Journal of Invertebrate Pathology 172 (2020) 107357

Contents lists available at ScienceDirect

Journal of Invertebrate Pathology

journal homepage: www.elsevier.com/locate/jip

European Foulbrood in stingless bees (Apidae: Meliponini) in Brazil: Old T

disease, renewed threat
Érica Weinstein Teixeiraa, , Eduardo Antonio Ferreirab, Cynthia Fernandes Pinto da Luzc,
⁎

Marta Fonseca Martinsd, Thiago Araújo Ramosb, Anete Pedro Lourençoe,

⁎

a
Laboratório Especializado de Sanidade Apícola (LASA)/Instituto Biológico/APTA/SAA-SP, Pindamonhangaba, SP, Brazil
b
Instituto Federal de Educação, Ciência e Tecnologia do Espírito Santo – Campus Santa Teresa, ES, Brazil
c
Instituto de Botânica, Núcleo de Pesquisa em Palinologia, São Paulo, SP, Brazil
d
EMBRAPA Gado de Leite – Laboratório de Genética Molecular, Juiz de Fora, MG, Brazil
e
Departamento de Ciências Biológicas, Universidade Federal dos Vales do Jequitinhonha e Mucuri, Diamantina, MG, Brazil

ARTICLE INFO ABSTRACT

Keywords: Stingless bees (Apidae: Meliponini) are a group of bees with vestigial stings showing a high level of social
Brood disease organization. They are important pollinators in tropical and subtropical regions, and, in the last decades,
Pathogens stingless beekeeping has increased rapidly in Brazil. Bee-collected pollen and honey of Apis mellifera can be an
Bee losses important source of disease when used as supplements to feed stingless bee colonies, a common and increasing
Melissococcus plutonius
practice adopted by stingless beekeepers. Here, we aimed to investigate the presence of pathogens commonly
Melipona
found in honey bees in diseased colonies of Melipona species in Espírito Santo and São Paulo States, Southeast
Brazil. We detected, for the first time, the bacterium Melissococcus plutonius and symptoms of European foul-
brood in Melipona spp., associated with brood death and colony losses in some cases. In addition, we tested for
the presence of the bacterium Paenibacillus larvae and the fungus Aschosphaera apis, as well as the six more
common honey bee viruses in Brazil (BQCV, ABPV, DWV, KBV, IAPV, CBPV) and the microsporidia Nosema apis
and Nosema ceranae. However, only one sample of brood was infected with N. ceranae and all other pathogens,
with the exception of Melissococcus plutonius, were absent in the analyzed brood. Lastly, we looked for toxic
pollen in all food fed to diseased colonies, but none was present.

1. Introduction managed or semi-domesticated nine species (Cortopassi-Laurino et al.,

Stingless bees (Apidae: Meliponini) are a group of bees with vesti-
gial stings showing a high level of social organization with perennial
colonies consisting of dozens to tens or hundreds of thousands of
workers (Michener, 2013). They comprise the most diverse group of
eusocial bees with more than 500 species with pantropical distribution
(Rasmussen and Cameron, 2010), and possibly 100 more species as yet
undescribed (Michener, 2013). They are ubiquitous in the tropics, their
nests sites vary widely and they are among the major pollinators of
many native and cultivated tropical plants. They are used in beekeeping
activities, especially by the inhabitants of rural areas (Vit et al., 2013;
and references therein). Stingless bee products have been used since
pre-Colombian times, when Mayan civilizations in Central America
managed Melipona species, practicing meliponiculture (stingless bee-
keeping) for food and medicine (Schuhli and Machado, 2014). In Brazil,
Kayapó Indians named and classified 34 species of stingless bees, and
2006).
Meliponini bees are important pollinators of several crops in tro-
pical and subtropical regions as they are generalist flower visitors and
can rapidly learn to exploit the resources of the introduced plants
(Heard, 1999). In Brazil, meliponiculture has increased rapidly in the
last decades, and several beekeepers have begun rearing stingless bees
as part of social and governmental projects (Cortopassi-Laurino et al.,
2006), especially colonies of Melipona spp. (Contrera et al., 2011).
Beekeeping with the Africanized honey bee Apis mellifera and stingless
bees usually occurs in the same area and both bees may share the same
plant resources. Overlapping of managed honey bees and stingless bees
allows a spillover of pathogens and parasites between them (Purkiss
and Lach, 2019). Similarly, bee-collected pollen and honey of Apis
mellifera used as supplements can be an important source of disease
(Shimanuki and Knox, 1997) when used to feed stingless bee colonies, a
common and increasing practice adopted by stingless beekeepers.

⁎
Corresponding authors.
E-mail addresses: erica@biologico.sp.gov.br (É.W. Teixeira), anete.lourenco@ufvjm.edu.br (A.P. Lourenço).

https://doi.org/10.1016/j.jip.2020.107357
Received 1 November 2019; Received in revised form 11 March 2020; Accepted 13 March 2020
Available online 19 March 2020
0022-2011/ © 2020 Elsevier Inc. All rights reserved.
É.W. Teixeira, et al.
Several pathogens and parasites have been identified in stingless
bees, among them phorid flies (Diptera: Phoridae) (Brown, 2016;
Robroek et al., 2003), the bacterium Lysinibacillus sphaericus that causes
a brood disease (Shanks et al., 2017), as well as the well-known honey
bee parasitic microsporidium Nosema ceranae (Porrini et al., 2017), and
viruses such as Acute Bee Paralysis Virus (ABPV), Deformed Wing Virus
(DWV), Black Queen Cell Virus (BQCV) and Israeli Acute Paralysis Virus
(IAPV) (Alvarez, 2018; Guzman-Novoa et al., 2016; Souza et al., 2019;
Ueira-Vieira et al., 2015).
Losses of stingless bee colonies have been reported in Brazil, but no
pathogens (viruses or bacteria) were found to be the cause of mortality
until recently (Caesar et al., 2019; Díaz et al., 2017). Here, we aimed to
investigate the presence of pathogenic bacteria common to honey bees
in diseased colonies of Melipona species in Espírito Santo and São Paulo
States, Southeast Brazil. In addition to Melissococcus plutonius, we tested
for the bacterium Paenibacillus larvae and the fungus Aschosphaera apis,
also known to affect brood, the six more common honey bee viruses in
Brazil (BQCV, ABPV, DWV, KBV, IAPV, CBPV) and the microsporidia
Nosema apis and Nosema ceranae (but see proposed Nosema genus re-
definition, Tokarev et al., 2020). Lastly, applying knowledge about
Melissopalynology, we looked for pollen that is toxic to bees in all food
of the diseased colonies.
2. Material and methods
2.1. Sampling and symptoms
Diseased colonies of Melipona ssp. were registered in two Brazilian
States (State of Espírito Santo and State of São Paulo). Disease char-
acteristics, samplings of bees and their food are described below.
2.1.1. State of Espírito Santo, Brazil
Clinical signs of brood disease (brood rot) were found in Meliponini
colonies of the meliponary (stingless bee colonies distributed in an open
and roofed area, in an orchard, Fig. 1) belonging to the Federal Institute
of Espírito Santo, in the Santa Tereza Campus (IFES-Santa Tereza),
19°48′21.5″S and 40°40′30.0″W, elevation 151 m in the district of São
João de Petrópolis, municipality of Santa Tereza, Espírito Santo, Brazil.
The meliponary consisted of 10 species of stingless bees (Table 1) and is
registered at the Brazilian Institute of the Environment and Renewable
Natural Resources (IBAMA), Brazilian Ministry of the Environment
(MMA) under Federal Technical Certificate No. 5370364. The same
disease signs were observed in two colonies in another orchard in the
municipality of Aracruz, 19°55′32.5″S and 40°08′29.9″W, elevation
24 m.
Fig. 1. Stingless bee colonies distributed in an open (A) and a roofed (B) orchard at the meliponary of the Federal Institute of Espírito Santo, in the Santa Tereza
Campus (IFES-Santa Tereza), Espírito Santo, Brazil.
2
Journal of Invertebrate Pathology 172 (2020) 107357
All colonies were inspected carefully at least once during each 15-d
period along the year. Symptoms of foulbrood disease were observed
starting in October 2018 and became more severe in June 2019 in some
colonies that did not recover naturally: young dead light to dark yellow
larvae inside the cell or outside the cell removed by workers (Fig. 2),
and dried larvae food in opened cells (Fig. 2). Consequently, the area of
young brood presented severe failure with numerous empty cells
(Fig. 2). The queen was present, but no new eggs were oviposited; the
mature brood disc (pre-pupae and pupae) was apparently normal at
first observation. With the progression of the disease, many dead ma-
ture larvae were observed, and pupae appeared decapitated, or partially
or completely removed from the brood disc (Fig. 2). Stored food was
abundant, and associated with a decrease in population. This stored
food increased the susceptibility of the colony to phorids (Pseudohypo-
cera kerteszi), a known opportunistic parasite. Characteristic acid or
sour (vinegar-like) odors were noticeable in some but not all infected
brood discs. The fermented characteristic of the stored food of stingless
bees can confuse this sensorial aspect. Bee species and number of dis-
eased and recovered colonies in the roofed and open orchard area are
listed in Table A.1, Appendices.
Brood, pollen and honey derived from the storage pots of the co-
lonies were collected in June 2019 from the following species of
stingless bees: (a) Melipona marginata Lepeletier, 1836 (common name:
Mandurí escura); (b) Melipona quadrifasciata Lepeletier, 1836 (common
name: Mandaçaia or MQA) – Santa Tereza municipality; (c) Melipona
mandacaia Smith, 1863 (common name: Mandacaia or MMS) – Santa
Tereza municipality; (d) Melipona rufiventris Lepeletier, 1836 (common
name: Uruçu amarela do Cerrado), colony I and colony II – Santa Tereza
municipality; (e) Melipona mondury Smith, 1863 (common name: Uruçu
amarela do litoral or Bugia) – Aracruz municipality; (f) Melipona com-
pressipes Fabricius, 1804 (common name: Tiúba) – Aracruz municipality.
Material used to feed stingless bees was also analyzed: Bee-pollen
powder of Apis mellifera from the Northeast of the country (Rio Grande
do Norte State; origin declared as purchased by the person responsible
in the IFES) and bee-pollen of Apis mellifera and a protein-based com-
mercial ration prepared with bee-pollen of Apis mellifera, both from the
same beekeeper from the South of the country (Santa Catarina State).
The origin of the bee-pollen of A. mellifera was declared by the stingless
beekeeper.
2.1.2. State of São Paulo, Brazil
The same symptoms were observed in another meliponary located
in downtown (23°32′28″S 46°38′30″W) São Paulo, São Paulo, Brazil.
Brood, pollen and honey derived from the storage pots of one colony of
Melipona mondury (common name: Uruçu amarela do litoral or Bugia)
É.W. Teixeira, et al. Journal of Invertebrate Pathology 172 (2020) 107357

Table 1
Species maintained in the meliponary of Federal Institute, Espírito Santo State, and their distribution in an open and roofed building, in an orchard.
Species Common name Open building Roofed building

Frieseomelitta varia (Lepeletier, 1836) Marmelada 06 –

Tetragonisca angustula (Latreille, 1811) Jataí 04 09
Scaptotrigona polysticta Moure, 1950 Benjoí 05 09
Scaptotrigona xanthotricha Moure, 1950 Mandaguari 02 –
Amarela
Scaptotrigona bipunctata (Lepeletier, 1836) Tubuna 04 –
Melipona quadrifasciata Lepeletier, 1836 Mandaçaia/MQA 07 09
Melipona marginata Lepeletier, 1836 Manduri – 04
Melipona mandacaia Smith, 1863 Mandacaia/MMS – 09
Melipona rufiventris Lepeletier, 1836 Uruçu amarela – 03
Melipona scutellaris Latreille, 1811 Uruçu nordestina 04 –
Others: Plebeia spp. and Friesella schrottkyi (Friese, 1900) Mirins 08 04

TOTAL – 40 47

UNHEALTHY COLONY UNHEALTHY COLONY HEALTHY COLONY

A B C

UNHEALTHY COLONY UNHEALTHY COLONY COLLAPSED COLONY

NEW
HEALTHY
BROOD
E
UNHEALTHY
BROOD

D F G H

Fig. 2. Broods of Melipona mandacaia Smith (MMS) and Melipona quadrifasciata Lepeletier (MQA) with symptoms of European Foulbrood in the meliponary of the
Federal Institute of Espírito Santo, in the Santa Tereza Campus (IFES-Santa Tereza), Espírito Santo, Brazil. A and B. Unhealthy colony, and brood disc of MMS, with
dead young brood (larvae) in different stages of the disease, from light yellow to dark color, and coiled stage (red arrows). C. Healthy colony, and brood disc of MMS.
D. Unhealthy colony of MMS, with dead mature brood (pupae, red arrows are pointing some of them), failed and deformed brood disc. E. Young broods (larvae) of
MMS, dead (left) and health (right). F. Mature brood (pupae) of MQA, dead (brown) and healthy (white). G. Unhealthy colony of MQA with a healthy new young
brood disc and unhealthy brood disc showing mature dead brood (red arrows). H. Collapsed colony of MQA without brood (cleaned by workers). (For interpretation
of the references to color in this figure legend, the reader is referred to the web version of this article.)

were collected in October 2019. Material used to feed the stingless bees
was also analyzed: honey of Apis mellifera, bee-pollen of A. mellifera
from the Northeast of the country (origin declared as purchased by the
stingless beekeeper) and candy bee-pollen ball prepared with the same
A. mellifera bee-pollen coated with Apis mellifera wax.
2.2. Molecular diagnosis
All molecular analyses were conducted in the Honey Bee Health
Laboratory (LASA), São Paulo, Brazil, Biological Institute of São Paulo
State Agribusiness Technology Agency. The laboratory specializes in
bee health and analyses are carried out in order to elucidate sanitary
emergencies, as in the present case, and to collaborate with the Official
Veterinary Service.
2.3. Genomic DNA extraction and PCR amplification for bacteria and fungi
detection
Genomic DNA from brood was extracted and submitted for PCR
analysis according to Teixeira et al. (2018). The primer pair used for
Melissococcus plutonius amplifies a partial sequence (272 bp) of the 16S
rDNA (Evans 2006; Teixeira et al. 2008). In the LASA’s routine, all
samples of brood are submitted to PCR multiplex as proposed by
Teixeira et al. (2018), to test for the presence of the bacteria Paeniba-
cillus larvae and M. plutonius, and the fungus Ascosphaera apis, all major
causes of honey bee brood diseases. Positive and negative controls were
used in each reaction (DNA from A. mellifera infected with each pa-
thogen and DNase-free Ambion® water, respectively). After PCR, 5 µL of
the reaction product was submitted to 2% (w/v) agarose gel electro-
phoresis, stained with SYBR SAFE® (Life Technologies, Carlsbad, EUA)

3
É.W. Teixeira, et al.
in TBE 1× (89 mM Tris base, 89 mM boric acid and 2 mM EDTA) buffer
and photographed with E-Gel Imager (Life Technologies®, Carlsbad,
EUA). The 100 bp Marker (Invitrogen®, Carlsbad, EUA) was used to
determine the fragment size.
2.4. RNA extraction, cDNA synthesis and PCR amplification for viruses
detection
All samples were tested for the six most prevalent honey bee virus in
Brazil: Black queen cell virus (BQCV), Acute bee paralysis virus (ABPV),
Deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), Kashmir
bee virus (KBV), and Chronic bee paralysis virus (CBPV). Total RNA from
brood was extracted with the QIAGEN RNAse Mini Kit (Qiagen), fol-
lowing the manufacturer’s instructions. cDNA synthesis was performed
using the enzyme Superscript II Reverse Transcriptase (Invitrogen®),
10 mM dNTP Mix (Invitrogen®), Oligo (dT) (Invitrogen®) and RNAse
OUT (Invitrogen®). BQCV, ABPV and DWV, viruses were investigated
using a triplex PCR according Teixeira et al. (2008). To detect KBV and
IAPV, and CBPV, we followed the protocols used in the LASA with
duplex and monoplex PCR reactions, respectively (with the same PCR
conditions described in Teixeira et al., 2018). In order to determine if
KBV nucleic acid was present, PCR primers were the same used by
Stoltz et al. (1995) (KBV-F: GATGAACGTCGACCTATTGAA; R- TGTGG
GTTGGCTATGAGTTCA), and for IAPV the primers used by Chen and
Evans (2007) (F- GCGGAGAATATAAGGCTCAG; R- CTTGCAAGATAA
GAAAGGGGG). For the monoplex CBPV primers were the same pro-
posed by Ribière et al. (2002) (F- AGTTGTCATGGTAACAGGATACGAG;
R-TCTAATCTTAGCACGAAAGCCGAG). Each 20 μL reaction had 10 μL
GoTaq Green MasterMix 2x (Promega®), nuclease-free water (Pro-
mega®), 1 μL DNA (concentration ranging from 14 to 4398 ng), 1 μL of
each primer 10 μM, under the following reaction conditions: dena-
turation at 94 °C for 2 min, 35 cycles of 94 °C for 30 s, 54 °C for 30 s,
72 °C for 60 s and elongation at 72 °C for 5 min. The positive controls
were DNA from A. mellifera infected with each virus provided by the
Bee Research Laboratory – USDA. In the negative control DNase-free
Ambion® water substituted the DNA. Five μL of the reaction product
were submitted to 2% (w/v) agarose gel electrophoresis, stained with
SYBR SAFE® in TBE 1X buffer (89 mM Tris base, 89 mM boric acid and
2 M EDTA), and visualized with E-Gel Imager (Life Technologies®).
2.5. DNA sequencing and analyses
The bands resulting from PCR were excised and then purified using
QIAquick Gel Extraction Kit (Qiagen), following the manufacturer’s
instructions. The DNA fragments were sequenced using BigDye®
Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City,
USA) for the reactions in an ABI 3500 Genetic Analyzer (Applied
Biosystems). The identity of each sequence was confirmed using BASTN
in the NCBI GenBank (http://www.ncbi.nlm.nih.gov). CLUSTALW 2.1
(available on https://www.genome.jp/tools-bin/clustalw) was used to
align the DNA sequences. The partial sequences of the 16S rDNA of M.
plutonius sequenced from the bee and food samples were deposited in
GenBank (accession numbers MT179730, MT179731, MT179732,
MT179733, MT179734, MT179735).
2.6. Melissopalynology of all products samples
In order to certify the botanical origin of the honey and pollen
samples and be able to detect pollen that is toxic to bees, we performed
melissopalynological analysis. For the preparation of microscopy slides,
2-mL samples of honey were defrosted and homogenized in a beaker
with a glass rod, then prepared using the classic European method
(Barth, 1989; Von Der Ohe et al., 2004). Bee pollen preparations fol-
lowed the European standard method of Louveaux et al. (1978) with a
modification by Modro et al. (2009). For the stingless bees, the amount
of pollen was smaller than 2 g due to the small amounts collected. The
4
Journal of Invertebrate Pathology 172 (2020) 107357
final sediment was mounted in permanent microscopy slides using
glycerin jelly and sealed with paraffin (Kisser, 1935 apud Erdtman,
1952). Identification of pollen was performed by comparison with the
Palynological Collection of the Palynology Research Center (NPP-IBt) of
the Botanical Institute of São Paulo using the specific bibliography. The
qualitative analysis took into consideration the pollen types identified
when it was not possible to specify genus or species from the pollen
morphology (Barth, 1989; de Klerk and Joosten, 2007; Joosten and de
Klerk, 2002). Three hundred pollen grains per sample were counted for
honey and 500 for bee pollen. The relative frequencies of pollen grains
in the honey and bee bread samples was based on internationally ac-
cepted classes, following Louveaux et al. (1978): predominant pollen
(> 45% of the total pollen contained in the honey sample), secondary
pollen (16 to 45%), important minor pollen (3 to 15%) and minor
pollen (< 3%). To determine the botanical origin of the honey, a
second relative frequency was obtained ruling out the pollen from
polliniferous and anemophilous species from the counting. The re-
sulting calculation is the frequency of pollen grains from nectariferous
species (Barth, 1989; Von Der Ohe et al., 2004). Generally, honeys with
pollen frequency above 45% of a single nectariferous species are called
monofloral/unifloral in melissopalynology, i.e., nectar mostly from a
single plant species. Furthermore, in general, honeys from flowers with
over-represented pollen grains have a higher absolute pollen content,
and only honeys containing 90% or more of pollen from these taxa are
considered monofloral (Louveaux et al., 1978). Bee pollen samples with
more than 90% of the same pollen grain type, or 60% to 90% of a pollen
type without the occurrence of secondary pollen were classified as
monofloral; the other samples were classified as heterofloral.
3. Results
3.1. Detection of bacteria Melissococcus plutonius and Paenibacillus larvae
PCR using primers for detection of the bacteria M. plutonius and P.
larvae (data not shown) resulted in amplifications only for M. plutonius
either in brood (Fig. 3) or in colony products (Fig. 4), from both States
(Espírito Santo and São Paulo). Subsequent sequencing of the amplified
partial sequence (272 bp) of the 16S rDNA of the M. plutonius matched
M. plutonius strains deposited in GenBank, with identity of 99–100%
(Figure A.1, Appendices). Alignment of the partial sequences obtained
from brood and food showed only one base of divergence (Figure A.1,
Appendices), well within the variation found for Melissococcus pluto-
nius.
DNA sequencing confirmed M. plutonius in 60% (18) of 30 samples
(brood, pollen and honey) of Melipona spp. from both States (Espírito
Santo and São Paulo) (Table 2). In Espírito Santo, M. plutonius was
detected in brood of diseased M. marginata, M. quadrifasciata, M.
mandacaia, and M. mondury hives, 57.1% (7) of brood samples
Fig. 3. Agarose gel (2% w/v) stained with SYBR® Safe of the PCR products for
detection of Melissococcus plutonius in broods of stingless bees from Espírito
Santo State, Brazil. M: 100 bp marker. Lane 1 Negative control; Lane 2 Positive
control for Melissococcus plutonius (272 bp); Lanes 3 and 4 Negative sample of
Melissococcus plutonius broods; Lanes 5, 6 and 7 M. plutonius positive results for
broods of Melipona quadrifasciata, Melipona mandacaia, and Melipona mondury.
É.W. Teixeira, et al.
Fig. 4. Agarose gel (2% w/v) stained with SYBR® Safe of the PCR products for
detection of Melissococcus plutonius in the bee-pollen powder of Apis mellifera
used to feed stingless bees and honey of stingless bees from Espírito Santo State,
Brazil. M: 100 bp marker. Lane 1 Negative control; Lane 2 Positive control for
Melissococcus plutonius (272 bp); Lane 3 Positive sample of A. mellifera bee-
pollen powder used to prepare candy bee-pollen ball to feed stingless bees
colonies; Lanes 4 and 5 Honey of Melipona rufiventris and Melipona mandacaia
positive for Melissococcus plutonius: Lane 6 M. plutonius-negative sample of
stingless bee honey.
analysed. Brood of M. rufiventris was not positive for M. plutonius al-
though this bacterium was detected in honey and pollen collected from
their pots (Table 2). M. plutonius was also detected in honey and pollen
from pots in hives of M. quadrifasciata and M. mandacaia. In the São
Paulo State samples, brood and pollen from a diseased hive of M.
mondury was infected with M. plutonius (Table 2). All samples of honey
bee pollen and/or honey used to feed stingless bees in Espírito Santo
and São Paulo States were contaminated with M. plutonius (Table 2).
Paenibacillus larvae was not detected in any of the samples.
3.2. Detection of other pathogens
While screening samples from Espírito Santo for six common honey
bee viruses in Brazil (BQCV, ABPV, DWV, KBV, IAPV, and CBPV), the
fungi Aschosphaera apis, and the microsporidia N. apis and N. ceranae,
we detected only N. ceranae in one sample of brood (Melipona mar-
ginata), which was co-infected with M. plutonius, but the other patho-
gens were absent in all broods (Table 3). BQCV was present in honey of
M. mondury and M. compressipes, and N. ceranae was present in honey of
M. compressipes and M. rufiventris, as well. Regarding the products used
to feed stingless bees in the meliponary of Espírito Santo, N. ceranae was
detected in the powder of A. mellifera bee-pollen and bee-pollen of A.
Table 2
Samples of brood, pollen and honey of stingless bees from the States of Espírito Santo and São Paulo, infected or not with Melissococcus plutonius (EFB).
SAMPLE
From each colony and Brood
species Pollen
Honey
Used to feed stingless bees Bee-pollen powder of A. mellifera (from the Noertheast, Brazil)
Bee-pollen of Apis mellifera (from the South, Brazil)
Proteic commercial ration (prepared with bee-pollen of Apis mellifera, from
the South, Brazil)
Bee-pollen of A. mellifera (from the Noertheast, Brazil)
Candy bee-pollen ball (prepared with the same bee-pollen of A. mellifera
from the Noertheast, coated with A. mellifera wax)
Honey of A. mellifera
Total positive (n)
Stingless bees species: MM: Melipona marginata; MQA: Melipona quadrifasciata; MMS: Melipona mandacaia; MC: Melipona compressipes; MRR: Melipona rufiventris;
MRM: Melipona mondury. (+) EFB positive. (−) EFB negative. (*) no samples were analyzed.
5
Journal of Invertebrate Pathology 172 (2020) 107357
mellifera. Viruses were present in these products as well: BQCV in bee-
pollen of A. mellifera and a protein-based commercial ration (prepared
with the same Apis mellifera bee-pollen from the South of Brazil) and
ABPV in the powder of A. mellifera bee-pollen (purchased from the
Northeast of the Country).
3.3. Pollen spectrum
Nine pollen types were identified in honey samples from stingless
bees with regards to family, genus and species taxa (Table A.2,
Appendices). All of them are considered nectar-providing plants. The
pollen types that showed the highest frequency in honey samples were
Eucalyptus and Mimosa caesalpiniifolia. Of the six samples analysed, four
were monofloral (samples 1B, 3B, 4B and 6B), they had greater
than 45% of a unique predominant nectariferous pollen type. One other
sample (2B) was considered monofloral also, more than 90% of pollen
was of the Mimosa caesalpiniifolia type, a polliniferous taxon. The
sample 5B was classified as heterofloral because there was < 90% of
Mimosa caesalpiniifolia pollen.
Overall, 37 pollen types were identified in the pollen samples for
stingless bees and honeybees, as well as one unidentified type.
Eleven pollen types were identified in the stingless bee pollen
samples from Espírito Santo (Table A.3, Appendices). In these sam-
ples, the pollen types that showed the highest frequency in bee pollen
samples were also Eucalyptus and Mimosa caesalpiniifolia.
Anadenanthera, Leucaena leucocephala and Myrcia pollen types con-
tributed as secondary pollen (16 to 45%) to only one bee pollen sample
each. Of the six samples analysed, one was monofloral (sample 2C),
with a unique predominant pollen type (Mimosa caesalpiniifolia). Two
other samples (5C and 6C) were considered monofloral, both pre-
dominated by Mimosa caesalpiniifolia pollen type and a very low
quantity of other pollen types (minor pollen, < 3%). Sample 4C was
classified as heterofloral because there was no predominant pollen type.
Although samples 1C and 3C showed Eucalyptus predominant pollen
type, they were also considered as heterofloral; secondary pollen (16 to
45%) from Leucaena leucocephala and Mimosa caesalpiniifolia was pre-
sent.
The Apis mellifera pollen samples from Santa Catarina showed a
heterofloral spectrum with a higher percentage of pollen grains from
Amaranthus, Bidens and Maclura. One sample (D1) was compounded
basically by starch grains, with few pollen grains (Table A.3,
Appendices).
The Apis mellifera pollen sample from Rio Grande do Norte State
corroborated its origin from the northeast of Brazil, with Cocos nucifera
(coconut) and Mimosa caesalpiniifolia pollen grains from typical plants
Espírito Santo São Paulo
MM MQA MMS MC MRR (col. MRR (col. MRM MRM
I) II)
+ + + − − − + +
− + + − + − − +
− − + − + + − −
+ *
+
+
* +
+
+
13 (24) 5 (6)
É.W. Teixeira, et al.
Table 3
Viruses in samples of brood, pollen and honey of stingless bees from the States of Espírito Santo and São Paulo.
SAMPLE
From each colony and Brood
species Pollen
Honey
Used to feed stingless bees Powder bee-pollen of A. mellifera
Bee-pollen of A. mellifera
Proteic commercial ration (prepared with bee-pollen of Apis
mellifera)
Bee-pollen of A. mellifera
Bee-pollen powder candy ball (prepared with the same bee-pollen of
A. mellifera, coated with A. mellifera wax)
Honey of A. mellifera
Stingless bees species: MM: Melipona marginata; MQA: Melipona quadrifasciata; MMS: Melipona mandacaia; MC: Melipona compressipes; MRR: Melipona rufiventris;
MRM: Melipona mondury. Black queen cell virus (BQCV), Acute bee paralysis virus (ABPV), Deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), Kashmir bee
virus (KBV), and Chronic bee paralysis virus (CBPV), and fungi Aschosphaera apis (Aa), Nosema apis (Na) and Nosema ceranae (Nc). (−) negative for all pathogens. (*) no
samples were analyzed.
from this part of the country (Table A.3, Appendices).
The set of honey and bee pollen samples from stingless bees were
represented mainly by the floral resources considered to be native or
spontaneous in the Atlantic Forest of Espírito Santo State. Leucaena
leucocephala was an exception as a plant not native to the area and
Eucalyptus was the only taxon from cultivars. Pollen or nectar from all
species of plants found in the substrates analyzed (pot-pollen, pot-
honey and A. mellifera products) used to feed the stingless bees in
Espírito Santo is not considered toxic to the bees. We did not analyze
the pollen spectrum of the bees from the São Paulo colonies.
4. Discussion
To the best of our knowledge, the only records of European
Foulbrood (EFB) are from the Apini. Because of its importance, EFB is a
disease with mandatory notification (OiE, 2019a). The OIE Manual of
diagnostic tests and vaccines for terrestrial animals (OiE, 2019b) re-
commends identification of the disease based on the identification of
the pathogenic agent by means of molecular or microbiological ana-
lyses, in addition to the presence of clinical signs. Traditional PCR is
one of the recommended options. The causative organism of EFB is the
gram-positive bacterium Melissococcus plutonius (ex White, 1912) Bailey
and Collins, 1983. The known fastidious cultural growth requirements
(Arai et al., 2013), pleomorphic nature (Shimanuki and Knox, 2000)
and secondary bacteria associated with EFB (Nakai et al., 2018;
Shimanuki and Knox, 2000), encouraged the adoption of molecular
tools for official diagnoses. Our DNA sequencing confirmed that the
band generated by PCR corresponded to M. plutonius. From 272 bp, one
base differed among the samples (Figure A.1, Appendices), suggesting
the possibility of more than one strain of M. plutonius. As far as we
know, only one isolate, ST16, was molecularly identified in Brazil from
honey bees and is similar to the Japanese atypical isolate DAT 561 (also
ST10) (Haynes et al., 2013). The first records of the disease in honey
bee hives were from Southeast (1954 in São Paulo State, 1959 in Rio de
Janeiro State), and South (1964 in Santa Catarina State) of the country
(Camargo, 1972; Message et al., 2012).
In A. mellifera, EFB affects mainly unsealed larvae, and dead larvae
turn yellowish, then brown, decompose, and become watery (Arai et al.,
2012). It is thought that all subspecies of A. mellifera are susceptible to
this disease, but different subspecies may vary in their degree of sus-
ceptibility (OiE, 2019a). This is the first report of this disease in
stingless bees, a group of tropical wild bees, in which the symptoms
were quite similar to those observed in A. mellifera (Fig. 2). All diseased
larvae analyzed were of the genus Melipona. Their nests follow a basic
pattern, with a brood chamber containing brood cells in the center of
6
Journal of Invertebrate Pathology 172 (2020) 107357
Espírito Santo São Paulo
MM MQA MMS MC MRR (col. MRR (col. MRM MRM
I) II)
Nc − − − − − − −
− − − CBPV − − BQCV Nc
− − − BQCV, Nc − Nc BQCV −
ABPV, Nc *
BQCV, Nc
BQCV, Aa
* ABPV, Nc
ABPV, Nc
−
the nest, in each of which one bee is reared. The cells are provisioned,
an egg is laid and the cell is closed without progressive feeding of the
larva (Michener, 2013). Diseased and removed brood can be observed
in these colonies (Fig. 2) as a consequence of the hygienic behavior and
worker inspection. This behavior reflects social immunity against dis-
eases and parasites in honey bees (Facchini et al., 2019) and also in
stingless bees (Toufailia et al., 2016), including bacterial-infected brood
(Danka et al., 2013).
Melissococcus plutonius was first isolated in São Paulo State, Brazil in
1966, with samples from Suzano municipality. At the time, the bac-
terium was named Streptococcus pluton, and the Brazilian isolate was
sorologically similar to English samples (Tomioka, 1966). European
Foulbrood is not considered to be a serious problem to apiculture in
Brazil. The symptoms appear sporadically in different regions, but
without serious consequences, and replacement of queens to produce
less susceptible offspring, and selection for hygienic behavior are effi-
cient means of controlling it (Message et al., 2012). The disease severely
affected honey bee colonies in the region of Alta Mogiana (Northeast of
São Paulo State) between the years of 1972–1974, and then dis-
appeared without any treatment (Machado and Lemos, 1974). In Brazil,
Africanized bees reflect decades of introgression between the European
subspecies and the introduction of the African subspecies A. mellifera
scutellata in 1956 (Kerr, 1967; Moritz et al., 2016). Probably the Afri-
canization process is involved with the decrease in disease prevalence;
since the late 1970 s, Africanized honey bees have spread across most of
the country (Moritz et al., 2016; Teixeira et al., 2008), and these bees
seem to be more resistant to pathogens and parasites (Rosenkranz et al.,
2010). Forsgren et al. (2013) showed that EFB disease in European
honey bees appears to vary in severity (e.g., in Switzerland, where the
incidence of EFB has increased dramatically since the late 1990s, and in
UK where it became the most widespread bacterial brood disease) from
being relatively benign in some areas but increasingly severe in others.
In Brazil, although no official reports were made until 2010, in the
past decade some clinical cases have emerged in Apis mellifera and now
in another group of bees (Meliponini), as described here. The disease
seems to be more virulent in stingless bees, but the outbreak circum-
stances were similar to that described for A. mellifera: bees are usually
diseased during the spring, and it is frequently associated with abrupt
changes in nectar flow (when it begins or ends suddenly) or with
stressed climatic conditions such as long period of rain or scarcity of
food sources (Morse and Flottum, 1997; Tomioka, 1967). In Brazil, the
spring season starts the last week of September, but as a tropical and
continental country (of more than eight million square kilometers)
there are substantial differences among regions. In Espírito Santo and
São Paulo States, the beginning of the spring is somewhat similar and
É.W. Teixeira, et al.
colonies begin to grow quickly in early spring, sometimes before food is
widely available. In Espírito Santo State, brood disease symptoms in
stingless bees were first observed in October 2018, but again with se-
verity in September 2019, although still present with variable evidence
(according to the species involved) during the months between. In São
Paulo State we have no details about the development of the disease,
but certainly there is no natural source of food and the bees only re-
ceived supplemental food prepared with A. mellifera products.
Perhaps the reason that symptoms of EFB in stingless bees in Brazil
have only become prevalent recently is an increase in environmental
stressors (Potts et al., 2016), from decreased natural food supply and
habitat changes to increased exposure to chemicals (Pires et al., 2016).
None of the diseased colonies were kept in areas with agrochemical
applications. One hypothesis of the bacteria spillover (in stingless bees
away from urban areas) could be related to shared food sources with A.
mellifera in the field, as has occurred with viruses and Nosema (Guzman-
Novoa et al., 2016; Purkiss and Lach, 2019; Singh et al., 2010). But this
hypothesis still needs confirmation. In the cases presented here all
diseased colonies received supplementation with contaminated A.
mellifera products and the ingestion of the bacteria and its fast multi-
plication probably did not permit the efficient and timely cleaning by
workers. There are no apiaries in downtown São Paulo or inside the
IFES-Santa Tereza Campus, ES.
It is known that M. plutonius is very resistant to adverse environ-
mental conditions (Tomioka, 1967) and can change its physiological
state to that which is advantageous for survival (Takamatsu et al.,
2017). These features can explain how it survives in A. mellifera pro-
ducts, and then infects broods of stingless bees.
Although little or nothing is known about the sanitary situation of
meliponaries in Brazil (Message et al., 2012), this is the first time that
stingless beekeepers in the two states we analyzed complained about
such sanitary problems and resorted to contacting the Official Veter-
inary Services for assistance. It is not mandatory in Brazil to check the
identity and quality of A. mellifera products for presence/absence of bee
pathogens, as the objective of the Brazilian regulations focuses on food
safety for human consumption, thus avoidance of the use of honey bee
products to feed stingless bees was suggested. The only process bee-
pollen undergoes is drying (usually by warm air, around 42 °C) and
physical removal of some debris before and after drying (Shimanuki
and Knox, 1997). Routine drying of pollen after freezing is sufficient to
avoid viable insect eggs or live mites, for example (Shimanuki and
Knox, 1997), but probably not efficacious for removal of bacteria such
as M. plutonius.
There is a considerable cost involved in the use of pollen supple-
mentation of stingless bees and sometimes stingless beekeepers, while
looking for cheaper product use also the fine powder remaining from
the process, as occurred in the Espírito Santo case.
Another interesting finding was the possible difference in the sus-
ceptibility of the species involved (Table 2). It was not possible to
analyze M. scutellaris samples because all colonies of this species col-
lapsed very quickly with the disease and subsequent attack by phorids.
Another observation was related with the location of the colony in the
IFES-ES meliponary (open and covered building, Fig. 1). In late Sep-
tember 2019, 67.6% of the colonies in the roofed building were infected
while 7.4% of the colonies of the open orchard were infected. Probably
the small distance among colonies under the same roof contributed
negatively to the fast spread of the disease (bees from one colony fre-
quently enter others). So, the distribution of colonies in an open
orchard and not so close to each other (approximately 2 m) seems to be
important in preventing the entry of sick bees into healthy colonies.
Disease symptoms were not observed in any colonies of the non-
Melipona bees Scaptotrigona, Frieseomelitta or Tetragonisca in the open or
roofed areas. It is possible that differences in colony microorganisms,
some with antibacterial effect, could be important for resisting disease
(Menezes et al., 2013).
It is important to highlight that although viruses also were present
7
Journal of Invertebrate Pathology 172 (2020) 107357
in the food and eventually in the pot-honey and pot-pollen, they were
not detected in the brood. This might be because virus transmission
benefits from vectors, such as ectoparasite Varroa destructor in A. mel-
lifera (Sumpter and Martin, 2004), but it is not necessary for virus
transmission. In fact, this parasite has not been detected in stingless
bees, although viruses are present in these bees in Brazil (Guimarães-
Cestaro et al., in press; Souza et al., 2019; Ueira-Vieira et al., 2015),
Argentine (Alvarez, 2018) and North America (Guzman-Novoa et al.,
2016).
Many aspects of disease in stingless bees, such as disease prevalence,
susceptibility, screening of the M. plutonius strains and morphological
alterations in the larval gut need to be addressed for assertive man-
agement of EFB in stingless bees. In Brazil, there is no approved
treatment in order to avoid the emergence of microorganism resistance
and the contamination of the bee products with antibiotics. Thus, we
began some experiments to explore non-specific osmotic effects on the
bacterium by exposing infected colonies to NaCl solutions in different
concentrations added to food and also applied over the colony by
sprinkling. Although very preliminary, this was effective in some ways
and concentrations, but nothing was conclusive, considering differences
in growth requirements already known about strains (Takamatsu et al.,
2013).
EFB was described nearly a century ago, but many basic aspects of
its pathogenesis are still unknown (Forsgren et al., 2013). While we
look for some answers, urgent prophylactic actions should be im-
mediately adopted including, (1) avoiding the introduction of queens,
swarms or colonies in apiaries or meliponaries without sanitary criteria,
(2) avoiding the use of contaminated vests and utensils, by disinfecting
appropriately and scorching hives and all woody material before in-
stalling new colonies, (3) eliminating old and combs suspected of being
infected, and 4) limiting the use of pollen-based supplements to sustain
meliponine colonies. There is no effective treatment and the beekeeper
must exercise judgment when feeding pollen from unknown sources, as
they are responsible for the prevention and control of EFB (Shimanuki,
1997).
5. Actions taken
Following the governmental duties and as an immediate con-
sequence of the results obtained, the Brazilian Ministry of Agriculture
(MAPA) was officially notified of the presence of M. plutonius in the
honey bee products used to feed stingless bees. More importantly, we
provided scientific evidence that EFB can infect stingless bees, and that
the consequences can be worse than those observed in Africanized
honey bees colonies, the base of the apiculture in the country. Our
research is aiding development of governmental guidelines for protec-
tion of apiculture and meliponiculture with the intention of amelior-
ating the real risk of dispersion of pathogens to susceptible species via
trade of bee products.
6. Conclusions
European Foulbrood can infect Meliponini species and appears to be
more virulent in stingless bees than in the Apini. The use of A. mellifera
products contaminated with M. plutonius to feed stingless bees poses a
real risk of transmission of the pathogen. We demonstrated the im-
portance of avoiding the use of honey bee products to feed stingless
bees.
Acknowledgements
The authors thank CNPq (Conselho Nacional do Desenvolvimento
Científico e Tecnológico) for the financial support, and Coordenadoria
de Defesa Agropecuária de São Paulo for the samplings in the munici-
pality of São Paulo. We thank Dr. Eduardo Almeida (Universidade de
São Paulo - Ribeirão Preto/SP) for stingless species identification. The
É.W. Teixeira, et al.
authors also express their sincere appreciation to Dr. Jay D. Evans for
his careful and critical reading of the manuscript.
Appendix A. Supplementary material
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.jip.2020.107357.
References
Alvarez, L.J., 2018. Detection of honey bee viruses in Argentinian stingless bees
(Hymenoptera: Apidae). Insectes Soc. 65, 191–197. https://doi.org/10.1007/s00040-
017-0587-2.
Arai, R., Miyoshi-akiyama, T., Okumura, K., Morinaga, Y., Wu, M., 2013. Development of
duplex PCR assay for detection and differentiation of typical and atypical
Melissococcus plutonius strains. J. Vet. Med. Sci. 76, 491–498. https://doi.org/10.
1292/jvms.13-0386.
Arai, R., Tominaga, K., Wu, M., Okura, M., Ito, K., Okamura, N., Onishi, H., Osaki, M.,
Sugimura, Y., Yoshiyama, M., Takamatsu, D., 2012. Diversity of Melissococcus plu-
tonius from Honeybee Larvae in Japan and Experimental Reproduction of European
Foulbrood with Cultured Atypical Isolates. PLoS One 7, e33708. https://doi.org/10.
1371/journal.pone.0033708.
Barth, O.M., 1989. O pólen no mel brasileiro. Editora Luxor, Rio de Janeiro.
Brown, B.V., 2016. Two new bee-killing flies from Brazil (Insecta: Diptera: Phoridae:
Melaloncha). Biodivers. Data J. 4. https://doi.org/10.3897/BDJ.4.e7715.
Caesar, L., Cibulski, S.P., Canal, C.W., Blochtein, B., Sattler, A., Luisa, K., 2019. The
virome of an endangered stingless bee suffering from annual mortality in southern
Brazil. J. Gen. Virol. 190907, 1–12. https://doi.org/10.1099/jgv.0.001273.
Camargo, J.M.F., 1972. Manual de apicultura. Editora Ceres, São Paulo.
Chen, Y., Evans, J.D., 2007. Historical presence of Israeli acute paralysis virus in the
United States. Am. Bee J. 147, 1027–1028.
Contrera, F., Menezes, C., Venturieri, G., 2011. New horizons on stingless beekeeping
(Apidae, Meliponini). Rev. Bras. Zootec. 40, 48–51.
Cortopassi-Laurino, M., Imperatriz-Fonseca, V., Roubik, D., Dollin, A., Heard, T., Aguilar,
I., Venturieri, G., Eardley, C., Nogueira-Neto, P., 2006. Global Meliponiculture:
challenges and opportunities 37, 275–292.
Danka, R.G., Harris, J.W., Villa, J.D., Dodds, G.E., 2013. Varying congruence of hygienic
responses to Varroa destructor and freeze-killed brood among different types of
honeybees. Apidologie 44, 447–457.
de Klerk, P., Joosten, H., 2007. The difference between pollen types and plant taxa: a plea
for clarity and scientific freedom. Eiszeitalter und Gegenwart Jahrb. der Dtsch
Quartärvereinigung 56, 162–171.
Díaz, S., Souza, S. De, Caesar, L., Blochtein, B., Sattler, A., Zuge, V., Luisa, K., 2017.
Report on the microbiota of Melipona quadrifasciata affected by a recurrent disease. J.
Invertebr. Pathol. 143, 35–39. https://doi.org/10.1016/j.jip.2016.11.012.
Erdtman, G., 1952. Pollen morphology and plant taxonomy: Angiosperms. Almqvist &
Wiksell; Chronica Botanica Co., Stockholm; Waltham, Mass.
Evans, J.D., 2006. Beepath: An ordered quantitative-PCR array for exploring honey bee
immunity and disease. J. Invertebr. Pathol. 93, 135–139. https://doi.org/10.1016/j.
jip.2006.04.004.
Facchini, E., Bijma, P., Pagnacco, G., Rizzi, R., Brascamp, E.W., 2019. Hygienic behaviour
in honeybees: a comparison of two recording methods and estimation of genetic
parameters. Apidologie 50, 163–172. https://doi.org/10.1007/s13592-018-0627-6.
Forsgren, E., Budge, G.E., Charrière, J., Hornitzky, M.A.Z., Forsgren, E., Budge, G.E.,
Charrière, J., Hornitzky, M.A.Z., 2013. Standard methods for European foulbrood
research. J. Apic. Res. 52, 1–14. https://doi.org/10.3896/IBRA.1.52.1.12.
Guimarães-Cestaro, L., Martins, M.F., Alves, M.L.T.M.F., Guidugli-Lazzarini, K.R., Nocelli,
R.C.F., Malaspina, O., Serrão, J.E., Teixeira, E.W., in press. Occurrence of virus,
microsporidia, and pesticide residues in three species of stingless bees (Apidae:
Meliponini) in the field. Sci. Nat.
Guzman-Novoa, E., Md Hamiduzzaman, M., Anguiano-Baez, R., Correa-Benítez, A.,
Castañeda-Cervantes, E., Arnold, N.I., 2016. First detection of honey bee viruses in
stingless bees in North America. J. Apic. Res. 54, 93–95. https://doi.org/10.1080/
00218839.2015.1100154.
Haynes, E., Helgason, T., Young, J.P.W., Thwaites, R., Budge, G.E., 2013. A typing scheme
for the honeybee pathogen Melissococcus plutonius allows detection of disease trans-
mission events and a study of the distribution of variants. Environ. Microbiol. Rep. 5,
525–529. https://doi.org/10.1111/1758-2229.12057.
Heard, T.A., 1999. The role of stingless bees in crop pollination. Annu. Rev. Entomol. 44,
183–206. https://doi.org/10.1146/annurev.ento.44.1.183.
Joosten, H., de Klerk, P., 2002. Whats in a name?: Some thoughts on pollen classification,
identification, and nomenclature in Quaternary palynology. Rev. Palaeobot. Palynol.
122, 29–45.
Kerr, W.E., 1967. The history of the introduction of African bees in Brazil. South African
Bee J. 39, 33–35.
Louveaux, J., Maurizio, A., Vorwohl, G., 1978. Methods of Melissopalynology. Bee World
59, 139–157.
Machado, J.O., Lemos, M.V.F., 1974. Streptococcus pluton, seu isolamento e combate nos
apiários de Igarapava, Jardinópolis e Ribeirão Preto. In: III Congresso Brasileiro de
Apicultura. Piracicaba, pp. 199–203.
Menezes, Cristiano, Vollet-Neto, Ayrton, Contrera, Felipe Andrés Felipe León, Venturieri,
Giorgio Cristino, Imperatriz-Fonseca, Vera Lucia, 2013. The role of useful micro-
organisms to stingless bees and stingless beekeeping. In: Vit, Patricia, Pedro, Silvia
8
Journal of Invertebrate Pathology 172 (2020) 107357
R.M., Roubik, David (Eds.), Pot-Honey. Springer New York, New York, NY, pp.
153–171. https://doi.org/10.1007/978-1-4614-4960-7_10.
Message, D., Teixeira, E.W., Jong, D. De, 2012. Situação da sanidade das abelhas no
Brasil. In: Imperatriz-Fonseca, V.L., Canhos, D.A.L., Alves, D.A. (Eds.), Polinizadores
No Brasil: Contribuição e Perspectivas Para a Biodiversidade, Uso Sustentável,
Conservação e Serviços Ambientais. Editora da Universidade de São Paulo, São Paulo,
pp. 237–256.
Michener, C.D., 2013. The Meliponini, in: Vit, P., Pedro, S.R.M., Roubik, D. (Eds.), Pot-
Honey: A Legacy of Stingless Bees. Springer New York, New York, NY, pp. 3–17.
https://doi.org/10.1007/978-1-4614-4960-7_1.
Modro, A.F.H., Maia, E., da Silva, I.C., da Luz, C.F.P., Message, D., 2009. Subamostragem
de pólen apícola para análise melissopalinológica. Hoehnea 36, 709–714. https://doi.
org/10.1590/S2236-89062009000400009.
Moritz, R.F.A., Härtel, S., Neumann, P., Moritz, R.F.A., Härtel, S., Neumann, P., 2016.
Global invasions of the western honeybee (Apis mellifera) and the consequences for
biodiversity. Écoscience 12, 289–301. https://doi.org/10.2980/i1195-6860-12-3-
289.1.
Morse, R.A., Flottum, K., 1997. Honey bee pests, predators, and diseases, third ed. The A.
I. Root Company, Medina, Ohio.
Nakai, Y., Ishihara, M., Arai, R., Takamatsu, D., 2018. A scientific note on improved
isolation methods for Melissococcus plutonius from diseased Apis mellifera larvae.
Apidologie 49, 459–461. https://doi.org/10.1007/s13592-018-0572-4.
OiE, 2019a. Infection of honey bees with Melissococcus plutonius (European foulbrood),
in: Terrestrial Animal Health Code (2019). OIE, Paris, pp. 1–4. https://www.oie.int/
fileadmin/Home/eng/Health_standards/tahc/current/chapitre_melissococcus_
plutonius.pdf.
OiE, 2019b. European foulbrood of honey bees (infection of honey bees with
Melissococcus plutonius), in: Manual of Diagnostic Tests and Vaccines for Terrestrial
Animals 2019. OiE, Paris, pp. 736–743. https://www.oie.int/fileadmin/Home/eng/
Health_standards/tahm/3.02.03_EUROPEAN_FOULBROOD.pdf.
Pires, C.S.S., de Mello Pereira, F., do Rêgo Lopes, M.T., Nocelli, R.C.F., Malaspina, O.,
Pettis, J.S., Teixeira, É.W., 2016. Weakness and collapse of bee colonies in Brazil: Are
there cases of CCD? Pesqui. Agropecu. Bras. 51, 422–442. https://doi.org/10.1590/
S0100-204X2016000500003.
Porrini, M.P., Porrini, L.P., Garrido, P.M., Melo, C. De, Porrini, D.P., Muller, F., Nuñez,
L.A., Alvarez, L., Iriarte, P.F., Eguaras, M.J., 2017. Nosema ceranae in South American
Native Stingless Bees and Social Wasp. Microb. Ecol. 74, 761–764. https://doi.org/
10.1007/s00248-017-0975-1.
Potts, S.G., Imperatriz-Fonseca, V., Ngo, H.T., Aizen, M.A., Biesmeijer, J.C., Breeze, T.D.,
Dicks, L.V., Garibaldi, L.A., Hill, R., Settele, J., Vanbergen, A.J., 2016. Safeguarding
pollinators and their values to human well-being. Nature 540, 220–229. https://doi.
org/10.1038/nature20588.
Purkiss, T., Lach, L., 2019. Pathogen spillover from Apis mellifera to a stingless bee. Proc.
R. Soc. B Biol. Sci. 286, 20191071. https://doi.org/10.1098/rspb.2019.1071.
Rasmussen, C., Cameron, S.A., 2010. Global stingless bee phylogeny supports ancient
divergence, vicariance, and long distance dispersal. Biol. J. Linn. Soc. 99, 206–232.
https://doi.org/10.1111/j.1095-8312.2009.01341.x.
Ribière, M., Triboulot, C., Mathieu, L., Aurières, C., Faucon, J.-P., Pépin, M., 2002.
Molecular diagnosis of chronic bee paralysis virus infection. Apidologie 33, 339–351.
https://doi.org/10.1051/apido:2002020.
Robroek, B.J.M., Jong, H. De, Arce, H., Sommeijer, M.J., 2003. The development of
Pseudohypocera kerteszi (Diptera, Phoridae), a kleptoparasite in nests of stingless
bees (Hymenoptera, Apidae) in Central America. Proc. Sect. Exp. Appl. Entomol.
Netherlands Entomol. Soc. 14, 71–74.
Rosenkranz, P., Aumeier, P., Ziegelmann, B., 2010. Biology and control of Varroa de-
structor. J. Invertebr. Pathol. 103, S96–S119. https://doi.org/10.1016/j.jip.2009.07.
016.
Schuhli, G., Machado, A., 2014. Abelhas nativas sem ferrão (Meliponini) e serviços de
polinização em espécies florestais, 1a, Edição. ed. Embrapa Florestas, Colombo.
Shanks, J., Lee, J., Mark, A., Riegler, M., Spooner-hart, R.N., 2017. First confirmed report
of a bacterial brood disease in stingless bees. J. Invertebr. Pathol. 144, 7–10. https://
doi.org/10.1016/j.jip.2017.01.004.
Shimanuki, H., 1997. Bacteria, in: Morse, R.A., Flottum, K. (Eds.), Honey Bee Pests,
Pedrators, and Diseases. The A. I. Root Company, Medina, Ohio, pp. 33–54.
Shimanuki, H., Knox, D.A., 2000. Diagnosis of Honey Bee Diseases, United States
Department of Agriculture, Handbook No. AH-690. Washington, DC.
Shimanuki, H., Knox, D.A., 1997. Bee health and international trade. Rev. Sci. Tech. Int.
Des Epizoot. 16, 172–176. https://doi.org/10.20506/rst.16.1.1008.
Singh, R., Levitt, A.L., Rajotte, E.G., Holmes, E.C., Ostiguy, N., Vanengelsdorp, D., Lipkin,
W.I., Depamphilis, C.W., Toth, A.L., Cox-Foster, D.L., 2010. RNA viruses in hyme-
nopteran pollinators: Evidence of inter-taxa virus transmission via pollen and po-
tential impact on non-Apis hymenopteran species. PLoS One 5, e14357. https://doi.
org/10.1371/journal.pone.0014357.
Souza, D., Oliveira, C., Carvalho, D., Souza, D., Oliveira, C., Carvalho, D., 2019.
Occurrence of deformed wing virus variants in the stingless Melipona subnitida and
honey Apis mellifera bee populations in North Eastern Brazil. J. Gen. Virol. 100,
289–294. https://doi.org/10.1099/jgv.0.001206.
Stoltz, D., Shen, X.-R., Boggis, C., Sisson, G., 1995. Molecular diagnosis of Kashmir bee
virus infection. J. Apic. Res. 34, 153–160. https://doi.org/10.1080/00218839.1995.
11100900.
Sumpter, D.J.T., Martin, S.J., 2004. The dynamics of virus epidemics in Varroa-infested
honey bee colonies. J. Anim. Ecol. 73, 51–63. https://doi.org/10.1111/j.1365-2656.
2004.00776.x.
Takamatsu, D., Arai, R., Miyoshi-akiyama, T., Okumura, K., Okura, M., Kirikae, T.,
Kojima, A., 2013. Identification of Mutations Involved in the Requirement of
Potassium for Growth of Typical Melissococcus plutonius Strains. Appl. Environ.
É.W. Teixeira, et al.
Microbiol. 79, 3882–3886. https://doi.org/10.1128/AEM.00598-13.
Takamatsu, D., Osawa, A., Nakamura, K., Yoshiyama, M., Okura, M., 2017. High-level
resistance of Melissococcus plutonius clonal complex 3 strains to antimicrobial activity
of royal jelly. Environ. Microbiol. Rep. 9, 562–570. https://doi.org/10.1111/1758-
2229.12590.
Teixeira, E.W., Chen, Y., Message, D., Pettis, J., Evans, J.D., 2008. Virus infections in
Brazilian honey bees. J. Invertebr. Pathol. 99, 117–119. https://doi.org/10.1016/j.
jip.2008.03.014.
Teixeira, E.W., Guimarães-cestaro, L., Luisa, M., Marques, T., Alves, F., Message, D.,
Martins, M.F., Fernandes, C., Serrão, J.E., 2018. Spores of Paenibacillus larvae,
Ascosphaera apis, Nosema ceranae and Nosema apis in bee products supervised by the
Brazilian Federal Inspection Service. Rev. Bras. Entomol. 62, 188–194. https://doi.
org/10.1016/j.rbe.2018.04.001.
Tokarev, Y.S., Huang, W.-F., Solter, L.F., Malysh, J.M., Becnel, J.J., Charles, R.V., 2020. A
formal redefinition of the genera Nosema and Vairimorpha (Microsporidia:
Nosematidae) and reassignment of species based on molecular phylogenetics. J.
Invertebr. Pathol. 169, 2–7. https://doi.org/10.1016/j.jip.2019.107279.
Journal of Invertebrate Pathology 172 (2020) 107357
Tomioka, T., 1967. Estudos sobre a resistência do Streptococcus pluton em larvas de
abelhas mortas. O Biológico. Notas e Informações. 33, 207–208.
Tomioka, T., 1966. Isolamento e identificação de Streptococcus pluton no Brasil. O
Biológico. Notas e Informações. 32, 226–227.
Toufailia, H., Alves, D.A., Bento, J.M.S., Marchini, L.C., Ratnieks, F.L.W., 2016. Hygienic
behaviour in Brazilian Stingless bees. Biol. Open 5, 1712–1718. https://doi.org/10.
1242/bio.018549.
Ueira-Vieira, C., Almeida, L.O., de Almeida, F.C., Amaral, I.M.R., Brandeburgo, M.A.M.,
Bonetti, A.M., 2015. Scientific note on the first molecular detection of the acute bee
paralysis virus in Brazilian stingless bees. Apidologie 46, 628–630. https://doi.org/
10.1007/s13592-015-0353-2.
Vit, P., Pedro, S.R.M., Roubik, D.W., 2013. Pot-Honey: A legacy of stingless bees.
Springer, New York, NY. https://doi.org/10.1007/978-1-4614-4960-7.
Von Der Ohe, W., Persano Oddo, L., Piana, M.L., Morlot, M., Martin, P., 2004.
Harmonized methods of melissopalynology. Apidologie 35, S18–S25. https://doi.
org/10.1051/apido:2004050.