BIOLOGY CLASS: XII

MOLECULAR BASIS OF INHERITANCE

VERY SHORT ANSWER TYPE QUESTIONS (1 MARK)

1. Name the nucleic acid which is not only function as a genetic material but also
mostly functions as a messenger.
2. What are the estimated base pairs in the lambda Bacteriophage?
3. What are the estimated base pairs in the Escherichia coli?
4. How many base pairs are present in haploid human genome?
5. Name the nitrogenous base present in the RNA but absent in the DNA.
6. Name the nitrogenous base present in the DNA but absent in the RNA.
7. Name the bond by which a nitrogenous base is linked to the pentose sugar to
form a nucleoside.
8. Where does the phosphate group attached to the nucleoside to form a
nucleotide?
9. Name the bond that joins the two nucleotides to form a dinucleotide.
10. What forms the back bone of the polynucleotide chain?
11. Write the other chemical name of the thymine.
12. Who discovered the nucleic acid and named as nuclein?
13. Who proposed the Double helix structure of the DNA?
14. What was the observation of the Errwin Chargaff that for a double stranded
DNA?
15. What is the pitch of the DNA double helix?
16. What is the distance between two base pair in a DNA helix?
17. How many base pair present in a single turn of a DNA helix?
18. Why the distance between two polynucleotide chains in DNA remains almost
constant?
19. If the length of a DNA is 1.32 mm, calculate the number of base pairs in that
DNA.
20. Name the basic nucleoprotein remain associated with the nucleic acid.
21. What are the basic amino acids rich in histone?
22. How many base pair present in a nucleosome?
23. What you call to the repeating units of the chromatin?
24. What you call to the additional set of proteins that required for packaging of
chromatin at higher level?
25. What you call to the transcriptionaly active region of the chromatin?
26. What you call to the tightly packed transcriptionaly inactive region of the
chromatin?
27. What makes the S-Strain of Streptococcus bacteria virulent?
28. What you call to the virus that infects bacteria?
29. What was the first genetic material, RNA or DNA?
30. Name the nucleic acid which not only acts as genetic material but also acts as a
catalyst.

DEPARTMENT OF BIOLOGY, J.N.V., EASTGODAVARI-II, A.P. 1

BIOLOGY CLASS: XII

31. Name the scientist who proved that the replication in DNA is semiconservative
type.
32. What was the source of Heavy nitrogen for Meselson and Stahl experiment?
33. What type of centrifugation was used by Meselson and Stahl in their
experiment?
34. What is the time required by E.coli to replicate?
35. In relation to the Meselson and Stahl experiment, If E.coli was allowed to grow
for 80 minutes then what would be the proportions of light and hybrid densities
DNA molecule?
36. How Meselson and Stahl able to separate the DNA of different densities?
37. Name the plant in which Taylor experimented with radioactive thymine to prove
Semiconservative DNA replication.
38. Name the principal enzyme required for Replication of DNA.
39. Name the substrate required for DNA replication.
40. Replication the energetically expensive process. What is the source of energy
during DNA replication?
41. In which direction the DNA dependent DNA polymerase catalyses the
polymerization reaction?
42. Name the enzyme that required joining the discontinuously synthesized DNA
fragment during Replication.
43. Replication does not initiate randomly at any place in DNA. What you call to the
definite region of E.coli DNA where the replication starts?
44. When the replication of DNA did take place in Eukaryotic cell?
45. What you call to the process of copying genetic information form one strand of
the DNA into RNA?
46. Name the enzyme required for the process of transcription.
47. What you call to the single DNA strand from which the RNA is synthesized?
48. What you call to a segment of DNA coding for a polypeptide?
49. What you call to the coding sequence or expressed sequence of the split gene?
50. What you call to the non coding sequence or non expressed sequence of the
split gene?
51. What you call to the structural gene in the transcription unit in prokaryotes?
52. What you call to the structural gene in the transcription unit in eukaryotes?
53. What is the product of RNA polymerase III?
54. What is the product of the RNA polymerase II?
55. What is the product of the RNA polymerase I during the process of
transcription?
56. Name the precursor of mRNA produced in the nucleus of eukaryotic cell.
57. Name the unusual nucleotide adder to the 5- end of the hnRNA during the
process of capping.
58. Some amino acid coded by more than one codon. What you call to this
characteristic of the genetic code?
59. Which codon is called the initiation codon among the genetic code?
60. Name the amino acid coded by the initiation codon.
61. Which RNA is otherwise known as the sRNA?
62. What you call to the secondary structure of the tRNA?
63. Which cell organelle is known as the cellular factory responsible for synthesizing
protein in the cell?
DEPARTMENT OF BIOLOGY, J.N.V., EASTGODAVARI-II, A.P. 2
BIOLOGY CLASS: XII

64. Name the rRNA acts as the catalyst for formation of the peptide bond.
65. What is the role of the ribozyme in the process of translation in bacteria?
66. What is the chemical nature of the ribozyme?
67. Name the enzyme synthesized by the E.coli which catalyses the hydrolysis of
lactose into glucose and galactose.
68. What do you mean by a polycistronic structural gene?
69. In what condition point mutation takes place in a gene?
70. In what condition frame shift mutation takes place in a gene?
71. If the sequence of the one strand of DNA is written as follows:
5’- ATGCATGTCCGAATCGTCATC – 3’
Write down the sequence of complementary stand in 5’----- 3’ direction.
72. Expand the term HGP.
73. How many bas pair present in a human genome approximately?
74. How many bases present in the average gene of human?
75. How many genes are located in the chromosome I
76. Which chromosome contains least number of genes? What is that number?
77. Expand the term SNPs, in relation to the human genome.
78. Who developed the techniques of DNA finger printing?
79. Expand the term VNTR.

DEPARTMENT OF BIOLOGY, J.N.V., EASTGODAVARI-II, A.P. 3