaccharides but could be composed of other materials
9. Differential media – media that allow grouping of microbes based on different characteristics demonstrated on
the medium
10. Differential stains – stains such as the Gram stain that stain components of the smear differently so that each
component can be recognized .
11. Eukaryotes – organism with complex cell; structures in which the genetic material is organized into a
membrane-bound nucleus
Definition of Terms
12. Facultative anaerobes – microorganism that does not require oxygen for growth but will use oxygen and grow
better if it is present
13. Fermentation – process in which a molecule is oxidized to produce energy without an exogenous electron
acceptor. Organic molecules usually serve as electron donors and electron acceptors.
14. Fimbriae – nonflagellar, sticky, proteinaceous, hairlike appendages that adhere some bacterial cells to each
other and to environmental surfaces
15. Flagella – exterior protein filaments that rotate; used by microorganisms for motility
16. Fusiform – spindle shaped or tapered at each end
17. Gram-negative bacteria – bacteria that do not retain the crystal violet complex; stained red by the safranin
counterstain
18. Gram-positive-bacteria - bacteria that retain the crystal violet-iodine complex and appear blue-black on Gram-
stained smears
19. Halophilic – “salt-loving”; an organism that grows best in media with an increased concentration of NaCl.
20. Heterotrophs – organism that requires organic substrates as a source of carbon for growth and development
21. Lysogeny – incorporation of the genetic material of a bacteriophage with that of the host bacterium.
22. Mesophiles – organism that grows best in moderate temperature, neither hot nor cold (25 to 40 C).
23. Microaerophilic – microorganisms that require environments containing concentrations of oxygen lower than
that present in the atmosphere (about 20%).
24. Minimal medium – laboratory growth medium whose contents are simple and completely defined.
25. Nutrient Media – culture media that are complex; made of extracts of meat or soybeans
Definition of Terms
26. Obligate aerobes – microorganisms that require oxygen for growth
27. Obligate anaerobes – microorganisms that can live and reproduce only in a strict anaerobic environment (0%
oxygen)
28. Pathogenic bacteria – organisms capable of causing disease
29. Pili – nonmotile, long, hollow protein tubes that connect two bacterial cells and mediate DNA exchange
30. Plasmids – extrachromosomal, circular pieces of DNA found in many strains of bacteria.
31. Pleomorphic – demonstrating a variety of shapes and forms; for a Gram stain, neither distinctly coccoid nor
rod-shaped; also used to describe the Gram stain morphology of bacteria that exhibit a combination of cocci,
bacilli, coccobacilli, and filamentous forms in a single stained smear.
32. Prokaryotes – microorganisms that lack a true nucleus and nuclear membrane
33. Psychrophiles – bacteria that grow best at cold temperatures (optimal growth at 10 to 20 C)
34. Selective media – media that support the growth of one type or one group of microbes but not of another
type.
35. Spores – unit of asexual reproduction that appears as a highly refractile body in the cell.
36. Thermophiles – bacteria that grow best at high temperatures (optimal growth at 50 to 60 C)
37. Transport medium – liquid or semisolid medium meant to preserve and maintain the integrity of the
specimen for the period between specimen collection and laboratory processing of the sample.
38. Virulence - degree of pathology caused by an organism; the disease-evoking power of a microorganisms
Safety, Specimen
and Waste
Management in
the Microbiology
Laboratory
STERILIZATION
Is the process whereby all forms of microbial life, including bacterial spores
are killed and can be accomplished by physical of chemical means.
• Methods of Sterilization:
• PHYSICAL METHODS
✓Incineration
✓Moist Heat
✓Dry Heat
✓Filtration
✓Ionizing (gamma) radiation
• CHEMICAL METHODS
STERILIZATION: Physical Methods
▪ Incineration – is the most common method of treating infectious waste.
Hazardous material is literally burned to ashes at temperature of 870º to
980º C. Considered as the safest method to ensure that no infective
materials remain in samples or containers when disposed.
▪ Moist Heat (Steam Under Pressure)
• Is used to sterilize biohazardous trash and heat-stable objects;
an autoclave is used or this purpose.
• Moist heat in the form of saturated steam under 1 atmosphere
(15 psi) of pressure causes the irreversible denaturation of
enzymes and structural proteins.
• The most common type of steam sterilizer in microbiology
laboratory is the gravity displacement type.
• The two common temperatures are 121º C (250º F) and 132º
C (270º F).
• Items such as media, liquids, and instruments are usually
autoclaved for 15 minutes at 121º C.
• Infectious medical waste is sterilized at 132º C for 30 to
60 minutes to allow penetration of the steam throughout
the waste and the displacement of air trapped inside the
autoclave bag.
▪ Dry Heat
• Requires longer exposure times (1.5 to 3 hours) and higher
temperatures than moist heat (160º to 180º C)
• Used to sterilize items such as glassware, oil, petroleum, or
powders.
▪ Filtration
• Is the method of choice for antibiotic solutions, toxic chemicals,
radioisotopes, vaccines, and carbohydrates, which are all heat
sensitive.
• Filtration of liquid is accomplished by pulling the solution through a
cellulose acetate or cellulose nitrate membrane with vacuum.
• Filtration of air is accomplished using High-Efficiency-Particulate-Air
(HEPA) filters designed to remove organisms larger than 0.3 um
from isolation rooms, operating rooms, and biological cabinets
(BSCs)
▪ Ionizing Radiation
• Ionizing radiation used in microwaves and radiograph machines are
short wavelength and high-energy gamma rays.
• Used for sterilizing disposables such as plastic syringes, catheters,
or gloves before use
STERILIZATION: Chemical Methods
• Most common sterilant is Ethylene oxide (EtO), which is used in gaseous form for sterilizing heat-sensitive
objects.
• Formaldehyde vapor and vapor-phase hydrogen peroxide (oxidizing agent) have been used to sterilize HEPA
filters in BSCs.
• Glutaraldehyde, which is sporicidal (kills spores) in 3 to 10 hours, is used for medical equipment such as
bronchoscopes, because it does not corrode lenses, metal, or rubber.
• Peracetic acid, effective in the presence of organic material, has also been used for the surface
sterilization of surgical instruments.
• The use of peracetic acid or glutaraldehyde is called cold sterilization.
DISINFECTION
Is a process whereby pathogenic
organisms, but not necessarily all
microorganisms or spores, are destroyed.
▪ Physical Methods of Disinfection
• Boiling at 100º C for 15 minutes, which kills
vegetative bacteria.
• Pasteurizing at 63º C for 30 minutes or 72º C
for 15 seconds, which kills food pathogens
• Using nonionizing radiation such as
ultraviolet (UV) light
• UV rays are long wavelength and low
energy. They do not penetrate well and
organisms must have direct surface
exposure, such as the working surface of
a BSC, for this form of disinfection to
work.
DISINFECTION
▪ Chemical Methods of Disinfection When chemicals are used to destroy all life they
are called chemical sterilants, or biocides;
however, these same chemicals used for shorter
periods are disinfectants. Disinfectants used on
living tissue are called antiseptics.
Factors that influence the activity of
disinfectants:
• Type of organisms present
• Temperature and pH of process
• Number of organism present (microbial load)
• Concentration of disinfectant
• Amount of organics (blood, mucus, pus)
present
• Heavy metals • Nature of surface to be disinfected (e.g.,
• Quaternary ammonium compounds potential of corrosion; porous vs. nonporous
surface)
• Length of contact time
REMEMBER ! ! Prepare a working solution of the compound
• Type of water available (hard vs. soft)
EXACTLY according to the manufacturer’s package insert.
CHEMICAL SAFETY
• The United States Occupational Safety and Health
Administration (OSHA) published the Hazard Communication
Standard, which provides for certain institutional educational
practices to ensure all laboratory personnel have a thorough
working knowledge of the hazards of chemicals with which they
work. This standard has also been called the “employee right-to-
know”.
• It mandates that all hazardous chemicals in the workplace
be identified and clearly marked with a National Fire
Protection Association (NFPA) label stating the health risks,
such as carcinogens, mutagens, or teratogens, and the
hazard class.
• Each laboratory should have a chemical hygiene plan that
includes guidelines on proper labeling of chemical
containers, manufacturer’s material safety data sheet
(MSDS), and a written chemical safety training and
retraining programs.
CHEMICAL SAFETY
• The MSDSs include information on the nature of the chemical,
the precautions to take if the chemical is spilled, the disposal
recommendations. The sections in the typical MSDS include
• Substance name;
• Name, address, and phone number of manufacturer
• Hazardous ingredient(s);
• Physical and chemical properties
• Fire and explosion data;
• Toxicity
• Health effects and firs aid;
• Stability and reactivity
• Shipping data;
• Spill, leak, and disposal procedures
• Personal protective equipment;
• Handling and storage
• Fume hoods are provided in the laboratory to prevent inhalation
of toxic fumes
BIOSAFETY
Individuals are exposed in various ways to laboratory acquired infections in microbiology laboratories.
These involve the following:
• Rubbing the eyes or nose with contaminated hands
• Inhaling aerosols produced during centrifugation, vortexing, or spills of liquid cultures
• Accidentally ingesting microorganisms by putting pens or fingers in the mouth
• Suffering percutaneous inoculation, that is, being punctured by a needlestick.
• In the clinical microbiology laboratory, shigellosis, salmonellosis, tuberculosis, brucellosis, and hepatitis
are the five most frequently acquired laboratory infections.
• Viral agents transmitted through blood and body fluids cause most of infections in nonmicrobiology
laboratory workers and in health care workers in general. These include Hepatitis B Virus, Hepatitis C
Virus, Hepatitis D Virus, and HIV.
EXPOSURE CONTROL PLAN
• It is the legal responsibility of the laboratory director and supervisor to ensure that an Exposure Control
Plan has been implemented and that the mandated safety guidelines are followed. The plan identifies
tasks that are hazardous to employees and promotes employee safety through the following:
• Employee education and orientation
• Appropriate disposal of hazardous waste
• Standard Precautions
• Engineering controls and safe work practices, as well as appropriate waste disposal and use of
biological safety cabinets.
• Personal Protective Equipment
• Postexposure plan involving the investigation of all accidents and a plan to prevent recurrences.
EXPOSURE CONTROL PLAN: Disposal of Hazardous Waste
• All materials contaminated with potentially infectious agents must be decontaminated before disposal.
Infectious waste from microbiology laboratories is usually autoclaved on-site or sent for incineration.
• In 1986 the EPA published a guide to hazardous waste reduction to limit the amount of hazardous
waste generated and released into the environment. These regulations call for the following:
• Substituting less hazardous chemicals when possible
• Developing procedures that use less of a hazardous chemical
• Segregating infectious waste from uncontaminated trash
• Substituting miniaturized systems for identification and antimicrobial susceptibility testing of
potential pathogens to reduce the volume of chemical reagents and infectious wastes.
EXPOSURE CONTROL PLAN : Disposal of Hazardous Waste
• Recently, several alternative waste-treatment machines were developed to reduce the amount of waste
buried in landfills. These systems combine mechanical shredding or compacting of the waste with either
chemical (sodium hypochlorite, chlorine dioxide, peracetic acid), thermal (moist heat, dry heat), or ionizing
radiation (microwaves, radio waves) decontamination.
• Infectious waste should be placed into two leak-

proof, plastic bags for sturdiness; this is known as
double-bagging in common laboratory jargon.
• Pipettes, swabs, and other glass objects should be
placed into rigid cardboard containers before
disposal.
• Broken glass is placed in thick boxes lined with
plastic biohazard bags; when full, the box is
incinerated or autoclaved.
• Sharp objects, including scalpels and needles, are
placed in Sharps containers, which are autoclaved
or incinerated when full.
STANDARD PRECAUTIONS
▪ The essentials of Standard Precautions and safe laboratory work practices
are as follows:
• Do not eat, drink, smoke, or apply cosmetics (including lip balm)
• Do not insert or remove contact lenses
• Do not bite nails or chew on pens
• Do not mouth-pipette
• Limit access to the laboratory to trained personnel only
• Assume all patients are infectious for all blood-borne pathogens
• Use appropriate barrier precautions to prevent skin and mucous membrane exposure, including
wearing gloves at all times and masks, goggles, gowns, or aprons if splash or droplet formation is a
risk.
• Thoroughly wash hands and other skin surfaces after removing gloves and immediately after any
contamination.
• Take special care to prevent injuries with sharp objects, such as needles and scalpels.
STANDARD PRECAUTIONS
▪ Precautions applies to blood and all body fluids, except sweat.
▪ Food and drinks must be stored in refrigerators in areas separate from the work area.
▪ It is good practice to store sera collected periodically from all health care workers so that, in the event of
an accidental, a seroconversion (acquisition of antibodies to an infectious agent) can be documented.
▪ All health care workers should follow Standard Precautions whether working inside or outside the
laboratory. When colleting specimens outside the laboratory, individuals should follow these guidelines:
• Wear gloves and a laboratory coat.
• Deal carefully with needles and lancets.
• Discard sharps in an appropriate, puncture-resistant container.
• Never recap needles by hand; if necessary, special safety devices are available.
ENGINEERING CONTROLS: Laboratory Environment
• The biohazard symbol should be prominently displayed on laboratory doors and any equipment that
contain infectious materials.
• The air-handling system of a microbiology laboratory should move air from lower to higher risk areas, never
reverse.
• Ideally, the microbiology laboratory should be under negative pressure, and air should not be recirculated
after passing through microbiology.
• The selected use of BSCs for procedures that generate infectious aerosols is critical to laboratory safety.
• Subculturing blood cultures by puncturing the septum with a needle should be performed behind a barrier
to protect the worker from droplets.
• Procedures used to process specimens for culture, notably, mincing, grinding, vortexing, and preparing
direct smears for microscopic examination should be performed in a BSC.
• Access to microbiology laboratory should be limited to employees and other necessary personnel.
• Care should be taken to prevent insects from infesting any laboratory area.
• A pest control program should be in place to control rodents and insects.
ENGINEERING CONTROLS: Biologic Safety Cabinet
• BSC is a device that encloses a workspace in such a way as to protect workers from aerosol exposure to
infectious disease agents.
• Air that contains the infectious material is sterilized, either by heat, UV light, most commonly by passage
through a HEPA filter that removes most particles larger than 0.3 um in diameter.
CLASS I CABINETS
• Allow room (unsterilized) air to pass into
the cabinet and around the area and
material within, sterilizing only the air to be
exhausted.
• They have negative pressure, are
ventilated to the outside, and are usually
operated with an open front.
CLASS II CABINETS
• Sterilize air that flows over the infectious material, as well as
air to be exhausted.
• The air flows in “sheets” which serve as barriers to particles
from outside the cabinet and direct the flow of contaminated
air into the filters; thus called vertical laminar flow BSCs.
• Have a variable sash opening though which the operator
gains access to the work surface.
• Depending on their inlet flow velocity and the percent of air
that is HEPA filtered and recirculated, class II cabinets are
further differentiated into:
• Type A (Class IIA) – is self-contained, and 70% of the air
is recirculated; mostly used in hospital clinical
microbiology laboratory
• Type B (Class IIB) – exhaust air is discharged outside the
building; is selected for radioisotopes, toxic chemicals, or
carcinogens will be used.
CLASS III CABINETS

• Offer the most protection to the worker because
they are completely closed and have negative
pressure.
• Air coming into and going out of the cabinet is filter
sterilized, and the infectious material within is
handled with rubber gloves that are attached and
sealed to the cabinet.
• It is important to the proper operation of laminar
flow cabinets that an open area for 3 feet from the
cabinet be maintained during operation of the air-
circulating system; this ensures that infectious
material is directed through the HEPA filters.
CLASSIFICATION OF BIOLOGIC AGENTS BASED ON HAZARD
BIOSAFETY LEVEL 1(BSL-1) Agents

• Include those that have no known potential for infecting healthy people and are well defined and
characterized.
• Used in laboratory teaching exercises for undergraduate, secondary educational training and teaching
laboratories for students in microbiology.
• Includes Bacillus subtilis and Naegleria gruberi
• Precautions working with BSL-1 agents include standard good laboratory technique.
BIOSAFETY LEVEL 2 (BSL-2) Agents
• Those that are most commonly being sought in clinical specimens and used in diagnostic, teaching, and
other laboratories.
• Includes all the common agents of infectious disease, as well as HIV, HBV, Salmonella organisms, and
several more unusual pathogens.
CLASSIFICATION OF BIOLOGIC AGENTS BASED ON HAZARD
• Procedures have been recommended for the handling of material suspected of harboring organisms
unlikely to be encountered in a routine clinical laboratory and for such organisms as Mycobacterium
tuberculosis, Coxiella burnetii, the mold stages of systemic fungi, and some other organisms when grown
in quantities greater than that found in patient specimens.
• Those working with BSL-3 agents should have baseline sera specimens stored for comparison with acute
sera that can be drawn in the event of unexplained illness.
• BSL-3 organisms are primarily transmitted by infectious aerosols
• Are exotic agents that are considered high risk and cause life-threatening disease
• Include Marburg virus or Congo-Crimean hemorrhagic fever
• Personnel and all materials must be decontaminated before leaving the facility and all procedures are
performed under maximum containment.
• Most facilities that deal with BSL-4 agents are public health or research laboratories.
MAILING BIOHAZARDOUS MATERIALS
• Packaging must meet the requirements of the International Air Transport Association (IATA) and the
International Civil Aviation Organization (IACO).
• The shipper is the individual (institution) ultimately responsible for safe and appropriate packaging. Any
fines or penalties are the shipper’s responsibility.
• Infectious specimens or isolates should be wrapped with absorbent material and placed inside a plastic
biohazard bag, called a primary receptacle. The primary receptacle is then inserted into a secondary
container, most often a watertight, hard plastic mailer. The secondary container is capped and placed
inside an outer, tertiary container that protects it from physical and water damage.
• The package must display the UN Packaging
Specification Marking and must be labeled with a
specific hazard label as an infectious substance.
• A packaging list and a Shippers Declaration for
Dangerous Goods Form must accompany the air
bill or ground form.
• Shippers should note that some carriers have
additional requirements for coolant materials,
such as ice, dry ice, or liquid nitrogen.
LEARNING OUTCOMES:
MICROBIAL TAXONOMY:
• Properly use the binomial nomenclature in the identification of organisms, including
syntax, capitalization, and punctuation.
• Identify the phenotypic and genotypic characteristics of microorganisms.
• Describe how microbial taxonomy plays a role in diagnostic settings.
BACTERIAL GENETICS AND METABOLISM:

• Describe the basic structure of prokaryotic genetic material.
• Describe the role of mutations in the evolution and survival of microorganisms.
BACTERIAL STRUCTURE:
• State the functions and biologic significance prokaryotic cellular structures.
• Differentiate the cell wall of Gram-positive and Gram-negative bacteria.
COVERAGE:
MICROBIAL TAXONOMY:
• Classification, Identification, Species, Genus, and Binomial Nomenclature
• Microorganism’s Phenotypic and Genotypic Characteristics
BACTERIAL GENETICS AND METABOLISM:

• Bacterial Nucleic Acid Structure and Organization
• Replication and Expression of Genetic Information
• Bacterial Metabolism
BACTERIAL STRUCTURE:
• Structure of Prokaryotic Cells
• Bacterial Morphology
• Bacterial Cell Components
Microbial Taxonomy
TAXONOMY
Nomenclature Identification Classification

(Naming) (Describing) (Classifying)
Binomial System Genotypic Characteristics Hierarchical

(Two-name) Phenotypic Characteristics Classification System
Microbial Classification
Classification: a method for organizing microorganisms into groups or taxa based on similar
morphologic, physiologic, and genetic traits (Tille, 2014).
Hierarchical Classification System

Species: specific epithet (quality or characteristic)
Genus: contains similar species
Family: contains similar genera
Order: contains similar families
Class: contains similar orders
Phylum: contains similar classes
Kingdom: contains similar divisions or phyla
Microbial Identification
Identification: is the process by which a microorganism’s key features are delineated. Once those
features have been established, the profile is compared with those of other previously characterized
microorganisms (Tille, 2014).
GENOTYPIC CHARACTERISTICS PHENOTYPIC CHARACTERISTICS

Genotypic characteristics: relate to an Phenotypic characteristics: are based on
organism’s genetic makeup, including the features beyond the genetic level and include
nature of the organism’s genes and both readily observable characteristics and
constituent nucleic acids. characteristics that may require extensive
analytic procedures to be detected.
• Deoxyribonucleic acid (DNA) base
composition ratio • Macroscopic and microscopic morphology
• Nucleic acid (DNA and ribonucleic acid • Staining characteristics
[RNA]) base sequence analysis, including • Environmental and nutritional requirements
hybridization assays • Resistance profiles
• Antigenic properties
• Subcellular properties
Microbial Nomenclature
Nomenclature: is the naming of microorganisms according to established rules and guidelines set forth
in the International Code of Nomenclature of Bacteria (ICNB) or the Bacteriological Code (BC). It
provides the accepted labels by which organisms are universally recognized (Tille, 2014).
Binomial Nomenclature (Two-Name) System:

 Every organism is assigned a scientific name or
label composed of a genus and species
designation Staphylococcus aureus
 Greek or Latin derivation; Greek staphulē ‘bunch of grapes’ Latin aurum ‘gold’
 Characteristics of the sample or organism + kokkos ‘berry’
 Personal names of scientists or discoverer;
 Geographical locations (e.g., Hafnia, Providencia)
 Name of institutions or events (e.g., Legionella
from American Legion Convention) Escherichia coli
 While the specific name is written in lowercase German-Austrian pediatrician Greek kólon ‘colon’
Theodor Escherich (large intestine)
letters, the first letter of the generic name is
always written in UPPERCASE form. [eshʺə-rikʹ]
Microbial Nomenclature
Binomial Nomenclature System - continuation
Example:
 The two components of the scientific name are used Escherichia coli is a Gram-negative, oxidase-
SIMULTANEOUSLY and written in italics or negative, facultative anaerobic, coccobacilli
underlined in script or text. found in the intestines of people and animals.
 For the generic epithet, all names derived from

Example: Escherichia, Legionella, Salmonella,
people, places, or events must be in the female
Listeria, Bartonella, etc.
nominative case (adding the suffix –ia, –a, or –ella).
 Alternatively, the scientific name may be abbreviated Examples:

by using the uppercase form of the first letter of Escherichia coli E. coli
the generic epithet followed by a period (.) and the
full specific name, which is never abbreviated. Staphylococcus aureus S. aureus
 Frequently, an informal designation may be used to Examples:

label a particular group of organisms. These staphylococci streptococci spirochete
designations are not capitalized or italicized. enterococci actinomycete mycobacteria
Microbial Viability and Survival
Genetics Metabolism Structure

(cellular processes)
• Bacterial nucleic acid • Fueling • Bacterial morphology

structure and organization • Biosynthesis • Bacterial cell components
• Replication and expression of • Polymerization and assembly
genetic information
• Waste removal
• Genetic exchange and
diversity • Motion and other responses
to environment
Bacterial Nucleic Acid Structure and Organization
Nucleobases
The Sugar-Phosphate Backbone NH3 O O
5’
HOCH2 O OH C C C CH3
4’ 1’ N CH HN CH HN C
H H
H 3’ 2’ H C CH C CH C CH
O- O N O N O N
OH H H H H
O- P O Deoxyribose sugar Cytosine (C) Uracil (U) Thymine (T)
O- 5’
HOCH2 O OH O NH2
4’ 1’ N C N C
H H N NH C N
Phosphate Group
(PO4-3)
H 3’ 2’ H HC HC
C C C CH
OH OH N NH2 N
H N H N
Ribose sugar
Guanine (G) Adenine (A)
Bacterial Nucleic Acid Structure and Organization 3’
5’
T
G
C
A |||
||| C
|| G
T
A
5’
3’
Bacterial Nucleic Acid Structure and Organization
Chromosome Characteristics of Prokaryotic (Bacterial)

Nucleic Acid Structure and Organization:
• Single (haploid) chromosome
• Genetic material is not contained in
membrane-bound organelles (e.g.,
nucleus)
• Bacterial chromosome exists as a
double-stranded, closed, circular,
Plasmid supercoiled (extensively folded and
twisted) macromolecule
Plasmids: may contain genes that enhance the • Bacterial plasmids exist as double-
survival of an organism, either by killing other
organisms or by defending the host cell by stranded, closed, circular, autonomously
producing toxins, and providing genetic advantages replicating non-chromosomal elements
such as antimicrobial resistance. Some plasmids
facilitate the process of replication in bacteria.
Bacterial DNA Replication
Parent Bacterial chromosome

bacterial (closed, circular, dsDNA)
cell
Cell
division
4 Stages of Bacterial DNA Replication:

1. Unwinding (relaxation) of supercoiled chromosome DNA
Two (2)
2.Separation of complementary strands of the parent DNA
daughter
3. Synthesis of new DNA strands by DNA polymerase III
cells
4. Termination of replication and segregation of the two
identical chromosomes to each daughter cell
Bacterial DNA Replication: Initiation
Step Events Enzymes / Proteins Involved
Initiation Uncoiling (relaxation) of supercoiled Topoisomerase II (DNA gyrase)

bacterial chromosome
Breaking of hydrogen bonds Helicase

between nucleobase pairs
As the DNA is unzipped, Y-shaped –

structures called replication forks
are formed
A primer composed of 5-10 RNA primase (a type of RNA

complementary RNA nucleotides are polymerase)
added to the template DNA strand
Helicase unzips the double-stranded DNA

5’ 3’
TTAATCCGGTTGCTAAGTAATTTCCTTACGCCGG
AATTAGGCCAACGATTCATTAAAGGAATGCGGCC
3’ 5’
Topoisomerase II relaxes the
supercoiled double-stranded DNA
The site of active replication is referred to as the replication fork; two bidirectional forks
are involved in the replication process.
3’
Replication
TTAATCCGGTTGCTAAG
fork CGAUU
3’ 5’
RNA primer
5’
ATG
3’
TAC
RNA primer
5’ 3’
AAUCC
AATTAGGCCAACGATTC 5’
Bacterial DNA Replication: Elongation
Step Events Enzymes / Proteins Involved
Elongation Addition of complementary DNA DNA polymerase III

nucleotides to the 3’ end
Holds DNA polymerase in place as Sliding clamp
it continues to add DNA nucleotides
Prevents over-winding of DNA Topoisomerase II (DNA gyrase)
strand ahead of replication fork
Removal of RNA primers from DNA polymerase I (with
the lagging strand exonuclease activity)
Formation of phosphodiester bonds DNA ligase

between nucleotides, including the
Okazaki fragments
Replication 3’
fork TTAATCCGGTTGCTAAG
AATTAGGCCAA CGAUU
3’ 5’
RNA primer
5’
ATG
Primase
DNA
TAC
polymerase
3’ Primase
DNA
RNA primer polymerase
5’ 3’
AAUCCGGTTGCTAAG
AATTAGGCCAACGATTC 5’
3’
AATTGTCCGAATTAATAGGACCTATGGA
TTAACAGGCTTAATTATCCTG GAUAC
3’ 5’
5 ’ AATTGTC Leading strand (continuous synthesis) RNA primer
TTAACAG RNA primer RNA primer

3’ 5’ 3’ 5’ 3’ 3’
UUGUC CCAATTAAUAGGACCTATGGA
TTAACAGGCTTAATTATCCTGGATACCT
5’
Lagging strand (discontinuous synthesis) = RNA primers + Okazaki fragments
DNA polymerase I will remove Okazaki fragments are small DNA ligase catalyzes the
the RNA primers and replaces it DNA segments separated by the formation of phosphodiester
with newly synthesized DNA RNA primers bonds between the 3’-OH and
5’-phosphate end
Bacterial DNA Replication: Termination
Duplicated
Bacterial topoisomerase IV
chromosome introduces double-stranded
breaks into DNA molecules,
allowing them to separate from
Topoisomerase IV each other. It then reseals the
Parent circular chromosomes
chromosome
Circular chromosomes (DNA)

are interlocked and must be
separated from each other
Bacterial Growth
Bacteria are prokaryotic organisms

that most commonly replicate by
the asexual process of binary fission.
These microbes reproduce rapidly at

an exponential rate under favorable
conditions.
Bacterial Growth
LAG PHASE:
• This initial phase is characterized

by cellular activity but not growth.
• A small group of cells are placed in

a nutrient-rich medium that allows
them to synthesize proteins and
other molecules necessary for
replication.
• These cells increase in size, but no

cell division occurs in the phase.
Bacterial Growth
EXPONENTIAL / LOG PHASE:
• This is the time when the cells are
dividing by binary fission and
doubling in numbers after each
generation time.
• The metabolic activity is high as
DNA, RNA, cell wall components,
and other substances necessary for
growth are generated for division.
• It is in this growth phase that
antibiotics and disinfectants are
most effective as these substances
typically target bacteria cell walls or
the protein synthesis processes of
DNA transcription and RNA
translation.
Bacterial Growth
STATIONARY / PLATEAU PHASE:

• The population growth experienced in
the log phase begins to decline as the
available nutrients become depleted
and waste products start to
accumulate.
• The number of dividing cells equal the
number of dying cells = no overall
population growth.
• Under the less favorable conditions,
competition for nutrients increases and
the cells become less metabolically
active.
• Spore-forming bacteria produce
endospores and pathogenic bacteria
begin to generate virulence factors.
Bacterial Growth
DEATH PHASE:
• As nutrients become less available and
waste products increase, the number of
dying cells continues to rise.
• In the death phase, the number of
living cells decreases exponentially and
population growth experiences a sharp
decline.
• As dying cells lyse or break open, they
spill their contents into the
environment, making these nutrients
available to other bacteria. This helps
spore-producing bacteria to survive long
enough for spore production.
• Spores are able to survive the harsh
conditions of the death phase.
Bacterial Metabolism: Requirements (Fueling Reactions)
Precursor Metabolites Nutrients, Other Growth Requirements
• Gases: Carbon dioxide (CO2), Oxygen • Glucose-6-phosphate

(O2), Ammonia (NH3) • Fructose-6-phosphate
• Organic compounds, including amino acids • Pentose-5-phosphate
• Water (H2O) • Erythrose-4-phosphate
• Nitrate (NO3-) • 3-Phosphoglycerate
• Phosphate (PO43-) • Phosphoenolpyruvate
• Hydrogen sulfide (H2S) • Pyruvate
• Sulfate (SO42-) • Acetyl CoA
• Potassium (K+) • α—Ketoglutarate
• Magnesium (Mg2+) • Succinyl CoA
• Calcium (Ca2+) • Oxaloacetate
• Sodium (Na+)
• Iron (Fe3+) - organic iron complexes
Bacterial Metabolism
Assembly
Fueling Biosynthetic Polymerization reactions
reactions reactions reactions
Precursor Lipids Inclusions
Fatty acids
metabolites
Lipopoly-
saccharide Envelope
Sugars
Glycogen
Glucose Metabolic Flagella
energy Murein Pili
(peptidoglycan)
Amino acids
Nutrients Cytosol
Protein
Polyribosomes
RNA
Nucleotides
DNA Nucleoid
Fueling products Building blocks Macromolecules Structures

Bacterial Structure and Function
PROKARYOTES EUKARYOTES
Representative Viruses are

Bacteria Fungi, Parasites acellular and
Organisms
depend on host
cells for survival
Cytoskeleton and
Membrane-enclosed NO YES
organelles
Cell wall has a

peptidoglycan layer YES NO
Location of metabolic
Cytoplasm Nucleus and
processes / functions cytoplasm
Bacterial Structure and Function Monotrichous
(flagellum at one end)
Lophotrichous
(tuft of flagella at
one end)
Amphitrichous
(flagella at both ends)
Peritrichous
(flagella covering entire surface)
Bacterial Structure and Function
Step Gram-Positive Bacteria Gram-Negative Bacteria
1 Heat fixation
2 Crystal violet
(primary stain)
3 Gram’s iodine
(mordant)
4 Acetone-alcohol
(decolorizer)
5 Safranin
(counterstain)
Positive (dark purple) Negative (red)
Bacterial Morphology
Three Basic Shapes of Bacteria
Round Rod Curved

(coccus) (bacilli)
Cocci in pairs Cocci in chains Cocci in fours

(diplococcus) (streptococcus) (tetrad)
Round
(coccus)
Cocci in cuboidal
Cocci in clusters packets of eight
(staphylococcus) (sarcina)
Plump rod Bacilli in pairs Bacilli in chains

(coccobacillus) (diplobacillus) (streptobacillus)
Clostridium spp.
Rod (anaerobic)
(bacilli) Bacillus spp.
(aerobic)
Palisades Club rod
(bacilli bends at (coryneform bacillus, Spore-formers
points of division) diphtheroids) (bacilli with endospores)
Curved Spiral
(vibrio) (spirillum)
Curved
Corkscrew
(spirochete)
Coverage
General Stages of Microbial–Host Interaction

• The Encounter Between the Host and Microorganism
• Microorganism Colonization of Host Surfaces
• Microorganism Entry, Invasion, and Dissemination
• Outcome of Infectious Diseases
Prevention of Infectious Diseases

Learning Outcomes
1. Define epidemiologic terminologies related to the topic;
2. List the various reservoirs that facilitate host-microorganism interactions;
3. Define direct and indirect transmission and give examples;
4. Define and differentiate the interactions between the host and microorganism;
5. Provide specific examples of disease prevention strategies, including preventing
transmission, controlling reservoirs and minimizing risk of exposure;
6. Differentiate between bacterial endotoxins and exotoxins and provide examples of
each;
7. Given a patient history of an infectious process, identify and differentiate a sign
versus a symptom;
8. Define and differentiate between an acute infectious process and one that is
chronic and/or latent; and
9. Describe the prevention and control measures of infectious diseases.
The Encounter Between Host and Microorganism
The Human Host’s Perspective The Microorganism’s Perspective
• Microbial Reservoirs and Transmission
• Human and Microbe Interactions
• Animals as Microbial Reservoirs Microbial survival (fulfillment of their
• Insects as Vectors metabolic and genetic needs)
• The Environment as a Microbial
Reservoir
Bacteria and microbe encounters:

Humans are exposed to the organism through various means (modes of transmission)
1. Humans are directly exposed to the same environment where the organism lives; or
2. Humans are exposed to the organism through indirect means (e.g., vectors, vehicles)
Microbial Reservoirs and Transmission
Microbial Reservoirs: origin of the etiologic agent Mode of Transmission: means by which etiologic
or location from which it disseminates (e.g., agents are brought in contact with the human
water, food, insects, animals, other humans) host (e.g., direct and indirect transmission)
Microorganism Sources Modes of Transmission

(Reservoirs) Direct transmission: transmitted
by direct contact between
Humans reservoir and host
Animals
Food (from plant and
animal sources) Indirect transmission: transmitted Human
Water to host via vectors and vehicles
Air (inanimate objects) host
Soil
Modes of Microbial Transmission
Direct Transmission: transmitted by Indirect Transmission: transmitted to
direct contact between reservoir and host via intervening agents (there is no
the host direct human-to-human contact)
• Horizontal Transmission: • Airborne transmission (<5 microns): droplet

• Direct contact (e.g., skin-to-skin contact; nuclei suspended in air
kissing; unsafe sexual practices; direct • Vehicles are non-living entities that are
inoculation through needlestick or animal contaminated with the etiologic agent (e.g.,
bite; transfer of agent to open wounds) water, food, air, blood products, medical devices)
• Blood or body fluid physical contact or and as such is the mode of transmission for
exposure; Droplet spread (>5 microns) that agent
• Vertical Transmission: • Vectors are living entities such as animals,
blood-feeding arthropods (e.g., ticks, fleas,
• Perinatal (transmission of etiologic agent mosquitoes), or another human, that transmit
from mother to fetus) the etiologic agent
References: Tille (2014). Bailey & Scotts’ Diagnostic Microbiology. | CDC (2012). Sec. 10 - Chain of Infection.
Human and Microbe Interactions
Humans play a substantial role as microbial reservoirs.
EXAMPLES: MODE OF TRANSMISSION:
Conjunctivitis of the newborn Direct mother-to-baby transmission with the
(also known as ophthalmia neonatorum) mother's birth canal that is infected with an STI
(e.g., Neisseria gonorrhoeae, Chlamydia trachomatis)
Group A streptococcal pharyngitis Direct person-to-person transmission through saliva

(Streptococcus pyogenes, “strep throat”) or nasal secretions from an infected person
Gonococcal urethritis (Neisseria gonorrhoeae) Direct person-to-person transmission through unsafe

Syphilis (Treponema pallidum) sexual practices
Pulmonary tuberculosis Indirect transmission mainly through airborne

(Mycobacterium tuberculosis) transmission of droplet nuclei
Cholera (Vibrio cholerae) Indirect transmission through ingestion of fecal-
contaminated water
Animals as Microbial Reservoirs (Zoonotic Infection)
Animals also play a substantial role as microbial reservoirs.
EXAMPLES: MODE OF TRANSMISSION:
Cat-scratch disease (Bartonella henselae) Direct (animal-to-human) transmission through a cat
bite or scratch; cat licks an open wound
Rocky Mountain spotted fever Indirect (animal-to-human) transmission through a
(Rickettsia rickettsii) bite from an infected tick (Dermacentor spp.)
Lyme disease (Borrelia burgdorferi) Indirect (animal-to-human) transmission through a
bite from an infected tick (Ixodes spp.)
Tularemia (Francisella tularensis) Indirect (animal-to-human) transmission through
handling infected animals, ingestion of contaminated
food or water, inhalation of infective aerosols, and
arthropod bites (ticks and insects)
Salmonella spp., Campylobacter spp., Indirect (animal-to-human) transmission usually through
Enterohemorrhagic E. coli (EHEC) ingestion of raw or undercooked meat, poultry or eggs
Microorganism Colonization of Host Surfaces
Internal and external body surfaces are our first lines of defense against invading pathogens.
External environment
Bacteria
Histologic layers
Sebaceous of the skin
gland
Epidermis
Dermis
Hair
follicle
Sweat gland
Subcutaneous tissue
Internal and external body surfaces are our first lines of defense against invading pathogens.
Mucus (with trapped bacteria)
External Goblet cell

environment
Epithelial lining of the mucosa

(mucous membrane)
Normal flora: microorganisms that inhabit

many surfaces of the human body (also
referred to as colonizers, normal
microbiota, and resident microflora).
Microorganism Entry, Invasion, and Dissemination
First line of defense Disruption of host’s Second line of defense

(non-specific or innate (non-specific or innate
immune responses) surface barriers immune responses)
• Phagocytosis by
(e.g., dryness of skin, trauma, monocytes, neutrophils,
needlestick injury, surgical and and macrophages
penetrating wounds, burns)
• Inflammatory response
• Physical barriers: skin • Naturally occurring

and mucous membranes (e.g., loss of stomach acidity,
antimicrobial substances
smoking, toxic gases, trauma,
• Secretions, mucus implantation of medical devices, (e.g., complement
• Reflexes malignancies, alcoholism, proteins, cytokines,
• Normal flora childbirth, overuse of antibiotics) coagulation proteins)
Second Line of Defense: Phagocytosis Three possible
outcomes:
Phagocyte Bacteria Noooooooo!
Destruction of
bacteria
Lysosome
Long-term
Phagosome
(a vesicle around an
survival of
engulfed bacteria) bacteria
Endocytosis
Phagosome
Destruction of
phagocyte
Phagosome-lysosome fusion
Second Line of Defense: Complement System
Membrane Attack Inflammation

Complex (MAC)
Phagocytosis
Cell lysis
Second Line of Defense: Inflammatory Response
Inflammatory response (inflammation): occurs when tissues are injured
by bacteria, trauma, toxins, heat, or any other cause. The damaged
cells release chemicals including histamine, bradykinin, and
prostaglandins. These chemicals cause blood vessels to leak fluid into
the tissues, causing swelling.
Blood Vessel Responses Leukocyte Responses
1. Changes in vascular 1. Recruitment of

flow and caliber leukocytes to the
sites of injury
2. Increased vascular 2. Recognition of
permeability microbes (and other
stimuli)
3. Responses of 3. Removal/destruction
lymphatic vessels of offending agents
(e.g., bacteria)
Antibody production
Third line of defense
(specific or acquired immune responses)
P
Antigen-presenting Plasma
Memory B cell
cell (macrophages, B cells
Second line B cell, dendritic
cells)
of defense B
B lymphocyte
IL-2
Presented
(breach) TH
antigen
Ingestion of
1
Interleukin-1 (IL-l): pathogen
secreted by activated
TH cell and B cell
phagocytes (Mo, | PMN) 3 activation
Interleukin-2 (IL-2):
2 Antigen
secreted by activated
presentation
TH cells
TH (helper) lymphocyte
IL-l
Pathogens: microorganisms that cause
infection or disease.
Virulence factors: the characteristics of

organisms that enable them to cause
disease, to evade host’s defenses, or to
mediate damaging effects on host cells.
Pathogenicity: refers to the organism’s

ability to cause disease. An organism of
high pathogenicity is very likely to cause
disease, whereas an organism of low
pathogenicity is much less likely to cause
infection.
Virulence: refers to the measure or degree

of pathogenicity of an organism. The
degree of severity decreases with
diminishing virulence of the microorganism.
Microbial Strategies for Surviving the Host’s Immune System
Rapid multiplication and invasion Invasion and destruction of host cells Pathogen survives unrecognized in
to complete host cell destruction involved in the immune response host cells and avoids detection by
or to increase its virulence (production of M protein, collagenase, immune system
hyaluronidase, nuclease, etc.)
???
Pathogen covers its antigens with Pathogen changes antigens so that Pathogen produces enzymes
a capsule or biofilm so that an immune system is constantly (proteases) that directly destroy
immune response is not activated fighting a primary encounter or inactivate antibodies
Toxins: these are biochemically
Microbial Toxins active substances released by
microorganisms that have a
particular effect on host cells.
Endotoxins – its presence can be detected in-vitro! Microorganisms use toxins to
establish infections and multiply
• General toxin common to almost all Gram- within the host.
negative bacteria
• Composed of lipopolysaccharide (LPS)
Exotoxins
portion of Gram-negative cell envelope • General toxin common to almost all Gram-
• Released when Gram-negative bacterial cell positive bacteria
is destroyed • Produced and released by living bacteria; do
• Effects on host include: not require bacterial death for its release
• Disruption of clotting, causing clots to • Specific toxins target specific host cells;
form throughout the body (i.e., DIC) type of toxin varies with bacterial species
• Fever • Some toxins kill host cells and some help
• Activation of complement and immune spread bacteria in tissues (e.g., enzymes)
systems • Some toxins interfere with specific cellular
• Circulatory changes that lead to activities (e.g., protein synthesis, internal
hypotension, shock, and death signaling, neuromuscular interruption, etc.)
In-vitro Test for Bacterial Endotoxins
Limulus Amebocyte Lysate (LAL) Test: an in-vitro bacterial endotoxin test that is necessary to quantify this
gram-negative bacteria within a cell wall. Performed as a lot release test, the LAL assesses medical devices
coming in contact with cerebrospinal fluid or the cardiovascular system. The bacterial endotoxin test uses the
lysate from blood cells from horseshoe crabs (Limulus polyphemus) to detect bacterial endotoxins.
Its blue blood is used in medicine to ensure that anything

that gets injected or implanted into the human body is
free of potential bacterial contamination.
Outcome of Infectious Diseases
Acute infections: infectious processes

that develop quickly.
Chronic infections: infectious processes

that develop and progress slowly,
sometimes over a period of years.
Clinical signs: are measurable indications

or physical observations, such as an
increase in body temperature (fever) or
the development of a rash or swelling.
Symptoms: are indictors as described by

the patient, such as headache, aches,
fatigue, and nausea.
Outcome of Infectious Diseases
Outcome of Infectious Diseases The signs and symptoms reflect
the stages of infection. In turn,
the stages of infection generally
reflect the stages in host-
microorganism interactions.
Controlling or clearing an
infectious process depends on
the following factors:
1. Severity of infection
(determined by host and
microbial interactions)
2.Accuracy in diagnosing the
etiologic agent (microorganism
causing the infection)
3. Whether the patient receives
appropriate treatment for
infection (depends on the
accuracy of diagnosis)
Prevention of Infectious Diseases
Preventing Transmission Break the link:
Antimicrobial therapy
• Avoid direct contact with infected persons or Decontamination
(Sterilization, Disinfection)
body fluids; wear appropriate PPE
• Block the spread of airborne microorganisms Susceptible
Host Reservoir
• Use sterile medical techniques Break the link:
Break the link:
Immunization Engineering controls
Recognition of high-risk patients Decontamination
Controlling Microbial Reservoirs Treatment Agent Water treatment
• Sanitation and disinfection
• Sewage treatment
• Food preservation Break the link: Mode of Break the link:
Aseptic technique Hand hygiene
• Water treatment Hand hygiene Transmission Control of excretions
• Control of pests and insect vector populations Use of PPE and secretions
Waste disposal
Portal of Portal of
Minimizing Risk Before or Shortly After Exposure Entry Exit
• Immunization or vaccination Break the link:
Engineering controls
• Cleansing and use of antiseptics Hand hygiene
• Prophylactic use of antimicrobial agents Use of PPE
Coverage
General Concepts for Specimen Collection and Handling
• Appropriate Collection Techniques
• Specimen Transport Conditions
• Common Sample Types and Their Primary Plating Media
Principles of Bacterial Cultivation
• Purpose of Bacterial Cultivation
• Nutritional and Oxygenation Requirements
Types of Microbiological Media
• Classification According to Physical State or Consistency
• Classification According to Chemical Composition
• Classification According to Functional Use or Application
Learning Outcomes
1. Define terminologies related to the topic;
2. Define bacterial cultivation and state its three main important purposes;
3. List the environmental conditions that are crucial in supporting bacterial in-vitro
growth and explain how each factor is controlled and monitored;
4. Describe the oxygenation states (atmospheric conditions) associated with
anaerobic, facultative anaerobic, capnophilic, aerobic, and microaerophilic
organisms;
5. Define and differentiate the different classifications of culture media according
to consistency, chemical composition, and functional use;
6. Explain the biochemical principles for each type of culture medium;
7. Explain the most common bacterial streaking technique, the principle associated
with the technique, and how colonies are enumerated using this technique; and
8. Identify the key criteria used in characterizing and reporting bacterial culture
growth pertaining to the phenotypic results.
Appropriate Collection Techniques: *Information should include:

1. Safety considerations
1. Specimens should be collected during 2. Selection of appropriate anatomic
the acute (early) phase of an illness. site and specimen
2. Specimens should be collected before 3. Collection instructions, including
type of swab or transport medium
antibiotics are administered. 4. Transportation conditions, including
3. Specimen collection must be performed time and temperature
by a trained laboratory personnel or 5. Labeling instructions, including
healthcare worker patient information (with at least
4. Optimal sample collection and two [2] patient identifiers)
6. Special instructions such as patient
transportation techniques should be preparation
strictly followed 7. Sterile versus non-sterile collection
5. A sample collection manual* should be devices
provided to doctors and nursing staff 8. Minimal acceptable quality
Specimen Transport Conditions:

Ideally, clinical specimens should be
All primary specimen containers
transported to the laboratory within
should be leak-proof (e.g., screw-
2 hours of collection; refrigerated
cap containers); resealable plastic
(4°C, up to 24 hours) if delay in
bags (secondary container)
processing is anticipated
Dela Cruz, Juan Dereccion

12-25-1990 31 M
316
Dr. Santos
Urine C/S 08-17-21 @7AM
Specimen containers should be properly

labeled and should match with the Bags and other secondary containers
information on the requisition form should be marked with a biohazard label
Rejection of Unacceptable Samples:
1. Improper labeling of the specimen container
2. Incorrect transport conditions (e.g., temperature)
3. Incorrect transport medium (e.g., anaerobic samples collected in aerobic
transport conditions)
4. Quantity of the samples is insufficient (QNS – quantity not sufficient)
5. Leaking containers and contaminated container exterior
6. Improperly preservation or delay in transporting (>2 hours from collection)
7. Specimen received in a fixative solution (e.g., formalin, alcohol, etc.)
8. Improper collection techniques for anaerobic culture (e.g., collection of samples
from anatomical sites known to have anaerobes as resident microflora)
9. Specimen is dried
10. Processing the specimen would produce information of questionable medical
value (e.g., Foley catheter tip)
Specimen Processing: Critical Samples
1. Critical sample types must be given When multiple samples arrive at the
priority; process these specimens same time, the following critical
immediately as they arrive in the lab samples must be given priority and
processed immediately:
2. Acid-fast bacilli (AFB-DSSM), viral, and 1. Cerebrospinal fluid (CSF)
2. Tissue
fungal specimens are usually processed in
3. Blood
batches
4. Sterile fluids
3. QNS samples received, but with multiple

test requests: call the physician and ask Can be saved for later:
which test(s) should be prioritized  1. Urine
agreements between lab staff and nurses 2. Respiratory samples
or doctors must be properly documented to 3. Stool
ensure proper follow-up 4. Wound / abscess
Selection of Primary Culture Media
1. Selection of media to inoculate for any given

specimen is usually based on the organisms
most likely to be involved in the disease process.
2. Selected media should support the growth of the

organisms most likely to be involved in the
disease process.
3. When a specimen is to be collected from a

source likely to be contaminated with resident
microflora, the addition of a selective medium to
the current setup is recommended for optimum
recovery of pathogens and suppression of normal
flora (e.g., MacConkey agar [MAC], Columbia
agar with colistin and nalidixic acid [CNA])
Common Sample Types and Their Primary Plating Media
Principles of Bacterial Cultivation
Three main purposes: Nutritional Requirements:
1. To grow and isolate all bacteria present
in a clinical specimen
2. To determine which of the bacteria

that grow are most likely causing
infection and which are likely
contaminants or colonizers
3. To obtain sufficient growth of clinically

relevant bacteria to allow identification,
characterization, and susceptibility
testing
Types of Microbiological Culture Media
Chemical Composition Physical Nature Functional Use

• Liquid Media • Enriched Media
• Simple (Basal) Media
• Semi-solid Media • Nutritive Media
• Defined (Synthetic) Media
• Solid Media • Selective and Enrichment
• Complex Media Media
• Biphasic Media
• Differential Media
• Transport Media
• Anaerobic Media
Classification According to Chemical Composition:
Simple Medium: also called basal or general-purpose Examples: peptone water,
media; supports the growth of most non-fastidious nutrient broth, and nutrient
bacteria; generally used for primary isolation of agar
microorganisms.
Chemically Defined Medium: also called synthetic Examples: glucose salt broth,
media; is a medium in which all the chemicals used inorganic synthetic broth
are known; no yeast, animal, or plant tissue is
present.
Complex Medium: usually contain complex materials Examples: nutrient broth/agar with
of biological origin such as blood or milk or yeast supplements (plant, yeast, or
extract or beef extract, the exact chemical animal tissue), tryptic soy
composition is not specific or undetermined. broth/agar, blood agar
Classification According to Physical Nature (Consistency):
Liquid Medium: also called broth medium; contain Examples: nutrient broth,
specific amounts of nutrients but don’t have a trace tryptic soy broth, MR-VP broth,
of gelling or solidifying agents such as gelatin or tryptone broth, lauryl tryptose
agar. Broth medium serves various purposes such as broth, lactose broth, brilliant
propagation of a large number of organisms, green lactose bile broth, sodium
fermentation studies, and various other tests. polyanetholsulfonate (SPS)
Semi-solid Medium: is prepared with agar at Examples: nutrient broth

concentrations of 0.5% or less. Semi-solid medium containing 0.5% agar,
has a soft custard-like consistency and is useful for thioglycollate medium, sulfide-
the cultivation of microaerophilic bacteria or for the indole-motility (SIM) medium,
determination of bacterial motility. cystine trypticase agar
Classification According to Physical Nature (Consistency):
Solid Medium: contains agar at a concentration of Examples: blood agar, chocolate
1.5-2.0%. Solid medium has a physical structure agar, nutrient agar, MacConkey
and allows bacteria to grow in physically informative agar, triple-sugar iron agar, etc.
or useful ways (e.g. as colonies or in streaks). Solid
medium is useful for isolating bacteria or for
determining the colony characteristics of the isolate.
Biphasic Medium: is called so because of containing Examples: Castaneda blood

medium both solid and liquid states in a single culture medium, Brucella
bottle. Used mainly for minimizing contamination biphasic medium, Middlebrook
and spread of infections. It applies to cultures of biphasic medium
highly infectious agents like Brucella and
Mycobacterium.
Classification According to Functional Use:
Enriched Medium: addition of extra nutrients in the Examples: Blood agar (BA),
form of blood, serum, egg yolk, etc., to the basal chocolate agar (aka lysed BA or
medium makes an enriched medium. Enriched media heated BA, Loeffler’s serum
are used to grow nutritionally exacting (fastidious) slope
bacteria.
Nutritive Medium: also called supportive media; Examples: tryptic soy agar,
contain nutrients that support growth of most non- nutrient agar, Saboraud’s
fastidious organisms without giving any particular dextrose agar (for fungi)
organism a growth advantage.
Selective and Enrichment Medium: designed to Examples: buffered charcoal
inhibit unwanted commensal or contaminating yeast extract agar, Thayer
bacteria and help to recover pathogens from a Martin agar, mannitol salt agar,
mixture of bacteria. While selective media are agar- MacConkey agar, Lowenstein-
based, enrichment media are liquid in consistency. Jensen medium, thiosulfate-
Both these media serve the same purpose. citrate-bile salt-sucrose agar
Differential Medium: are designed in such a way Examples: mannitol salt agar,
that different bacteria can be recognized on the blood agar, MacConkey agar,
basis of their colony color. Various approaches thiosulfate-citrate-bile salt-
include incorporation of dyes, metabolic substrates, sucrose agar, Simmons citrate
etc., so that those bacteria that utilize them appear agar, oxidation-fermentation
as differently colored colonies. (OF) medium, etc.
Transport Medium: clinical specimens must be Examples:
transported to the laboratory immediately after Amie's transport medium
collection to prevent overgrowth of contaminating Stuart's transport medium
organisms or commensals and maintain the viability Cary Blair transport medium
of the potential pathogens. This can be achieved by Sach’s buffered glycerol saline
using transport media. Such media prevent drying Pike’s medium
(desiccation) of a specimen, maintain the pathogen
to commensal ratio, and inhibit the overgrowth of
unwanted bacteria.
Anaerobic Medium: special media designed for Examples: thioglycollate broth,

anaerobic bacteria, which need need low oxygen Robertson cooked meat (RCM)
content, reduced oxidation-reduction potential, and medium, etc.
extra nutrients.
Examples of Microbiological Culture Media
Blood Agar
Classification: Enriched and Differential
Purpose: general-purpose (non-selective)solid medium for the cultivation of
fastidious and non-fastidious microorganisms and for determination of
hemolytic reactions; usually prepared from tryptic soy agar or Columbia
agar as the basal media, supplied with 5% sheep or human blood
Uninoculated Beta-hemolytic Alpha-hemolytic Gamma-hemolytic

Chocolate Agar (Heated or Lysed Blood Agar)
Classification: Enriched
Purpose: general-purpose (non-selective) solid medium for the cultivation of non-
fastidious and fastidious microorganisms (such as Haemophilus spp.,
Brucella spp., and pathogenic Neisseria spp.)
Uninoculated Growth after 24-48 hours of incubation

MacConkey Agar
Classification: Selective and Differential
Purpose: designed to isolate and differentiate enteric bacteria based on their
ability to ferment lactose.
Principle: Lactose provides a source of fermentable carbohydrate, allowing for

differentiation. Neutral red is a pH indicator that turns red at a pH
below 6.8 and is colorless at any pH greater than 6.8. Organisms that
ferment lactose and thereby produce an acidic environment will appear
pink because of the neutral red turning red. Bile salts may also
precipitate out of the media surrounding the growth of fermenters
because of the change in pH. Non-fermenters will produce normally-
colored or colorless colonies.
MacConkey Agar
Classification: Selective and Differential
Purpose: designed to isolate and differentiate enteric bacteria based on their
ability to ferment lactose.
Uninoculated Lactose-fermenter Non-lactose-fermenter

(pink colonies) (colorless colonies)
Thioglycollate Broth
Classification: Enriched, Anaerobic, and Differential
Purpose: The fluid thioglycollate medium is used to test for aerotolerance of
microorganisms. It contains sodium thioglycollate, which helps gets rid of
oxygen; resazurin, an indicator that is pink when exposed to oxygen; and
nutrients necessary for growth.
Principle: Pancreatic digest of casein, soy broth, and glucose enrich growth of most
microorganisms; includes reducing agents thioglycollate, cystine, and
sodium sulfite; semi-solid medium with a low concentration of agar,
reducing the oxygen diffusion in the medium
Triple Sugar Iron (TSI) Agar
Classification: Differential
Purpose: The triple sugar iron medium is used to differentiate organisms based on
their ability to metabolize glucose, lactose, and sucrose in either aerobic
or anaerobic conditions.
Principle: Ferrous sulfate creates a black precipitate when the organism produces
hydrogen sulfide. Lactose or sucrose-fermenting organisms turn the slant
and butt portions yellow. Organisms that can only ferment glucose turn
the slant red and the but yellow.
Oxidation-Fermentation (OF) Medium
Classification: Differential
Purpose: Whether an organism is oxidative or fermentative can be determined by
using Hugh and Leifson’s medium, commonly called as OF medium which
contain tryptone and bromothymol blue (an indicator). One of the
sugars, such as glucose, xylose, mannitol, lactose, sucrose, and maltose is
added to the medium which serves as the fermentable carbohydrate.
Principle: The oxidative-fermentative test determines if certain gram-negative rods

metabolize glucose by fermentation (anerobically) or aerobic respiration
(oxidatively). During the anaerobic process of fermentation, pyruvate is
converted to a variety of mixed acids depending on the type of
fermentation. The high concentration of acid produced during
fermentation will turn the bromthymol blue indicator in OF media from
green to yellow in the presence or absence of oxygen .
Streaking Technique
Gram Staining: Review It separates bacteria into
two large groups (Gram-
Gram-positive Step Gram-negative positive and Gram-negative)
based on their different cell
Flame wall constituents.
1 (heat fixation)
Crystal Violet
2 (primary stain)
3 Gram’s Iodine
(mordant)
Acetone-alcohol
4 (decolorizer)
Safranin
5 (counterstain)
Review of Bacterial Morphology
Three Basic Shapes of Bacteria
Round Rod Curved

(coccus) (bacillus)
Cocci in pairs Cocci in chains Cocci in fours
(diplococcus) (streptococcus) (tetrad, quartet)
Round
(coccus)
Cocci in clusters Cocci in cuboidal

(staphylococcus) packets of eight
(sarcina, octet)
Gram-Positive Cocci
 Gram-positive cocci are those that
stain positive with the Gram staining
method (purple color)
 The peptidoglycan layer is
substantially thicker in Gram-positive
bacteria
 Common isolates in the clinical
microbiology laboratory
 Most Gram-positive cocci are
members of the indigenous microbiota
(normal flora)
 Some species are pathogenic
(disease-causing)
Gram-Positive Cocci
The catalase test is
 They are initially differentiated by the used to differentiate
staphylococci (+) from
catalase test. streptococci (–).
 This test determines the presence of the enzyme
catalase
 Catalase is an enzyme that breaks down the
harmful substance, hydrogen peroxide, into water
and oxygen.
 If an organism can produce catalase, it will
produce bubbles of oxygen when 3% hydrogen
peroxide is added to it.
 Positive result: effervescence
 Catalase-positive: Staphylococcus spp.
 Catalase-negative: Streptococcus spp.
Gram-Positive Cocci
 The catalase enzyme is a significant

virulence factor (disease-causing
factor) for the Staphylococcus spp.
 Staphylococcal catalase protects

intra-phagocytic microbes by
destroying hydrogen peroxide produced
by the phagocyte
 The catalase test detects the

presence of this enzyme
Gram-Positive Cocci
A positive catalase
test is indicated by
effervescence
 Positive result: effervescence or formation of bubbles

 Catalase-positive: Staphylococcus spp.
 Catalase-negative: Streptococcus spp.
Gram-Positive Cocci
Important!
 The test organisms should not be taken from
blood agar culture.
Staphylococcus aureus  Human red blood cells contain catalase and
cultivated on Mannitol their presence will give a false-positive test.
Salt Agar  Culture should be 18 to 24 hours old.
 Hydrogen peroxide must be fresh as it is very
unstable.
Reaction Principle:
Staphylococcus aureus
cultivated on Sheep catalase
2H2O2 2H2O + O2 (gas)
Blood Agar (showing
beta-hemolytic pattern
/ clear zone around
the colonies)
Genera to be Considered
 Staphylococcus aureus (coagulase-positive)

 Coagulase-negative staphylococci (most common ones)
• Staphylococcus epidermidis
• Staphylococcus saprophyticus
• Staphylococcus haemolyticus
• Staphylococcus lugdunensis
 Micrococcus spp.
 Rothia, Aerococcus, Alloiococcus spp.
Staphylococcus spp.
 Gram-positive cocci
 They produce the enzyme catalase
 Exhibit spherical shapes (0.5 to 1.5 µm) that may
appear singly, in pairs, and in clusters
 The microscopic appearance is NOT specific or
characteristic for staphylococci
 They resemble some members of the family
Micrococcaceae, such as the genus Micrococcus
Staphylococcus spp.
 They are non-motile

 They are non-spore-forming
 They may be aerobic or facultative anaerobic, except for
Staphylococcus saccharolyticus (obligate anaerobe)
 Colonies (after 18-24 hours of incubation at 37oC):
medium-sized (4-8 mm) and appear cream-colored,
white or rarely light gold, and buttery-looking
 Some are ß-hemolytic
 They are one of the most commonly isolated organisms
Reference: Tille, Patricia. (2014). Staphylococcus, Micrococcus, and Similar Organisms. Bailey & Scotts Diagnostic Microbiology,
13th Edition (page 233). St. Louis, Missouri: Elsevier-Mosby.
Staphylococcus spp.
They are initially differentiated by the coagulase test.

 This test determines the presence of the enzyme staphylocoagulase
 This enzyme is a virulence factor for Staphylococcus aureus
staphylocoagulase
Coagulase-reacting factor Coagulase-CRF complex
(in plasma)
Coagulase-CRF
Fibrinogen Fibrin (clot)
complex
 The positive result is the formation of clot in plasma

 Staphylococci that are able to produce this enzyme are called coagulase-
positive staphylococci
Staphylococcus spp.
Free, extracellular coagulase Remember!
(staphylocoagulase)
Slide = Bound
Coagulase Test Bound or cell-bound coagulase Tube = Free
(clumping factor)
Slide Tube Slide Tube

(bound coagulase) (free coagulase) (bound coagulase) (free coagulase)
Positive Coagulase Test Negative Coagulase Test

Organism: Staphylococcus aureus Organism: Staphylococcus epidermidis
Notice the formation of clot in plasma Notice the absence of clot in plasma
Staphylococcus spp.
Coagulase-positive staphylococci (CoPS):

 Staphylococcus aureus – most commonly isolated, most
virulent and clinically significant CoPS
Animal-associated species (less frequently isolated from humans):

 Staphylococcus intermedius
 Staphylococcus delphini
 Staphylococcus lutrae
 Some strains of Staphylococcus hyicus
Staphylococcus spp.
Coagulase-negative staphylococci (CoNS):

 Clinically significant and commonly recovered CoNS:
 Staphylococcus epidermidis – nosocomial infection
 Staphylococcus saprophyticus – urinary tract infection (UTI)
 Occasional isolates and can be significant pathogens:

 Staphylococcus haemolyticus – wound, septicemia (blood),
UTI, native valve infections
 Staphylococcus lugdunensis – catheter-related bacteremia and
endocarditis
Staphylococcus spp.
Coagulase as a virulence factor

Bound coagulase (clumping factor)
Fibrin capsule
Coagulase-positive
staphylococci
coagulase
Fibrin-encapsulated
staphylococci
The fibrin capsule may protect the bacterium from

Coagulase-positive staphylococci showing phagocytosis and isolate it from other defenses of the
bound coagulase (clumping factor) on the host. The fibrin coat or capsule can therefore make
bacterial cell wall. the bacteria more virulent.
 Most clinically significant species of staphylococci

 Can be recovered from almost any specimen
 An important cause of nosocomial (healthcare-acquired)
and community-acquired infections
 Associated with suppurative skin and wound infections
 Abscess filled with pus and surrounded by necrotic tissue and damaged
leukocytes
 Examples: folliculitis, furuncles (boils), carbuncles (multiple furuncles
with fever and chills), and bullous impetigo (a highly contagious
infection; larger pustules surrounded by small zone of erythema)
Staphylococcus aureus (Blood Agar Plate) Staphylococcus aureus (Gram stain)

Notice the ß-hemolytic pattern (clear zone Notice the Gram-positive spherical
around the bacterial colony) on sheep blood bacterial cells. They may appear singly, in
agar plate. Colonies are medium-sized and pairs, or in clusters.
buttery-looking.
On microscopy of Gram-stained bacterial

smears, S. aureus cells occur in grape-like
clusters, may occur singly or in pairs.
Colonies produce a golden pigment,
staphyloxanthin
MSA contains the sugar mannitol and the

pH indicator phenol red. If an organism Mannitol Salt Agar (MSA) is both
can ferment mannitol, an acidic byproduct selective and differential.
is formed that will cause the phenol red Staphylococcus spp. can tolerate a
Gram Stain in the agar to turn yellow. high-salt (7.5% NaCl) environment
Disease-Causing Factors (or Virulence Factors):
 Enzymes: catalase, staphylocoagulase, clumping factor, hyaluronidase, protease,
lipase, nuclease, fibrinolysin
 Enterotoxin B – implicated in staphylococcal food poisoning; stimulates cytokine
release and inflammation
 Toxic shock syndrome toxin-1 (TSST-1) – causes desquamation (peeling of the
skin), high fever, rash, hypotension
 Exfoliative toxin – implicated in staphylococcal scalded skin syndrome (SSSS,
Ritter’s disease); targets the protein desmoglein-1 (DG-1)
 Cytolytic toxin – lyses RBCs (hemolysin) and WBCs (leukotoxin)
 Protein A – can bind to the Fc portion of IgG antibody, blocking
opsonophagocytosis

 Coagulase
 Bound coagulase (or clumping factor) – bound to cell wall of
the bacterium
 Has the ability to stimulate clot formation in plasma
 Facilitates in the conversion of fibrinogen to fibrin in the
immediate vicinity of the bacterium as means of self-
protection  fibrin capsule  inhibits phagocytosis
 Mainly produced by S. aureus; coagulase is also produced by
other coagulase-positive staphylococci and Yersinia pestis

 Hyaluronidase
 This enzyme hydrolyzes hyaluronic acid that makes up your
connective tissues
 Damage to connective tissues will permit the spread of
bacteria during infection

 Lipase
 This enzyme is produced by both coagulase-positive and
coagulase-negative staphylococci
 Lipase acts on the lipids present on the surface of the skin,
particularly the fats and oil secreted by the sebaceous glands
 Acting together with protease and hyaluronidase, these
enzymes are capable of destroying tissue and may facilitate
the spread of infection to adjoining tissues

 Enterotoxins
 Staphylococcal enterotoxins are heat-stable exotoxins (stable at 100oC for
30 minutes)  reheating contaminated food does not prevent disease or
infection
 Cause symptoms such as vomiting and diarrhea
 Staphylococcal food poisoning is most commonly caused by enterotoxins
A, B, and D  BAD enterotoxins
 Enterotoxins B and C (sometime G and I) are associated with toxic
shock syndrome
 Enterotoxin B is associated with staphylococcal pseudomembranous
enterocolitis

 Toxic Shock Syndrome Toxin-1 (TSST-1)
 Causes nearly all cases of menstruating-associated toxic
shock syndrome
 Previously called enterotoxin F
 A superantigen that stimulates T-cell proliferation and
subsequent production of cytokines that are responsible for
the symptoms
 At low concentrations, TSST-1 causes leakage by endothelial
cells
 It is cytotoxic to these cells at higher concentrations

 Exfoliative Toxin
 Also called epidermolytic toxin
 It causes the epidermal layer of the skin to
slough off
 Associated with scalded skin syndrome (SSS),
which is sometimes referred to as Ritter
disease; it is a bullous exfoliative dermatitis
primarily in newborns and previously healthy
young children
 Also has been implicated in bullous
impetigo
Scalded skin syndrome

 Cytolytic Toxin
 An extracellular protein that affect red blood cells and white blood cells
 Hemolysins – affects red blood cells; cause hemolysis!
 Leukocidin – affects white blood cells
 S. aureus produces four (4) hemolysins: alpha-, beta-, gamma-, and
delta-hemolysin
 Beta-hemolysin (sphingomyelinase C, “hot-cold” lysin) – acts on the
sphingomyelin in the RBC plasma membrane
 Gamma-hemolysin is associated with the Panton-Valentine Leukocidin
(PVL), which is lethal to neutrophils and contributes to the invasiveness
of the organism by suppressing phagocytosis; associated with severe skin
infections, and necrotizing pneumonia
Disease-Causing Factors (or Virulence

Factors):
 Protein A
 Also identified in the cell wall of
 Its most significant role is its binding
ability to the Fc portion (crystallizable
fragment) of immunoglobulin G (IgG)
antibodies.
 Binding IgG inhibits opsonization, which
is an important step in phagocytosis and
negates the protective effect of IgG
antibody
Opsonization
Reference: Tille, Patricia. (2014). Staphylococcus, Micrococcus, and Similar Organisms. Bailey & Scotts Diagnostic Microbiology,
13th Edition (page 233). St. Louis, Missouri: Elsevier-Mosby.
Identification Scheme for Staphylococci:
Proceed to Gram staining
Gram Stain
*MSA – mannitol salt agar
Beta-hemolytic
colonies after 18-24 MSA-negative:
hours of incubation Other staphylococci
Gram-positive cocci Gram-negative
Proceed to catalase test if Gram (+)
Catalase-negative: Catalase-positive:
Streptococci Staphylococci
Proceed to coagulase test if catalase (+)
Coagulase-negative: – + Coagulase-positive: MSA-positive:

Other staphylococci Staphylococcus aureus Staphylococcus aureus
Catalase-negative: Catalase-positive:
Streptococci Staphylococci
Proceed to coagulase test if catalase (+)
– +
Coagulase-negative: Coagulase-positive:
Other staphylococci Staphylococcus aureus
Proceed to novobiocin sensitivity test if

coagulase-negative
Novobiocin-sensitive:
Novobiocin-resistant: S. epidermidis
S. saprophyticus S. aureus
“resistant” is indicated by a “sensitive” is indicated by the

small or absence of zone of presence of a zone of
inhibition of colonies around inhibition of colonies around
the antimicrobial disk the antimicrobial disk
Summary of the Key Tests for the Identification of the Most
Clinically Significant Staphylococcus Species Affecting Humans
Test S. aureus S. epidermidis S. saprophyticus
Gram staining Gram (+) Gram (+) Gram (+)

Colony pigment Positive Negative Negative
Staphylocoagulase Positive Negative Negative
Clumping factor Positive Negative Negative
Mannitol fermentation Positive Negative Negative
Novobiocin Sensitive Sensitive Resistant
Let’s recap! (Staphylococci)
 Staphylococcus species are considered normal flora of
the skin and mucous membranes.
 They cause disease when there is a break in the skin

integrity (e.g. wounds) or when there is traumatic
introduction or implantation of medical devices (e.g.
catheters, shunts, prosthetic devices).
 Virulence factors are produced by disease-causing

organisms such as Staphylococcus aureus. These factors
will provide protection to the organism from the natural
antimicrobial defenses of their human hosts, thereby
increasing the risk of infection.
 Gram-positive cocci are initially tested with the
catalase test
 Positive result: formation of bubbles after adding hydrogen
peroxide solution
 Catalase-positive: staphylococci (with bubbles)
 Catalase-negative: streptococci (no bubbles)
 Catalase-positive staphylococci then undergo the

slide and tube coagulase test:
 Slide coagulase: detects the presence of cell-bound
coagulase or the clumping factor
 Tube coagulase: the confirmatory test for a negative slide
coagulase test and detects the presence of the free
coagulase or the staphylocoagulase enzyme
 Staphylococci that will exhibit a positive result

with the slide and tube coagulase tests are called
coagulase-positive staphylococci
 Coagulase-positive: Staphylococcus aureus (with clot)
 Coagulase-negative: other staphylococci (no clot)
 Coagulase-negative staphylococci then undergo

the sensitivity testing with the antimicrobial
novobiocin
 Novobiocin-sensitive: S. epidermidis (growth inhibited)
 Novobiocin-resistant: S. saprophyticus (growth not inhibited)
 Inhibition of growth is indicated by a zone of inhibition of
colonies around the antimicrobial-impregnated disk
General Characteristics:
 Gram-positive (purple color)
 Microscopy: cocci pairs, short chains or in grape-like clusters
 Non-spore-forming (does not produce spores)
 Non-motile (immobile, no flagella)
 Catalase-positive (add H2O2  bubbles)
 Oxidase-negative
 Aerotolerance: facultative anaerobic (can grow with or without O2)
(except S. saccharolyticus and S. aureus subsp. anaerobius – strict
anaerobes)
 Can grow in the presence of 5%-12% NaCl (salt)
 Resistant to drying and high salt concentration
 Can grow to temperatures as high as 50oC
 Bacitracin (Taxo A)-resistant (growth not inhibited)
Methicillin-Resistant Staphylococcus aureus (MRSA)

 Hospital-acquired and community-acquired infections
 Associated with long-term hospital stay and dialysis,
presence of indwelling devices, or recent hospitalization
 They are Staphylococcus aureus strains that carry the mecA
gene, which encodes for penicillin-binding protein 2a
(PBP2a)
 Strains are resistant to penicillinase-resistant penicillin (e.g.
methicillin, oxacillin, or nafcillin) because of the production
of PBP2a, which renders beta-lactams essentially ineffective.
 The antibiotic vancomycin remains the treatment of choice
for MRSA
Staphylococci Identification Diagram
Gram-Positive Cocci
Catalase Test
Catalase-Positive Catalase-Negative
Staphylococci Streptococci
Coagulase test Growth on

Mannitol Salt
Agar (MSA)
Coagulase-Positive Coagulase-Negative
Staphylococcus aureus Other staphylococci S. aureus can grow in the
presence of salt and can utilize
Novobiocin sensitivity mannitol as energy source
S. epidermidis Novobiocin-sensitive Novobiocin-resistant S. saprophyticus

Micrococcus species
General Characteristics:
 Must be differentiated with Staphylococcus species
 Microscopy: cocci pairs, tetrads, irregular clusters (no chains)
 Size: 0.5µm by 2µm
 Non-spore-forming (does not produce spores)
 Non-motile (immobile, no flagella)
 Catalase-positive (add H2O2  bubbles)
 Oxidase-positive (add oxidase reagent  blue / purple color)
 Aerotolerance: aerobic
 Bacitracin (Taxo A)-sensitive
 Usually considered contaminants of clinical specimens; rarely
implicated as cause of infections in humans
Coverage of this lecture:
General Characteristics of Streptococcus and Enterococcus

Lancefield Classification System for Streptococcus spp.
Pathogenesis and Spectrum of Disease
Colony Morphology
Hemolytic Patterns on Blood Agar Plate
Biochemical Tests for Identification
Serologic Tests for Post-Streptococcal Sequelae
Virulence Factors of Streptococcus spp.
Appropriate Clinical Specimens for Isolation
General Characteristics
Streptococcus spp. and Enterococcus spp.

 Spherical or ovoid shape, non-motile, non-spore-forming, and
occurs in pairs (diplococci) or chains (streptococci)
 Aerotolerance: most streptococci are facultative anaerobes, and
some are obligate (strict) anaerobes
 Most require enriched media (blood agar)
 Oxidase-negative (add oxidase reagent no blue color)
 Catalase-negative (add H2O2  no bubbles)
 Many of these organisms are part of the normal human flora
(e.g., skin, genital, respiratory and digestive tract)
 Become pathogenic  organisms gain entry to sterile sites
General Characteristics
Epidemiology:
 Streptococcus pyogenes, S. pneumoniae, S. agalactiae, viridans
streptococci, Enterococcus faecalis, and Enterococcus faecium are
clinically important pathogens
 Streptococcus pneumoniae is the leading cause of bacterial pneumonia

and meningitis
 Streptococcus pyogenes, designated as the “flesh-eating bacteria,” is

associated with bacterial acute pharyngitis (strep throat) and skin
infections such as impetigo and erysipelas
 The main beta-hemolytic streptococci that cause pharyngitis are under

the Lancefield group A, C, and G
Beta Hemolytic Streptococci
Streptococcus pyogenes
 This is the most clinically

significant streptococci belonging to
the Lancefield group A
 Produces virulence factors such as

hemolysins streptolysin O and
streptolysin S  responsible for
the beta-hemolytic pattern on
blood agar plate (clear zone of
hemolysis around the colony)
Group A (beta-hemolytic) streptococci
Notice the clear zone of hemolysis around the colony
Streptolysin O Streptolysin S
 Oxygen-labile (unstable) exotoxin  Oxygen-stable exotoxin
 Broken down by oxygen  Non-immunogenic hemolysin
 Immunogenic hemolysin  Polypeptide: MW 28 amino acids
 Protein: MW of 61.5 kDa  Also capable of lysing the cell
 Capable of lysing the cell membrane of blood cells
membrane of blood cells  Can produce hemolysis in the
 e.g., erythrocytes, leukocytes, and presence of room air
platelets
 Produce hemolysis only in the
absence of oxygen Immunogen
It refers to any foreign substance capable
 It is inhibited by the presence of
of producing an immune response.
cholesterol in skin lipids
 Body cannot produce protective If a substance has the ability to induce an
antibodies associated with skin immune response, then it is considered
infections immunogenic.
Laboratory Determination of Anti-Streptolysin O (ASO)
Method: ASO Latex Agglutination
Principle: Indirect (Passive) Agglutination
ASO latex agglutination test method is based on an immunologic reaction between

streptococcal exotoxins (Streptolysin O) bound to biologically inert polystyrene latex particles
and streptococcal antibodies in the test sample. Visible agglutination occurs when increased
antibody level, are present in the test specimen.
+ YYY
Streptolysin O Patient’s serum sample
coated latex with antibodies to
Agglutination (clumping) of latex particles
particles Streptolysin O
due to immune complex formation
Types of Agglutination Reactions
Passive Agglutination requires cells or inert particles as
carriers of antigens or antibodies.
Indirect (Passive) Reverse (Passive)

Direct Agglutination Agglutination Agglutination
Cells (such as bacteria, fungus, Known soluble antigens are Specific antibodies are coated
and erythrocytes) and insoluble coated on to other cells (e.g., on to other cells (e.g.,
particulate antigens can be erythrocytes) or inert particles erythrocytes) or inert particles
directly agglutinated by their (e.g., latex, bentonite, charcoal, (e.g., latex, bentonite, charcoal,
specific antibodies. polystyrene), which act as polystyrene), which act as
passive carriers of antigens. passive carriers of antibodies.
Laboratory Determination of Anti-Streptolysin O (ASO)
Method: ASO Latex Agglutination
Principle: Indirect (Passive) Agglutination
This is a qualitative test: it only detects the Our analyte (unknown substance of
presence or absence of the analyte of interest. interest) is Anti-Streptolysin O antibodies.
Positive Result: Presence of visible

agglutination or clumping of latex
particles. It indicates the presence of
antibodies to Streptolysin O (ASO)
Negative Result: Absence of visible

agglutination or no clumping of latex
particles. It indicates the absence of
antibodies to Streptolysin O (ASO)
Beta-Hemolytic, Group A Streptococci
Virulence Factors:
 Protein F – mediates epithelial cell binding (fibronectin component)
 M protein – inhibits phagocytosis (anti-phagocytic)
 Hemolysins (Streptolysin O and S) – cause lysis of cells
 Streptokinase – activates plasminogen to plasmin
 DNAse – helps bacteria escape neutrophil extracellular traps (NETs)
 Hyaluronidase – helps bacteria penetrate into tissues
 Streptococcal pyrogenic exotoxins – mediate production of rash (i.e.
scarlet fever) or multisystem effects
 Complement C5a peptidase – destroy complement system chemotactic
factors for phagocytes
Habitat (Reservoir):
 This organism is not considered a normal flora
 Its presence in clinical samples is almost always considered clinically
significant
 It inhabits the skin and upper respiratory tract of humans
 It is carried on nasal, pharyngeal, and sometimes, anal mucosa
Mode of transmission:
 Direct contact: person to person
 Indirect contact: aerosolized droplets from coughs or sneezes
Diseases or Infections:
 Acute pharyngitis
 Impetigo, cellulitis, erysipelas
 Necrotizing fasciitis and myositis
 Bacteremia with potential for infection in
any of several organs Scarlet fever is a disease caused by
 Pneumonia Streptococcus pyogenes. The signs and
 Scarlet fever symptoms include a sore throat, fever,
 Streptococcal toxic shock syndrome headaches, swollen lymph nodes, and a
characteristic rash. The rash is red and feels
like sandpaper and the tongue may be red
and bumpy.
Post-Streptococcal Sequelae (After Streptococcal Infection):
 Rheumatic fever and PSGN are inflammatory diseases that can develop
(10-14 days after streptococcal infection) when strep throat or scarlet
fever aren't properly treated. They are not caused by the bacteria itself,
but by the body’s immune reaction to the bacteria
 Rheumatic fever – cross-reactions of antibodies produced against

streptococcal antigens and human heart tissue
 Post-streptococcal glomerulonephritis (PSGN) – deposition of antibody-

streptococcal antigen immune complexes in kidney (glomerular
basement membrane) results in damage to glomeruli
Laboratory Test for Post-Streptococcal Sequelae
 Anti-Streptolysin O (ASO) titer
 Anti-streptolysin O is the antibody made against streptolysin O, an

immunogenic, oxygen-labile streptococcal hemolytic exotoxin produced by most
strains of group A and many strains of groups C and G streptococci.
 This test helps determine whether you have had a recent streptococcal
infection with the bacteria group A, beta-hemolytic streptococci.
 It also helps diagnose complications resulting from a streptococcal infection

such as rheumatic fever or glomerulonephritis, a form of kidney disease.
Beta-Hemolytic, Group B
Streptococci
Streptococcus agalactiae
 Clinically significant streptococci

belonging to the Lancefield group B
 Infections are usually associated

with neonates and are acquired
before or during birthing process.
 It is associated with septicemia,

pneumonia, and meningitis in
newborns. Group B (beta-hemolytic) streptococci
Notice the clear zone of hemolysis around the colony
Beta-Hemolytic, Group B Streptococci
 Normal flora of the female genital tract and lower gastrointestinal
tract
 Occasional colonizer of the upper respiratory tract
 Some endogenous strains cause disease if they gain access to sterile
sites
Mode of transmission:
 Direct contact: person to person from mother in-utero or during
delivery
 Nosocomial transmission by unwashed hands of mother or healthcare
personnel
Beta-Hemolytic, Group B Streptococci
Virulence Factor:
 Capsular material interferes with the phagocytic activity and
complement system cascade activation
 Infections in neonates often present as multisystem problems,
including sepsis, fever, meningitis, respiratory distress, lethargy, and
hypotension
 Infections in immunocompromised adults include bacteremia,
pneumonia, endocarditis, arthritis, osteomyelitis, and skin and soft
tissue infections
Beta-Hemolytic Streptococci
Lancefield Group C, F, and G Streptococci
 Normal flora of the skin, nasopharynx, gastrointestinal tract, and genital

tract; some endogenous strains may gain access to sterile sites
 Cause similar types of acute infections in adults as described for S.

pyogenes and S. agalactiae, but usually involve immunocompromised
patients; do not cause post-infection sequelae
 A notable proportion of infections caused by Lancefield group G streptococci

occur in patients with underlying malignancies
 Lancefield group C organisms occasionally have been associated with acute

pharyngitis
Lancefield Group C Streptococci
 Group C streptococci (GCS) are livestock pathogens and they often cause
zoonotic diseases in humans
 They are Gram-positive, in mostly β-hemolytic and facultative anaerobes
Organisms under this group:

 S. dysgalactiae subs. equisimilis (also under group A and G)
 S. equi subs. equi
 S. equi subs. zooepidemicus
 S. constellatus subs. pharyngis
Lancefield Group F Streptococci
 Group F streptococci are part of the oropharyngeal, bowel, and perineal flora
 Group F β-hemolytic streptococci cause purulent disease and bacteremia in

adults. Infections with these organisms are rare in previously healthy
children.
 Produce minute beta-hemolytic pattern on blood agar
Organism under this group:

 Streptococcus anginosus
Beta Hemolytic Streptococci
Lancefield Group G Streptococci
 Group G streptococcus (GGS) are commonly regarded as commensals usually

found in association with the normal flora of human skin, pharynx, and
intestine.
Organisms and their Reservoirs:

 S. dysgalactiae subspecies equisimilis – humans
 S. milleri – humans
 S. canis – dogs
 S. intestinalis – pigs
Streptococcus pneumoniae
 Gram-positive
 Spherical, encapsulated, lancet-
shaped bacteria
 Usually occurring in pairs
(diplococci)
 Non-motile and non-spore-forming
 Facultative anaerobic
 Produce alpha (under aerobic
conditions) or beta-hemolytic
(under anaerobic conditions)
patterns on blood agar
 Alpha-hemolytic streptococci must
be differentiated from the viridans Streptococcus pneumoniae (alpha hemolysis)
streptococci (also alpha-hemolytic) Notice the greenish zone of hemolysis around the colony
Virulence Factors:
 C polysaccharide – unrelated to the Lancefield grouping; the polysaccharide
capsule that inhibits phagocytosis (anti-phagocytic) is primary virulence factor
 Pneumolysin – has various effects on host cells: activates the classical

complement pathway and mediates suppression of the oxidative burst in
phagocytes
 Secretory IgA protease – proteolytic enzymes that cleave specific peptide bonds
in the human immunoglobulin A1 (IgA1) hinge region sequence
 Phosphorylcholine – binds receptors for platelet-activating factor in endothelial

cells, leukocytes, platelets, and tissue cells of the lungs and meninges providing
for entry and spread of the organism
 Nasopharynx
 Leading cause of bacterial meningitis and pneumonia with or without
bacteremia; also causes sinusitis and otitis media
 S. pneumoniae is capable of spreading to the lungs, paranasal sinuses, and middle ear.
In addition, this organism accesses the bloodstream and the meninges to cause acute,
purulent, and often life-threatening infections
Mode of Transmission:
 Direct contact: person to person with contaminated respiratory
secretions
Viridans group streptococci
 Gram-positive
 Catalase and coagulase-negative
 Non-motile and non-spore-forming
 Facultatively anaerobic
 Produce alpha-hemolytic pattern

(greenish) on blood agar – must be
differentiated from S. pneumoniae
(also alpha-hemolytic)
 Viridans streptococci can be

distinguished from S. pneumoniae,
by resistance to optochin and lack Viridans group streptococci (alpha hemolysis)
of bile solubility Notice the greenish zone of hemolysis around the colony
Normal Flora:
 Oral cavity, gastrointestinal tract, female genital tract
 Endogenous strains may gain access to sterile sites; most notably
results from dental manipulations
Virulence Factors:
 Generally considered to be of low virulence
 Production of extracellular complex polysaccharides (e.g., glucans and
dextrans) enhance attachment to host cell surfaces, such as cardiac
endothelial cells or tooth surfaces in the case of dental caries
 Slowly evolving (subacute) endocarditis,
particularly in patients with previously damaged
heart valves
 Bacteremia and infections of other sterile sites do

occur in immunocompromised patients
 Meningitis can develop in patients suffering

trauma or defects that allow upper respiratory
flora to gain access to the central nervous system
 Streptococcus mutans plays a key role in the

development of dental caries (tooth cavities)
Enterococcus spp.
 Formerly part of the group D streptococci
 Causes nosocomial and wound infections
Normal Flora (Reservoir):

 Humans, animals, and birds
 Gastrointestinal tract and female genitourinary tract
 Endogenous strains may gain access to sterile sites
Clinically Significant Organisms:

 Enterococcus faecalis – linked to increased virulence
 Enterococcus faecium
Enterococcus spp.
Virulence Factors:
 Antibiotic resistance
 Enterococcal surface protein – allows the bacteria to aggregate and form
bioflims
 Aggregation substance – allows the microbe to bind to target cells and it
facilitates the transfer of genetic material between cells.
 Superoxide, hydrogen peroxide, and hydroxyl radicals production
 Gelatinase and hyaluronidase – hydrolyzes peptides
 Cytosolin – is a protein found in the cytosol and lyses erythrocytes.
The enterococci are accountable for up to Enterococcus faecium has multidrug resistance
20% of all cases of infective endocarditis, characteristics. Incidence is on the rise in
with Enterococcus faecalis being the primary hospitals due to its resistance to vancomycin
causative isolate. and other antibiotics.
Nutritionally Variant
Streptococci:
Abiotrophia spp.
Granulicatella spp. S. aureus
 Normal flora of the oral cavity

 Abiotrophia spp. grow well in blood,
but fail to grow when subcultured
on conventional agar media. Satellite
 Grow as satellite colonies if the colonies
plates are streaked with S. aureus,
or if the growth medium is enriched
with vitamin B6 (pyridoxine).
 Associated with endocarditis
Abiotrophia spp. (satellitism)
Notice the small satellite colonies around the
Staphylococcus aureus colony
Culture Media of Choice
Streptococcus spp. and Enteroroccus spp.
 Organisms discussed will grow on standard laboratory media such as
nutrient and enrichment broths (e.g., thioglycollate, brain-heart infusion,
blood culture bottle), 5% sheep blood agar (BA) and chocolate agar (CA)
Abiotrophia spp. and Granulicatella spp.

 The nutritionally variant streptococci will not grow on solid media (e.g.,
BA or CA) unless you supplement these culture media with pyridoxal
(vitamin B6) or by cross-streaking the media with Staphylococcus aureus
 Liquid media (e.g., nutrient and enrichment broths) also support the
growth of these organisms
 Consider these organisms if there is no growth on solid media, but there
is growth on liquid media; and Gram-stain shows Gram-positive cocci in
chains
Culture Media of Choice
Solid Media: BA and CA Chocolate agar is composed of
heated blood agar; no chocolate
ingredient is added!
5% Sheep Blood Agar (BA) Chocolate Agar (CA)

BA is an enriched and CA is an enriched medium
differential medium
Incubation Conditions
 Most organisms in this group are facultative anaerobes with
some preferring a CO2-enriched environment.
 Laboratories typically incubate BA and CA plates in 5% to 10%

carbon dioxide (may be achieved using a candle jar) – this is
the preferred atmosphere for Streptococcus pneumoniae and
other genera discussed in this lecture.
 Beta-hemolytic patterns are enhanced when BA plates are

incubated in an anaerobic environment (may be achieved by
stabbing the inoculating loop into the agar several times.
 Oxygen-labile hemolysins (Streptolysin O) are produced in the absence
of oxygen, producing subsurface hemolysis of the BA.
Incubation Conditions
Enhanced beta-hemolysis may be

achieved by stabbing the inoculating
loop into the agar several times.
CA plates incubated inside a candle jar

Approach for Identification
Initial laboratory tests for identification:
 Gram staining: organisms under this group are Gram-positive cocci in pairs
(S. pneumoniae) or chains (others)
 Catalase test: Streptococcus, Enterococcus, and similar organisms do not
produce this enzyme, hence they test negative (catalase-negative)
 Hemolytic patterns on 5% sheep blood agar
Other biochemical tests for presumptive identification:

 PYR test: detection of PYRase enzyme
 Bile solubility test: test for clearing in the presence of bile salts
 Optochin sensitivity test: test for inhibition in the presence of optochin
 CAMP test: test for enhanced (arrowhead) hemolysis
 Hippurate hydrolysis test: test for hippuricase enzyme
Identification: Hemolytic Patterns on BA
Organism Hemolytic Pattern

Streptococcus pyogenes Beta-hemolysis
Streptococcus agalactiae Beta-hemolysis
Streptococcus pneumoniae Alpha (aerobic)
Beta (anaerobic)
Viridans streptococci Alpha-hemolysis
Enterococcus faecalis Gamma-hemolytic
Enterococcus faecium Gamma-hemolytic
TYPES OF HEMOLYTIC PATTERNS

(ON BLOOD AGAR PLATE)
Beta-hemolysis Complete hemolysis

(clear zone around colony)
Alpha-hemolysis Partial hemolysis

(green zone around colony)
Gamma-hemolysis No hemolysis
Identification: PYR Test
PURPOSE and PRINCIPLE: Organism PYR Test Result
Streptococcus pyogenes Positive
 Used for the presumptive identification or Enterococcus faecalis Positive
separation of group A ß-hemolytic Enterococcus faecium Positive
streptococci (Streptococcus pyogenes) and Streptococcus pneumoniae Positive
Streptococcus agalactiae Negative
Enterococcus spp. from other streptococci Viridans streptococci Negative
 It tests for the presence of the enzyme
called L-pyrroglutamyl-aminopeptidase that
breaks down the substrate L-pyrrolidonyl-
ß-naphthylamide (PYR) to produce ß-
naphthylamine, which is detected by the
reagent called N,N-methyl-
aminocinnamaldehyde
 Positive result: red-colored product
Identification: PYR Test
Gram-positive cocci Catalase Test
Catalase-positive: Catalase-negative:
Staphylococcus Streptococcus, Enterococcus
Beta-hemolytic streptococci Alpha-hemolytic streptococci Gamma-hemolytic streptococci

Streptococcus pyogenes (group A) Streptococcus pneumoniae Enterococcus faecalis (group D)
Streptococcus agalactiae (group B) Viridans streptococci Enterococcus faecium (group D)
Group C, F, and G streptococci
PYR Test
Organism PYR Test Result
Streptococcus pyogenes Positive
Enterococcus faecalis Positive
PYR-positive: PYR-negative: Enterococcus faecium Positive
Streptococcus pyogenes Streptococcus agalactiae (group B) Streptococcus pneumoniae Positive
(group A) Group C, F, and G streptococci Streptococcus agalactiae Negative
Viridans streptococci Negative
Identification: Bile Solubility Test
PURPOSE and PRINCIPLE: Organism Bile Solubility
Streptococcus pneumoniae Positive
 Used to differentiate Streptococcus Viridans streptococci Negative
pneumoniae [aerobic incubation: alpha Enterococcus spp. Negative
hemolysis] (positive) from alpha-hemolytic
streptococci (negative).
 Bile or a solution of bile salt (sodium
desoxycholate) rapidly lyses or dissolves
pneumococcal colonies
 Bile salts lower the surface tension
between the bacterial cell membrane and
the medium (accelerates autolytic process
of the organism)
 Positive result: colony disintegrates or lysed
by bile salt solution (clear)
(–) (+)
 Negative: intact colonies
Identification: Bile Solubility Test

Bile Solubility Test
Organism Bile Solubility

Bile solubility-positive: Bile solubility-negative: Streptococcus pneumoniae Positive
Streptococcus pneumoniae Viridans streptococci Viridans streptococci Negative
Enterococcus spp. Negative
Identification: Optochin Sensitivity Test
PURPOSE and PRINCIPLE: Organism Taxo P sensitivity
 Also called Taxo P sensitivity test Streptococcus pneumoniae Sensitive
Viridans streptococci Resistant
 Used to determine the effect of optochin Streptococcus pyogenes Resistant
(ethylhydrocupreine hydrochloride) on an Streptococcus agalactiae Resistant
organism. Enterococcus spp. Resistant
 Optochin lyses pneumococci (positive test),

but alpha-hemolytic streptococci are
resistant (negative test)
 Positive: presence of zone of inhibition
around optochin disk (>14 mm) zone of
 Negative: absence of zone of inhibition inhibition
around optochin disk (<14 mm)
 The strain is only identified as S.
pneumoniae (pneumococcus) if the result
for bile solubility is positive S. pneumoniae (alpha-hemolytic), optochin-
sensitive (notice the zone of inhibition
Identification: Optochin Sensitivity Test

Optochin (Taxo P) sensitivity
Organism Taxo P sensitivity

Optochin-sensitive: Optochin-resistant: Streptococcus pneumoniae Sensitive
Streptococcus pneumoniae Viridans streptococci Viridans streptococci Resistant
Identification: CAMP Test
PURPOSE and PRINCIPLE: Organism CAMP Test
Streptococcus agalactiae Positive
 CAMP stands for Christie-Atkins-Munch- Streptococcus pyogenes Negative
Peterson
 Used to presumptively identify group B β-
hemolytic streptococci (Streptococcus
agalactiae) based on their formation of a arrowhead
substance (CAMP factor) that enlarges or zone of beta-
enhances the area of hemolysis formed by hemolysis
the β-hemolysin elaborated from

S. aureus
Staphylococcus aureus. S. agalactiae
 Positive: enhanced hemolysis is indicated

by an arrowhead-shaped zone of beta-
S. pyogenes
hemolysis at the juncture of the two

organisms.
 Negative: no enhancement of hemolysis
Identification: CAMP Test

CAMP Test
CAMP-negative: CAMP-positive: Organism CAMP Test

Streptococcus pyogenes Streptococcus agalactiae Streptococcus agalactiae Positive
(group A) (group B) Streptococcus pyogenes Negative
Identification: Hippurate Hydrolysis Test
PURPOSE and PRINCIPLE: Organism Hippurate Hydrolysis
Streptococcus agalactiae Positive
 Hippurate hydrolysis test is used to detect Streptococcus pyogenes Negative
the ability of bacteria to hydrolyze
substrate hippurate into glycine and
benzoic acid by action of hippuricase
enzyme present in bacteria.
 It is used for the presumptive
identification of S. agalactiae (positive)
 Glycine is deaminated by the ninhydrin
reagent, which is reduced in the process.
 Positive: deep purple color indicates
hippurate has been hydrolyzed
 Negative: slightly yellow-pink or colorless
Identification: Hippurate Hydrolysis Test

Hippurate hydrolysis
Hippurate hydrolysis Hippurate hydrolysis positive: Organism Hippurate Hydrolysis

negative: Streptococcus agalactiae Streptococcus agalactiae Positive
Streptococcus pyogenes (group B) Streptococcus pyogenes Negative
(group A)
Identification: Neufeld’s Quellung Reaction
Bacterial cell
Specific
antibodies
Capsular
polysaccharide
Positive result: capsules look “swollen” and refractile

Quellung reactions are based on swelling of the
capsules surrounding individual organisms in the
presence of specific antisera and may be Clinically significant bacteria that produce polysaccharide capsule:
performed by the microscopic examination of Streptococcus pneumoniae Haemophilus infuenzae type b
cover-slipped slides with a mixture of one Streptococcus agalactiae Pseudomonas aeruginosa
loopful each of an overnight Todd-Hewitt broth
Klebsiella pneumoniae Neisseria meningitidis
culture, specific antiserum, and methylene blue
(Weisbroth and Freimer, 1969). Yersinia pestis Salmonella enterica serovar typhi
Clostridium perfringens Bacillus anthracis
Approach for Identification: Summary
• Gram-positive cocci in chains (S. pneumoniae classically diplococci)
• Catalase-negative
• Alpha- or beta-hemolytic on blood agar, depending on species (gamma reclassified as
Enterococcus)
• Bile solubility test (sodium deoxycholate) to distinguish alpha-hemolytic species:
Viridans group Strep. (bile insoluble) from S. pneumoniae (bile soluble)
• Latex agglutination card test for Lancefield serotyping of beta-hemolytic strains
• S. pneumoniae: Quellung (Neufeld's quellung [German: ‘swelling’]) reaction-positive,
optochin ("P" disc)-sensitive
• S. pyogenes: positive for PYR test (L-pyrrolidonyl-beta-naphthylamide), bacitracin-
sensitive, CAMP (Christie Atkins Munch-Petersen) test negative
• S. agalactiae: CAMP test positive, hippurate-positive
• Biochemical identification especially useful for Viridans group
• Rapid antigen detection used clinically for Group A Strep; culture is gold standard

Introduction to Clinical Microbiology: Key Concepts

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Introduction to Clinical Microbiology: Key Concepts

Uploaded by

Copyright:

Available Formats

Introduction to

• Infectious waste should be placed into two leak-

CLASS III CABINETS

BIOSAFETY LEVEL 1(BSL-1) Agents

BACTERIAL GENETICS AND METABOLISM:

BACTERIAL GENETICS AND METABOLISM:

Nomenclature Identification Classification

Binomial System Genotypic Characteristics Hierarchical

Hierarchical Classification System

GENOTYPIC CHARACTERISTICS PHENOTYPIC CHARACTERISTICS

Binomial Nomenclature (Two-Name) System:

 For the generic epithet, all names derived from

 Alternatively, the scientific name may be abbreviated Examples:

 Frequently, an informal designation may be used to Examples:

Genetics Metabolism Structure

• Bacterial nucleic acid • Fueling • Bacterial morphology

Chromosome Characteristics of Prokaryotic (Bacterial)

Parent Bacterial chromosome

4 Stages of Bacterial DNA Replication:

Initiation Uncoiling (relaxation) of supercoiled Topoisomerase II (DNA gyrase)

Breaking of hydrogen bonds Helicase

As the DNA is unzipped, Y-shaped –

A primer composed of 5-10 RNA primase (a type of RNA

Helicase unzips the double-stranded DNA

Elongation Addition of complementary DNA DNA polymerase III

Formation of phosphodiester bonds DNA ligase

TTAACAG RNA primer RNA primer

Circular chromosomes (DNA)

Bacteria are prokaryotic organisms

These microbes reproduce rapidly at

• This initial phase is characterized

• A small group of cells are placed in

• These cells increase in size, but no

STATIONARY / PLATEAU PHASE:

Precursor Metabolites Nutrients, Other Growth Requirements

• Gases: Carbon dioxide (CO2), Oxygen • Glucose-6-phosphate

Fueling products Building blocks Macromolecules Structures

Representative Viruses are

Cell wall has a

Three Basic Shapes of Bacteria

Round Rod Curved

Cocci in pairs Cocci in chains Cocci in fours

Plump rod Bacilli in pairs Bacilli in chains

General Stages of Microbial–Host Interaction

Prevention of Infectious Diseases

Bacteria and microbe encounters:

Microorganism Sources Modes of Transmission

• Horizontal Transmission: • Airborne transmission (<5 microns): droplet

Group A streptococcal pharyngitis Direct person-to-person transmission through saliva

Gonococcal urethritis (Neisseria gonorrhoeae) Direct person-to-person transmission through unsafe

Pulmonary tuberculosis Indirect transmission mainly through airborne

Mucus (with trapped bacteria)

External Goblet cell

Epithelial lining of the mucosa

Normal flora: microorganisms that inhabit

First line of defense Disruption of host’s Second line of defense

• Physical barriers: skin • Naturally occurring

Membrane Attack Inflammation

Blood Vessel Responses Leukocyte Responses

1. Changes in vascular 1. Recruitment of

Virulence factors: the characteristics of

Pathogenicity: refers to the organism’s

Virulence: refers to the measure or degree