elongation of po thatcatalys ond of sxowh sonal enzyme Mat yydroxy en i stent wo ee on in i ide chai in the polynucleotide chain jeg gaps Aue spunits. It plays primary role repeat | | ave been identified, These © neat hi Ly merece 7 A volfneyiee DNA), DNA poly B (the nig} omplex) and DNA polymerase thay : Tis 1. DNA polymere 7 of monon™ in by the alton. ot role He proofreading and od (exonuclease oe fe Iymerase irs Aono suit ak fo 1A polymerase 111 €2) Send id algo called i aiteerent DI tic cell, ‘ation of ™ ui polymerase cor the replica form clam polymerase), DNA polymer erendlng)- ly ivity for proof ‘exonuclease activity for pt ND CENT! CENTRAL DOGMA ANTGENETIC oofrend ana fil P med of 10-20 84 RAL DOGMA REVERSE ABOUT FORMATION 5 of genetic information The stranded MRNA sere, | Siam Be rec yk nO) Regn invSimaon tes inte fofwing direction DNA Tacit, mRNA In RNA tumour viruses where RNA is hereditary material, ON) ae on RNA Fane cease he ree FN. Pron ae DNA, mRNA i tan Be ecinton orinvese tow of ican described by D. Baltimore (1970). The flow of information can be represented as follows: NA eebion,_aRNA Sanat ee aivanelation’ “ophoteine RNA TRANSCRIPTION OF RNA Transcription is defined as the process of formation of RNA from the DNA template, Itis the led in DNA into mRNA molecule. The transcribed RNA moves copying of genetic message cod Sut of the nucleus to the ribosomes in the cytoplasm to direct protein synthesis. Necessity of Transcription synthesis of cell's specific proteins. DNA is located in the DNA contains information for the Bucleoid (in prokaryotes) or nucleus (in eukaryotes) while protein synthesis occurs in the te of protein synthesis (ribosomes) to directly guide the cytoplasm. DNA does not move to the si Process, Instead, it transfers its information to single-stranded mRNA molecules which move {0 the ribosomes to direct protein synthesis, Sites and Time of Occurrence of Transcription Transcription occurs in the nucle i Bers ponnaren ae pu during G, and G; phases of cell cycle during interphase. i9 3° direction, it is transcribed only on DNA strand. en strand (from which RNA is transcribed) i called template 5 Pang strand. Its complemen a a eee rad or sense strand or coding aan te eee Oe Sep genous bases as the RNA transer| t ie polarity: 5° 3° as the RNA. ee that in RNA T is substituted by U: ji — f bases in RNA transcribed from template strand of above DNA will be: CGUACGUACGUACGUACGUAGA ANA 2° Transeript eof RNA Synthe: NA serv, nism of RNA synthesis was worked out in late 1950s by the American investigators, y flow of He orwitz, Samuel B. Weiss and Audrey Stevens, in vitro Dpesmentn a Unit Tee ecement ‘of DNA template strand which transcribes RNA is called transcription unit It Ipise three regions: promotor region structural gene and terminator region. Region: Promotor region is located just upstream of the initiation codon of the 4g. Promoter z towards the 5’ end of coding strand. The promotor sequence of nitrogenous bases on RNA gotwal g ae he pro nice t ree Ba cic for the binding of RNA polymerase for the initiation of transcription. It also helps in the naecined sation of template and coding strands of DNA. The functional sequences in promotor region rocess of ecilled consensus sequences. These functional sequences are variants of 5 TATAAT 3° and This was ws: ‘TRANSCRIPTION START SITE PROMOTOR TEMPLATE STRAND _TERMINATEA n STRUCTURAL ENE Be ies CODING STRAND mnoves Fig, 6.25 Structure of Transcription Unit TATA box. It is known as Pribnow Box (after its discoverer David Pribnow) in s and Goldberg Hogness box in eukaryotes. ein WP Terminator Region: Terminator region is located downstream be, towards 3” end of the ee le or coding strand, It defines the end of the transcription Of structural gene. The fon sites have two or more stretches of G = C pairs arranged as inverted repeats followed ring of adenine (poly A). Gene (Transcription Unit and Gene); Structural gene is the functional unit of Tis a segment of DNA with specific sequence of nucleotides which codes for a Hn or polypeptide needed for morphological or functional trait of the cell. Benzer (1955) used. letm cistron for such a functional segment of DNA. Therefore, according to this modern ‘gene is considered a unit of function (« ‘ron), a unit of recombination (recon), a unit (muton) or a unit of regulation (operon): oa204 mewotoov-t0 = of two type The srwctural gon orleans anh wich ote ee te) tpt AUbees The gener called polycistronic genes and RNA as polycisteone RAL Titoie Te ly in prokaryotes. mRNA Tete ave fund OIVIN OKAY co nly fron peti () Monocistronic G Suich monocistronie ane tin estrone is discontinuous oF interrupted. Itis split into seve, incaryoes the message edd in citeons is diconinnoure Coing units are called egal by concede ot {crrupted or split genes by Robarg, coding units separate Hea intervening DNA segments ax introns and such gen oe 1993), The processed or mature RNA contains only the The scheme denna dep processing. Thus, transcription of an interruple gone prota the primary transcript RNA or premeavenger RNA oF Heterogeneous ANA BRU SS Minato ote erp gone. Te ancora RNA i formed by he enn ‘of introns or unwanted base sequences and the rejoining of its exons or ess ia quences. This process is called RNA splicing. Mechanism of Transcription in Prokaryotic Cells The mechanism of transcription involves following steps: 1. Activation of Ribonucleotides: The ribonucleotices present in the nucleoplasm are converted ive triphosphates by phosphorylation, ATP provides energy for phosphorylation, Recognition of Promotor Region and Binding of RNA Polymerase to Promotor Region on toplasm, the histones associated with the DNA double helix from DNA: On a signal from the the gene to be transcribed are removed, exposing the base sequence in this region of DNA. The sigma factor of RNA polymerase enzyme recognises the concensus sequence in the promoter region and enzyme RNA polymerase binds to the promotor in the template strand of the DNA double helix. The 3° ~ 5” strand of DNA functions as template. 3. Exposure of DNA Bases and Initiation of Transcription: RNA polymerase causes local unwinding and separation of two strands of DNA. The separation begins from the middle of Pribnow box and produces a transcription bubble. The separation of strands exposes the bases of DNA for initiation of transcription, 4. Base Pairing: The ribonucleotide triphosphate molecules, i.e., adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP) and uridine triphosphate (UTP) start binding to the nucleotides of template strand of DNA from the initiation point onward according to base pairing rule of Watson and Crick, This is brought about by RNA polymerase, Thus, enzyme RNA polymerase not only initiates but also causes polymerisation, ie. elongation of polynucleotide chain in 5’ ~> 3° direction, ‘ 5, Conversion of Ribonucleotide Triphosphates to Ribonucleoside Monophosphate: The various ribonucleoside triphosphates, on linking to the DNA template chain, break off their high- energy bonds, This changes them to ribonucleoside monophosphate and pyrophosphate groups (P-P) are se free. Pyrophosphate undergoes hydrolysis by the enzyme pyrophosphatase releasing energy, The first ribonucleotide triphosphate retains all the three phosphates Pyephaphaise > pe faery P~P+ HO 6. Formation and Elongation of RNA Polynucleotide Chain; With the 2 ain: With the energy so released, each ribonucleoside monophosphate joined to DNA template chain then joins the yborucleotide arrived earlier, making the RNA chain longer. The enzyme RNA polymerase catalyses Me formation of phosphodiester bonds between successive nucleotides and requires divalent ions Mg" and Mn**} 296 sc wiowoay=12 1.Three different RNA polyme! required in the transcription of three different types of RNA: (@) RNA polymerase Tt PRNAs (285, 185 and 5.85). ©) RNA polymerase II transcribes precursor of mRNA (the heterogeneous nuclear RNA hnRNA) and occurs in nucleoplasm. (RNA polymerase ILL catalyses transcription of (RNA, 55 RNA and small nuclear RNAs (snRNAs), [tis also found in nucleoplasm. 2, Eukaryotes have three different types of promoters for three different polymerases, 3.Eukaryotes have many additional ‘ranscription factors for binding of RNA polymerases to DNA. TABLE 6.11 Ditteron _ Prekaryolle T lon | 1 Prokanyone tanseripton aecurs in the oytoplasm. 2 There is no definite phase forte accurrence. 3. A single RIVA polymerase symhesises all he three types of RNA (mRNA, {FNA. ANA) 4 Coupled transcription translation isthe rule | & Intistion of trancorition does not need any | proteins or intiation factors, seribes 5. NAS are released and processed in th oytoplas 7. BINA polymerase is a complex of | 5 polpepiices | ® Transcriptional unit has one or more genes (Potyeistronic | & The mRNA primary transcript has fewer surplus nucleotides, a single primary transerpt between Prokaryotic and Eukaryotic Transcriptions: 10 | 10. The 238, 165 ana 65 rANAs are formed fram Eukaryotic transcription occurs in cee Povvabetruanoy SS ie Pou 4 MESSENGER RNA (NA Ta Fig. 6.27 Process of transcription in eukaryotes Eukaryotic Transcription 1 mucous, Takes place in the G, and > phases of eal jee Three different ANA polymerases | Il and ll synthesiso rRNA, mRNA and (RNA respectively Coupled transcription translation is nat possite. Intation of transcription requires proteins called transcription factors to recognise TATA bor These are TFIIA, TFB, TFIID, TFHE, TRUE and TFIIH NAS are released and processed in the nucleus INA polymerases are complexes of 10 to 15 polypeptiges, Transcriptional unit has only one gene. (Monoeistronic), ‘The mRNA primary transeript has a large umber of surplus nucleotides The 28S, 185, 5.8S and 5S rRNAS are formed from two primary transeripts, The originally transcribed RNA mol biologically inactive and in eukar transcripts undergo extensive chan, or post-transcriptional modifications of RNAs. 1. Larger RNA precursors are cut into smalle 2, Unwanted ribonucleotides or introns are 3. Functional regions or exons are rejoined 4. Certain nucleotides are added at the 5, Molecule may fold on itself to assume 6, Some nucleotides may be modified (Nucle ecules are called pri ryotes they have exons as wel iges to become functional. Thi: nal Processing of RNA Transcript nary transcripts or hnRNA. They are las introns, Therefore, RNA is is called processing of RNAS During RNA processing RNAs by a ribom removed by enz} in defined order by nd enzymatically (Terminal addition), Proper shape (Folding) in tRNA and tRNAs clease-P enzyme (Cleaving). 'ymes named nucleases (Splicing) 'y Ligase enzyme (Union) modification) in tRNA. and in ribomit c. Pro Eon ‘been «298 WwewreLoey-12 GENETIC CODE mine the sequence of ami -Scovery of Triplet Genetic Code nly four nitrogenous Sanco rd that since there are only roge rs ao ckinb tds, each codon should have a combination of ree nie Pa ae ey Nene (iste ze ion ard Matec Treztars ce spines ari mRNA which consid molecules of only one Hace dag was named as pelyuridylic (poly-U) molecule. The synthetic poly-U was placed in a cells’ fystem containing protein synthesising enzyme, al the twenty amino acids and necessary ATP, Sometime a small protein-ike molecule was produced which was formed by the linking a Phenylsianine, It means UUU is the codon for phenylalanine. Similaty, poly-A MRNA gives polylysine peptide chain and poly-C gives polyproline. ‘Therelore, codon-AAA was assigned for lysine and CGC to proline. Codon from DNA pelea a be defined asa triplet sequence of nitrogenous bases in mRNA copie sequcnen qrnalecile which codes fora particular amino acid, whereas the genetic exec tak of dane cualttogenous bases in mRNA molecule, which encloses the infor antique linking Of amino acids during the synthesis of protein meleculen TABLE 6.13 Codons of mRNA for different Amino acids ner ease SECOND BASE Hino Base y c [a | @ UU ps, usu ua] uauy uuc f FF | mee | vac f leek o S ‘UUA | uca p Ser | pee - UGA} Teminator § 6 | Hes (| dan roe Loe A le | | ta } Temi eu) 0 ice 01 | © cuss te cca f Pe | Ae! c cus | |cos} | Gra} Gn ry / Avy | a ee __ a AUC Fey ace aac f Asn le v J» wal fen fw | MC acc f 5 c AUG 7 Matintacy | aca] | Rak } ya AGA hg A uv] i 3 a6 | é ouC | Sou u G Gua j c cus A aT c&Cod ea particular eo 1 iy Because a particular codon 9 Genetic Code is Unambigu Bpetfle te = i 0 acid roumnent RO eae q Genetic code represents sequence of codons in id the. Iuranged inthe same linear Sequences es of polypeptide arranged in me th DNA and with amino acids in poly) tion Codons: The eam known ation codon. It marks the beginning og in the beginning ofthe esron I known a initiation codon, sete cr cnn foramino acid mathnite: In bacteria AUG eodon codes for formyimethioning, iy Siitarly the lst coon ofa eistron helps in reading the termina ation of PlyeBtidea Ce ee an ee a oics tre funcon of ae Ce lo hee etl aesear don bese hes do nol oe foray of he ano acids They signet of he nase polypeptide from the ribosome because ea m3 zo cognate tRNA that has anticodons complementary to these stop codons, The vacant ae inci ‘on ribosome is then occupied by release factor to facilitate the release, 3 ill three lette Wasm | can Non i s phenomen = Inst The initiator and terminator codons are known as signals and this pheno 107 is know | 8 punctuation, Paictuation helps in delimiting the different cistrons on a polycistronic mR ¢ Ins S. Genetic Code is Universal: It is because the same genetic code is present in all living ins organisms including viruses, bacteria, unicellular and multicellular organisms. similar! * No © De * De * De ‘The: ane & the read “ony encore ieee nucleot MORE 1 | noowe hie deletio Gen three n Import oy memby Gene Mutation and Genetic Code 2 } Gene mutation or point mutation is volt sranaton oF pont mut fon is change in the arrangement of nucleotides (substitution Ancon csually eesdieed ee ellis (frame-shift mutations) ina DNA molecule, Thisis - Shee ean tan cr be png OMA my oe | Se Effect of Substitution Mutation on Genetic Code — Sickle-cett an, ie a a By substitution mutation only one codon is chang, retule | lc codon is replaced by another nitrogenous base, Teac ae, dee, itFogenous base of a nea (©) de amino acid and may produc red cox 7 a 4 protein molecul lon may code for some aif altered protein may produce an alte le with a substi sets802 ssc mLoay- 12 4. In Animal Husbandary n anim cattes, sheep, et: have been developed ‘of burden), better yield of milk, but 5. In Industral Microbiology: In indust obtained from new strains of microorgar TRANSLATION (PROTEIN SYNTHESIS) Den es Og Ea oder of cea a a Serine hoo aaiymin at aw Material for Protein Synthesis (Translation Machinery) Following machinery and substances are required for protein synthesis: 1 Ribosomes ao protein factories act as site of translation, 2 Amino acids as raw material sbandary, mutant forms of pels, domenicg In a ning, varieties of horses and mules ee “ind eneat and better Variety of wool te Misti microbiology, new varieties ofan tyr inducing new mutations ot ay 3, mRNA as messenger, carries coded information from cistron /cistrons. 4 {RNA as adaptor for transport of amino acids 5:Enzymes: (a) Amino acid activating enzymes (amino acyl-tRNA synthetase) (b) Peptide polymerase system 6 Adenosine triphosphate (ATP) as an energy source for activation of amino acids 7. Guanosine triphosphate (GTP) for synthesis of peptide bond 8, Soluble protein initiation and transfer factors 9-Various inorganic cations such as Mg", K* and NH Mechanism of Translation he process of translation or assembly of. amino aci 's is completed in the following steps 1, Activation of Amino Acids adenylate (AMP ~ AA) enzyme combigg adenosine monophosphate or aminox) 1 AA + ATP Bye thmino atid) “Nee? AA ~ AMP Enzyme + p~ Pp (Aninoae!adenyive ey non any rophomint 2 P= P+ 10 —2eemnpiane ope 2, Attachment of ActivBted Amino acig The enzyme-bound activated amino gig specific IRNA molecules and form ani + Energy With RNA oF Charging of taNA | ney Tey Adenylates) attach to the 3 end of het | MeVIMRNA. The reaction is catalysed by the sam Fig. | AA- tRNA informal acid is s {RNA y termina isno tk A spe tRNA molec 3. For Initial Three and | Hibos« In mRN In E, ARN: resp Nato each Nvfofor its yecessary 0 aa a 2 sequences necesstF, nit is @ stretch of DNA that(encodef{an RNA molecule bnalfthe se: snes cineca A transcription unlt cones of ee aE a promoter, an RNA-coding seque” |_| tetminator:) erase 2. jymerase the RNA polymer (Promoter is a small DNA sequence whici Is present upstrean} fee tne rection of Sieeweneaeen ich OF the two DNA strands isto be read as the template pnd sigt tranccrption) fhe promoter also determace te transcribed Ito RNA) at wil start site,] thé first nucleotide that 2 RNA oe to cleotide that Is copied into. an jal gene (RNA-coding region) Is a/sequence of DNA nucleotic (Terminator is afequence of nucebtdec Hons pre ent donneor goa saris hae rans istoenttFerminators aréusually part ofthe cod ion ops or ben copied into RNA. oS htust Remember | ‘The strand that has the polarity 3! to s' Strangely, itis called anti sense (-) strand ‘The other strand which has t it does not code for anything, Sequence is same as that of late strand. acts as a template, and is also referred to as template oF non-coding strand. however he polarity (5' to 3') is called non-template or sense or coding strand (| is that its /.e., {ts not transcribed. Logic for saying it as a sense or coding strand is t MRNA (except thymine at the pla ce of ured). hs JE must be noted that all the reference points while defining a transcription unt are made with coding st (ie, 5't0 3 strand). 3 sens o cong Upetream «+. ownstream H) | crnmocnas Ss pat fe — ; Eee an ep = Transcription Terminator Transcription fetes ro stat ste | ——- ie RNA transept = Upstream and downstream (Basic concepts) When DNA sequences are written out, often the sequence of onl » typically write the Sequence of the fon-template ii as the sequence of the RNA transcribed from the i So, by convention, the se 'y one of the two strands is listed. Scientists strand (sense strand, which 5' to 3°), because it will be the same template (with the exception that U in the 3’ RNAreplacesT in DNA), ‘quence on the non-template strand is written. with the 5’ end on the left and €nd on the right. The first nucleotide transcribed (the transcription start site) is numbered +1. The Ducleotides downstream ofthe start ste are assigned roitive numbers, whereas the nucleotides upstream of the Start site are assigned negative numbers, So, nurlectye =30 would be 30 nucleotides upstream of the start site, whereas nucleotide +30 would be 30 nucleotides Gomra Team of the start site, There is no nucleotide assigned 0, Mechanism of Transcription the help of helicase en; me, lising proteins (similar to theTypes of RNA polymerases —__— erase | RNA polymerase in.prokaryotes =n pee) ‘only_one type of RNA polym ae thesise al types of RNA molecties requlrea Aes eee De pecne insuneryoten Cert ots Many types of ANA polymers aitererc yes of RNA motets) he RNA polymerase I — synthesises rRNA eon muckoes : me. NA RNA polymerase II — synthesises mRNA and some Sx hee Ba phrase Il —aytesses UA and ste See «some miro RNA motel iA polymerase IV and V — in some plants only, izing Se ‘And Terminators (for competitions) only ona word (ise) (eaynames? wd snetars i prokarjoios ate [Geet lat st hia amar nts sos) oat gees owever fn prokaryote Coaster) twa important saquences (one-at “10 Bp upstrenn oo ee recognized ty be common ial Species, Tins thoy ere ce, led the -10 sequence and the -35 sequent respectively[Such promoters are called Conserved reaverca =a ‘se 1Z raat (I-10 consensis seaence)(Pribfswvboe) tik mea tnd non-tempete strandXS' 183’ (0X35 consensus sequence (it Is TIGACA jh tHe no template strand\5' t6 3"). a vn ee ‘conseneus Transcription eaand, a zee mane INA | |Pramoters in eukaryotes ( Promoters for(RNA polymerase y) in eukaryotes arity -yatied,)species to species and gene to gene, | However, two important conserved sequchec: have been tecognized in éukaryotes also, These ore TATA box and | CAAT bo» 1 ae » | as rt | (a TATA box also called Ho. gness Goldberg box) (his is 25 to 35 Go Jipstream(¢s: % 3! on | non-tempiate nd Bequence, which has éonse s(TATAA Prien cntty of these aces. It resembles the /-Pribnow box of the py paryetesyits function is also similar to Pribnow-box, fe. to rec [Besides this, te intiotion ore Fecognize RNA polyn Bolymerase, e scription at promoter also requires the Presence of Many genéral transect {Sctorifalso called TF 11, e., transcription factors ription IA polymerase 1) Jone very important of these factors ig | CAD hc IS compled to TATA box. (by “AAT box ally occu | sequence G6 2n Non-template stran (it usually occurs near position(s on 2208 a 4uuu vau u c voc! == | uce vac vec e A 6 uua | uca AA UGA Juve | uce |oxe Nec wet ie | 4 [sfeuv |ccu CAC] main [CSU v| | fe fev | imme | 2° | nan | enc coc |e} ¢| j | s| CUA CCA GAA | cutatioe | CGA Hse sig H | Ce | [cus | cce | cas |ccc sl 3 : nue oe" | ace Tere | AAC = ; Ih . | | Java aca aa ] (EWS wanierine | ace AAG | ecu cau - jalient (1. Genetic Codes are en, de ). In other words, a sequ 41500 muceties of OWA or RNAY.ca'code fora plypeptce chain with S00 anion org, Oroe ® SEQUENCE OF 2, Genetic Codes se Givers & Genetic codes are universal; i.e,, there is a single code system (Note : however the universality of genetic codes is not applicable for mitochondrial DNA, we iene tie which has its own code Genetic Codes ardLinearly Arranged and Non-overlappin a Codons are arranged i nearfastion ina gene (ONA) and non, a can code only for 3 amino acids, not more than this, PPING, L€., 2 Sequence Of 9 nucteotides4. Genetic Codes ard Unambiguous Genetic codes code for only one amino acid, never any other, = ee sca Smiony UCC aikays codes fr sern ‘acids are only 20, ‘more than one codon. a af endon. (Dont confuse unambiguity). For example, UCU, UCC and UCA all code for serine. Similarly, GUU, GUC, GUA and GUG all code for valine. ise cae ‘as wobble ee) In above example you will see that the first two nucleotides of some: depres: of wena US7 0a ‘codons (which code for same amino acid) are similar but the third ‘nucleotide is changed. Thus, the major cause of codon degeneracy {s the third nucieotide base af the codon. It Is called wobble base. f. Genetic Codes arf Comma-less. ‘There is no punctuation in the genetic cpes, /e,, there is no signal (-e., pause or comma or gap) between the f€s. Once the reading is commenced, the codes would be counted 3 after 3 nucleotides, until a termination n is reached. If one nucleotide is removed or added then the missing or adding signal would not be alarmed. is the basis of frameshift mutation), i : 38 codon, i.e, in all kinds of biological protein {rst and provides signal for_the initiation protein synthesis. But when AUG is present ally similar to other codon: ef Ft omit en) on re ton Genetic Codes and Exceptions ML ‘Genetic codes are universal and possess propestias, which have been discussed above. However there are gacfermination cadon. Instead they code fof glutamine, e Wvius, genetic codes do overlap. Its DI s, but it requires about 6000 nucleotides de for its proteins, - — : \drial DNR ae different from nuclear genetic codes, they actas terminating cedons. but for mitochondrial DNA For exampl Universality of Codes and Origin of Life f genetic codes provides a strong clue that life on this earth was ori ated onl ceive #m came into existence, these codes were established and Peele nee tan: 94 jutations and Genetic Codes hich afecto very specie portion ofthe DNA (gene) suchas a nucleotide bet rovegls the Invowement of pene Ware weet re out Inoirtion ha ene (GWA) 1 very sect and accurate, any change the pace Schnace Gnstaer) can aretha expresion of pane sdvereey ~ We know that gene mutations are of two types. fo “suvetitution mutations’, 9 particular nuceotide of DNA (gene) is substituted (replaced) by another nucbatide. Bo, these mutations are harmitt-Onée-cistcar example of such matatinec ore ‘ile-cell anaenm ' ene fi a glohin.chain becomes affected, Due to a single base pair change in this. gene, instead of corporation aration of «base pain a gene can be extremely dangerous asf changes the entire uch mutations aF@ Calied frameshift mutations’) Folio yples show the effect of such mutations “ Semen’ Which is made up of the folowing words. In this case, each word consists of thrée letters RAM HAS RED CAP Jeter B in betwoon HAS and RE: D and rearrange te statement, it would read as follows RAM HAS SRE DCA P we now insert two letters at the same place, say BI’. Now it would read, RAM HAS SIR EDC AP ther, say BIG, the statement would fad RAM HAS BIG RED CAP @ exercise can be repeated, by delet riplet word ert three letters t ing the letters R, E and D, one by one and rearranging the RAM HAS DCA Pp RAM HAS cap ear, that genetic codes are commaless. ically change the nature of the gene sed quostions in PMT: Hot to solve? ve exercises, It Is very A single base pair change tution | j Question: How many 6: Solution: In triplet (ii). Sense codons sfe 61 in number o, ttl base subatntion «6190566 (ii) Sense codons ? 9 bases and can form 9 new codons. ple — ests ronan $n